Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j ourna l homepage: www.e lsev ie r.com/ locate /cbpa

Organic anion transporting polypeptides (OATP) in zebrafish (Danio rerio):Phylogenetic analysis and tissue distribution

Marta Popovic, Roko Zaja, Tvrtko Smital ⁎Laboratory for Molecular Ecotoxicology, Division for Marine and Environmental Research, Rudjer Boskovic Institute, Bijenička 54, 10 000 Zagreb, Croatia

⁎ Corresponding author. Tel.: +385 1 45 61 088; fax:E-mail address: smital@irb.hr (T. Smital).

1095-6433/$ – see front matter © 2009 Elsevier Inc. Aldoi:10.1016/j.cbpa.2009.11.011

a b s t r a c t

a r t i c l e i n f o

Article history:Received 6 August 2009Received in revised form 11 November 2009Accepted 12 November 2009Available online 25 November 2009

Keywords:OATPZebrafishPhylogenetic analysisMembrane topologyTissue distribution

The aim of our study was the initial characterization of Organic anion transporting polypeptides (SLCO genesuperfamily) in zebrafish (Danio rerio) as an important model species in biomedical and ecotoxicologicalresearch, using phylogenetic analysis, membrane topology prediction and tissue expression profiling. Thephylogenetic tree of Oatp superfamily in vertebrates was constructed in Mega 3.1. Software, membranetopology was predicted using HMMTOP algorithm, while qRT-PCR was used to determine tissue-specificgene expression levels. Phylogenetic analysis revealed that Oatp superfamily in zebrafish consists of fivefamilies that include 14 SLCO genes. Eight out of 14 transporters do have orthologs or co-orthologs in othervertebrates, while 6 members are found only in fish lineage. Topology analysis showed that all zebrafishOatps consist of 12 transmembrane domains (TMD) with the large fifth extracellular loop (LP5). Tissuedistribution analysis revealed that the expression patterns of Oatp2a1, Oatp2b1 and Oatp3a1 follow tissuedistribution patterns of their mammalian (co)orthologs. Expression pattern of a newly identified Oatp1d1 issimilar to mouse Oatp1a4, while other new zebrafish Oatps (Oatp1e1, 1f2) do not resemble any of themammalian Oatps. In summary, the described comprehensive analysis of Oatp superfamily in fish representsa first step towards research on toxicological relevance of uptake transporters in aquatic organisms.

+385 1 46 80 243.

l rights reserved.

© 2009 Elsevier Inc. All rights reserved.

1. Introduction

Organic anion transporting polypeptides (OATP) are membranetransporters thatmediate sodium-independent uptakeof amphipathicorganic compounds. OATPs transport a wide range of substrates,including various endobiotic (bile acids, eicosanoids, steroid andthyroid hormones and their conjugates) and xenobiotic compounds(anionic oligopeptides, organic dyes, several toxins and numerousdrugs). During recent years, it has become increasingly recognized thatOATPs play important roles in drug absorption and disposition and arecritically involved in the cellular uptake of drugs in tissues importantfor pharmacokinetics, such as intestine, liver and kidney (Kindla et al.,2009). Nevertheless, only a few of these transporters have beencharacterised in detail (reviewed in Hagenbuch and Gui (2008)).

More than 160 OATPs/Oatps have been predicted on the genomelevel in at least 25 animal species. Based on the phylogenetic analysis, allso far identified Oatps have been classified into six families and speciesdependent number of subfamilies (Hagenbuch and Meier, 2004). Atypical Oatp transporter is 643–722 amino acids long protein withmolecular mass between 80 and 90 kDa. Based on the high-resolutioncrystal structure for several bacterial transmembrane transporters and

computational prediction algorithms, it is predicted that all Oatps sharesimilar structure with 12 transmembrane domains (TMDs) and a large5th extracellular loop (LP5) (Hagenbuch and Gui, 2008), while recentlyWang et al. (2008) showed that rat Oatp1a1 contains 12 TMDs. TMDsformpositively charged pore,which probably containsmultiple bindingsites of different affinities (Tamai et al., 2001; Noe et al., 2007).Conserved structural features of theOATP superfamily include 13 aminoacids long signature on the border of extracellular LP3 and TMD6, and alarge extracellular LP5 with 10 conserved cysteine residues. The role ofthis highly conserved sequence is not known. On the contrary, 10 highlyconserved cysteine residues within LP5 are found to be crucial forprotein function (Hanggi et al., 2006). The exact transportmechanismofOATPs is still unknown. Earlier studies suggested that Oatp transportmechanism may be based on organic anion exchange with glutathione(GSH) or bicarbonate, as it has been proved in the case of rat Oatp1a1(Satlin et al., 1997; Li et al., 1998), rat Oatp1a4 (Li et al., 2000) andOATP1B3 (Briz et al., 2006). However, it has recently been shown thattransport ismost likely bidirectional facilitated diffusion independent ofGSH (Mahagita et al., 2007).

Considering OATPs substrate specificities, it is known thatsome substrates, like taurocholate, estrone-3-sulfate, estradiol-17β-glucuronide, bromosulfophthalein and thyroxine, are transportedby the majority of OATPs (Hagenbuch and Meier, 2003). However,despite overlapping substrate range, substrate affinity can be signif-icantly different, like e.g., in the case of OATP1C1, which transports

328 M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

thyroid hormones with Km values in nanomolar range (Pizzagalliet al., 2002).

Members of 1A and 1B subfamilies have the widest substrate range.While 1A members transport physiological substrates and xenobiotics(reviewed inHagenbuchandGui (2008)), 1B transporters (1B1and1B3)are expressed predominantly in liver, where they are crucial for uptakeand vectorial transport of various xenobiotics from the blood (Hsiang etal., 1999; Konig et al., 2000). The onlymember of 1C subfamily in humanand rodents (1C1) is predominantly expressed in brain where itmediates transport of thyroid hormones (Pizzagalli et al., 2002).OATP2 family is subdivided into the two subfamilies with a singlemember within each subfamily (OATP2A1 and OATP2B1). OATP2A1 isexpressed in numerous tissues and is involved in transport ofprostaglandins and other eicosanoids (Lu et al., 1996; Bao et al., 2002).Similarly, OATP2B1 is ubiquitously expressed, showing awider substraterange, which includes physiological substrates like taurocholate andestron-3-sulfate, as well as various drugs (fexofenadine, statins andglibenclamide) (Hagenbuch and Gui, 2008). The only and ubiquitouslyexpressedmember of OATP3 family, OATP3A1, has a possibly importantrole in the transport of neuron-active peptides, thyroid hormones andprostaglandins (Huber et al., 2007). Two members of the OATP4 familydiffer significantly with respect to their tissue distribution and substratespecificity. The OATP4A1 is a ubiquitously expressed uptake transporterinvolved in the transport of thyroid hormones, taurocholate andprobably prostaglandins (Tamai et al, 2000; Fujiwara et al., 2001),while OATP4C1 is a kidney-specific transporter that, besides thyroidhormones, transports cAMP and several drugs (digoxin, methotrexateand ouabain) (Mikkaichi et al., 2004). Function and tissue distribution ofOATP5A1 are yet unknown (Hagenbuch and Gui, 2008). The singlememberof theOATP6 family inhumans,OATP6A1, is highly expressed intestis, while its expression has also been detected in several tumour andcancer cell lines (Suzuki et al., 2003; Lee et al., 2004).

Tissue distribution of Oatps on themRNA level is known for human(Lu et al., 1996; Nishimura and Naito, 2005), mouse (Cheng et al.,2005) and rat (Pizzagalli et al., 2002), whereas such analysis has neverbeen conducted for the non-mammalian species. Detailed summary ofOatps protein expression across tissues is given in the review byHagenbuch and Gui (2008).

Despite their physiological importance and role in cellular detoxi-fication, the knowledge about uptake transporters from the Oatpsuperfamily in non-mammalian species is modest. So far, four zebrafishOatps, six chicken, five frog and 13 invertebrate Oatps have beenreported on the genome level (Meier-Abt et al., 2005), while only a fewstudies focused on the analysis of non-mammalian Oatps on thefunctional level (Nakao et al., 2006;Mulenga et al., 2008). Infish, uptakeof various compounds into liver has been studied mainly in little skate(Raja erinacea) (Boyer et al., 1976; Reed et al., 1982; Fricker et al., 1987;Hugentobler et al., 1987; Boyer et al., 1993; Fricker et al., 1994; Raberghet al., 1994; Smith et al., 2005), but the liver specific little skate uptaketransporterOatp1d1has been identified and characterised only recently(Cai et al., 2002; Ballatori et al., 2006;Meier-Abt et al., 2007). Apart fromstudies on little skate, Oatp1d1-like transporter has been identified inthe liver of rainbow trout (Oncorhynchus mykiss) (Boaru et al., 2006).

Considering lack of knowledge on the uptake transporters in fishand aquatic organisms in general, in this study we have focused on adetailed phylogenetic and tissue distribution analysis of one of thetwo major superfamilies of uptake transporters (SLCO) in zebrafish(Danio rerio), offering the first insight into the expression and possiblerole of Oatps in this valuable model species.

2. Materials and methods

2.1. Phylogenetic analysis, motif identification and membrane topology

Two databases were examined in search of Oatp sequences invertebrates: The National Center of Biotechnology Information (NCBI)

(http://www.ncbi.nlm.nih.gov/) and ENSEMBL (http://www.ensembl.org/index.html). Previously annotated Oatps (mostly mammalianones), were named accordingly, while for non-mammalianOatps blastxalgorithm was used to search for Oatps by blasting human sequencesagainst the genome of chicken (Gallus gallus), frog (Xenopus tropicalis),zebrafish (Danio rerio), Japanese pufferfish (Takifugu rubripes) andgreen spotted pufferfish (Tetraodon nigroviridis). Sequences wereconsidered to be part of the OATP superfamily if they complied to thetwo criteria: (1) blastx hit with threshold value of e=10−3; and (2) thepresence of superfamily signature (D-X-RW-(I,V)-GAWW-XG-(F,L)-L).All SLCO genes (except the ones previously annotated) were annotatedbased on phylogenetic analysis and amino acid sequence identity. Avalue of 40% amino acid sequence identity was taken as a threshold toassign a gene to certain Oatp family (e.g., Oatp1), while 60% amino acidsequence identity was taken as a threshold to assign a gene to the Oatpsubfamily (e.g., Oatp1a) (Meier-Abt et al., 2005). Names were given inaccordance with the new nomenclature adopted by the HUGO GeneNomenclature Committee (http://www.genenames.org). TMDs werepredicted using HMMTOP algorithm version 2.0. (Tusnady and Simon,2001), followed by the prediction correction according to the multiplealignments with human Oatps. Sequences were aligned in ClustalXversion 2.0 (Higgins and Sharp, 1988) and adjusted manually whenneeded. Phylogenetic trees were built in Mega Software version 3.1.using minimum evolutionmethod (Kumar et al., 2004). The robustnessof the tree was determined by bootstrap test with 1000 replications(Felsenstein, 1985). BioEdit Software version 7.0. was used for sequenceediting and alignment display (Hall, 1999), while sequence identitieswere calculated in DNAstar Software (version 7.0.).

2.2. Tissue-specific gene expression analysis

Adult female zebrafish, purchased from a local fish supplier, weresacrificed by decapitation for the collection of tissues. Tissues (brain,gills, liver, intestine, ovaries and skeletal muscle) from four specimenswere pooled together in order to get substantial amount of materialfor RNA isolation. Three independent pools were collected. In order toget enough tissue for RNA isolation from kidney, 13 specimens had tobe sacrificed. Tissues were stored in RNA later (Qiagen, Hilden,Germany) and afterwards homogenized (20 s) using rotor–statorhomogenizer at 10,000 rpm. Total RNA isolation was carried out usingRneasy Mini Kit (Qiagen) in the case of brain, gills, liver, intestine andovaries, and with TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) inthe case of skeletal muscle. After homogenization in Tri-reagent(Sigma-Aldrich, Taufkirchen, Germany), muscle tissue was incubatedin proteinase K for 10 min at 55 °C, in order to improve tissue tearing,after which Trizol isolation followed according to the manufacturer'sinstructions. Genomic DNA digestionwas carried out using Rnase-freeDNase Set (Qiagen). Total RNA was quantified using Agilent 2100Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) followed byreverse transcription (1 µg of total RNA using High Capacity cDNAReverse Transcription Kit with RNase Inhibitor (Applied Biosystems,Foster City, CA, USA)).

For the purpose of qRT-PCR specific primers were designed usingthe Primer express 3.0 Software (Applied Biosystems), adjustedmanually if necessary (Table 1), and purchased from Invitrogen. In thecase of Oatp1f subfamily, specific primers could not be designed todistinguish between Oatp1f1 and 1f4 genes, due to the fact that thosesequences are too similar (Table S2). Therefore, data related toquantification of Oatp1f2 actually represents expression of all fourOatp1f genes. Target amplicons of 90–100 bp were cloned usingpGEM-T Vector System I (Promega, Madison, WI, USA). Plasmids werepurified by QIAprep Spin Miniprep Kit (Qiagen) and amplicons wereverified by sequencing at the Rudjer Boskovic Institute DNA Service(Zagreb, Croatia). Quantification of SLCO genes was conducted bycombining absolute and relative quantification method. For thepurpose of absolute quantification, standards were constructed by

Table 1Primer sequences used for absolute quantification of zebrafish Oatps using qRT-PCRanalysis and standard curve parameters.

Proteinname

Primer sequence 5→3 Finalconc.(nM)

Slope Intercept Efficiency[%]

Oatp1d1 F ACGCCCTGTACAGCTCATCCT 300 −3.49 47.27 93.4%R ACTGGTCCTTTAGCGCTTGCT 300

Oatp1e1 F TGCAAATGAGACTGTCGTTATAGCT 300 −3.55 31.37 91.2%R TGGTATTATCGATGTGCTGTATTGAG 300

Oatp1f2 F ACAGCTGCCACCCACACTAAT 300 −3.44 31.16 95.2%R GGCATCCAGAAAAAGGCTGTT 900

Oatp2a1 F GACTCATTGCAAGCCTGACACA 300 −3.35 46.64 98.9%R AGCAAAAACTGGATCCCTATGG 300

Oatp2b1 F ACGCAGACTGGGTTTGACTGT 300 −3.67 55.04 87.3%R GCAGCCAATAAAAAGAAGTGGAA 300

Oatp3a1 F TGTGGATGCTTTGTTCATCGA 900 −3.31 42.59 100.4%R GGCACCGCAGATGAGGAAT 300

Oatp3a2 F GTGCGCTTGCAGCATGAT 50 −3.93 35.51 79.5%R TCAGCTCTGGGCTCACAGTTC 300

Oatp5a2 F ATCGTGGGCTGTGAAAGCA 300 −3.90 38.27 80.5%R CGTCAGGTTTCTGTGGGTCAA 300

EF1α F CCTGGGAGTGAAACAGCTGATC 300 −3.43 42.49 95.5%R GCTGACTTCCTTGGTGATTTCC 300

Table 2Number of genes present in different Oatp subfamilies within vertebrate lineage. X.tropicalis = Xenopus (Silurana) tropicalis).

Oatp1 Oatp2 Oatp3 Oatp4 Oatp5 Oatp6

Species 1a 1b 1c 1d 1e 1f 2a 2b 3a 4a 4c 5a 6a–d

H. sapiens 1 2 1 – – – 1 1 1 1 1 1 1M. musculus 4 1 1 – – – 1 1 1 1 1 1 3R. norvegicus 5 1 1 – – – 1 1 1 1 1 1 2G. gallus 1 1 1 – – – 1 1 1 1 – 1 –

X. tropicalis 1 1 1 – – – 1 1 1 1 1 1 –

D. rerio – – 1 1 1 4 1 1 2 1 – 2 –

T. rubripes – – 2 1 1 – 1 1 2 1 – 1 –

T. nigroviridis – – 2 1 – – 1 1 1 – – 2 –

329M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

standard PCR amplification (50 µL reaction volume) of recombinantpGEM-T vector (plasmid) carrying target amplicon with M13 primersfollowed by elution from the 1.2% agarose gel in TAE buffer usingMiniElute Gel Extraction Kit (Qiagen). Standards were quantified onBioanalyzer (Agilent Technologies) using Agilent DNA1000 kitaccording to the manufacturer's instruction. Standard curves wereconstructed for each gene, and their equations were used to calculateabsolute copy number. Slope, intercept and amplification efficiency ofstandards given in Table 1 are averages of 3 independent experiments.Correlation coefficients of all standards were above 0.99. Relativequantification was conducted using Q-Gene method, which correctsfor the difference in amplification efficiencies of target genes (Mulleret al., 2002; Simon, 2003). Elongation factor (EF1α) was chosen as ahousekeeping gene, given the fact that its expression was found to besimilar across all analysed tissues. qRT-PCR was performed using theABI PRISM 7000 Sequence Detection System using Power SYBR GreenPCRMaster Mix (Applied Biosystems). Optimal primer concentrationswere determined for each gene. qRT-PCR reaction mix was preparedto a final volume of 10 µL containing: 5 µL of SYBER Greenmaster mix,0.5 µL of each primer, 1 µL of template (10 ng/well) and 3 µL ofUltrapure DNase/RNase free distilled water (Molecular Bioproducts,San Diego, CA, USA). After the denaturation at 95 °C for 10 min, 40cycles of amplification were carried out with denaturation at 95 °C for15 s, annealing and elongation at 60 °C for 1 min, altogether followedby the melting curve analysis. Data were analysed with ABI PRISMSequence Detection Software 1.4 (Applied Biosystems) and GraphPadPrism Software version 5.00.

3. Results

3.1. Phylogenetic analysis, motif identification and membrane topology

We have identified fourteen SLCO genes in zebrafish. Number ofgenes within each SLCO family in analysed vertebrate species is givenin Table 2. Six new zebrafish genes have been found within the Oatp1family and were subsequently classified within 3 new subfamilies(Oatp1d1, Oatp1e1 and Oatp1f1–4) (Table 2). Orthologs of six newlyidentified zebrafish genes were not found in genomes of othervertebrate (Fig. 1A) nor invertebrate species (data not shown), exceptin teleosts in the case of Oatp1d and 1e subfamilies. Unlike inmammals, where six families are found, Oatp superfamily in zebrafishencompasses 5 families. Oatp1 family consists of 7 transporters: 6 new

members and previously annotated Oatp1c1, which has orthologs inall vertebrate species analysed (Fig. 1A). Oatp2 family encompassestwo members within the two subfamilies: Oatp2a1 and Oatp2b1,which both have orthologs in other vertebrates (Fig. 1A). The same istrue for Oatp3 and Oatp5 families, which both include two members(Oatp3a1, Oatp3a2 and Oatp5a1, Oatp5a2) that have a single orthologin other vertebrate species. Conversely, Oatp4 family has only oneOatp4a subfamily representative in zebrafish (Oatp4a1), while sub-family Oatp4c is not found. Furthermore, Oatp6 family is not present inthe zebrafish genome (Table 2).

Phylogenetic analysis revealed that newly identified memberswithin Oatp1 family, Oatp1d1 and Oatp1e1, show the closest rela-tionship to the Oatp1b and Oatp1c members (Fig. 1A). When aminoacid sequence identities were compared, both proteins show similardifferences to all mammalian Oatp1 subfamilies (Table S2). Oatp1d1 ismost similar to Oatp1c1 in rat and mouse (48% amino acid identity),followed by Oatp1b members in frog, mouse and rat (45, 43 and 42%,respectively), and finally by Oatp1a members in rodents and human(40–42 and 39%, respectively). A similar pattern can be observed forOatp1e1 (Table S2). In pufferfishes, both Oatp1d and Oatp1esubfamily members are present (Table 2). Oatp1d1 shares the highestamino acid sequence identity with Oatp1d1 in pufferfishes (61–64%)but only 44% with the previously annotated little skate Oatp1d1.The Oatp1e1, on the other hand, is phylogenetically most similar tothe Oatp1e1 in green spotted pufferfish (Tetraodon nigroviridis)(TnOatp1e1), although it shares an equally low sequence identitywith mentioned TnOatp1e1 (54%), as it does with Oatp1d and Oatp1cmembers in pufferfishes (48–54%) and with Oatp1d1 in little skate(48%) (Table S2). Oatp1f subfamily members do not have orthologs inpufferfishes (Fig. 1B). They form a distinct gene cluster with highamino acid sequence identity between each other (84–89%) and lowidentity with all other vertebrate Oatps. Their sequences are mostsimilar to Oatp1c and 1d members (40–46%) in other fish species(Table S2). In comparison to human OATPs, Oatp1f1–4 are mostsimilar to OATP1C1 (36–40%) and OATP1A2 (35–39%) in terms ofsequence identity. Finally, zebrafish Oatp1c1 is the only Oatp1subfamily member that has orthologs in other vertebrate species. Itshares the highest amino acid sequence identity with other fishOatp1cmembers (59–65%) and somewhat lower identity with Oatp1cmembers in humans (54% with OATP1C) and chicken (56% withOatp1c1).

Single Oatp2a and 2b subfamily members are found in genomes ofall analysed vertebrate species (Table 2). As expected, zebrafishOatp2a1 is most similar to Oatp2a1 in Japanese pufferfish and greenspotted pufferfish (55 and 59% amino acid sequence identity,respectively), followed by 50–52% sequence identity with Oatp2amembers in other vertebrates (Table S2). Similar is true for zebrafishOatp2b1, that shares 53–54% amino acid sequence identity withOatp2b members in pufferfishes and 42–49% sequence identity withOatp2b members in other vertebrates (Table S2).

Fig. 1. Phylogenetic tree of Oatp superfamily in vertebrates (A) and fish (B) (numbers represent bootstrap values based on 1000 replications). Species abbreviations: Hs, Homosapiens; Rn, Rattus norvegicus; Gg, Gallus gallus; Xt, Xenopus tropicalis; Dr, Danio rerio; Tn, Tetraodon nigroviridis; Tr, Takifugu rubripes; Le, Leucoraja erinacea.

330 M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

Within Oatp3a subfamily, two members are found in zebrafish, aswell as in Japanese pufferfish. On the contrary, one Oatp3a member ispresent in all other vertebrates. Oatp3a1 and Oatp3a2 in zebrafishshow highest sequence identity with pufferfishes (76–77%) andalmost equally high sequence identity with other vertebrate Oatp3members (71–75%) (Table S2).

The only member of Oatp4a subfamily in zebrafish, Oatp4a1,shows the highest sequence identity with chicken Oatp4a1 (67%),followed by Japanese pufferfish Oatp4a1 (63%), frog Oatp4a1 (60%)and OATP4A1 (59%).

Two members are found within the Oatp5a subfamily, both inzebrafish and in green spotted pufferfish, while a single member ispresent in other vertebrates. Zebrafish Oatp5a1 is most similar to theother Oatp5a members in pufferfishes (66–79%), followed by othervertebrates (45–54%) (Table S2). Oatp5a2 shares very high amino acididentity with its ortholog in green spotted pufferfish (90%), followedby Oatp5 members in frog, chicken and human (80, 73 and 68%,respectively) and finally by two Oatp5a3 members in pufferfishes(64–66%) (Table S2).

Predicted membrane topology of zebrafish Oatps confirmed thatthey most probably have 12 TMDs like it was previously hypothesizedfor the majority of mammalian Oatps. Where sequences were incom-

plete (Oatp1d1, 1f1, 1f3, 1f4 and 5a1) (Table S1), topologies werepredicted combining multiple alignments with full gene sequences ofother vertebrate Oatps and HMMTOP algorithm prediction. Someuncertainties were present in the topology prediction of zebrafishOatp1c1 and Oatp2a1, which were treated as an algorithm mistake,and membrane topologies of mentioned transporters were correctedaccording to the multiple sequence alignment. As a result, all ver-tebrate Oatps are predicted to consist of 12 TMDs.

Three conserved motifs were identified in the zebrafish Oatpmembers: superfamily signature, large extracellular loop 5 and KazalSLC21 domain. Superfamily signature (D-X-RW-(I,V)-GAWW-XG-(F,L)-L) is confirmed to be highly conserved not just in zebrafish andvertebrate Oatps, but also in invertebrate SLCO genes (data notshown). Analysis of TMDs and LPs confirmed that all zebrafish Oatpshave a large extracellular LP5 between TMD9 and TMD10 thatcontains 10 conserved cysteine residues, as is the case with otheranalysed vertebrate (Fig. 2) and invertebrate Oatps (data not shown).Within the LP5 of all analysed vertebrate Oatps, including zebrafish,the Kazal SLC21 domain is found, a domain similar to the Kazal-typeserine protease inhibitor domain. This motif is 49 amino acids long(CX3CXCX6PVC X6YXSXCXAGC X11Y X2CXCV) and encompasses firsteight conserved cysteine residues (Cys) within LP5 (Fig. 2). Overall,

Fig. 2. Extract from the multiple alignment of zebrafish and human Oatp1–5 families showing superfamily signature and extracellular LP5 with 10 conserved Cys residues denoted with asterisk (⁎) and Kazal SLC21 domain indicated with greyline.

331M.Popovic

etal./

Comparative

Biochemistry

andPhysiology,Part

A155

(2010)327

–335

332 M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

the membrane topology comparison of all analysed vertebrate Oatpsrevealed that length and arrangements of TMDs and LPs are verysimilar within the vertebrate lineage (data not shown).

3.2. Tissue distribution

Tissue-specific expression pattern of zebrafish Oatps is shown inFig. 3A–G, while genes copy numbers/1 µg of total RNA are shown inTable 3. Oatp1d1 is ubiquitously expressed, with high mRNA levelsranging from 5.9×107 copies/µg of total RNA in kidney to 3.5×109

copies/μg in liver. On the contrary, other Oatp1 subfamily membersshow considerably lower expression. Oatp1e1mRNA levels are almostnegligible across all tissues, with the highest expression in brain(7.9×103 copies/μg). Oatp1f2 shows the lowest expression in allanalysed tissues, with the maximal expression in kidney (5.7×105

Fig. 3. Expression pattern of SLCO genes within each of the seven tissues analysed, quantiexperiments (three pools of four individuals) are given, except in the case of skeletal musclefrom one pool of 14 individuals. Data are shown as mean fold expression difference over th

copies/μg), followed by 2.5×102 copies/µg of total RNA in the brain. Inkidney, according to the relative quantification, Oatp1f2 is most highlyexpressed, followed by Oatp2b1. However, absolute quantificationrevealed different expression pattern in the kidney, showing under-estimated values for Oatp1f2, and overestimated expression ofOatp2b1. Described inconsistency in absolute quantification is a resultof comparatively lower standard curve intercept in comparison toother genes in the case of Oatp1f2, and comparatively higher interceptvalue in the case of Oatp2b1, respectively (Table 1). Therefore, inkidney relative quantification provide more informative data (Fig 3D).

Both members of Oatp2 subfamily showed high expression acrossall tissues analysed. Oatp2a1 is ubiquitously distributed, withexpression levels ranging from 2.1×108 copies/μg in liver to1.5×109 copies/μg in intestine. Overall expression of Oatp2b1 iseven higher than Oatp2a1, with maximal expression in gills

fied with qRT-PCR using relative quantification method. Results of three independentwhere results of only one pool are presented, and the kidney expression data resultinge least expressed gene within each tissue±SE (e.g., over 1f2 in brain, 3a1 in liver etc.).

Table 3Tissue distribution of Oatp superfamily members in adult female zebrafish quantified with qRT-PCR using absolute quantificationmethod. Data are given in copy numbers per 1 µg oftotal RNA. Results of three independent experiments (three pools of four individuals) are given, except in the case of skeletal muscle where results of only one pool are presented,and the kidney expression data resulting from one pool of 14 specimens.

Brain Gills Liver Intestine Kidney Ovaries Skeletal muscle

Oatp1d2 2.3E+09 3.5E+08 3.5E+09 6.4E+08 5.9E+07 7.2E+07 2.8E+08Oatp1e1 7.5E+03 2.4E+02 4.9E+01 2.3E+01 5.7E+01 2.5E+02 1.2E+02Oatp1f2 2.5E+02 9.4E+01 5.1E+01 1.4E+01 5.7E+05 6.6E+02 6.5E+01Oatp2a1 8.0E+08 5.5E+08 2.1E+08 1.5E+09 7.1E+08 3.2E+08 1.4E+09Oatp2b1 6.5E+10 5.6E+11 1.4E+10 1.3E+11 2.8E+11 2.2E+10 4.9E+09Oatp3a1 1.4E+08 9.1E+07 2.3E+06 6.7E+07 1.3E+08 2.8E+07 7.5E+07Oatp3a2 1.9E+05 3.9E+03 2.0E+02 4.9E+02 1.5E+03 1.4E+03 1.8E+03Oatp5a2 2.6E+05 7.4E+03 5.0E+03 2.9E+03 1.7E+05 8.2E+04 1.9E+04

333M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

(5.6×1011 copies/μg). As previously mentioned, we should take intoaccount that absolute copy numbers of Oatp2b1 in all tissues mightbe overestimated due to the very high value of standard interceptin comparison to the other genes (Table 1). Therefore, in the caseof Oatp2b1 it might be more informative to consider its relativeexpression within each tissue given in Fig. 3A–G. From these data weconclude that Oatp2b1 is indeed dominant Oatp gene in gills, whichcorresponds to the absolute quantification data. Despite mentionedinconsistencies, when combining both quantification methods we canconclude that Oatp2b1 is ubiquitously highly expressed across alltissues.

Within the Oatp3 family, Oatp3a1 shows ubiquitous and highexpression (from 2.3×106 copies/μg in liver to 1.3×108 and 1.4×108

copies/μg in kidney and brain respectively), while the expression ofother Oatp3a member, Oatp3a2, is lower with maximal expression inthe brain (1.9×105 copies/μg). According to the relative quantifica-tion, its expression level in brain is even higher then expression of itsco-ortholog DrOatp3a1 (Fig 3A), while absolute copy numbers areprobably underestimated due to the comparatively lower standardcurve intercept (Table 1).

Finally, Oatp5a2 is moderately expressed in all tissues, withmaximum expression in brain (2.6×105 copies/µg) and kidney(1.7×105 copies/μg) (Table 3).

In the case of Oatp1c1 and Oatp4a1, four primer pairs were testedacross studied tissues for each gene, but none showed any expression.Therefore, we conclude that those two genes, although present inzebrafish genome (Fig 1), are not constitutively expressed in any ofthe analysed tissues.

4. Discussion

Data showed in this study represents the first comprehensiveanalysis of the presence and expression of SLCO transporters inzebrafish. In addition to previously annotated Oatp1c1, 2a1, 3a1 and4a1 (Meier-Abt et al., 2005), we have identified and classified 10 newzebrafish Oatp genes (Fig. 1A). Membrane topology analysis revealedthat zebrafish Oatps most probably have 12 TMDs. Similar topologyhas already been predicted for mammalian Oatps (Hagenbuch andMeier, 2004) and Oatp1d1 in little skate (Cai et al., 2002) and has beenproven in the case of rat Oatp1a1 Wang et al. (2008). Furthermore,topology prediction showed that organization of TMDs and LPs ishighly conserved throughout the whole vertebrate lineage, and notjust within mammals as previously reported (reviewed in Hagenbuchand Gui (2008)). However, further studies and experimental evidenceare necessary to confirm the predicted topology of zebrafish Oatps.As expected, conserved motifs specific for Oatp superfamily wereidentified in zebrafish Oatps as well. These include superfamily sig-nature, large extracellular loop 5 with 10 conserved Cysteines andKazal SLC21 domain. The function of these motifs (with the exceptionof Cysteine residues that have been studied (Hanggi et al., 2006)) ismostly unknown and remains to be determined (Kawaji et al., 2002;

Hagenbuch and Gui, 2008). In summary, our membrane topologyanalysis showed that all mentioned motifs are conserved not justwithin mammals, but also within vertebrate and invertebratelineages.

Most importantly, results of our phylogenetic and tissue distribu-tion analysis clearly indicate that zebrafish Oatp1 family is consider-ably different from Oatp1 family in other vertebrates. The maindifference is the fact that within the zebrafish genome no orthologs ofOatp1a and 1b subfamily members can be found. In human, OATP1Afamily members are expressed in various tissues and transport a widerange of compounds, including numerous physiological substrates(e.g., bile salts, thyroxine, estrone-3-sulfate) and xenobiotics (e.g.,methotrexate, fexofenadine, microcystin) (Hagenbuch and Gui,2008). Unlike Oatp1a, 1b members (mouse Oatp1b2 and humanOATP1B1 and 1B3) are expressed predominantly in liver, where theyare involved in elimination of toxic compounds from the blood(Hagenbuch and Meier, 2003). Phylogenetically closest to Oatp1a and1b are zebrafish Oatp1d1 and 1e1 (Fig. 1A), despite the fact that theyform a distinct cluster and share low amino acid sequence identitywith mammalian Oatp1a and Oatp1b subfamily members (Fig 1A).Although Oatp1d1 is phylogenetically closer to Oatp1b members,its ubiquitous and high expression levels are more similar to themammalian Oatp1a subfamily, in particular to the mouse Oatp1a4(Cheng et al., 2005). Given the similarity in expression pattern toOatp1a family, it is possible that, Oatp1d1 is involved in the transportof similar physiological substrates as OATP1A2. However, Oatp1d1showed the highest expression in liver, where it is dominant SLCOtransporter and the only Oatp1 subfamily member expressed inzebrafish liver. Since it is known that another Oatp1d family member,Oatp1d1 in little skate, is a liver specific transporter responsible foruptake of phalloidin and mycrocystin (Meier-Abt et al., 2007), it ispossible that zebrafish Oatp1d1 is also involved in the uptake ofxenobiotics in the liver, along with the yet unknown physiologicalsubstrates.

The second newly identified member of Oatp1 family in zebrafish,Oatp1e1, shares the same phylogenetic relationshipwith other Oatps asdoes Oatp1d1, but exhibits comparatively lower expression in allanalysed tissues. Notable expression is detected only in brain. In themammalian brain, OATP1C1, OATP1A2 and OATP3A1 are major Oatpsthat are involved in the transport of thyroid hormones (Cheng et al.,2005; Nishimura and Naito, 2005). In zebrafish brain, Oatp1c1expressionwas not detected,while Oatp3a1 and Oatp3a2 (co-orthologsof human OATP3A1) are more than an order of magnitude moreexpressed than Oatp1e1. Consequently, our results indicate that besideOatp1d1, Oatp3a1 and/or Oatp3a2 may act as major thyroid hormonetransporters in the zebrafish brain, while Oatp1e1 is probably of lesserphysiological importance.

Zebrafish Oatp1f genes form a distinct cluster and show very highsequence identity between themselves, while at the same time theyshare low sequence identity in comparison to all other Oatps.Additionally, Oatp1f family was not found in pufferfishes, while its

334 M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

presence remains to be determined in other teleosts. Apart from thephylogenetic distance, the tissue distribution pattern of Oatp1f2 doesnot resemble any of the mammalian Oatps (Cheng et al., 2005;Nishimura and Naito, 2005). Zebrafish Oatp1f2 showed the highestexpression in kidney, followed by considerably lower expression inbrain and negligible expression in other tissues. When comparingrelative expression of Oatps in the mouse (Cheng et al., 2005) andhuman (Nishimura and Naito, 2005) kidney, the determined patternresemble that of zebrafish kidney (excluding Oatp1f family which isnot present in mammals). Despite some inconsistencies in quantifi-cation methods, Oatp1f2 appears to be highly expressed in kidney.

Zebrafish Oatp2a1 is phylogenetically closest to the other Oatp2asubfamily members, with ubiquitously high expression similar tohuman and mouse orthologs OATP2A1/Oatp2a1. Its relative tissue dis-tributionpattern corresponds to themouseOatp2a1,with the exceptionof comparatively higher expression in brain (Cheng et al., 2005).Considering mentioned similarities, zebrafish Oatp2a1 is possibly afunctional ortholog of a prostaglandin transporter OATP2A1.

Zebrafish Oatp2b1 shows ubiquitously high expression with tissueexpression pattern similar to mouse Oatp2b1 (Cheng et al., 2005) andmarkedly high expression in all tissues including liver. Given the factthat it is phylogenetically closest to OATP2B1/Oatp2b1 and sharessimilar expression profile, zebrafish Oatp2b1 is possibly a functionalortholog of OATP2B1, which is known to be involved in the absorptionand disposition of numerous endo- and xenobiotics, and is of primaryimportance for uptake of xenobiotics in human liver, along withOATP1B1 and 1B3 (Hagenbuch and Meier, 2003).

Our data revealed that Oatp3a family is most highly conservedamong the Oatp families (along with Oatp5a), not just in mammals aspreviously noted, but throughout the whole vertebrate lineage. Twoco-orthologs of human OATP3A1 are found within zebrafish genome.Zebrafish Oatp3a1 showed high sequence identity and similar tissuedistribution pattern with OATP3A1/Oatp3a1 (Cheng et al., 2005;Nishimura and Naito, 2005). Considering all mentioned it is possiblethat Oatp3a1 is a functional ortholog of OATP3A1 that is suggested tobe involved in the transport of thyroid hormones and/or neuron-active peptides in the brain and other tissues (Hagenbuch and Gui,2008). The other co-ortholog of OATP3A1, zebrafish Oatp3a2, showedquite different tissue distribution pattern in comparison to OATP3A1,mouse Oatp3a1 and zebrafish Oatp3a1. Considering its low expressionin all tissues except brain, it could possibly have similar function likeits co-ortholog zebrafish Oatp3a1.

Similar to the Oatp3a subfamily, zebrafish Oatp5a1 and Oatp5a2are probable co-orthologs of OATP5A1. Unfortunately, tissue distri-bution patterns of human and rodent OATP5A1/Oatp5a1 are stillunknown and our study is the first insight into the tissue expressionprofile of Oatp5 family members. We have found that Oatp5a2 isrelatively highly expressed across all zebrafish tissues. Given the factthat Oatp5a family is the most highly conserved within vertebratelineage (along with Oatp3 family), and that zebrafish Oatp5a2 isubiquitously highly expressed, DrOatp5a2 probably has an importantphysiological function that remains to be determined in furtherstudies.

In summary, we have resolved phylogenetic relationship withinOatp superfamily and offered an expression analysis of this importantfamily of uptake transporters in zebrafish. Physiological role ofdetermined Oatp members in fish remains highly speculative at thismoment. However, we believe the described data offer the first andnecessary base for further studies directed to the thorough molecularcharacterization of individual Oatps in the appropriate heterologousexpression systems. Furthermore, considering current gap in knowl-edge on ecotoxicological relevance of uptake transporters, this studyoffers the first insight into the subject. Out of 14 identified SLCO genes,the most likely candidates for further (eco)toxicological research onOatp-mediated xenobiotic uptake in fish appears to be Oatp1d1 andOatp2b1 in liver, and Oatp1f2 in kidney.

Acknowledgements

This work has been supported by the Ministry for Science andTechnology of the Republic of Croatia, Project Nos. 00981510 and 098-0982934-2745.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi: 10.1016/j.cbpa.2009.11.011.

References

Ballatori, N., Henson, J.H., Seward, D.J., Cai, S.Y., Runnegar, M., Fricker, G., Miller, D.S.,Boyer, J.L., 2006. Retention of structural and functional polarity in cultured skatehepatocytes undergoing in vitro morphogenesis. Comp. Biochem. Physiol. B.Biochem. Mol. Biol. 144, 167–179.

Bao, Y., Pucci, M.L., Chan, B.S., Lu, R., Ito, S., Schuster, V.L., 2002. Prostaglandintransporter PGT is expressed in cell types that synthesize and release prostanoids.Am. J. Physiol.-Renal. 282, F1103–F1110.

Boaru, D.A., Dragos, N., Schirmer, K., 2006. Microcystin-LR induced cellular effects inmammalian and fish primary hepatocyte cultures and cell lines: a comparativestudy. Toxicology 218, 134–148.

Boyer, J.L., Schwarz, J., Smith, N., 1976. Biliary secretion in elasmobranchs II. Hepaticuptake and biliary excretion of organic anions. Am. J. Physiol. 230, 974–981.

Boyer, J.L., Hagenbuch, B., Ananthanarayanan, M., Suchy, F., Stieger, B., Meier, P.J., 1993.Phylogenic and ontogenic expression of hepatocellular bile acid transport. Proc.Natl. Acad. Sci. U. S. A. 90, 435–438.

Briz, O., Romero, M.R., Martinez-Becerra, P., Macias, R.I.R., Perez, M.J., Jimenez, F., SanMartin, F.G., Marin, J.J.G., 2006. OATP8/1B3-mediated cotransport of bile acids andglutathione — an export pathway for organic anions from hepatocytes? J. Biol.Chem. 281, 30326–30335.

Cai, S.Y., Wang, W., Soroka, C.J., Ballatori, N., Boyer, J.L., 2002. An evolutionarily ancientOatp: insights into conserved functional domains of these proteins. Am. J. Physiol.Gastrointest. Liver. Physiol. 282, G702–710.

Cheng, X., Maher, J., Chen, C., Klaassen, C.D., 2005. Tissue distribution and ontogeny ofmouse organic anion transporting polypeptides (Oatps). Drug Metab. Dispos. 33,1062–1073.

Felsenstein, J., 1985. Confidence-limits on phylogenies — an approach using thebootstrap. Evolution 39, 783–791.

Fricker, G., Hugentobler, G., Meier, P.J., Kurz, G., Boyer, J.L., 1987. Identification of asingle sinusoidal bile salt uptake system in skate liver. Am. J. Physiol. 253,G816–822.

Fricker, G., Dubost, V., Finsterwald, K., Boyer, J.L., 1994. Characteristics of bile salt uptakeinto skate hepatocytes. Biochem. J. 299, 665–670.

Fujiwara, K., Adachi, H., Nishio, T., Unno, M., Tokui, T., Okabe, M., Onogawa, T., Suzuki, T.,Asano, N., Tanemoto, M., Seki, M., Shiiba, K., Suzuki, M., Kondo, Y., Nunoki, K.,Shimosegawa, T., Iinuma, K., Ito, S., Matsuno, S., Abe, T., 2001. Identification ofthyroid hormone transporters in humans: different molecules are involved in atissue-specific manner. Endocrinology 142, 2005–2012.

Hagenbuch, B., Meier, P.J., 2003. The superfamily of organic anion transportingpolypeptides. BBA Biomembranes 1609, 1–18.

Hagenbuch, B., Meier, P.J., 2004. Organic anion transporting polypeptides of the OATP/SLC21 family: phylogenetic classification as OATP/SLCO superfamily, new nomen-clature and molecular/functional properties. Pflugers Arch. 447, 653–665.

Hagenbuch, B., Gui, C., 2008. Xenobiotic transporters of the human organic aniontransporting polypeptides (OATP) family. Xenobiotica 38, 778–801.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98.

Hanggi, E., Grundschober, A.F., Leuthold, S., Meier, P.J., St-Pierre, M.V., 2006. Functionalanalysis of the extracellular cysteinee residues in the human organic aniontransporting polypeptide, OATP2B1. Mol. Pharmacol. 70, 806–817.

Higgins, D.G., Sharp, P.M., 1988. CLUSTAL: a package for performing multiple sequencealignment on a microcomputer. Gene 73, 237–244.

Hsiang, B.N., Zhu, Y.J., Wang, Z.Q., Wu, Y.L., Sasseville, V., Yang, W.P., Kirchgessner, T.G.,1999. A novel human hepatic organic anion transporting polypeptide (OATP2) —identification of a liver-specific human organic anion transporting polypeptide andidentification of rat and human hydroxymethylglutaryl-CoA reductase inhibitortransporters. J. Biol. Chem. 274, 37161–37168.

Huber, R.D., Gao, B., Pfandler, M.A.S., Zhang-Fu, W.T., Leuthold, S., Hagenbuch, B.,Folkers, G., Meier, P.J., Stieger, B., 2007. Characterization of two splice variants ofhuman organic anion transporting polypeptide 3A1 isolated from human brain.Am. J. Physiol.—Cell. Physiol. 292, C795–C806.

Hugentobler, G., Fricker, G., Boyer, J.L., Meier, P.J., 1987. Anion transport in basolateral(sinusoidal) liver plasma-membrane vesicles of the little skate (Raja erinacea).Biochemical J. 247, 589–595.

Kawaji, H., Schonbach, C., Matsuo, Y., Kawai, J., Okazaki, Y., Hayashizaki, Y., Matsuda, H.,2002. Exploration of novel motifs derived from mouse cDNA sequences. GenomeRes. 12, 367–378.

Kindla, J., Fromm, M.F., König, J., 2009. In vitro evidence for the role of OATP and OCTuptake transporters in drug–drug interactions. Exp. Opin. Drug Metab. Toxicol. 5,489–500.

335M. Popovic et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 327–335

Konig, J., Cui, Y.H., Nies, A.T., Keppler, D., 2000. Localization and genomic organization ofa new hepatocellular organic anion transporting polypeptide. J. Biol. Chem. 275,23161–23168.

Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecularevolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5,150–163.

Lee, S.Y.,Williamson, B., Caballero, O.L., Chen, Y.T., Scanlan,M.J., Ritter, G., Jongeneel, C.V.,Simpson, A.J., Old, L.J., 2004. Identification of the gonad-specific anion transporterSLCO6A1 as a cancer/testis (CT) antigen expressed in human lung cancer. CancerImmun. 4, 13.

Li, L.Q., Lee, T.K., Meier, P.J., Ballatori, N., 1998. Identification of glutathione as a drivingforce and leukotriene C-4 as a substrate for oatp1, the hepatic sinusoidal organicsolute transporter. J. Biol. Chem. 273, 16184–16191.

Li, L.Q., Meier, P.J., Ballatori, N., 2000. Oatp2 mediates bidirectional organic solutetransport: A role for intracellular glutathione. Mol. Pharmacol. 58, 335–340.

Lu, R., Kanai, N., Bao, Y., Schuster, V.L., 1996. Cloning, in vitro expression, and tissuedistribution of a human prostaglandin transporter cDNA (hPGT). J. Clin. Invest. 98,1142–1149.

Mahagita, C., Grassl, S.M., Piyachaturawat, P., Ballatori, N., 2007. Human organic aniontransporter 1B1 and 1B3 function as bidirectional carriers and do not mediate GSH–bile acid cotransport. Am. J. Physiol. 293, G271–G278.

Meier-Abt, F., Mokrab, Y., Mizuguchi, K., 2005. Organic anion transporting polypeptidesof the OATP/SLCO superfamily: identification of new members in nonmammalianspecies, comparative modeling and a potential transport mode. J. Membr. Biol. 208,213–227.

Meier-Abt, F., Hammann-Hanni, A., Stieger, B., Ballatori, N., Boyer, J.L., 2007. The organicanion transport polypeptide 1d1 (Oatp1d1) mediates hepatocellular uptake ofphalloidin andmicrocystin into skate liver. Toxicol. Appl. Pharmacol. 218, 274–279.

Mikkaichi, T., Suzuki, T., Onogawa, T., Tanemoto, M., Mizutamari, H., Okada, M., Chaki,T., Masuda, S., Tokui, T., Eto, N., Abe, M., Satoh, F., Unno, M., Hishinuma, T., Inui, K.-I.,Ito, S., Goto, J., Abe, T., 2004. Isolation and characterization of a digoxin transporterand its rat homologue expressed in the kidney. Proc. Natl. Acad. Sci. USA 101,3569–3574.

Mulenga, M., Khumthong, R., Chalaire, K.C., Strey, O., Teel, P., 2008. Molecular andbiological characterization of the Amblyomma americanum organic aniontransporter polypeptide. J. Exp. Biol. 211, 3401–3408.

Muller, P.Y., Janovjak, H., Miserez, A.R., Dobbie, Z., 2002. Processing of gene expressiondata generated by quantitative real-time RT-PCR. BioTechniques 32, 1372–1379.

Nakao, N., Takagi, T., Iigo, M., Tsukamoto, T., Yasuo, S., Masuda, T., Yanagisawa, T.,Ebihara, S., Yoshimura, T., 2006. Possible involvement of organic anion transportingpolypeptide 1c1 in the photoperiodic response of gonads in birds. Endocrinology147, 1067–1073.

Nishimura, M., Naito, S., 2005. Tissue-specific mRNA expression profiles of human ATP-binding cassette and solute carrier transporter superfamilies. Drug. Metab.Pharmacokinet. 20, 452–477.

Noe, J., Portmann, R., Brun, M.E., Funk, C., 2007. Substrate-dependent drug–druginteractions between gemfibrozil, fluvastatin and other organic anion-transportingpeptide (OATP) substrates on OATP1B1, OATP2B1, and OATP1B3. Drug. Metab.Dispos. 35, 1308–1314.

Pizzagalli, F., Hagenbuch, B., Stieger, B., Klenk, U., Folkers, G., Meier, P.J., 2002.Identification of a novel human organic anion transporting polypeptide as a highaffinity thyroxine transporter. Mol. Endocrinol. 16, 2283–2296.

Rabergh, C.M., Ziegler, K., Isomaa, B., Lipsky, M.M., Eriksson, J.E., 1994. Uptake oftaurocholic acid and cholic acid in isolated hepatocytes from rainbow trout. Am. J.Physiol. 267, G380–386.

Reed, J.S., Smith, N.D., Boyer, J.L., 1982. Hemodynamic effects on oxygen consumptionand bile flow in isolated skate liver. Am. J. Physiol. 242, G313–318.

Satlin, L.M., Amin, V., Wolkoff, A.W., 1997. Organic anion transporting polypeptidemediates organic anion/HCO3-exchange. J. Biol. Chem. 272, 26340–26345.

Simon, P., 2003. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics19, 1439–1440.

Smith, N.F., Figg, W.D., Sparreboom, A., 2005. Role of the liver-specific transportersOATP1B1 and OATP1B3 in governing drug elimination. Expert Opin. Drug Metab.Toxicol. 1, 429–445.

Suzuki, T., Onogawa, T., Asano, N., Mizutamari, H., Mikkaichi, T., Tanemoto, M., Abe, M.,Satoh, F., Unno, M., Nunoki, K., Nunoki, K., Suzuki, M., Hishinuma, T., Goto, J.,Shimosegawa, T., Matsuno, S., Ito, S., Abe, T., 2003. Identification and character-ization of novel rat and human gonad-specific organic anion transporters. Mol.Endocrinol. 17, 1203–1215.

Tamai, I., Nezu, J., Uchino, H., Sai, Y., Oku, A., Shimane, M., Tsuji, A., 2000. Molecularidentification and characterization of novel members of the human organic aniontransporter (OATP) family. Biochem. Bioph. Res. Co. 273, 251–260.

Tamai, I., Nozawa, T., Koshida, M., Nezu, J., Sai, Y., Tsuji, A., 2001. Functionalcharacterization of human organic anion transporting polypeptide B (OATP-B) incomparison with liver-specific OATP-C. Pharm. Res. 18, 1262–1269.

Tusnady, G.E., Simon, I., 2001. The HMMTOP transmembrane topology predictionserver. Bioinformatics 17, 849–850.

Wang, P., Hata, S., Xiao, Y., Murray, J.W., Wolkoff, A.W., 2008. Topological assessment ofoatp1a1: A 12-transmembrane domain integral membrane protein with three N-linked carbohydrate chains. Am. J. Physiol. 294, G1052–G1059.

Web references

The National Center of Biotechnology Information (NCBI). Available at http://www.ncbi.nlm.nih.gov/ (July 2009).

ENSEMBL gene database. Available at http://www.ensembl.org/index.html (July 2009).