“pata prieta” de la jamaica

7/24/2019 Pata Prieta de La Jamaica

1/22

173Volumen 33, Nmero 2, 2015

Ortega-Acosta SA, Hernndez-Morales J, Sandoval-

Islas JS, Ayala-Escobar V, Soto-Rojas L y Alejo-Jaimes

A. 2015. Distribucin y Frecuencia de Organismos

Asociados a la Enfermedad Pata Prieta de la Jamaica

(Hibiscus sabdariffaL.), en Guerrero, Mxico. Revista

Mexicana de Fitopatologa 33: 173-194.

Resumen.Se estudi la distribucin y frecuen-

cia de organismos asociados a la pata prieta dela jamaica en Guerrero durante el 2011, se evalua-ron 12 parcelas comerciales. La identicacin se

hizo con base en caractersticas culturales y clavestaxonmicas. La caracterizacin molecular se efec-tu amplicando la regin intergentica transcrip-cional (ITS) del rDNA. Los organismos aisladosfueron Phytophthora parasitica, Macrophominaphaseolina, Fusarium oxysporum, Fusarium in-carnatum, Fusarium solani,Phomopsis longicolla,

Glomerella cingulatay Colletotrichum truncatum.La mayor frecuencia (72.4 %) se obtuvo conP. pa-rasiticadistribuido en 10 de 12 sitios, seguido porF. oxysporumde amplia distribucin pero de bajafrecuencia (10.6%),M. phaseolina se aisl de cua-tro sitios con frecuencia de 10.9 %.F. incarnatum,

Distribucin y Frecuencia de Organismos Asociadosa la EnfermedadPata Prieta de la Jamaica(Hibiscus sabdariffa L.) en Guerrero, Mxico

Distribution and Frequency of Organisms Associated to Disease BlackLeg of Roselle (Hibiscus sabdariffa L.) in Guerrero, Mxico

Santo ngel Ortega-Acosta, Javier Hernndez-Morales*, Jos Sergio Sandoval-Islas, Victoria Ayala-Es-cobar, Lauro Soto-Rojas. Colegio de Postgraduados, Instituto de Fitosanidad, Programa de Fitopatologa, km36.5 Carretera Mxico- Texcoco, Montecillo, Estado de Mxico CP 59510. Antonino Alejo-Jaimes; CEIGUA/INIFAP. Iguala, Guerrero. Carretera Iguala-Tuxpan, km 2.5. CP 40000. *Correspondencia: [email protected].

Recibido: Junio 22, 2015. Aceptado: Junio 29, 2015

Abstract. The distribution and frequencyof organisms associated with the black legof roselle was studied in 2011 in Guerrero,where 12 commercial plots were evaluated. Theidentication was based on cultural characteristics

and taxonomic keys. Molecular characterizationwas performed by amplifying the internaltranscribed spacer region (ITS) of the rDNA. The

isolated organisms were Phytophthora parasitica,Macrophomina phaseolina, Fusarium oxysporum,Fusarium incarnatum, Fusarium solani,Phomopsis longicolla, Glomerella cingulata andColletotrichum truncatum. P. parasitica was themost frequent specie (72.4 %), distributed in 10of the 12 sites, followed by F. oxysporumwidelydistributed but with low frequency (10.6 %),M. phaseolina was isolated from four sites withfrequency 10.9 %. F. incarnatum, F. solani, P.longicolla, G. cingulataand C. truncatumshowed

low frequency (0.4 to 2.4 %) and distribution.Molecular analysis corroborated the identication

of organisms. In pathogenicity tests,P. parasitica,M. phaseolina and F. incarnatumwere pathogenic.This is the rst report in Mexico forM. phaseolinaandF. incarnatumas pathogen of roselle.


2/22

Revista Mexicana de FITOPATOLOGA

Volumen 33, Nmero 2, 2015 174

F. solani, P. longicolla, G. cingulatay C. trunca-tumpresentaron baja frecuencia y distribucin (0.4a 2.4 %). Los anlisis moleculares corroboraron laidenticacin de los organismos. En pruebas de

patogenicidad, P. parasitica, M. phaseolina y F.incarnatumfueron patognicos. Este es el primerreporte en Mxico para Macrophomina phaseoli-na y Fusarium incarnatum como patgenos delajamaica.

Palabras clave: pudricin de tallo y raz, oomi-ceto, complejo fungoso, Phytophthora parasitica,Macrophomina phaseolina.

En Mxico en 2010 se cultivaron alrededor de19, 000 ha de jamaica (Hibiscus sabdariffa L.),Guerrero fue el principal productor con ms del70 % (SIAP, 2010); la principal zona productorase ubica en los municipios de Ayutla y Tecoanapa.En esta regin, la enfermedad pata prieta que secaracteriza por presentar necrosis basal, marchitezgeneralizada, amarillamiento de hojas y muerte dela planta, constituye una de las principales limitan-tes tosanitarias para la produccin de esta especie.

En estudios realizados en esta zona se concluyque Phytophthora parasitica es el agente causalde esta enfermedad (Hernndez y Romero, 1990).Sin embargo, en otros pases se han reportado di-versos organismos como causantes de pudricin detallo y raz en el cultivo de jamaica, entre los quedestacan; Phytophthora parasitica, Rhizoctoniasolani,Macrophomina phaseolina, Sclerotium rol-fsii,Phymatotrichopsis omnivora,Fusarium oxys-porum, F. semitectum, F. solaniy F. equiseti (Ooi

y Salleh, 1999; Amusa et al.,2005; Ploetz et al.,2007; Horst, 2008; Hassan et al., 2014). En estosmunicipios el cultivo se distribuye en rangos de al-titudes que van desde los 100 msnm hasta alturassuperiores a los 700 msnm, por lo que se consi-der realizar el presente trabajo de investigacin,mediante un muestro estraticado (Ceja-Torres et

Key words:root and stem rot, oomycete, funguscomplex,Phytophthora parasitica,Macrophominaphaseolina.

Around 19,000 ha of roselle (Hibiscus sabdariffaL.)were planted in Mexico in the year 2010, and thestate of Guerrero was the main producer, with over70 % (SIAP, 2010); the main region of productionis located in the municipalities of Ayutla andTecoanapa. In this region, the disease known asblack leg, the main characteristics of which arebasal necrosis, general wilting, leaves acquiringa yellow color, and death of the plant, constitutesone of the main plant health limitations for the

production of this species. Studies carried out inthis region concluded thatPhytophthora parasiticais the agent that causes this disease (Hernndez andRomero, 1990). However, there have been reportsin other countries of diverse organisms as thecausing stem and root rot on roselle crops, the mostoutstanding ones being Phytophthoraparasitica,Rhizoctonia solani, Macrophomina phaseolina,Sclerotium rolfsii, Phymatotrichopsis omnivora,Fusarium oxysporum, F. semitectum, F. Solani,

andF. equiseti (Ooi y Salleh, 1999; Amusaet al.,2005; Ploetz et al., 2007; Horst, 2008; Hassan etal., 2014). In these municipal areas, the crop isdistributed in ranges of heights that go from 100masl to over 700 masl, therefore this research workwas considered to be carried out using stratied

sampling (Ceja-Torres et al., 2000). Based on theabove, the aim of this study was to determine thedistribution and frequency of the organisms relatedto the black leg disease on roselle in Ayutla and

Tecoanapa, Guerrero.

MATERIALS AND METHODS

Area of Study and Sampling. The area ofstudy was established in the municipalities of


3/22



al., 2000). Con base en lo anterior el objetivo delpresente estudio fue determinar la distribucin yfrecuencia de los organismos asociados a la enfer-medad pata prieta de la jamaica en Ayutla y Te-

coanapa, Guerrero.

MATERIALES Y MTODOS

Zona de estudio y muestreo. Se estableci el reade estudio en los municipios de Ayutla y Tecoana-pa (Figura 1), en el ciclo de produccin primavera-verano de 2011. En base a los registros de la esta-cin ms cercana (estacin: 12012), los municipios

registraron temperatura y precipitacin promedioanual de 27.7 C y 1,519.9 mm (SMN, 2012). Parala seleccin de sitios se utiliz un muestreo estra-ticado (Ceja-Torreset al.,2000), se consider lavariacin que presenta esta zona con respecto a laaltitud (msnm). Cuatro estratos quedaron denidos

de la siguiente manera: estrato I) 100 a 300, estratoII) 301 a 500, estrato III) 501 a 700 y estrato IV)

Ayutla and Tecoanapa (Figure 1), in the spring-summer production cycle of 2011. Based onrecords from the nearest station (station 12012),the municipalities recorded an average annual

temperature and rainfall of 27.7 C and 1,519.9mm (SMN, 2012). For the selection of sites,stratied sampling was used (Ceja-Torres et al.,2000), and the variation presented by the area withregard to altitude (masl) was considered. Fourstrata were dened as follows: stratum I) 100 to

300, stratum II) 301 to 500, stratum III) 501 to 700,and stratum IV) >701 (Table 1). Twelve producinglocations were selected and in each one a samplingsite was selected. The altitude and geographic

position (latitude and longitude) of each site wasdetermined using a GPS (Garmin Etrex) (Table1; Figure 1). In each site selected, four samplingswere carried out, directed at plants with black legsymptoms in the months of September, October,November, and December. Five plants were takenin each sampling, labeled for their identication,

and taken to the laboratory for processing. In each

Figura 1. Sitios de muestreo en los municipios de Ayutla y Tecoanapa, Gro. Mxico. Ciclo de produccin primavera-verano de2011.

Figure 1.Sampling sites in the municipal areas of Ayutla and Tecoanapa, Gro. Mexico. Spring-summer 2011 production cycle.


4/22



>701 (Cuadro 1). Se seleccionaron 12 localidadesproductoras y en cada una de ellas se seleccionun sitio de muestreo. La altitud y posicin geogr-ca (latitud y longitud) de cada sitio se determin

mediante un geoposicionador global (GPS, GarminEtrex) (Cuadro 1; Figura 1). En cada sitio selec-cionado, se realizaron cuatro muestreos dirigidos aplantas con sntomas de pata prieta en los mesesde septiembre, octubre, noviembre y diciembre.Se colectaron cinco plantas en cada muestreo, lasplantas fueron etiquetadas para su identicacin y

trasladadas a laboratorio para ser procesadas. Encada sitio se determinaron las caractersticas fsi-cas y qumicas de suelo en el laboratorio de Fsica

de Suelos del Colegio de Postgraduados. La textu-ra se determin por el mtodo del hidrmetro deBouyoucos, el pH (relacin 1:2 en H

2O) y la ma-

teria orgnica mediante el mtodo de Walkley yBlack (1934).

Distribucin y frecuencia de organismos.Frag-mentos de tejido de plantas enfermas de aproxima-damente 0.5 cm se desinfestaron y sumergieron enuna solucin de hipoclorito de sodio al 1.5 %

durante 2 min, posteriormente se enjuagaron tres

site, the physical and chemical characteristics weredetermined in the Soil Physics Lab of the Colegiode Postgraduados. Texture was determined usingthe Bouyoucos hydrometer method, and pH (ratio

1:2 in H2O) and organic matter, using Walkley andBlacks method (1934).

Distribution and Frequency of Organisms.Fragments of tissue from diseased plants ofapproximately 0.5 cm were desinfected in a sodiumhypochlorite solution at 1.5 % for 2 min. Later, theywere rinsed three times with sterile distilled water,dried with sterilized paper towels, transferred toPDA culture medium, and incubated at 242 C

under controlled conditions for a week; the growthof each organism was then quantied. From the

data obtained for each isolated organism for eachsampling site, a distribution map was created.A means difference test (Tukey, p=0.05) wasperformed of the frequencies obtained from eachspecies of microorganism (SAS Institute, 1988).

Cultural and Morphological Characterization.The mycelial growths were transferred and

puried using the monosporic culture and hyphal

Cuadro 1. Ubicacin geogrca de sitios de muestro en Ayutla y Tecoanapa, Guerrero, Mxico.Table 1.Geograc ubication of samples sites in Ayutla and Teconapa, Guerrero, Mexico.

Estrato No Comunidad Municipio Altitud (msnm) N O

I 1 Tlachimala Ayutla 103 16 48 42.6 99 06 15.6I 2 Tutepec Ayutla 261 16 55 64. 1 99 08 20.0I 3 Pozolapa Ayutla 279 16 53 56.7 99 05 96.3II 4 Tepango Ayutla 365 16 54 09.6 99 04 56.5

II 5 Pochotillo Tecoanapa 388 17 01 42.9 99 25 78.9II 6 Parota Seca Tecoanapa 425 16 56 19.2 99 14 98.5II 7 Tecoanapa Tecoanapa 427 16 59 56.4 99 15 17.4II 8 San Jos la Hacienda Ayutla 460 16 59 00.3 99 03 94.5III 9 Las Parotillas Tecoanapa 637 16 57 39.2 99 15 64.2III 10 Xalpatlhuac Tecoanapa 659 17 00 14.1 99 18 94.6III 11 Las Animas Tecoanapa 667 16 57 98.6 99 19 28.3IV 12 Los Tepetates Ayutla 722 17 03 32.8 99 14 69.1


5/22



veces con agua destilada estril, se secaron con pa-pel absorbente estril, se transrieron a medio de

cultivo PDA y se incubaron a 242 C en condicio-nes controladas durante una semana, se cuantic

el desarrollo de cada organismo. A partir de los da-tos obtenidos para cada organismo aislado por sitiode muestreo, se gener un mapa de distribucin.Se realiz una prueba de comparacin de medias(Tukey, p=0.05) de las frecuencias obtenidas decada especie de microorganismo (SAS Institute,1988).

Caracterizacin cultural y morfolgica. Loscrecimientos miceliales se transrieron y purica-

ron utilizando la tcnica de cultivos monospricosy punta de hifa en medio agua-agar al 2 %. En laidenticacin preliminar, las colonias con caracte-rsticas culturales a Phytophthora se transrieronen medio de cultivo V8-agar por catorce das, ypara inducir esporulacin se retransrieron discos

de un centmetro de dimetro en cajas Petri con25 mL de agua destilada estril. Los aislamientosrestantes se transrieron en medio de cultivo PDA.

En todos los casos, los organismos se incubaron

nuevamente a 242 C. La identicacin morfo-lgica se efectu con base en las claves taxon-micas de Holliday y Punithalingam (1970), Booth(1971), Mordue (1971), Sutton (1980), Hobbs et al.(1985), Hanlin (1990), Sutton (1992), Erwin y Ri-beiro (1996), Leslie y Summerell (2006), Barnett yHunter (2006), Galleglyy Hong (2008) y Damm etal. (2009).

Caracterizacin molecular. Del micelio de las

colonias de los diferentes aislados de una semanade edad en medio PDA, se realiz la extraccin deDNA con el mtodo de CTAB (Murray y Thomp-son, 1980) con algunas modicaciones (uso de

buffer STE1x y adicin de PVP40 al 4 % al bu-ffer de extraccin). El micelio de cada especie

tip techniques in a water-agar medium at 2 %. Inthe preliminary identication, the colonies with

cultural characteristics to Phytophthora weretransferred on V8-agar culture medium for fourteen

days, and in order to induce sporulation, disks, witha centimeter in diameter were retransferred in Petridishes containing 25 mL of sterile distilled water.The remaining isolations were transferred on PDAculture medium. In all cases, the organisms wereincubated once more at 24 2 C. The morphologicalisolation was carried out based on the taxonomicalkeys by Holliday and Punithalingam (1970), Booth(1971), Mordue (1971), Sutton (1980), Hobbs etal. (1985), Hanlin (1990), Sutton (1992), Erwin

and Ribeiro (1996), Leslie and Summerell (2006),Barnett and Hunter (2006), Gallegly and Hong(2008), and Damm et al. (2009).

Molecular Characterization. DNA was extractedfrom the mycelia of the colonies of the differentweek-old isolations on PDA medium using theCTAB method (Murray and Thompson, 1980)with some modications (use of STE1x buffer

and addition of PVP40 at 4 % to the extraction

buffer). The mycelium of each species wasmacerated with 1 mL de STE1x buffer (Tris-HCl100 mM pH8, EDTA 50 mM pH8, NaCl 100mM,-mercaptoethanol 0.3 %). The samples were

centrifuged at 14,000 rpm (revolutions per minute)for 8 min. The supernatant was decanted and 800 L

of extraction de buffer were added (Tris-HCl 100mM pH8, NaCl 1.5 M, EDTA 20 mM pH8, CTAB3 %, PVP40 4 %, -mercaptoethanol 0.3 %). It

was incubated for 40 min at 65 C, and later,

700 L of chloroform/isoamylalcohol were added(24:1); it was mixed and centrifuged for 8 min at14,000 rpm. The supernatant was transferred to anew tube containing 800 L of absolute ethanol.

The DNA was precipitated for an hour at -20 C,and then centrifuged for 8 min at 13,000 rpm.


6/22



se macer con 1 mL de buffer STE1x (Tris-HCl100 mM pH8, EDTA 50 mM pH8, NaCl 100mM,-mercaptoetanol 0.3 %). Las muestras se centri-fugaron a 14,000 rpm (revoluciones por minuto)

durante 8 min. El sobrenadante se decant y se adi-cionaron 800 L de buffer de extraccin (Tris-HCl

100 mM pH8, NaCl 1.5 M, EDTA 20 mM pH8,CTAB 3 %, PVP40 4 %, -mercaptoetanol 0.3 %).

Se incub durante 40 min a 65C, posteriormen-te, se adicionaron 700 L de cloroformo/alcohol

isoamlico (24:1), se mezcl y se centrifug por 8min a 14,000 rpm. El sobrenadante se transri a

un tubo nuevo que contena 800 L de etanol ab-soluto. El DNA se precipit por una hora a -20 C.

Posteriormente se centrifug por 8 min a 13,000rpm, el sobrenadante se decant y el precipitado sesec a 37 C por 20 min para resuspender el DNAobtenido en 100 L de agua ultrapura estril. Para

amplicar las regiones espaciadoras internas trans-critas (ITS1-ITS2) y la regin intermedia 5,8S delrDNA de todos los organismos aislados, con excep-cin deFusarium spp., se utilizaron los iniciadoresITS5 (5GGAAGTAAAAGTCGTAACAAGG) eITS4 (5-TCCTCCGCTTATTGATATGC) (White

et al., 1990). Mientras que para las especies deFu-sarium se emplearon los iniciadores ITS5 y NL4(5-GGTCCGTGTTTCAAGACGG-3), para am-plicar adems los dominios D1/D2 del gen 28S

(ODonnell, 1993). Las reacciones se realizaronen un volumen nal de 25L, que contenan 2.5 de

buffer 10X, 1 L de MgCl2 a 50mM, 0.5 L de la

mezcla de dNTPs 10 mM, 2 L de cada iniciador

10 pmol/L y 0.2 L de Taq-DNA polymerase 5U/

L (Invitrogen, USA). Las reacciones se realiza-

ron en un termociclador Biometra, con el siguienteprograma: desnaturalizacin inicial a 95 C por 3min, 35 ciclos de desnaturalizacin a 95 C por30 seg (segundos), alineamiento a 55 C por 45seg, y extensin a 72 C por 45 seg; una extensinnal de 72 C por 7 min. Los productos de PCR se

visualizaron por electroforesis en gel de agarosa al

The supernatant was decanted and the precipitatewas dried at 37 C for 20 min to resuspend theDNA obtained in 100 L of sterile ultrapure

water. To amplify the internal transcribed spacer

regions (ITS1-ITS2) and the intermediate region5,8S of the rDNA of all the isolated organisms,except for Fusarium spp., the initiators ITS5(5GGAAGTAAAAGTCGTAACAAGG) andITS4 (5-TCCTCCGCTTATTGATATGC) (Whiteet al., 1990) were used. Meanwhile, for thespecies of Fusarium, the initiators ITS5 and NL4(5-GGTCCGTGTTTCAAGACGG-3) were used,and to also amplify the dominions D1/D2 of thegene 28S (ODonnell, 1993). The reactions took

place in a nal volume of 25L that contained 2.5

of 10X buffer, 1 L of MgCl2 at 50mM, 0.5 L of

the mixture of dNTPs 10 mM, 2 L of each initiator

10 pmol/L and 0.2 L of Taq-DNA polymerase

5U/L (Invitrogen, USA). The reactions took

place in a Biometra thermocycler, with thefollowing program: initial denaturalization at 95 Cfor 3 min, 35 denaturalization cycles at 95 C for 30sec (seconds), alignment at 55 C for 45 sec andextension at 72 C for 45 sec; a nal extension of

72 C for 7 min. The products of PCR were viewedby electrophoresis in agarose gel at 2 %. Oncethe presence of only one stripe was observed, theamplied DNA was sent to the company Macrogen

(www.macrogen.com) to be sequenced.

A consensus sequences of each species wasobtained by alignment (forward and reverse) usingthe software DNA Baser ver. 4.16, and theywere compared and aligned with those available

in the database from the National Center forBiotechnology Information (NCBI) Gene Bank,U.S.A. using BLASTN 2.2.26 (Zhanget al.,2000)and they were deposited in the Gene Bank.

Pathogenicity Tests. In October of 2011, eachisolated pathogen was inoculated in three-month


7/22



2 %. Una vez constatada la presencia de una solabanda, el DNA amplicado se envi con la com-paa Macrogen (www.macrogen.com), para susecuenciacin.

Una secuencia consenso de cada especie fue ob-tenida por alineamiento (forward y reverse) con elsoftware DNA Baser ver. 4.16, se compararon yalinearon con las disponibles en la base de datosdel Banco de Genes del National Center for Biote-chnology Information (NCBI), EE.UU. utilizandoBLASTN 2.2.26 (Zhanget al.,2000) y se deposita-ron en el GenBank.

Pruebas de patogenicidad. En octubre de 2011,cada patgeno aislado se inocul en plantas de ja-maica de tres meses de edad, el material vegetal uti-lizado, se multiplic por semilla botnica criollade Guerrero, sembradas en macetas con suelo est-ril y cultivadas en cmara de ambiente controladocon temperatura de 28 C durante el da y 18 C enla noche, con periodos de luz/oscuridad de 12 h. Elinculo dePhytophthora parasitica se incrementen medio V8-agar durante 14 das, posteriormente,

para inducir la liberacin de zoosporas, discos de1cm de dimetro fueron transferidos a cajas Petricon 25 mL de agua destilada estril sometidos a 5 Cpor 5 min, y despus a temperatura ambiente (24-27 C) por 10-15 min; mientras que para el incre-mento de inculo de los otros organismos aislados,solo se utilizaron cajas Petri con PDA. As, paraFusarium oxyporum, Fusarium incarnatum, Fusa-

rium solani,Macrophomina phaseolinayColleto-trichum truncatumel desarrollo fue por 14 das, y

30 das para Phomopsis longicolla y Glomerellacingulata. La concentracin de inculo se estimcon una cmara de Neubauer. ParaP.parasitica fuede 2x103 zoosporas mL-1. Suspensiones conidialesdeF. oxyporum,F. solani, F. incarnatum,P. longico-lla, y C.truncatumse inocularon a concentracionesde 1x106conidios mL-1. La inoculacin deMacro-

roselle plants; the plant material used was multipliedby criolla Guerrero botanical seeds, planted inpots with sterile soil and cultivated in a controlledenvironment chamber with a temperature of 28 C

during the day and 18 C by night, with periodsof light/darkness of 12 h. The Phytophthoraparasitica inoculum increased on V8-agar mediumfor 14 days, and after this time, in order to inducethe release of zoospores, discs with a diameter of1cm were transferred into Petri dishes with 25 mLof sterile distilled water subjected to 5 C for 5min, and then to room temperature (24-27 C) for10-15 min; whereas for the increase in inoculumof the other isolated organisms, only Petri dishes

with PDA were used. In this way, for Fusariumoxyporum, Fusarium incarnatum, Fusarium solani,Macrophomina phaseolina, and Colletotrichumtruncatumgrowth was for 14 days, and 30 days forPhomopsis longicolla and Glomerella cingulata.The concentration of inoculum was estimatedusing a Neubauer chamber. ForP.parasitica it was2x103zoospores mL-1. Conidial suspensions of F.oxyporum,F. solani, F. incarnatum, P. longicolla,and C.truncatumwere inoculated at concentrations

of 1x106 conidia mL-1. The inoculation ofMacrophomina phaseolina was carried out withmicrosclerotia suspensions. In all cases, 10 mL ofthe suspension were inoculated per plant. For G.cingulata, ten PDA discs (1 cm diameter) wereused, placed at the base of the stem of each plant.Five plants for each organism species (treatment)were inoculated and a control treatment with noinoculation was added.

A second test was carried out in the opencast,in the INIFAP- Campo Experimental Iguala,Guerrero in February of 2012, with average annualtemperatures and rainfalls of 26.7 C and 965.4mm respectively (SMN, 2012). For the increase ofthe inoculum, we once again used PDA and V8-agar medium. Five three-month old plants were


8/22



phomina phaseolinase realiz con suspensiones demicroesclerocios. En todos los casos se inocula-ron 10 mL de la suspensin por planta. Para G.cingulatase utilizaron diez discos de PDA (1 cm

dimetro), colocados en la base del tallo de cadaplanta. Cinco plantas por cada especie de organis-mo (tratamiento) fueron inoculadas y se adicionun tratamiento testigo sin inocular.

Una segunda prueba se realiz en condicionesa cielo abierto, en el INIFAP-Campo ExperimentalIguala, Guerrero en febrero de 2012, con tempera-turas y precipitacin promedio anual de 26.7 C y965.4 mm respectivamente (SMN, 2012). Para el

incremento de inculo nuevamente se utiliz me-dio PDA y V8-agar. Se inocularon cinco plantasde tres meses de edad por cada especie de hongou oomiceto (tratamiento) mediante la insercin enel tallo de un palillo esterilizado impregnado conmicelio del microorganismo, ms un testigo sin laaplicacin de inculo. Las plantas en estudio que-daron a cielo abierto despus de ser inoculadas.Cuando se manifestaron sntomas inducidos por lospatgenos inoculados, stos fueron reaislados con

la tcnica descrita.

RESULTADOS Y DISCUSIN

Distribucin y frecuencia de organismos. De lasplantas colectadas y procesadas, se identicaron

cinco gneros de hongos y un oomiceto. Phyto-phthora parasitica(oomiceto) se detect en 10 si-tios con frecuencias que variaron de 85 a 92.2 %

(promedio de 72.4 %); Macrophomina phaseolinafue aislado en cuatro sitios y en dos de ellos, quefueron Tlachimala y Pozolapa, con altas frecuenciasde 66.7 y 56.3 % respectivamente y con promediode 10.6 %; Fusarium oxysporumse distribuy en11 sitios con frecuencias de aislamientos bajas (3.6a 18.8 %) y el promedio fue de 10.6 %. Los hongos

inoculated for each species of fungi or oomycete(treatment) by inserting a sterilized toothpickimpregnated with mycelium of the microorganisminto the stem, plus a control without the inoculum.

The plants under study remained opencast afterbeing inoculated. When the symptoms induced bythe inoculated pathogens presented themselves,these pathogens were reisolated using the techniquedescribed.

RESULTS AND DISCUSSION

Distribution and Frequency of Organisms.

From the plants collected and processed, ve

genuses of fungi and one oomycete wereidentied. Phytophthora parasitica (oomycete)was found in 10 sites, with frequencies that variedbetween 85 and 92.2 % (average of 72.4 %);Macrophomina phaseolina was isolated in foursites and in two of them, which were Tlachimalaand Pozolapa, had high frequencies of 66.7 and56.3 % respectively, and with an average of 10.6 %;Fusarium oxysporum was distributed in 11 sites

with low isolation frequencies (3.6 to 18.8 %),and the average was 10.6%. The fungi Fusariumincarnatum, Phomopsis longicolla, Fusarium

solani, Colletotricum truncatum, and Glomerellacingulata,with low frequencies (average of 0.4 to2.4 %) and distribution (Figure 2, Table 2).

Table 2 shows that the frequency ofPhytophthoraparasitica was signicantly higher (p=0.05); the

other organisms showed no signicant differences

between groups, yet in terms of numbers, the abovewas followed by Macrophomina phaseolina andFusariumoxysporum.

The diseased plants in which Phytophthoraparasiticawas most frequently isolated displayedgeneralized wilting, a yellow color, abby leaves,

necrosis in the base of the stem, which often


9/22



Fusarium incarnatum, Phomopsis longicolla, Fu-

sarium solani, Colletotricum truncatum yGlome-rella cingulatade baja frecuencia (promedio de 0.4a 2.4 %) y distribucin (Figura 2, Cuadro 2).

En el Cuadro 2 se observa que la frecuencia dePhytophthora parasitica fue signicativamente

mayor (p=0.05), los otros organismos no mostrarondiferencias signicativas entre grupos, sin embargo

numricamente le siguenMacrophomina phaseoli-na yFusariumoxysporum.

Las plantas enfermas en donde se aisl con ma-yor frecuencia aPhytophthora parasiticaexhibie-ron marchitez generalizada, amarillamiento, aci-

dez de hojas, necrosis en la parte basal del tallo, lacual en ocasiones se extendi hacia la parte area,abarcando parte de las ramas (Figura 3a y b). Tam-bin en menor grado fueron observados sntomasde necrosis ms agrietamiento en la base del tallocon produccin de exudados, lo cual en ocasiones

extended up to the aerial section, reaching partsof the branches (Figure 3a and b). Also, yet in alesser degree, there were symptoms of necrosisobserved along with cracking at the base of the

stem with the production of exudates, whichoccasionally caused the attening and death of the

plant; these symptoms correspond to those reportedby Hernndez and Romero (1990), and Erwin andRibeiro (1996). However, in diseased plants fromTlachimala and Pozolapa, where P. parasiticawas not isolated, similar symptoms were found;in these places, necrosis was limited to the base ofthe plants stem; plants were frequently found withdetached epidermis and constriction in the area of

progress of the disease (Figure 3d). Plants displayedgeneralized wilting, a yellow color, abby leaves

(Figure 3c), and death of the plant. In these sitesMacrophomina phaseolina was frequently isolated(Table 2). Locally, both symptomatologies areknown as roselle black leg.

Figura 2. Distribucin de organismos asociados a la pata prieta de la jamaica durante el ciclo primavera-verano 2011, en Ayutlay Tecoanapa, Guerrero.

Figure 2. Distribution of organisms related to black leg of roselle during the spring-summer 2011 cycle in Ayutla and Tecoanapa,Guerrero.


10/22



provoc el acame y muerte de la planta, stos sn-tomas corresponden a los ya reportados por Her-nndez y Romero (1990) y Erwin y Ribeiro (1996).

Sin embargo, en plantas enfermas provenientes deTlachimala y Pozolapa en donde P. parasitica nofue aislado, se detectaron sntomas similares, enestos lugares la necrosis se limit a la base del tallode la planta, frecuentemente se encontraron plantascon desprendimiento de epidermis y constriccinen la zona de avance de la enfermedad (Figura 3d),las plantas presentaron marchitez generalizada,amarillamiento y acidez de hojas (Figura 3c) y

muerte de la planta, en estos sitiosMacrophomina

phaseolina fue aislado con alta frecuencia (Cuadro2). Localmente ambas sintomatologas son conoci-das como pata prieta de la jamaica.

Este es el primer reporte de M. phaseolina, F.incarnatum, F. solani, P. longicolla, C. truncatumy G. cingulata, como organismos asociados a laenfermedad pata prieta en esta zona del estado

This is the rst report on M. phaseolina, F.incarnatum,F. solani,P. longicolla, C. truncatum,and G. cingulata, as organisms related to the black

leg disease in this area of the state of Guerrero, inwhich we proved, based on pathogenicity tests, thatnot all were pathogenic.

On the other hand, the pH ranges varied from 4.7to 6.9, organic matter content varied between 1.2and 2.9 % and soil types were loam, sandy loam,and sandy clay loam. The organism Phytophthoraparasitica was isolated from diseased plants in 10sites which characteristically present soils withpH ranging from 4.7 to 5.5, whereas in two sites it

was not isolated: Pozolapa and Tlachimala (Table2) and presented a pH of 6.6 and 6.8, respectively(Table 3), sites located in stratum I. This indicatesthat the conditions of soils with pH close to neutraldid not favor the presence ofP. parasitica.

There is evidence of soil pH being a criticalfactor for the formation of sporangia in some

Cuadro 2. Frecuencia de organismos aislados de plantas de jamaica con sntomas de pata prieta en 12 localidades de los muni-cipios de Ayutla y Tecoanapa, Guerrero, Mxico. En el ciclo de cultivo primavera-verano de 2011.

Table 2.Frecuency of aisolated organisms in roselle plants with black leg symptoms in 12 localities of Ayutla and Teconapa,Guerrero, Mxico. Crop cicle Spring-Summer 2011.

Estrato No Localidad Frecuencia de aislamiento (%)

Pp Fox Fso Fin Map Pho Col Glo

I 1 Tlachimala 0 10 0 11.7 66.7 3.3 3.3 5I 2 Tutepec 89.3 3.6 1.8 1.8 0 3.6 0 0I 3 Pozolapa 0 18.8 3.8 15 56.3 3.8 2.5 0II 4 Tepango 87.5 6.3 0 0 4.2 2.1 0 0II 5 Pochotillo 87.5 12.5 0 0 0 0 0 0II 6 Parota seca 85 15 0 0 0 0 0 0II 7 Tecoanapa 90 5 1.3 0 3.8 0 0 0II 8 San Jos la Hacienda 90.6 9.4 0 0 0 0 0 0III 9 Las Parotillas 92.2 0 5.9 0 0 2 0 0III 10 Xalpatlhuac 85 15 0 0 0 0 0 0

III 11 Las Animas 76.8 19.6 0 0 0 3.6 0 0IV 12 Los Tepetates 85 12.5 0 0 0 2.5 0 0

Medias(%) 72.4* 10.6 1.1 2.4 10.9 1.7 0.5 0.4

Pp=Phytophthora parasitica, Fox=Fusarium oxysporum, Fso=Fusarium solani, Fin=Fusarium incarnatum, Map=Macrophominaphaseolina,Pho=Phomopsis longicolla, Col=Colletotrichum truncatum,Glo=Glomerellacingulata. Pp, Fin, Map = Patognicos.Medias con asterisco (*), son estadsticamente diferentes (p=0.05).


11/22



de Guerrero, en donde se comprob con base enpruebas de patogenicidad, que no todos fueron pa-tognicos.

Por otra parte, los rangos de pH variaron de 4.7 a6.9, el contenido de materia orgnica de 1.2 a 2.9 %y los tipos de suelo fueron franco, franco arenoso y

species of Phytophthora.In general, a high pH istoxic for the sporangia; in this sense, Dasguptaetal.(2012), evaluated the behavior ofP. parasitica insoils with a pH of 5.4, 7.0, and 8.5, and establishedthat the athogen presented a better growth in a pHof 5.4. Likewise, Besoain (2013), reported that

Figura 3. Sntomas de pata prieta causada por diferentes organismos. a) marchitez generalizada, amarillamiento y acidez dehojas. b) necrosis de tallo, extendindose hacia las ramas. c) marchitez generalizada, amarillamiento y acidez de hojas.d) pudricin en races y base del tallo con desprendimiento de epidermis y constriccin en la zona de avance.

Figure 3. Symptoms of black leg caused by different organisms. a) generalized wilting, yellowing, and leaf abbiness; b) stemnecrosis, extending to the branches, c) generalized wilting, yellowing, and leaf abbiness. d) root and stem base rot with

peeling of epidermis and constriction in the area of progress.

d)c)

a) b)


12/22



franco arcillo arenoso. El organismoPhytophthoraparasitica fue aislado de plantas enfermas en 10sitios caracterizadas por presentar suelos con pH de4.7 a 5.5, mientras que en dos sitios no fue aisla-

do, estos fueron Pozolapa y Tlachimala (Cuadro 2)y presentaron un pH de 6.6 y 6.8 respectivamente(Cuadro 3), sitios ubicados en el estrato I. Lo an-terior indica que las condiciones del suelo con pHcercanos a la neutralidad no favoreci la presenciadeP. parasitica.

Existen evidencias de que el pH del suelo es unfactor crtico para la formacin de esporangios enalgunas especies de Phytophthora.En general unpH alto resulta txico para los esporangios; en este

sentido, Dasguptaet al.(2012), evaluaron el com-portamiento de P. parasitica en suelos con pH de5.4, 7.0 y 8.5, determinaron que el patgeno pre-sent el mejor crecimiento en pH de 5.4. De igualforma Besoain (2013), report que las colonias dePhytophthora parasitica se desarrollan a pH entre5.5 y 6, y su crecimiento fue afectado cuando ste erasuperior a 6.5. En el presente estudioP. parasitica fue

the colonies of Phytophthora parasitica grow ina pH of between 5.5 and 6, and their growth wasaffected when it was higher than 6.5. In this studyP.parasiticawas isolated in soils with a pH of between

4.7 and 5.5, whereas in soils with a pH between 6.6and 6.8 this organism was not isolated; these resultsare similar to those reported by Dasgupta et al.(2012) and Besoan (2013). On the other hand, inother crops, Jha and Dubey (2000); Surinder et al.(2013), determined thatMacrophomina phaseolinaprefers pH ranges between 6 and 7, similar to thosefound in Tlachimala and Pozolapa, where thispathogen was frequently isolated. No relation wasfound between the content of organic matter and

texture (Table 3).

Cultural and Morphological Characterization. Inthe plants processed, eight species of microorganismswere identied: 1) Phytophthora pasitica Dasturdeveloped dense colonies of a cotton-like growthin the shape of rosette, coenocytic mycelia, mostlypresenting spider-like growth, predominantly oval-

Cuadro 3. Caractersticas edcas en parcelas de jamaica (Hibiscus sabdariffaL.) de Ayutla y Tecoanapa, Guerrero, Mxico.Table 3.Soil characteristics in plots of roselle (Hibiscus sabdariffaL.) in Ayutla and Tecoanapa, Guerrero, Mexico.

Proporcin (%)

Estrato Localidad pH MO Arena Limo Arcilla Textura

I Tlachimala 6.8 1.8 67 18 15 Franco arenosoI Tutepec 5 1.9 59 14 27 Franco arcillo arenosoI Pozolapa 6.6 2.9 69 16 15 Franco arenosoII Tepango 5.5 2.9 63 16 21 Franco arcillo arenosoII Pochotillo 5.2 1.3 51 32 17 FrancoII Parota Seca 5 2.5 67 14 19 Franco arenosoII Tecoanapa 4.8 2.6 51 24 25 Franco arcillo arenoso

II San Jos la Hacienda 5 1.6 65 20 15 Franco arenosoIII Las Parotillas 4.9 2.2 59 18 23 Franco arcillo arenosoIII Xalpatlhuac 4.7 1.8 71 4 25 Franco arcillo arenosoIII Las Animas 5.1 1.2 45 32 23 FrancoIV Los Tepetates 4.9 1.2 39 42 19 Franco

pH= Potencial de Hidrgeno.MO=Materia orgnica (%).


13/22



aislado en suelos con pH de 4.7 a 5.5, mientras queen suelos con pH entre 6.6 y 6.8 no se aisl este or-ganismo, resultados similares a los reportados porDasgupta et al. (2012) y Besoan (2013). Por otra

parte en otros cultivos Jha y Dubey (2000); Surin-der et al.(2013), determinaron queMacrophominaphaseolinapreere rangos de pH entre 6 y 7, simi-lares a los presentes en las localidades de Tlachi-mala y Pozolapa donde este patgeno fue aisladoen alta frecuencia. No se detect relacin con elcontenido de materia orgnica y textura (Cuadro 3).

Caracterizacin cultural y morfolgica. De lasplantas procesadas se identicaron ocho especies

de microorganismos. 1) Phytophthora pasiticaDastur, desarroll colonias densas, de crecimientoalgodonoso, en forma de roseta, micelio cenoctico,en su mayora de crecimiento aracnoide, esporan-gios predominantemente de forma oval y con unapapila prominente, en promedio midieron de 44.4x 35.3 m (largo por ancho), clamidosporas inter-calares y terminales (28 m en promedio), carac-tersticas que coinciden con lo descrito para estaespecie por Erwin y Ribeiro (1996) y Gallegly y

Hong (2008). 2) Macrophomina phaseolina (Tas-si.) Goid., las colonias presentaron coloracin grisen su fase de crecimiento y desarrollo, oscurecin-dose con la edad, desarrollaron microesclerociosmuy variables en tamao (33-54 m), de redondos

a irregular con coloracin negra, articulados y du-ros, micelio septado, caractersticas que coincidenpara esta especie con base en lo descrito por Ho-lliday y Punithalingam (1970), Abawi y Pastor-Corrales (1990), Kaur et al. (2012). 3) Fusarium

incarnatum (Robergge) Sacc. (=F. semitectum),colonias inicialmente blancas, con pigmento ana-ranjado en el centro, posteriormente se volvieroncolor marrn. En medio de cultivo CLA (CarnationLeaf Agar) produjo macroconidios con septos quevariaron en nmero de 3 a 5 (28.3-35.4 m) y con

shaped sporangia, and with a prominent papilla;average measurements were 44.4 x 35.3 m (length

x width), intercalary and terminal chlamydospores(28 m on average). These characteristics coincide

with descriptions for this species by Erwin andRibeiro (1996), and Gallegly and Hong (2008). 2)Macrophomina phaseolina (Tassi.) Goid. coloniesdisplayed a gray color in their phase of growthand development, and became darker with age;they developed microsclerotia that varied in size(33-54 m), round to irregular in shape with a

black color, articulate and hard, septate mycelia;these characteristics for the species coincidewith descriptions by Holliday and Punithalingam

(1970), Abawi and Pastor-Corrales (1990), Kauret al.(2012). 3)Fusarium incarnatum (Robergge)Sacc. (=F. semitectum), initially white colonieswith an orange pigment in the center, later becamebrown. In CLA (Carnation Leaf Agar) medium, itproduced macroconidias with septa that varied innumbers from 3 to 5 (28.3-35.4 m) and with a foot-

shaped base cell, microconidias from 0 to 3 septa,these characteristics coincide with descriptions byNelson et al.(1983) y Leslie y Summerell (2006)

for this species. 4) Fusarium oxysporum Snyderand Hansen, pinkish-white colonies that turnedviolet with time, presented fusiformed conidias,generally with 3 septa measuring 23.3-49.9 x 3.1-5.2 m, an abundance of microconidias, without

septa and cylindrical, intercalary and terminalchlamydospores; these characteristics coincidewith those reported by Nelson et al. (1983),Leslie and Summerell (2006). 5) Fusarium solaniSnyder and Hansen displayed cream-colored

colonies, scarce mycelia, abundant sporodochiapresent, frequently with a greenish pigmentationin the center, macroconidias between 5 and 7 septameasuring 28.3-41.5 x 4.3-6.4 m, microconidiasfrom 0 to 2 septa, conidiogenous cells in longmonophialides; these characteristics coincide with


14/22



clula basal en forma de pie, microconidios de 0 a3 septos, estas caractersticas coinciden a lo descri-to por Nelson et al.(1983) y Leslie y Summerell(2006) para esta especie. 4) Fusarium oxysporum

Snyder y Hansen, colonias de color blanco-rosada,con el tiempo se tornaron violeta, presentaron ma-croconidios fusiformes, generalmente con 3 septos,de 23.3-49.9 x 3.1-5.2 m, microconidios abundan-tes, sin septos y cilndricos, clamidosporas interca-lares y terminales, caractersticas que coincidencon las reportadas por Nelson et al.(1983), Lesliey Summerell (2006). 5)Fusarium solaniSnyder yHansen, present colonias de color crema, micelioescaso, esporodoquios presentes en abundancia,

frecuentemente con pigmentacin verdosa en elcentro, macroconidios de 5 a 7 septos de 28.3-41.5x 4.3-6.4 m, microconidios de 0 a 2 septos, clulasconidiognicas en monoalides largas, caracters-ticas que coinciden para esta especie de acuerdo aNelson et al. (1983), Leslie y Summerell (2006).6) Glomerella cingulata (Stoneman) Spauld. y H.Schrenk, colonias de color blanco grisceo a oscu-ras, las ascas se formaron despus de 3 a 4 semanas,de forma clavada a cilndrica (45.8-62.6 x 9.2-11.6

m) ligeramente curvadas, con ocho ascosporaspor asca de forma cilndricas (11.7-18.5 x 3.8-5.3m), unicelulares y hialinas, esto concuerda con

las caractersticas culturales y morfolgicas sea-ladas para esta especiepor Mordue (1971).(7) Co-lletotrichumtruncatum (Schwein.) Andrus y W.D.Moore, colonias planas, blanco grisceas, desarro-llaron acrvulos. Las setas midieron en promedio80-150 m, conidiforos ms de 90 m y conidios

ligeramente curvados, con promedio de 17.5-21.5

x 2.55-3.32 m, estas caractersticas fueron consis-tentes para la descripcin de Colletotrichum trun-catum (Damm et al., 2009). 8)Phomopsis longico-lla Hobbs (=Diaporthe longicolla) (Santos et al.,2011), las colonias presentaron crecimiento algo-donoso de color blanco, se observaron picnidios

the description by Nelson et al.(1983), and Leslieand Summerell (2006). 6) Glomerella cingulata(Stoneman) Spauld. and H. Schrenk, grayish-whiteto dark colonies, with asci that formed after 3 to

4 weeks, with nailed to cylindrical shapes (45.8-62.6 x 9.2-11.6 m) slightly curved, with eightascospores for every cylinder-shaped ascus (11.7-18.5 x 3.8-5.3 m), unicellular and hyaline; thiscoincides with the cultural and morphologicdescription for this species by Mordue (1971).(7) Colletotrichum truncatum (Schwein.) Andrusand W.D. Moore, at colonies, grayish-white,

they develop acervuli. Setae measured on average80-150 m, conidiophores were over 90 m and

conidia, slightly curved, measuring an average of17.5-21.5 x 2.55-3.32 m; these characteristics wereconsistent with the description of Colletotrichumtruncatum (Damm et al., 2009). 8) Phomopsislongicolla Hobbs (=Diaporthe longicolla) (Santoset al., 2011), the colonies presented white,cottonlike growth, long pycnidia were observedwhich produced alpha-conidia and beta-conidia.The alpha-conidia were hyaline, ellipsoidal, tofusiform, measuring 4.05-7.57 x 1.48-3.25 m.

Beta-conidia, scarce, hyaline, threadlike, and witha hook-shaped tip, measured 18.2-34.5 x 1.3-2.9m. Cultural and morphological characteristics

adjust to the description of Phomopsis longicollareported by Hobbs et al. (1985).

Molecular Characterization. The amplicationsperformed with the ITS5/ITS4 initiators amplied a

fragment of approximately 900 pb forPhytophthoraparasitica, and of approximately 600 pb for

Macrophomina phaseolina, Glomerella cingulata,Colletotrichum truncatum, and Phomopsislongicolla. With the ITS5/NL4 initiators, a fragmentof approximately 1100 pb was amplied in the

Fusarium spp isolations. The consensus sequencesof nucleotides obtained when compared to those


15/22



alargados y produjeron alfa-conidios y beta-coni-dios. Los alfa-conidios fueron hialinos, elipsoidesa fusiformes de 4.05-7.57 x 1.48-3.25 m. Beta-co-nidios, escasos, hialinos, liformes y con punta en

forma de gancho, con dimensiones de 18.2-34.5 x1.3-2.9 m. Las caractersticas de cultivo y morfo-lgicas se ajustan a la descripcin de Phomopsislongicolla reportadas por Hobbs et al. (1985).

Caracterizacin molecular. Las amplicacionesrealizadas con los iniciadores ITS5/ITS4 ampli-caron un fragmento aproximado de 900 pb para

Phytophthora parasitica, y de aproximadamente600 pb para Macrophomina phaseolina, Glomere-

lla cingulata, Colletotricum truncatumyPhomop-sis longicolla. Con los iniciadores ITS5/NL4 seamplic un fragmento aproximado de 1100 pb en

los aislamientos de Fusarium spp. Las secuenciasconsenso de nucletidos obtenidas al ser compara-das con las disponibles en el GenBank del NationalCenter for Biotechnology Information (NCBI), in-dicaron un 99% de porcentaje de similitud (Cuadro4). Lo que conrm la identidad de los organismos

aislados a nivel de especie. La secuencia consenso

de cada microorganismo fue depositada en el Gen-Bank (Cuadro 4).

Pruebas de patogenicidad. En los ensayos reali-zados en cmara de ambiente controlado y a cieloabiertoPhytophthora parasiticaresult ser el orga-nismo de mayor patogenicidad, al causar la muertedel 100 % de las plantas inoculadas. Plantas inocu-ladas con este organismo en cmara de ambientecontrolado, mostraron sntomas de la enfermedad

10 das despus de inocularse (ddi) (Cuadro 5). Acielo abierto los sntomas de la enfermedad fueronobservados a los 7 ddi. Resultados similares a losobtenidos por Hernndez y Romero (1990) para P.parasitica. El hongo Macrophomina phaseolina,en cmara de ambiente controlado indujo sntomas

available in the GenBank of the National Center forBiotechnology Information (NCBI), indicated a 99 %similarity (Table 4), which conrmed the identity

of the isolated organisms at the species level. The

consensus sequence of each microorganism wasdeposited in the GenBank (Table 4).

Pathogenicity Tests. In the tests performed ina controlled environment chamber and in theopencast, Phytophthora parasitica turned out tobe the organism with the highest pathogenicity,causing the deaths of 100 % of the inoculated plants.The plants that were inoculated with this organism

in a controlled environment chamber showedsymptoms of the disease 10 days after inoculation(dai) (Table 5). Opencast, the symptoms of thedisease were observed 7 dai. Similar results wereobtained by Hernndez and Romero (1990) for P.parasitica. The fungusMacrophomina phaseolina,in a controlled environment chamber, producedsymptoms in a plant at 28 dai (Table 5), and later,at an advanced stage of the disease (34 dai) formedmicrosclerotia in the base of the stem; whereas

opencast, it produced symptoms in two plants at 13dai (Table 5). In the sites whereM. phaseolina wasisolated in high frequently, with 66.7 % and 56.3 %(Tlachimala and Pozolapa, respectively), were theonly ones in which the presence of Phytophthoraparasitica was not detected, therefore weconsidered thatM. phaseolinacaused the symptomsobserved. However, in Tepango and Tecoanapa,where M. phaseolina was also detected, thoughless frequently (4.2 % and 3.8 %) respectively,

P. parasitica was isolated more frequently (Table2), which is why the latter was considered to bethe cause of the disease. In Mexico, up until themoment in which this investigation was carriedout, there were no reports on the pathogenicity ofM. phaseolinaon roselle.


16/22



en una planta a los 28 ddi (Cuadro 5), posterior-mente en la etapa avanzada de la enfermedad (34ddi) form microesclerocios en la base del tallo;mientras que a cielo abierto, indujo sntomas en

Fusarium incarnatumcaused symptoms of thedisease only in opencast tests, in two of the ve

inoculated plants. The symptoms were observed15 dai (Table 5), and characteristically included

Cuadro 5. Pruebas de patogenicidad con organismos asociados a la pata prieta de la jamaica (Hibiscus sabdariffaL.).Table 5.Pathogenicity tests with organisms associated to black leg of roselle (Hibiscus sabdariffaL.).

Organismoinoculado

Plantas consntomas

Das a inicio desntomas Incidencia (%)

Incidencia total(%)

1 2 1 2 1 2 ----

Phytophthora parasitica 5/5 5/5 10 7 100 100 100Fusarium oxysporum 0/5 0/5 - - - - -Fusarium solani 0/5 0/5 - - - - -Fusarium incarnatum 0/5 2/5 - 15 - 40 20Macrophomina phaseolina 1/5 2/5 28 13 20 40 30

Glomerellacingulata 0/5 0/5 - - - - -Phomopsis longicolla 0/5 0/5 - - - - -Colletotrichum truncarum 0/5 0/5 - - - - -Testigo 0/5 0/5 - - - - -

1=Ensayo 1, realizado en cmara de ambiente controlado. 2= Ensayo 2, realizado a cielo abierto / 1=Assay 1, testedin inviromental controled chamber. 2=Assay 2, tested on opencast. Proporcin de plantas que mostraron sntomas en cada ensayo / Proportion of plants that showed symptoms onevery assay.

Cuadro 4. Caracterizacin molecular por alineamiento de las secuencias reportadas en el banco de genes con las secuencias inter-gnicas (ITS) de los genes rDNA de los organismos aislados de plantas de jamaica con sntomas de pata prieta.

Table 4.Molecular characterization by alignment of sequences reported in the gene bank with the intergenic sequences (ITS ) of therDNA genes of organisms isolated roselle plants with symptoms of black leg.

Identicacin morfolgica No. de depsito enel NCBI Secuencia ms cercanaen el NCBI BLAST (%) desimilitud No. de accesoen el NCBI

Phytophthora parasitica KM519189 Phytophthora parasitica 99 GU111682Macrophomina phaseolina KM519193 Macrophomina phaseolina 99 HQ649832Fusarium incarnatum. KM519192 Fusarium incarnatum 99 AY633745Fusarium oxysporum KM519188 Fusarium oxysporum 99 AY188919Fusarium solani KM519190 Fusarium solani 99 KF938479

Glomerella cingulata KM519191Glomerella cingulata (Colletotrichum

gloeosporioides)z99 JN697580

Colletotrichum truncatum KM519187 Colletotrichum truncatum 99 KC460308

Phomopsis longicolla KM519194Diaporthe longicolla(Phomopsis

longicolla)z99 KF577911

NCBI (National Center of Biotechnology Information).ZAnamorfo.


17/22



dos plantas a los 13 ddi (Cuadro 5). En los sitiosdonde se aislM. phaseolina en alta frecuencia con66.7 % y 56.3 % (Tlachimala y Pozolapa respecti-vamente), fueron los nicos donde no se detect la

presencia de Phytophthora parasitica, por lo quese consider queM. phaseolina es el que caus lossntomas observados. Sin embargo, en los sitios deTepango y Tecoanapa en donde tambin se detect aM. phaseolina con baja frecuencia (4.2 % y 3.8 %)respectivamente,P. parasitica se aislcon mayorfrecuencia (Cuadro 2), por lo que se considera aeste ltimo como el causante de la enfermedad. EnMxico hasta el momento en que se desarroll estainvestigacin, no se encontraron reportes de la pa-

togenicidad deM. phaseolinaen jamaica.

Fusarium incarnatumocasion sntomas de laenfermedad nicamente en ensayo a cielo abierto,en dos de cinco plantas inoculadas. Los sntomasse observaron a los 15 ddi (Cuadro 5), y se caracte-rizaron por marchitez y necrosis basal. Al aislarsea este organismo con una baja frecuencia (2.4 %)(Cuadro 2), se considera en este estudio, como pa-tgeno secundario de la enfermedad pata prieta

en los sitios donde se detect.Los resultados de las inoculaciones con Phyto-

phthora parastica indicaron que este organismofue el de mayor patogenicidad, seguido porMacro-phomina phaseolinay el de menor patogenicidadfue Fusarium incarnatum (Cuadro 5). En EgiptoM. phaseolina yF. incarnatum fueron aislados deplantas con sntomas de pudricin radical y mar-chitez de plantas de jamaica. En inoculaciones ar-ticiales en invernadero y a cielo abierto determi-

naron queM. phaseolina fue ms patognico queF.incarnatum (Hassan et al., 2014), lo que coincidecon lo determinado en el presente estudio.

A partir de plantas inoculadas en forma inde-pendiente con P. parasitica, M. phaseolina y F.incarnatum, y que indujeron sntomas se obtuvo

wilting and basal necrosis. Because this organismwas isolated at a low frequency (2.4 %) (Table 2), itis considered by this study as a secondary pathogenof the black leg disease in the areas in which it

was detected.The results of the inoculations withPhytophthora

parastica indicated that this organism had thehighest pathogenicity, followed byMacrophominaphaseolina, and the lowest pathogenicity wasFusarium incarnatum (Table 5). In Egypt, M.phaseolina and F. incarnatum were isolated fromplants with symptoms of rooting rot and wilt ofroselle. In articial inoculations in greenhouses

and in the opencastM. phaseolina was found to be

more pathogenic thanF. incarnatum (Hassan et al.,2014), which coincides with the ndings by this

investigation.From plants independently inoculated with P.

parasitica,M. phaseolina, andF. incarnatum, andthat produced symptoms, we obtained the samespecies that was inoculated when reisolating.

In the tests performed in a controlledenvironment chamber and opencast, as shown inTable 5, the other inoculated organisms and control

plants did not show symptoms of the disease.In a similar study carried out in Nigeria on roselle

with stem and root rot, Phytophthora parasitica,Rhizoctonia solani, and Fusarium solani wereisolated. In pathogenicity tests P. parasitica wasfound to be the main cause of the disease;R. solanionly caused the death of plantlets, andF. solani wasnot pathogenic (Adeniji, 1970).

Phytophthora parasitica has been reported inGuerrero by Hernndez and Romero (1990) as being

the cause of black leg,, in India, it causes root andstem rotting in roselle (Kumar and Mandal, 2010),and its presence has also been reported in Africa,Indonesia, Puerto Rico, Malaysia, Philippines,Ivory Coast, Brazil, and other countries, as thecause of root rot and stem in this species (Erwin


18/22



la misma especie que fue inoculada, al realizar losreaislamientos.

En los ensayos realizados en cmara de ambien-te controlado y a cielo abierto, como se observa en

el Cuadro 5, los otros organismos inoculados y lasplantas testigos no manifestaron sntomas de la en-fermedad.

En un estudio similar realizado en Nigeria, enjamaica con pudricin de tallo y raz, se aisl aPhytophthora parasitica, Rhizoctonia solaniyFu-sarium solani. En pruebas de patogenenicidad P.parasiticaresult ser el principal agente causal dela enfermedad;R. solanisolo caus muerte de pln-tulas yF. solani no fue patognico (Adeniji, 1970).

Phytophthora parasitica ha sido reportado enGuerrero por Hernndez y Romero (1990) comoagente causal de la pata prieta, en la India causala pudricin radical y de tallo en jamaica (Kumary Mandal, 2010), tambin se ha informado de supresencia en frica, Indonesia, Puerto Rico, Ma-lasia, Filipina, Costa de Marl, Brasil, entre otros

pases, como causante de pudricin radical y de ta-llo en esta especie (Erwin y Ribeiro, 1996; Drenthy Guest, 2004; Silva et al., 2014).

Por otra parte, en Cuba y el Salvador, Wellman(1977) report que Macrophomina phaseolina escausante de pudricin del tallo en plantas de ja-maica, recientemente en Egipto se menciona comoinductor de pudricin radical y marchitez de plan-tas en esta misma especie (Hassan et al., 2014).En Banglads, se ha aislado de semilla de jamaica,como patgeno que afecta la germinacin (Islametal., 2013).Tambin se menciona en otras especiesdel gneroHibiscus. As, en la India causa la pu-

dricin del cuello en hibisco de coral (Hibiscusschizopetalus) (Santhakumari, 2002).

El hongo Fusarium incarnatum (=F. semitec-tum) en Egipto se reporta como causante de pudri-cin radical y marchitez de jamaica (Hassan et al.,2014). Adems en otros pases se tienen registros

and Ribeiro, 1996; Drenth and Guest, 2004; Silvaet al., 2014).

Likewise, in Cuba and El Salvador, Wellman(1977) reported that Macrophomina phaseolina

causes stem rot in roselle plants, and recently, inEgypt, it was mentioned as inducing root rot andwilting of plants of this same species (Hassan etal., 2014). In Bangladesh, it has been isolated fromroselle seeds as a pathogen that affects germination(Islam et al., 2013). It is also mentioned inother species of the genus Hibiscus. In India itcauses collar rot in coral hibiscus (Hibiscusschizopetalus) (Santhakumari, 2002).

In Egypt, the fungusFusarium incarnatum(=F.

semitectum) has been reported as the cause of rootrot and roselle wilting (Hassan et al., 2014). Also,in other countries, there are records of it beingpathogenic in other species of the genusHibiscus.For example, Farr and Rossman (2015) report F.incarnatum in kenaf (Hibiscus cannabinus L.)in Iran and Kenya, and on tulip (Hibiscus rosa-sinensisL.)in the Island of Barbados. Leslie et al.(1990) indicate that F. incarnatum is a commonpathogenic agent in the soil, distributed mostly in

tropical and subtropical regions.The fungus Fusarium oxysporum was not

considered pathogenic, despite reports of itspathogenicity in roselle in Malaysia, Nigeria,United States, and other countries (Ooi and Salleh,1999; Amusa et al., 2005; Ploetz et al., 2007;Hassan et al., 2014).

Additionally, in India Hibiscus sabdariffais reported as a new host for Fusarium solani(Padaganur et al., 1988). In Egypt, Hassan et al.

(2014) mention thatF. solaniis a pathogenic agentfor roselle, and Chehri et al. (2014) in Malaysiaisolated it from roselle plants with symptoms of rootrot. However, in this study it was not pathogenic.

The genus Colletotrichum includes severalpathogenic species of plants with economic


19/22



como patgeno de otras especies del gneroHibis-cus,por ejemplo; Farr y Rossman (2015) reportanaF. incarnatumen kenaf (Hibiscus cannabinusL.)en Irn y Kenia, y sobre tulipn (Hibiscus rosa-sinensis L.) en la Isla de Barbados. Leslie et al.(1990) indica que F. incarnatumes un agente pa-tognico comn en el suelo, distribuido principal-mente en regiones tropicales y subtropicales.

El hongoFusarium oxysporumno fue patogni-co, sin embargo existen reportes como patgeno dejamaica en Malasia, Nigeria, EUA, entre otros pa-ses (Ooi y Salleh, 1999; Amusa et al.,2005; Ploetzet al., 2007; Hassan et al., 2014).

Por otra parte en la India reportan a Hibiscus

sabdariffa como nuevo hospedante de Fusariumsolani (Padaganur et al.,1988). En Egipto Hassanet al. (2014) mencionan que F. solani es agentepatognico para la jamaica, adems Chehri et al.(2014) en Malasia lo aisl de plantas de jamaicacon sntomas de podredumbre de raz, sin embargoen el presente estudio no fue patognico.

El gnero Colletotrichumincluye a numerosasespecies patgenas de plantas de importancia eco-nmica. Distribuido principalmente en regiones

tropicales y subtropicales (Cannon et al., 2012).El hongo Colletotrichum truncatum es patgenode jamaicaen la India (Farr y Rossman, 2015) yadems se ha reportado en otras especies del g-nero Hibiscus, por ejemplo: H. esculentum en laIndia y Pakistn; mientras que en Malasia sobreH.rosa-sinensis(Farr y Rossman, 2015). Glomerellacingulatatambin se ha reportado en especies delgneroHibiscustales como H. tiliaceuscomo cau-sante de antracnosis en los EUA (Farr y Rossman,

2015) y enH. rosa-sinensis en Argentina (Rivera etal.,2000). Tanto C. truncatum y G. cingulata tam-bin han sido reportadas como especies endtas de

plantas de la familia Malvaceae, adems de otras

importance distributed mainly in tropical andsubtropical regions (Cannon et al., 2012). Thefungus Colletotrichum truncatum is a pathogenof roselle in India (Farr and Rossman, 2015), and

it has also been reported in other species of thegenusHibiscus, such asH. esculentum in India andPakistan orH. rosa-sinensisin Malaysia (Farr andRossman, 2015). Glomerella cingulata has alsobeen reported on species of the genus Hibiscussuch asH. tiliaceusas the cause of anthracnose inthe United States (Farr and Rossman, 2015) and onH. rosa-sinensis in Argentina (Rivera et al.,2000).Both C. truncatum and G. cingulata have also beenreported as endophytic species of the Malvaceae

family, as well as other plant species (Costa et al.,2012; Kumar and Kaushik, 2013). This coincideswith ndings from this study, in which they were

not found to be pathogenic in roselle plants.The genus Phomopsis is related to diseases in

herbaceous plants, although it can attack bushes andsome fruit trees (Agrios, 2005).P. longicollacausestem blight in peanut plants (Arachis hypogaea L.)(Sanogo and Etarock, 2009); in soybean, it inducescankers in the stem, and it can infect pods and seeds

(Lu et al., 2010; Li, 2010). It has also been reportedas being an endophyte in soybean and other species(Larran et al., 2002; Wagenaar and Clardy, 2001;Rhoden et al., 2012). No reports were found onthis organism as a pathogen of roselle (Farr andRossman, 2015), and in this study it was not foundto be pathogenic.

Due to the above, the fungi F. oxysporum,F. solani, G. cingulata, C. truncatum, and P.longicollaare considered organisms associated to

roselle and of low risk for this area of study, sincethey were not found to be pathogenic (Table 5).The frequency of isolation was low and in generalterms, they displayed a limited distribution.


20/22



especies de plantas (Costa et al., 2012; Kumar yKaushik, 2013). Lo que coincide con lo obtenidoen este estudio, al no ser patognicos en plantas dejamaica.

El gneroPhomopsis se relaciona con enferme-dades de plantas herbceas, aunque puede atacararbustos y algunos rboles frutales (Agrios, 2005).P. longicollaen cacahuate (Arachis hypogaea L.)causa tizn del tallo (Sanogo y Etarock, 2009), ensoya induce cancros en tallo, y es capaz de infec-tar vainas y semillas (Lu et al., 2010; Li, 2010),tambin ha sido reportado como endto en soya

y otras especies (Larran et al., 2002; Wagenaar yClardy, 2001; Rhoden et al., 2012), no se encon-

traron reportes de este organismo como patgenode jamaica (Farr y Rossman, 2015), adems en elpresente estudio, este organismo no fue patognico.Por lo anterior los hongos F. oxysporum, F. sola-ni, G. cingulata, C. truncatum y P. longicolla seconsideran organismos asociados a la jamaica y debajo riesgo para esta zona en estudio, debido a queno fueron patognicos (Cuadro 5), la frecuencia deaislamiento fue baja y en general presentaron dis-tribucin limitada.

CONCLUSIONES

Se concluye quePhytophthora parasiticaes elorganismo de mayor frecuencia y distribucin en laregin estudiada, por lo que se considera el princi-pal agente causal de la enfermedad pata prieta.El hongoMacrophomina phaseolinapresent bajadistribucin, sin embargo fue aislado en alta fre-

cuencia en dos sitios, por lo que es el causante de laenfermedad en tales lugares.Fusarium incarnatumfue patognico, sin embargo se requiere de ms es-tudios, debido a su baja frecuencia y distribucin.Se reporta por primera vez a Macrophomina pha-seolina y Fusarium incarnatum como patgenode la jamaica en Mxico. Fusarium oxysporum

CONCLUSIONS

We conclude that Phytophthora parasiticais the organism with the greatest frequency and

distribution in the region studied, and is thereforeconsidered the main cause of the black legdisease. The fungus Macrophomina phaseolinapresented low distribution, although it wasisolated with high frequency in two sites, andtherefore it is the cause of the disease in theseplaces. Fusarium incarnatum was pathogenic,although it requires further study, due to itslow frequency and distribution. MacrophominaphaseolinaandFusarium incarnatumare reported

as pathogenic for roselle for the rst time in

Mexico. Fusarium oxysporum was found widelydistributed, yet it presented a low frequency andit was not pathogenic. The fungiFusarium solani,Glomerella cingulata, Colletotrichum truncatum,andPhomopsis longicollaare considered low riskfor the crop, since they are not pathogenic and theirisolation frequency was low.

End of English version

se encontr ampliamente distribuido, no obstantepresent baja frecuencia y no fue patognico. Loshongos Fusarium solani, Glomerella cingulata,Colletotrichum truncatumyPhomopsis longicollase consideran de bajo riesgo para el cultivo, debidoa que no fueron patognicos y su frecuencia de ais-lamiento fue baja.

LITERATUTA CITADA

Abawi GS and Pastor-Corrales MA. 1990. Root rots ofbeans in Latin America and Africa: Diagnosis, researchmethodologies and management strategies. CentroInternacional de Agricultura Tropical. Cali, Colombia. 114 p.


21/22



Adeniji MO. 1970. Root and stem rot of the ber crop roselle(Hibiscus sabdariffa) in Nigeria. Plant Disease Reporter54:23-25.

Agrios GN. 2005. Plant pathology. Fifth edition. AcademicPress. New York, USA. 922p.

Amusa NA, Adegbite AA and Oladapo MO. 2005. Vascularwilt of roselle (Hibiscus sabdariffa L. var. sabdariffa) inthe humid forest region of South-western Nigeria. PlantPathology Journal 4:122-125.

Besoan CAX. 2013. Control biolgico de Phytophthora entomates y pimientos desarrollados bajo invernadero. Pp:65-68.In:Montealegre ARJ y Prez RLM (Eds). Control

biolgico de enfermedades de las plantas en Chile. Santia-go, Chile, Facultad de Ciencias Agronmicas, Universidadde Chile. 147 p.

Barnett LH and Hunter BB. 2006. Illustrated Genera of Imper-fect Fungi. Fourth Edition. The American Phytopathologi-cal Society. St. Paul, Minnesota, USA. 218p.

Booth C. 1971. The genusFusarium. Commonwealth Mycolo-gy Institute. Kew, Surrey, United Kingdom. 237 p.

Cannon PF, Damm U, Johnston PR and Weir BS. 2012. Colle-

totrichum current status and future directions. Studies inMycology 73: 181213.

Ceja-Torres LF, Tliz OD, Osada KS y Morales-Garca LJ.2000. Etiologa, distribucin e incidencia del cancro delaguacatePersea americana Mill. En cuatro municipios delestado de Michoacn, Mxico. Revista Mexicana de Fito-

patologa 18 (002): 79-86.Chehri K, Salleh B and Zakaria L. 2014.Fusarium virgulifor-

me, a soybean sudden death syndrome fungus in Malay-sian soil. Australasian Plant Disease Notes 9:128.

Costa IPMW, Assuncao MMC, Lima TEF, Oliveira RJV andCavalcanti MAQ. 2012. Checklist of endophytic fungifrom tropical regions. Mycotaxon 119: 494.

Damm U, Woudenberg JHC, Cannon PF and Crous PW. 2009.Colletotrichum species with curved conidia from herba-

ceous hosts. Fungal Diversity 39: 45-87.Dasgupta B, Mohanty B and Datta P. 2012. Survival ofPhyto-phthora parasiticacausing foot and leaf rot of betelvineunder different soil pH, moisture and temperature regimes.SAARC Journal of Agriculture 10 (1):29-43

Drenth A and Guest DI. 2004. Diversity and management ofPhytophthorain Southeast Asia. ACIAR Monograph No.114, 238p.

Erwin DC and Ribeiro OK. 1996. Phytophthora diseasesworldwide. The American Phytopathological Society. St.Paul, Minnesota, USA. 562 p.

Farr DF and Rossman AY. 2015. Fungal databases, systema-tic mycology and microbiology laboratory, ARS, USDA.http://nt.ars-grin.gov/fungaldatabases/ (consulta, marzo2015).

Gallegly ME and Hong C. 2008. Phytophthora: Identifyingspecies by morphology and DNA ngerprints. The Ameri-can Phytopathological Society. St. Paul, Minnesota, USA.158 p.

Hanlin RT. 1990. Illustrated genera of ascomycetes. Vol. 1.APS Press, The American Phytopathological Society. St.Paul, Minnesota, USA. 263 p.

Hassan N, Shimizu M and Hyakumachi M. 2014. Occurrenceof root rot and vascular wilt diseases in roselle (Hibiscus

sabdariffaL.) in Upper Egypt. Mycobiology 42(1): 66-72.Hernndez MJ y Romero CS. 1990. Identicacin del agente

causal de pata prieta de la jamaica (Hibiscus sabdariffa,L.) y pruebas de fungicidas para su control bajo condicio-nes de invernadero. Revista Chapingo (67-68):50-54.

Hobbs TW, Schmitthenner AF and Kuter GA. 1985. A newPhomopsisspecies from soybean. Mycologia 77, 53544.

Horst RK. 2008. Westcotts plant disease handbook. Seven-th Edition. Springer Verlag Berlin Heidelberg . NewYork,USA. 1317 p.

Holliday P and Punithalingam E. 1970. Macrophominaphaseolina. Commonwealth Mycological Institute. Des-criptions of Pathogenic Fungi and Bacteria, N 275. Kew,UK: Commonwealth Mycological Institute.

Islam MS, Uzzal MSI, Mallick K and Monjil MS. 2013. Mana-gement of seed mycoora of mesta (Hibiscus sabdariffa)

by seed washing, garlic extract and knowin. ProgressiveAgriculture. 24(1 and 2): 1-7.

Jha AK and Dubey SC. 2000. Occurrence of collar rot of

(Abelmoschus esculentus) in the plateau region of Bihar.Journal of Research Birsa Agriculture University 12 (1):67-72.

Kaur S, Dhillon GS, Brar SK, Vallad GE, Chand R and Chau-han VB. 2012. Emerging phytopathogen Macrophomina

phaseolina: biology, economic importance and currentdiagnostic trends. Critical Reviews in Microbiology38(2):136151.

Kumar R and Mandal RK. 2010. Effect of different fungicideson Phytophthora parasitica var. sabdariffae and Sclero-tium rolfsiiinfecting mesta. Pestology 34:23-27.

Kumar S and Kaushik N. 2013. Endophytic fungi isolatedfrom oil-seed cropJatropha curcasproduces oil and exhi-

bit antifungal activity. PLoS ONE 8(2):e56202.Larran S, Rollan C, Bruno HA, Alippi HE and Urrutia MI.

2002. Nota corta: endophytic fungi in healthy soybeanleaves. Investigacin agraria. Produccin y proteccin ve-getales. 17 (1):173178.

Leslie JF and Summerell BA 2006. The LaboratoryFusarium.Manual. Blackwell Publishing. Ames, Iowa, USA. 388 p.

Leslie JF, Pearson AC, Nelson EP and Touson AT. 1990. Fu-sarium species from corn, sorghum, and soybean eldsin the central and eastern United Stated. Phytopathology80:343-350.

Li S, Hartman GL and Boykin DL. 2010. Aggressivenessof Phomopsis longicolla and other Phomopsis spp. onsoybean. Plant Disease 94(8):1035-1040.

Lu X, Robertson EA, Byamukama ZE, and Nutter WF. 2010.Evaluating the importance of stem canker of soybean iniowa. Plant Disease 94 (2):167-173.

Mordue JEM. 1971. Glomerella cingulata. No. 315. In: CMIDescriptions of Pathogenic Fungi and Bacteria. CAB,Kew, UK.

Murray HG and Thompson WF. 1980. Rapid isolation of highmolecular weight DNA. Nucleic Acids Research. 8:4321-4325.


22/22



Nelson PE, Toussoun TA and Marasas WFO. 1983.Fusariumspecies: an illustrated manual for identication. The Penn-sylvania State University. University Park, Pennsylvania,USA. 193 p.

ODonnell K. 1993.Fusariumand its near relatives. In:Thefungal holomorph: mitotic, meiotic and pleomorphic spe-ciation in fungal systematics, pp. 225233. Edited by Re-ynolds DR and Taylor JW. Wallingford, UK: CAB Inter-national.

Ooi KH and Salleh B. 1999. Vegetative compatibility groupsof Fusarium oxysporum, the causal organism of vascularwilt on roselle in Malaysia. Biotropia 12:31-41.

Padaganur, GM, Kachapur, MR, Naik KS and Patil NK. 1988.Hibiscus sabdariffa L., a new host to Fusarium solani(Mart.) Sacc.Plant Pathol Newsl 6 (1-2):13.

Ploetz RC, Palmateer AJ, Geiser DM and Juba JH. 2007. Firstreport ofFusariumwilt caused byFusarium oxysporumonroselle in the United States. Plant Disease 91:639.

Rhoden SA, Garcia A, Bongiorno VA, Azevedo JL and Pam-phile JA. 2012. Antimicrobial activity of crude extracts ofendophytic fungi isolated from medicinal plant TrichiliaelegansA. Juss. Journal of Applied Pharmaceutical Scien-ce 02 (08): 57-59.

Rivera MC, Wright ER and Carballo S. 2000. First report ofColletotrichum gloeosporioideson chinese rose in Argen-tina. Plant Disease 84: 1345. (34598).

Sanogo S and Etarock FB. 2009. First report of Phomopsislongicolla causing stem blight of valencia peanut in NewMexico. Plant Disease 93 (9):965.1-965.1.

Santhakumari P, Kavitha K and Nisha MS. 2002. Occurrenceof collar rot in coral Hibiscus: a new record. Journal ofMycology and Plant Pathology 32(2):258-258.

Santos JM, K. Vrandecic K, C osic J, Duvnjak T and Phi-llips AJL. 2011. Resolving the Diaporthe species occu-rring on soybean in Croatia. Persoonia 27: 9-19.

SAS Institute. 1988. SAS Users Guide: Statistics. Release

6.03 Edition. SAS Institute, Inc. Cary, N.C. USA.SIAP. 2010. Anuario estadstico de la produccin agrco-la. http://www.siap.gob.mx/index.php?option=com_wrapper&view=wrapper&Itemid=351 (consulta, mayo2012).

Silva GS, Rgo AS and Leite RR. 2014. Doenas da vinagreirano Estado do Maranho. Summa Phytopathologica40 (4):378-380.

SMN. 2012. Servicio meteorolgico nacional. Comisin Na-cional del Agua. Normales climatolgicas. Periodo (1981-2010). http://smn.cna.gob.mx/index.php?option=com_content&view=article&id=182:guerrero&catid=14:normales-por-estacion (consulta, enero 2012).

Surinder K, Bahadur VC, Kaur SB and Singh GD. 2013. Adap-tability of Macrophomina phaseolina isolates of pigeon-

pea (Cajanus cajan L.) to different temperature and pH.International Journal of Life Sciences 1 (2): 81-88.

Sutton BC. 1980. The coelomycetes: fungi imperfecti withpycnidia, acervuli and stromata. Commonwealth Mycolo-gical Institute. Kew, England 696 p.

Sutton BC. 1992. The genus Glomerella and its anamorphCo-lletotrichum.In: Bailey JA, Jeger MJ, eds. Colletotrichum.Biology, pathology and control. Wallingford, UK: CABInternational. pp 126.

Wagenaar MM and Clardy J. 2001. Dicerandrols, new antibio-tic and cytotoxic dimers produced by the fungusPhomop-

sis longicollaisolated from an endangered mint. Journal ofNatural Products 64: 10061009.

Walkley A and Black IA. 1934. An examination of the Degtja-reff method for determining soil organic matter and propo-sed modication of the chromic acid titration method. SoilScience 37: 2938.

Wellman LF. 1977. Dictionary of tropical American crops andtheir diseases. The Scarecorw Press, Inc. Metuchen, NewJersey. 666 p.

White TJ, Bruns T, Lee S and Taylor, J. 1990. Amplicationand direct sequencing of fungal ribosomal RNA genes for

phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ,White TJ (Eds.) PCR Protocols. A guide to methods andapplications. New York NY. Academic Press, Inc. pp. 315-322.

Zhang Z, Schwartz S, Wagner L and Miller W. 2000. A greedyalgorithm for aligning DNA sequences. Journal of Compu-tational Biology 7:203-214.

“pata prieta” de la jamaica

Documents