organellar signaling expands plant phenotypic variation
TRANSCRIPT
University of Nebraska - Lincoln University of Nebraska - Lincoln
DigitalCommons@University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln
Theses, Dissertations, and Student Research in Agronomy and Horticulture Agronomy and Horticulture Department
10-2012
Organellar Signaling Expands Plant Phenotypic Variation and Organellar Signaling Expands Plant Phenotypic Variation and
Increases the Potential for Breeding the Epigenome Increases the Potential for Breeding the Epigenome
Roberto De la Rosa Santamaria University of Nebraska-Lincoln
Follow this and additional works at: https://digitalcommons.unl.edu/agronhortdiss
Part of the Agriculture Commons, and the Genetics Commons
De la Rosa Santamaria, Roberto, "Organellar Signaling Expands Plant Phenotypic Variation and Increases the Potential for Breeding the Epigenome" (2012). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 57. https://digitalcommons.unl.edu/agronhortdiss/57
This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln.
ORGANELLAR SIGNALING EXPANDS PLANT PHENOTYPIC VARIATION AND
INCREASES THE POTENTIAL FOR BREEDING THE EPIGENOME
By
Roberto De la Rosa Santamaria
A DISSERTATION
Presented to the Faculty of
The Graduate College at the University of Nebraska
In Partial Fulfillment of Requirements
For the Degree of Doctor of Philosophy
Major: Agronomy
(Plant Breeding and Genetics)
Under the Supervision of Professor Sally A. Mackenzie
Lincoln, Nebraska
October, 2012
ORGANELLAR SIGNALING EXPANDS PLANT PHENOTYPIC VARIATION AND
INCREASES THE POTENTIAL FOR BREEDING THE EPIGENOME
Roberto De la Rosa Santamaria, Ph.D.
University of Nebraska, 2012
Adviser: Sally A. Mackenzie
MUTS HOMOLOGUE 1 (MSH1) is a nuclear gene unique to plants that functions
in mitochondria and plastids, where it confers genome stability. Phenotypic
effects of MSH1 down- regulation were studied in sorghum inbreed line Tx430
and Arabidopsis ecotype Columbia-0, with the hypothesis that RNAi suppression
of MSH1 triggers retrograde signaling from organelles to the nucleus, alters the
epigenome, and derives heritable phenotypic variation suitable for artificial
selection. An array of morphological traits and metabolic pathways was detected,
including leaf variegation, male sterility and dwarfism, associated with altered
gibberellic acid metabolism, higher levels of reactive oxygen species (ROS), and
decreased synthesis of ATP. A phenotype that combines dwarf, increased
branching, reduced stomatal density and delayed flowering was identified, and
designated developmental reprogrammed (MSH1-dr). Reproducible in additional
plant species, this phenotypic variation is partially reversed by exogenous GA. In
sorghum, the phenotype displays complete penetrance under self-pollination,
even after segregation of the transgene, whereas progeny of MSH1-dr transgene
null plants x wildtype Tx430 display enhanced growth. Significant differences for
agronomic traits and response to selection were observed in the tested F2 to F4
generations, with mean values that surpass the wildtype up to 70% for grain
yield/panicle and plant height, and 100% for biomass yield/plant. SSR marker
analyses among the parental phenotypes Tx430 and MSH1-dr transgene null,
and their derived lines, show no polymorphism, suggesting that the observed
changes are non-genetic. In Arabidopsis, this enhanced growth is accompanied
by genome methylation changes, whereas genetic hemi-complementation
indicates that the novel phenotype results from chloroplast disruption.
4
Dedication
I want to dedicate this Thesis to my wife Rosalba, and our kids Roberto Edwin
and Shadid Fernanda, because of the love they have shared with me and
inspired on me to pursue new goals that alone I never would have reached. I am
convinced that beside a great man there is a great woman, and a great family.
I also dedicate this to my parents: Liborio Apolinar De la Rosa and Elvira
Santamaria; he just gave me my first lessons about agriculture and practical
plant breeding, while she just took care of all of the family; both have taught to
me that family is the cornerstone for every success in life.
For my parents in law Dolores Hernandez and Ismael Montiel (RIP), and sisters
in law Esthela and Elizabeth Montiel, who have been always there
unconditionally sharing successes and challenges.
For my brothers and sister: Pedro, Dionisio, Francisco, Ernesto, Gorgonio (RIP)
Reynaldo, Maria del Rocio, and Oscar; for my nieces and nephews.
5
Acknowledgements
I want to express my sincere gratitude to my adviser Dr. Sally A. Mackenzie,
whose support was determinant for me to reach this goal. Among other things,
she taught to me how to write, and encouraged me to see what Mother Nature
says through biological phenomena.
I thank sincerely the members of my supervisory committee, Drs.: Ismail
Dweikat, David Holding, Alan Christensen, and Tom Hoegemeyer for their
important suggestions and teaching during my academic program.
I am express my gratitude to Dr. John Rajewski, for his support during the
development of field experiments, to Osval Montesinos, for his help in the
statistical analyses, and to Victoria Lozano, for her logistical help.
I thank former and current members of Mackenzie Lab: Maria, Vikas, Jaime,
Wilson, Ajay, Saleem, Xue hui, Yashi, Ying Zhi, Fareha, Peibei, Geetanjali,
Kamaldeep, Ido, Ray, Omar, and Hardik; in different ways, everyone helped me
to be successful in this endeavor.
I thank Amy Hilske and Samantha Link for their careful attention of the plant
material used in greenhouse experiments, and the administrative staff of the
Center for Plant Science Innovation: Barb, Holly, Teresa, Lisa, Laurie, and Tracy.
I also thank Colegio de Postgraduados Mexico, the Fulbright program, and the
National Science Foundation for the sponsorship I received during these doctoral
studies; the latter through the program of my academic adviser.
6
Table of Contents
Abstract…………………………………………………………………………... 2
Dedication……………………………………………………………………….. 4
Acknowledgements……………………………………………………………. 5
Table of Contents………………………………………………………………. 6
List of Figures……………………….………………………………………….. 10
List of Tables……………………………………………………………………. 12
Chapter 1…………………………………………………………………………. 14
Literature Review.…………………………………………………………
• Introduction…………………………………………………………
14
14
• Nuclear and organellar plant genome interactions: how they
relate to the epigenome to effect plant phenotypy……………..
14
• The nuclear gene MSH1 and plant organelle interactions…… 17
• The nature of MSH1-associated mitochondrial genome
recombination……………………………………………………...
19
• MSH1 RNAi down-regulation and plant phenotypic plasticity... 20
• Genetic and epigenetic variation………………………………... 22
• The model plants to be used in this study……………….……..
Arabidopsis…………………………………………………………
Sorghum……………………………………………………………
23
23
24
• Rationale for epigenetic crop breeding………………………… 26
• References……………………………………………………….. 27
7
Chapter 2…………………………………………………………………………. 34
Chloroplast-mediated plant developmental reprogramming as a
result of MUTS HOMOLOG1 suppression…………………………….
34
Abstract…………………………………………………………… 34
Introduction……………………………………………………….. 35
Methods…………………………………………………………… 36
• Plant materials and growth conditions………………… 36
• Microscopy……………………………………………….. 39
• RNA Isolation and Real-Time PCR Analysis ………… 40
• Small RNA analysis…………………..…………………. 40
• Genomic DNA methylation assay……………………… 41
• Metabolite Analysis……………………………………… 41
Results……………………………………………………………. 43
• MSH1 suppression induces similar phenotypic
changes in sorghum as in other plant species…………
43
• Phenotypic variants induced in sorghum by MSH1
RNAi suppression are heritable…………………………
43
• Gibberellic acid partially restores the altered
phenotype, with significant interaction between GA
dosage and the RNAi transgene……………………….
44
• The MSH1-dr phenotype in transgene-null lines
displays enhanced growth following crosses with
wildtype……………………………………………………
46
8
• Fertility restoration occurs with wildtype pollen or in
CMS MSH1-RNAi lines following segregation of the
transgene…………………………………………………..
47
• Different metabolic pathways are altered by MSH1
suppression……………………………………………….
48
• Chloroplast changes are responsible for the MSH1-dr
phenotype…………………………………………………
50
Discussion………………………………………………………… 51
References………………………………………………………. 55
Chapter 3………………………………………………………………………… 71
Organelle perturbation alters the epigenome to produce dramatic
and heritable changes in plant growth………………………………….
71
Abstract…………………………………………………………… 71
Introduction……………………………………………………….. 73
Materials and methods………………………………………...... 76
• Plant materials……..…………………………………….. 76
• Field experiments………………………………………… 77
• Phenotypic traits…………………………………………. 78
• Statistical analyses……………………………………… 78
• Genotyping MSH1-dr plants……………………………. 79
• SSR marker screening …………………………………. 80
Results……………………………………………………………. 80
• The MSH1-dr sorghum phenotype is fully penetrant
9
under self-pollination, and derives enhanced growth
in crosses to wildtype, with expanded phenotypic
variation…………………………………………………..
80
• Derived epi-lines show enhanced growth for
agronomic traits with significant environmental
interaction effects…………………………………………
81
• Enhanced growth is also observed in derived
progenies of msh1 mutant x wildtype Arabidopsis…....
82
• The phenotypic traits are responsive to selection….… 84
• MSH1-dr and derived epi-lines are not polymorphic
compared to wildtype……………………….……………
84
Discussion………………………………………………………… 85
References………………………………………………………... 88
Conclusion…………………………………………………………………….. 103
10
List of Figures
Figure 2.1. Plant height distribution in a T3 MSH1 RNAi sorghum
population………………………………………………………………….
58
Figure 2.2. Plant height response to gibberellic acid (GA) in MSH1-dr
sorghum seedlings………………………………….…………………..
58
Figure 2.3. Plant height restoration by exogenous GA in MSH1-dr
sorghum.............................................................................................
59
Figure 2.4. Reversal of the MSH1-RNAi phenotype and enhanced growth
by crossing in sorghum…………………………………………………
59
Figure 2.5. Transcriptional and metabolic changes in Arabidopsis msh1
mutant and hemi-complementation lines……………………………..
60
Figure 2.6. MSH1 methylation and gene expression………………………… 61
Figure 2.7. PCR products of T3 sorghum plants displaying the MSH1-dr
phenotype.........................................................................................
62
Figure 3.1. Deriving MSH1-epiF2 populations of sorghum and
Arabidopsis……………………………………………………………..…
92
Figure 3.2. Enhanced growth phenotype of MSH1-dr-epi-lines of
sorghum……………………………………………………………………
92
Figure 3.3. Plant height distribution in F2 sorghum epi-lines……..…………. 93
Figure 3.4. Grain yield of F2 MSH1-dr epi-lines grown in two field
environments…………………………………………………………….
93
Figure 3.5. MSH1-epi enhanced growth in F2 Arabidopsis………………….. 94
Figure 3.6. Evidence of enhanced growth in F4 Arabidopsis……………….. 95
11
Figure 3.7. Grain yield is responsive to selection in derived MSH1-dr
sorghum epi-lines………………………………………………….........
95
Figure 3.8. MSH1-dr epi-lines selected for low grain………………………… 96
Figure 3. 9. Sample SSR marker analysis of sorghum genomic DNA…….. 96
12
List of Tables
Table 2.1. Phenotypic traits of T3 MSH1-RNAi progenies and wildtype
(TX430) sorghum…….………………………………………………
63
Table 2.2. Frequency of MSH1-dr sorghum plants arising in T3 families 63
Table 2.3. Inheritance of the dwarf phenotype in T3, T4 and T5
generations…………………………………………………………...
64
Table 2.4. Comparison of phenotypic traits between T4 MSH1-dr and
wildtype sorghum…………………………………………………….
64
Table 2.5. Stomatal number in sorghum non transgenic MSH1-dr and
wildtype sorghum…………………………………………………….
65
Table 2.6. Plant height (PH) response to GA in MSH1-dr sorghum
seedlings……………………………………………………………...
65
Table 2.7. GA effect on traits of MSH1-dr sorghum progenies………… 65
Table 2.8. Plant height of the F1 progeny between sorghum MSH1-dr
x Tx430……………………………………………………………….
66
Table 2.9. Plant height in the F1 of reciprocal crosses (RC) of sorghum
TX430 x MSH1-dr……………………………………………………
66
Table 2.10. Plant height of the F1 between non dwarf male sterile
sorghum MSH1(-) or MSH1(+) x Tx430…………………………..
67
Table 2.11. Plant height of individual F1 progenies between non dwarf
male sterile sorghum MSH1(-) x Tx430………………………….
67
Table 2.12. Plant height of F1 between MSH1-dr transgenic sorghum
pollinated by wildtype………………………………………………..
67
13
Table 2.13.Fertility restoration in crosses of male sterile T3 sorghum
plants………………………………………………………………….
68
Table 2.14. Arabidopsis gene expression changes associated with
altered phenotypes………………………………………………….
68
Table 2.15. Changes in GA content with loss of MSH1………………... 69
Table 2.16. Metabolite changes in Arabidopsis msh1 and sorghum
MSH1-RNAi plants…………………………………………………..
69
Table 2.17. Primers used in quantitative PCR and hybridization
assays…………………………………………………………..…….
70
Table 3.1.Variance comparison of F2 sorghum MSH1-dr epi-lines and
wildtype……………………………………………………………….
97
Table 3.2. Frequency of the MSH1-dr phenotype epi-F3 families……… 98
Table 3.3. Mean value samples of agronomic traits in three
generations of MSH1 epi-lines…………………………………….
99
Table 3.4. Phenotypic data from Arabidopsis F2 families derived by
crossing hemi-complementation lines x Col-0 wild type ……......
100
Table 3.5. SSR marker polymorphism output in sorghum……………… 101
14
Chapter 1
Literature Review
I. Introduction
Nuclear and organellar plant genome interactions: how they relate to the
epigenome to effect plant phenotypy. The plant genome is compartmentalized
in the nucleus, mitochondria and plastids; however, the interactive effects of
these genetic components on plant phenotype are not well elucidated. Although
genetic variation has been documented as the main factor determining
phenotypic variation in higher organisms (Hochholdinger and Hoecker, 2007;
Springer and Stupar, 2007; Becker et al. 2011), there is accumulating evidence
that organellar effects influence plant phenotype (Martinez-Zapater et al. 1992;
Sandhu et al. 2007; Yu et al. 2007; Shedge et al. 2010), supporting the proposed
mechanism of retrograde signaling (Liu and Butow, 2006; Rhoades et al. 2006;
Dietzel et al. 2009). In other words, while nuclear genes control most organellar
gene expression, retrograde signaling from the organelles influences the
expression of nuclear genes under normal or stressful conditions (Nott et al.
2006; Butow and Avadhani, 2004). Aspects of environmental signaling have
been proven to be heritable and epigenetic in their control (Nightingale et al.
2006; Skinner et al. 2010; Wallace and Fan, 2010), and an emerging question is
how retrograde signaling might modify the cellular epigenetic status and, in turn,
influence phenotypic variation.
15
Retrograde signaling is a cellular means of communication to indicate
organellar proteome status, influencing physiological cascades and acclimation
to the environment (Liu and Butow, 2006; Rhoades and Subbaiah, 2007; Dietzel
et al. 2009). The phenomenon is also referred to as retrograde regulation or
retrograde stress signaling (Liu and Butow, 2006), and it has been documented
in yeast, Saccharomyces cereviseae (Liu and Butow, 2006), mammals (Butow
and Avadhani, 2004), and plants (Rhoades and Subbaiah, 2007); in plants, the
mechanism involves both mitochondria and chloroplasts (Nott et al. 2006;
Rhoades and Subbaiah, 2007; Ruckle et al. 2007).
Mitochondrial retrograde regulation (mtRR) is mainly detected during the
synthesis of ATP, which is the product of oxidative phosphorylation (Mackenzie
and McIntosh, 1999; Kucej and Butow, 2007). In this process, mtDNA encodes
essential components coupled with the electron transport chain (ETC) (Burger et
al. 2003; Liu and Butow, 2006) driving the synthesis of reactive oxygen species
(ROS) (Rhoades et al. 2006), whose increased levels induce changes in nuclear
gene expression such as the alternative oxidation pathway (AOX) (Vanlerberghe
and McIntosh 1997; Van Aken et al. 2009). mtRR also involves factors that
detect and transmit mitochondrial signals to the nucleus effecting the expression
of genes related to glutamate biosynthesis, nitrogen metabolism, and the
activation of the cytochrome c oxidase (COX) (Liu and Butow, 2006);
modifications of these pathways can be accompanied by mitochondrial
dysfunction, with negative effects on mitochondrial DNA maintenance (Liu and
Butow, 2006) and chloroplast development (Gu et al. 1993).
16
Chloroplast retrograde regulation (cRR) occurs mainly during the
synthesis of photosynthetic enzymes, since plastid gene expression depends on
nuclear encoded factors in response to developmental processes or
environmental signals (Barkan and Goldschmidt-Clermont, 2000). In this context,
two elements that have been postulated to influence nuclear gene expression are
the chlorophyll precursors Mg-protoporphyrin IX and Mg-Protoporphyrin IX-
methylesters (Mg-ProtoIXme) (Nott et al. 2006); in addition, chloroplast signaling
is influenced by redox state of the photosynthetic electron transport (PET) chain,
NADPH and ATP synthesis, carbon intake, and photorespiration (Nott et al.
2006; Atkin and Maréchal, 2009). Since photochemical reactions in chloroplasts
also generate ROS, different reactive oxygen intermediates are derived as
partially reduced forms of atmospheric oxygen (O2); then, singlet oxygen (O21),
superoxide radical (O2-), hydrogen peroxide (H2O2), or hydroxyl radical (HO-)
become important retrograde signaling molecules (Mittler, 2002) that participate
in the regulation of downstream elements, and in the integration of chloroplast
biogenesis with environmental light and development (Nott et al. 2006; Ruckle et
al. 2007; Ruckle et al. 2012). Traditionally, ROS have been considered as toxic
molecules; however, current evidence indicates that they are produced steadily
by plants to control processes such as programmed cell death, response to
abiotic stress, biotic defense, and signaling (Mittler, 2002); consequently, plants
create an equilibrium between these signaling molecules and the detoxification
process when they over accumulate, being the main ROS scavengers
17
superoxide dismutase, ascorbate peroxidase, catalase, glutathione peroxidase,
α-tocoferol, and carotenoids (Mittler, 2002).
Besides the progress to understand different metabolic pathways driven
by retrograde regulation, there is evidence that these genome interactions modify
morphological traits in plants. In different plant species, mitochondrial dysfunction
or mitochondrial genome recombination has been associated with male sterility
(Martinez-Zapater et al. 1992; Gu et al. 2003; Sandhu et al. 2007; Arrieta-Montiel
and Mackenzie, 2011) and reduced growth and heat tolerance (Sedge et al.
2010). Chloroplast perturbation has also been associated with dwarfism, altered
leaf morphology, delayed flowering and leaf variegation in Arabidopsis (Redei,
1975; Maréchal et al. 2009; Xu et al. 2011). In fact, an array of phenotypic traits
modified by altered plastid development in monocots and dicots includes reduced
growth rate, increased GA catabolism, delayed flowering, extension of juvenility,
reduced stomatal density, secondary growth, and increased branching (Xu et al.
2012). It remains unclear how organellar effects can influence expansion of plant
phenotypic variation, as a result of retrograde regulation, and whether this
process can be exploited in plant breeding systems.
The nuclear gene MSH1 and plant organelle interactions
MUTS HOMOLOG1 (MSH1) is a nuclear gene unique to plants, which
participates in recombination surveillance in plant mitochondrial and chloroplast
genomes (Abdelnoor et al. 2003; Shedge et al. 2007; Arrieta-Montiel et al. 2009;
Xu et al. 2011). Loss of MSH1 expression results in enhanced mitochondrial
18
recombination activity by asymmetric strand invasion (Davila et al. 2010), and
altered plastid development that is associated with leaf variegation (Xu et al.
2011). Other targeted genes known to contribute to mitochondrial and/or
chloroplast genome stability include mitochondrial-targeted OSB1 (Zaegel et al.
2006) and RecA3 (Shedge et al. 2007; Rowan et al. 2010), as well as the genes
encoding whirly proteins WHY1, WHY2, and WHY3. WHY1 and WHY3 are
targeted to plastids (Krause et al. 2005; Maréchal et al. 2008; Maréchal et al.
2009), whereas WHY2 is targeted to mitochondria (Krause et al. 2005; Maréchal
et al. 2008). Among them, MSH1 appears to play a distinctive role in organellar
genome maintenance together with retrograde regulation.
Originally designated Chloroplast Mutator (CHM) and re-named AtMSH1
following its cloning and identification from Arabidopsis (Redei and Plurad, 1973;
Abdelnoor et al. 2003), MSH1 is a homolog of Escherichia coli MutS, which is
involved in mismatch repair during DNA replication (Redei and Plurad, 1973;
Reenan and Kolodner, 1992; Abdelnoor et al. 2003). The plant form of the gene
displays unique protein characteristics that have likely influenced its functions
relative to other MutS homologues from other eukaryotes (Abdelnoor et al. 2006).
The coding region of MSH1 in different plant species is around 3.3 kb,
although the overall genomic size varies from 6.3 kb in Arabidopsis (Abdelnoor et
al. 2006) to 39 kb in maize (G. Kandari, 2012, personal communication) due to
variability in intron sequence and size (Abdenoor et al. 2006). It contains 22
exons distributed in six domains, with Domains I, V and VI thought to be involved
in DNA binding, ATPase, and endonuclease functions, respectively (Abdelnoor et
19
al. 2006). Domain VI is a GIY-YIG homing endonuclease likely derived by gene
fusion in the evolution of the gene (Abdelnoor et al. 2006). Interestingly, an HNH
homing endonuclease also exists at the carboxy terminus of a mitochondrial
MutS homolog in soft corals, likely the result of convergent evolutionary
processes (Abdelnoor et al. 2006). In Arabidopsis, results of mutation or
disruption of Domain V and VI indicate these domains to be essential to gene
function (Martinez-Zapater et al. 1992; Sakamoto et al. 2003; Abdelnoor et al.
2006). For example, msh1 mutants display leaf variegation and cytoplasmic male
sterile (CMS) phenotypes that undergo maternal inheritance (Martinez-Zapater et
al. 1992; Abdelnoor et al. 2003; Sandhu et al. 2007).
The nature of MSH1-associated mitochondrial genome recombination
The plant mitochondrial genome is unusually recombinogenic, undergoing
DNA exchange at three types of repeated sequences (Arrieta-Montiel and
Mackenzie, 2011). Large homologous repeats, larger than 1 kb, undergo high
frequency reciprocal DNA exchange to produce a multipartite configuration as a
result of genome subdivision to equal parental and recombinant molecular forms
(Arrieta-Montiel and Mackenzie, 2011). Intermediate repeats of 50 to 500 bp
participate in low frequency asymmetric recombination; as a result, mitochondrial
DNA polymorphism and variation in relative molecular copy number are detected,
a phenomenon known as substoichiometric shifting (SSS) (Small et al. 1987;
Arrieta-Montiel et al. 2007; Arrieta-Montiel and Mackenzie, 2011). Small repeats,
4-25 bp in size, also participate in mitochondrial genome rearrangement via non-
20
homologous end joining (NHEJ), leading to the formation of sequence chimeras
(Small et al. 1987; Arrieta-Montiel et al. 2009).
In contrast to the plant mitochondrial genome, chloroplast genomes in
angiosperms are highly conserved in structure and gene sequence (Palmer,
1985), with four typical segments: a large region of single copy genes (LSC), a
small region of single copy genes (SSC), and two copies of an inverted repeat
that separate both single copies (Sugiura and Takeda, 2000); when
recombination occurs, it is generally restricted to the inverted repeat segments
(Palmer, 1983, 1985). Disruption of MSH1 in plants produces green-white
variegated sectors within which low frequency chloroplast illegitimate
recombination can be detected (Xu et al. 2011). Moreover, MSH1-GFP
transgenic fusion constructions show MSH1 chloroplast localization within
punctate structures thought to be nucleoids, further supporting a role for MSH1 in
chloroplast DNA binding (Xu et al. 2011).
MSH1 RNAi down-regulation and plant phenotypic plasticity
The properties and function of MSH1 have been studied by RNAi down-
regulation in different dicot and monocot plant species (Abdelnoor et al. 2006;
Sandhu et al. 2007; Shedge et al. 2007; Feng et al. 2008), in which novel and
common traits have been observed associated with organellar disruption. In
tobacco and tomato, the RNAi mediated suppression of MSH1 induced leaf
variegation and cytoplasmic male sterility, related to enhanced mitochondrial
recombination and altered plastid development (Maréchal et al. 2009; Sandhu et
21
al. 2007, Xu et al. 2011). However, in 20% of Arabidopsis msh1 mutants, and
20% of MSH1-RNAi transgenic lines, additional phenotypic plasticity is evident.
In Arabidopsis, short-day (10-hr day length) growth conditions produce enhanced
secondary growth, aerial rosettes and extended juvenility, delayed flowering,
reduced growth rate, enhanced branching and floral morphology alterations
(Shedge et al. 2010; Xu et al. 2012). The msh1 mutant also shows enhanced
high light tolerance (Xu et al. 2011) and thermo-tolerance in the msh1 recA3
double mutant (Shedge et al. 2010). In the monocots sorghum and pearl millet,
these novel developmental alterations include short internode length, dwarfism,
increased tillering, delayed flowering , male sterility, reduced stomatal density,
and altered GA metabolism as a consequence of MSH1 disruption (Feng, 2008;
Xu et al. 2012).
Although chloroplasts have been studied most extensively in
photosynthesis and metabolism, they also participate in pathways related to
stress response and signaling (Bouvier et al. 2009) and in the synthesis of other
organic compounds. This stress signaling includes the synthesis of molecules
like jasmonic acid, salicylic acid, gibberellins and carotenoids (Bouvier et al.
2009), and lipid biosynthesis and amino acid metabolism (Galili, 1995; Ohlrogge
and Browse, 1995). Chloroplast participation in the extensive developmental
reprogramming of phenotype in msh1 mutants was demonstrated by hemi-
complementation experiments, in which an MSH1 transgene construct containing
a chloroplast targeting sequence was able to complement the aberrant
22
phenotypes, when introduced to the mutant, whereas an MSH1 construct
containing a mitochondrial pre-sequence was not (Xu et al. 2012).
Genetic and epigenetic variation
Genetic variation is derived from structural or DNA sequence differences
represented by insertion-deletions (Indels), or single nucleotide polymorphisms
(SNPs) (Richards, 2006; Springer and Stupar, 2007; Johnson and Tricker, 2010).
Epigenetic effects, in contrast, refer to changes in gene expression that are not
related to changes in DNA sequence (Richards, 2006; Berger et al. 2009;
Eichten et al. 2011).
Major epigenetic modifications include DNA methylation, histone modification,
and RNA interference (Rutherford and Henikoff, 2003; Daxinger and Whitelaw,
2010; Johnson and Tricker, 2010). DNA methylation is the most studied, can be
stably inherited trans-generationally (Kakutani, 2002; Paszkowski and
Grossniklaus, 2011), and is one of the most important epigenetic factors that
regulate gene expression in nature (Richards, 2006; Chen, 2010). The
phenomenon relies on the methylation of cytosine residues in the following
environments: CG, CHG, or CHH, where H is any residue except G. Cytosine
methylation takes place within transposable elements, as well as in coding or
promoter regions, and may influence transposition activity (Zhang et al. 2006;
Becker et al. 2011; Schmitz et al. 2011).
In an epigenetic context, gene expression of hypermethylated genes
decreases, while hypomethylated genes show higher expression. Differential
23
methylation has been demonstrated, for example, in flower polymorphism in
SUPERMAN (SUP) alleles in Arabidopsis (Jacobsen and Meyerowitz, 2007),
variation in energy use efficiency in canola (Brassica napus) (Hauben et al.
2009), and hybrid vigor in corn (Tani et al. 2005), suggesting a role of the
epigenome in plant adaptation to environmental conditions (Rutherford and
Henikoff, 2003). Once thought to be rescheduled every generation, epigenetic
effects conditioned by DNA methylation have been demonstrated to undergo
trans-generational inheritance (Daxinger and Whitelaw, 2010), which indicates a
potential for response to selection (Hauben et al. 2009), and utility in plant
breeding, perhaps underpinning genotype by environment interactions.
The model plants to be used in this study:
Arabidopsis
Arabidopsis thaliana (Brassicaceae) has become a battle horse in genetic
studies due to its small nuclear genome size, 2n=10 and 125 Mbp, relatively
short biological cycle, large seed number, and small plant size (Redei, 1975;
Meinke et al. 1998; AGI, 2002). The entire Arabidopsis genome has been
sequenced, assembled, and extensively annotated, so that this species serves
as a model plant for identifying novel genes and for functional genomics studies
in dicot species (AGI, 2000). In addition, the description of the Arabidopsis
methylome (Zhang et al. 2006) was the first to be published, and population
variation is also best understood in this species in the context of genetics and
epigenetics. It has been feasible in Arabidopsis to begin to learn the patterns of
24
methylation that relate to gene density as well as transposable element activity
(Riddle and Richards, 2002).
Genomic and developmental features of Arabidopsis have also facilitated
comprehensive mutational approaches and Agrobacterium mediated
transformation projects (AGI, 2000). Identification of mutations in the methylation
machinery have allowed the development of epigenetically-altered recombinant
inbred lines (epi-RILs), designed to maximize epigenetic variation and minimize
genetic variation (Richards, 2009). This germplasm shows heritable phenotypic
variation for several important traits (Johannes et al. 2009), and maintains epi-
allelic plasticity (Reinders et al. 2009).
Sorghum
Sorghum (Sorghum bicolor Moench; Poaceae) is an important model plant due to
its relatively small genome size among the grasses, at 730 Mbp, its genomic co-
linearity with maize, and the availability of a full genome sequence. Its genome
and similarities in growth phenotype to maize offer an alternative for functional
genomics studies in monocot species (Paterson et al. 2009). Moreover, its C4
photosynthesis system makes it ideal to investigate carbon assimilation in C4
grasses, while the high inbreeding level it can tolerate offers a species ideal for
genetic studies that can be combined with Agrobacterium mediated
transformation (Zhao et al. 2000; Howe et al. 2006; Feng, 2008). Since sorghum
displays impressive levels of drought tolerance, it is a suitable crop for semiarid
regions like northeast Africa, and also offers opportunities for identification of
25
valuable strategies for crop improvement as we face challenges from climate
change (Paterson et al. 2009).
Sorghum ranks fifth among cereals grown worldwide, at 41 097 000
hectares (http://www.ers.usda.gov/Search/?qt=sorghum), following wheat, rice,
maize, and barley (FAOSTAT, 2010). The main world sorghum producers are:
The Western African Community and Sub-Saharan countries, India, USA,
Mexico, and Argentina, accounting for around 90% of the cultivated area. The
global sorghum production is around 65 797 000 ton, with an average yield of 1.0
ton/ha in African countries and India, and 4.5 ton/ha in the USA and Argentina; in
Mexico, sorghum yield oscillates around 3.8 ton/ha
(http://www.ers.usda.gov/Search/?qt=sorghum).
In the biofuel industry, sorghum is an important source of raw biomass
that can be grown as an annual, or as a perennial crop to produce ethanol, due
to the starch content in the kernel, and the hemi-cellulose and lignin of the stalk
(Paterson et al. 2009).
It is projected that by 2021, the sorghum demand will be around 72 076
000 ton, with the USA as main exporter
(http://www.ers.usda.gov/Search/?qt=sorghum). Therefore, efforts to increase the
efficiency of breeding methods in sorghum will be crucial to fulfill the future
sorghum demand. In that respect, the expansion of the phenotypic variation in
sorghum, as a consequence of MSH1 down regulation, discussed in Chapter 3,
illustrates the potential of this mechanism to make current breeding systems
more efficient.
26
Rationale for epigenetic crop breeding
While heterosis has been successfully deployed during the past century in crop
production systems, the genetic and epigenetic mechanisms underlying
enhanced vigor of the offspring compared to either parent are not well
understood (Hochholdinger and Hoecker, 2007; Chen, 2010). Similarly, the
phenotypic effects of the interactions between plant genomes that result in
retrograde signaling remain to be elucidated. In the context described in this
thesis, RNA interference represents a straightforward mechanism to afford
functional genomics studies (McGinnis, 2010), permitting study of plant
organellar genome dynamics as novel sources of phenotypic variation (Sandhu
et al. 2007; Feng, 2008; Xu et al. 2011; Xu et al. 2012). Therefore, the central
hypothesis within this Dissertation is that organellar physiological changes,
mediated by RNAi suppression of MSH1 in plants, underlie chloroplast
retrograde signaling to condition heritable epigenetic variation that shows
amenability to artificial selection in plant breeding programs.
27
References
Abdelnoor RV, Yule R, Elo A, Christensen AC, Meyer-Gauen G, Mackenzie SA. (2003). Substoichiometric shifting in the plant mitochondrial genome is influenced by a gene homologous to MutS. Proc. Natl Acad. Sci. USA100:5968-5973.
Abdelnoor RV,Christensen AC, Mohammed S, Munoz-Castillo B, Moriyama H, Mackenzie SA. (2006). Mitochondrial genome dynamics in plants and animals: convergent gene fusions of a MutS Homologue. J Mol Evol 63:165–173.
AGI (The Arabidopsis Genome Initiative). (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815.
Arrieta-Montiel MP, Mackenzie SA. (2011). Plant mitochondrial genomes and recombination. In: Advances in Plant Biology 1: Plant Mitochondria, F. Kempken (ed.), (New York: Springer), 65-82.
Arrieta-Montiel MP, Shedge V, Davila J, Christensen AC, Mackenzie SA. (2009). Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity. Genetics 183:1261–1268.
Atkin OK, Macherel D. (2009).The crucial role of plant mitochondria in orchestrating drought tolerance. Annals of Botany 103: 581–597.
Barkan A, Goldschmidt-Clermont M. (2000). Participation of nuclear genes in chloroplast gene expression. Biochimie 82 (6–7): 7: 559–572.
Becker C. Hagmann J, Muller J, Koenig D, Stegle O, Botgwardt K, Weigel D. (2011). Spontaneous epigenetic variation in the Arabidopsis thaliana methylome. Nature: 480: 245-249.
Berger SL, Kouzarides T, Shiekhattar R, Shilatifard A. (2009). An operational definition of epigenetics. Genes and Devel. 23: 781-783
Bouvier F, Mialoundama AS, Camara B. (2009). A sentinel role for plastids. In: Plant Cell Monographs. The Chloroplast-interactions with the environment. Sandelius A. S. and Aronsson H., (Eds), (Berlin, Springer), 267-292.
Burger G, Gray MW, Lang BF. (2003). Mitochondrial genomes: anything goes. Trends Genet 19:12:709-716.
Butow RA, Avadhani NG. (2004). Mitochondrial signaling: the retrograde response. Mol. Cel. 14: 1-15.
28
Chen ZJ. (2010). Molecular mechanisms of polyploidy and hybrid vigor. Trends Plant Sci. 15:2: 57-71.
Daxinger L. and Whitelaw E. (2010).Transgenerational epigenetic inheritance: More questions than answers. Gen. Res 20:1623–1628.
Dietzel L, Steiner S, Schröter Y, Pfannschmidt T. (2009). Retrograde signaling. The chloroplast-interactions with the environment. Sandelius A. S. and Aronsson H., (Eds) Springer-Verlag, Berlin:181-206.
Eichten SR, Swanson-Wagner RA, Schnable JC, Waters AJ, Hermanson PJ, et al. (2011). Heritable epigenetic variation among maize inbreds. PLoS Genet 7(11): e1002372. doi:10.1371/journal.pgen.1002372.
FAOSTAT (Food and Agriculture Organization of the United Nations Statistics) (2010). http://www.fao.org/corp/statistics/en/
Feng X. (2008). The molecular basis of mitochondrial genome rearrangements in pearl millet and sorghum. PhD Dissertation. University of Nebraska-Lincoln, 94 pp.
Galili, G. (1995). Regulation of lysine and threonine biosynthesis. Plant Cell 7, 899–906.
Galloway LF, Etterson JR. (2007). Transgenerational plasticity is adaptive in the wild. Science. 318:1134-1136.
Gu J, Miles D, Newton KJ. (1993). Analysis of leaf sectors in the NCS6 mitochondrial mutant of maize. Plant Cell 5: 963-971.
Hochholdinger F, Hoecker N. (2007). Towards the molecular basis of heterosis. Trends Plant Sci 12:9:427-432.
Howe A, Sato S, Dweikat I, Fromm M, Clemente T. (2006). Rapid and reproducible Agrobacterium-mediated transformation of sorghum. Plant Cell Rep. 25: 784–79.
Hauben M, Haesendonckx B, Standaert E, Van Der Kelen K, Azmi A, Akpo H Van Breusegem F, Guisez Y, Bots M, Lambert B, Laga B, De Block M. (2009). Energy use efficiency is characterized by an epigenetic component that can be directed through artificial selection to increase yield. PNAS 106: (47): 20109-20114.
Jacobsen SE, Meyerowitz EM. (1997). Hypermethylated SUPERMAN epigenetic alleles in Arabidopsis. Science 277:1100.
29
Johnson LJ, Tricker PJ. (2010). Epigenomic plasticity within populations: Its evolutionary significance and potential. Heredity 105:113–121.
Johannes F, Porcher E, Teixeira FK, Saliba-Colombani V, Simon M, Agier N, Bulski A, Albuisson J, Heredia F, Audigier P, et al. (2009). Assessing the impact of transgenerational epigenetic variation on complex traits. PLoS Genet 5: e1000530. doi: 10.1371/journal.pgen.1000530.
Kakutani T. (2002).Epi-alleles in plants: inheritance of epigenetic information over generations. Plant Cell Physiol. 43:10: 1106–1111.
Krause K, KilbienskiI,Mulisch M, Rodiger A, Schafer A, Krupinska K. (2005) DNA-binding proteins of the Whirly family in Arabidopsis thaliana are targeted to the organelles. FEBS Lett 579:3707–3712.
Kucej M, Butow RA. (2007). Evolutionary tinkering with mitochondrial nucleoids. Trends Cell Biol: 17: 12: 586-592.
Liu Z, Butow RA. (2006). Mitochondrial retrograde signaling. Annu. Rev. Genet. 2006. 40:159–85.
Mackenzie S, McIntosh. (1999). Higher plant mitochondria. Plant Cell11: 571–585.
Maréchal A, Parent J-S, Sabar M, Véronneau-Lafortune F, Abou-Rached C, Brisson N. (2008). Overexpression of mtDNA-associated AtWhy2 compromises mitochondrial function. BMC Plant Biol 8:42.
Maréchal A, Parent JS, Veronneau-Lafortune F, Joyeux A, Lang BF, Brisson N. (2009). Whirly proteins maintain plastid genome stability in Arabidopsis. Proc. Natl. Acad. Sci. USA 106: 14693–14698.
Martínez-Zapater JM, Gil P, Capel J, Somerville CR. (1992). Mutations at the Arabidopsis CHM locus promote rearrangements of the mitochondrial genome. Plant Cell 4(8):889-99.
McGinnis KM. (2010). RNAi for functional genomics in plants. Briefings in Functional Genomics 9: (2): 111-117.
Meinke DW, Cherry JM, Dean C, Rounsley SD, and Koornneef M. (1998). Arabidopsis thaliana: a model plant for genome analysis. Science 282: 662-665.
Mittler R. (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7: 405-410.
30
Nightingale KP, O’Neill LP, Turner BM. (2006). Histone modifications: signalling receptors and potential elements of a heritable epigenetic code. Curr Op Genet & Devel 2006, 16:125–136
Nott A, Jung H-S, Koussevitzky S, Chory J. (2006). Plastid-to-nucleus retrograde signaling. Annu. Rev. Plant Biol.2006. 57:739–59.
Ohlrogge J, Browse J. (1995). Lipid biosynthesis. Plant Cell 7, 957–970.
Palmer JD. (1983) Chloroplast DNA exists in 2 orientations. Nature 301:92–93.
Palmer JD. (1985). Comparative organization of chloroplast genomes. Ann Rev Genet 19:325-354.
Paterson A, Bowers JE, Bruggmann R, et al. (2009). The Sorghum bicolor genome and the diversification of grasses. Science 457: 551-556.
Rédei GP. (1975). Arabidopsis as a genetic tool. Annu Rev Genet 9:111-127.
Rédei GP, Plurad SB. (1973). Hereditary structural alterations of plastids induced by a nuclear mutator gene in Arabidopsis. Protoplasma 77:361-380.
Reenan RAG, Kolodner RD. (1992). Characterization of insertion mutations in the Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate mitochondrial and nuclear functions. Genetics 132: 975-985.
Reinders J, Wulff BB, Mirouze M, Marı-Ordonez A, Dapp M, Rozhon W, Bucher E, Theiler G, Paszkowski J. (2009). Compromised stability of DNA methylation and transposon immobilization in mosaic Arabidopsis epigenomes. Genes and Dev 23: 939–950.
Rhoades DM, Subbaiah CC. (2007). Mitochondrial retrograde regulation in plants. Mitochondrion 7: 177-194.
Rhoads DM, UmbachAL, SubbaiahCC, Siedow JN. (2006). Mitochondrial reactive oxygen species, contribution to oxidative stress and interorganellar signaling. Plant Phys. 141: 357–366.
Richards EJ. (2006). Inherited epigenetic variation —revisiting soft inheritance Nat. Rev. Genet: 7:395-401
Richards EJ. (2009). Quantitative epigenetics: DNA sequence variation need not apply. Genes Dev. 2009 23: 1601-1605.
Riddle NC, Richards EJ. (2002). The control of natural variation in cytosine methylation in Arabidopsis. Genetics162: 355.
31
Rowan BA, Oldenburg DJ, Bendich AJ. (2010). RecA maintains the integrity of chloroplast DNA molecules in Arabidopsis. J Exp Bot 61: 10: 2575–2588.
Ruckle ME, DeMarco SM, Larkin RM. (2007). Plastid signals remodel light signaling networks are essential for efficient chloroplast biogenesis in Arabidopsis. Plant Cell 19: 3944–3960.
Ruckle ME, Burgoon LD, Lawrence LA, Sinkler CA, Larkin RM. (2012). Plastids are major regulators of light signaling in Arabidopsis. Plant Physiology 159: 366–390.
Rutheford SL, Henikoff S. (2003). Quantitative epigenetics. Nature Genetics 33:6-8.
Sakamoto W. (2003). Leaf-variegated mutations and their responsible genes in Arabidopsis thaliana . Gen Genet Syst 78: 1-9.
Sakamoto W, Kondo H, Murata M, Motoyoshi F. (1996). Altered mitochondrial gene expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast mutator. Plant Cell 8:1377–1390.
Sandhu AP, Abdelnoor RV, Mackenzie SA. (2007). Transgenic induction of mitochondrial rearrangements for cytoplasmic male sterility in crop plants. Proc. Natl. Acad. Sci. U.S.A.104:1766–1770.
Sangster TA, Salathia N., Lee HN, Watanabe E., Schellenberg K., Morneau K, Wang H, Undurraga S, Queitsch C, Lindquist S. (2008). HSP90-buffered genetic variation is common in Arabidopsis thaliana. PNAS 105: 8: 2969–2974.
Schmitz RJ, Schultz MD, Lewsey MG, O’Malley RC, Urich MA, Libiger O, Schork NJ, Ecker JR. (2011). Transgenerational epigenetic instability is a source of novel methylation variants. Science 334:369-373.
Schmitz RJ, Ecker JR. (2012). Epigenetic and epigenomic variation in Arabidopsis thaliana. Trends Plant Sci 17:(3): 149-154.
Schnable PS, Ware D, Fulton RS, et al. (2009). The B73 maize genome: complexity, diversity, and dynamics. Science 326: 1112-1115.
Schofield MJ, Hsieh P. (2003). DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 2003. 57:579–608.
Shedge V, Arrieta-Montiel M, Christensen AC, Mackenzie SA. (2007). Plant mitochondrial recombination surveillance requires unusual RecA and MutS homologs. Plant Cell 19:1251–1264.
32
Shedge V, Davila J, Arrieta-Montiel MP, Mohammed S, Mackenzie SA. (2010). Extensive rearrangement of the Arabidopsis mitochondrial genome elicits cellular conditions for thermotolerance. Plant Physiol. 152:1960–1970.
Skinner MK, Manikkam M, Guerrero-Bosanga C. (2010). Epigenetic transgenerational actions of environmental factors in disease etiology. Trends Endocrinology & Metabolism 21: 214-222.
Small I, Isaac PJ, Leaver CJ. (1987). Stoichiometric differences in DNA molecules containing the atpA gene suggest mechanisms for the generation of mitochondrial genome diversity in maize. EMBO J 6:865-869.
Sollars V, Lu X, Xiao L, Wang X, Garfinkel MD, Ruden DM. (2003). Evidence for an epigenetic mechanism by which Hsp90 acts as a capacitor for morphological evolution. Nature Genetics 33:70–74.
Springer NM, Stupar RM. (2007). Allelic variation in maize: How do two halves make more than a whole? Gen. Res. 17:264-275.
Sugiura M, Takeda Y. (2000). Nucleic acids. In: Biochemistry and molecular biology of plants. Buchanan B, Gruissem W, and Jones R (Eds.). pp 260-310.
Tani E, Polidoros AN, Nianiou-Obeidat I, Tsaftaris AS. (2005). DNA methylation patterns are differently affected by planting density in maize inbreds and their hybrids. Maydica 50: 19-23.
Van Aken O, Giraud E, Clifton R, Whelan J. (2009). Alternative oxidase: a target and regulator of stress responses. Physiologia Plantarum 137: 354–361.
Vanlerberghe GC, McIntosh L. (1997). Alternative oxidase: from gene to function. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 703–734.
Wallace DC, Fan W. (2010). Energetics, epigenetics, mitochondrial genetics. Mitochondrion. 10(1): 12–31. doi:10.1016/j.mito.2009.09.006.
Wei F, Zhang J, Zhou S, He R, Schaeffer M, et al. (2009). The physical and genetic framework of the maize B73 genome. PLoS Genet 5 (11): e1000715. doi:10.1371/journal.pgen.1000715.
Xu Y-X, Arrieta-Montiel MP, Virdi KS, de Paula WBM, Widhalm JR, Basset GJ, Davila JI, Elthon TE, Elowsky CG, Sato SJ, Clemente TE, Mackenzie SA. (2011). MutS HOMOLOG1 is a nucleoid protein that alters mitochondrial and plastid properties and plant response to high light. Plant Cell 23:3428-3441.
33
Xu Y-Z, de la Rosa Santamaria R, Virdi KS, Arrieta-Montiel MP, Razvi F, Li S, Ren G, Yu B, Alexander D, Guo L, Feng X, Dweikat IM, Clemente TE, Mackenzie SA. (2012). The chloroplast triggers developmental reprogramming when MUTS HOMOLOG1 is suppressed in plants. Plant Physiol 159:710-720.
Yu F, Fu A, Aluru M, Park S, Xu Y, Liu H, Liu X, Foudree A, Nambogga M, Rodermel S. (2007). Variegation mutants and mechanisms of chloroplast biogenesis. Plant Cell Environ. 30: 350–365.
Zaegel V, Guermann B, Le Ret M, Andres C, Meyer D, Erhardt M, Canada YJ, Gualberto JM, Imbault P. (2006). The plant-specific ssDNA binding protein OSB1 is involved in the stoichiometric transmission of mitochondrial DNA in Arabidopsis. Plant Cell18:3548–3563.
Zhang X, Yazaki J, Sundaresan A, Cokus S, Chan SW-L, Chen H, Henderson IR, Shinn P, Pellegrini M, Jacobsen SE, Ecker JR. (2006). Genome-wide high-resolution mapping and functional analysis of DNA methylation in Arabidopsis. Cell 126, 1189–1201.
Zhao ZY, Cai T, Tagliani L, Miller M, Wang N, Pang H, Rudert M, Schroeder S, Hondred D, Seltzer J, Pierce D. (2000). Agrobacterium mediated sorghum transformation. Plant Mol. Biol. 44:789-798.
34
Chapter 2
Chloroplast-Mediated Plant Developmental Reprogramming as a result of
MUTS HOMOLOG1 Suppression
Abstract. The effect of a single plant nuclear gene on the expression and
transmission of phenotypic variability was examined. MutS HOMOLOG 1 (MSH1)
is a plant-specific nuclear gene product that functions in both mitochondria and
plastids to maintain genome stability. RNAi suppression of the gene elicited
strikingly similar programmed changes in plant growth pattern in sorghum as in
other plant species; these changes were subsequently heritable independent of
the RNAi transgene. The altered phenotypes, designated MSH1-dr, reflect
multiple pathways that are known to participate in adaptation, including altered
phytohormone effects for dwarfed growth and reduced internode elongation,
enhanced branching, reduced stomatal density, altered leaf morphology, delayed
flowering and extended juvenility. Some of these effects are partially reversed
with application of gibberellic acid (GA), with a significant interaction between the
GA concentrations applied and the presence or absence of the transgene.
Genetic hemi-complementation experiments have shown that this phenotypic
plasticity derives from changes in chloroplast state, and the results suggest that
suppression of MSH1, which occurs under several forms of abiotic stress,
triggers a plastidial response process that involves non-genetic inheritance.
Interestingly, the MSH1-dr phenotype is maintained by self-pollination, allowing
the maintenance of inbred lines that breed true with complete penetrance of the
phenotype, while upon genetic segregation of the transgene, enhanced growth
35
was detected in the progeny of direct and reciprocal crosses between MSH1-dr
plants and the wild type cultivar TX430.
Introduction
Phenotypic plasticity is an inherent characteristic of land plants that allows them
to adapt to environmental changes. This ability is thought to include non-genetic,
trans-generational processes (Bonduriansky and Day, 2009) that could integrate
epigenetic and cytoplasmic elements (Danchin et al. 2011; Johannes et al.
2008). While the influence of maternal effects has been demonstrated in these
plant responses (Galloway, 2005), little is known about the role of organelles in
plant and environment interactions.
The MutS HOMOLOG1 (MSH1) gene is unique to plants, and encodes a
homolog to the bacterial mismatch repair protein MutS (Abdelnoor et al. 2003).
The product is dual-targeting, localized to both mitochondrial and chloroplast
nucleoids (Xu et al. 2011) and the gene disruption is associated with enhanced
recombination at 47 pairs of repeated sequences in the mitochondrial genome of
Arabidopsis (Shedge et al. 2007; Arrieta-Montiel et al. 2009; Davila et al. 2011).
This mitochondrial recombination gives rise to cytoplasmic male sterility in
tomato (Solanum lycopersicum) and tobacco (Nicotiana tabacum) (Sandhu et al.
2007). In contrast, within the chloroplast, disruption of MSH1 results in low
frequency DNA rearrangements mediated by recombination, together with
altered redox properties of the cell and variegation of the plant (Xu et al. 2011).
In both cytoplasmic male sterility and variegation, the altered phenotype displays
36
incomplete penetrance and appears to derive from organellar genomic
rearrangements that undergo subsequent maternal inheritance.
Comparative studies were carried out to investigate the phenotypic
changes that occur in response to MSH1 suppression in sorghum, but do not
appear to be derived from organellar genome instability. These studies produced
evidence of developmental reprogramming in response to chloroplast signals that
accompany MSH1 suppression. Outstandingly, these developmental changes,
once effected, are stable, heritable and independent of the RNAi transgene in
subsequent generations, suggesting that these organellar signals influence the
plant epigenetic status.
Methods
Plant materials and growth conditions
The sorghum germplasm used in these experiments was generated by Feng
(2008). Briefly, Agrobacterium mediated transformation of the commercial
sorghum inbred line Tx430 (Miller, 1984) was conducted with an RNAi construct
to down-regulate the MSH1 gene. The construct was designed to target unique
sequences within the Domain VI endonuclease region. Two dwarfed, high
tillering, delayed flowering plants from the T2 generation were selected, among
others, based on their induced flowering in response to gibberellic acid (GA)
treatment (Feng, 2008); these plants were designated GAI and GAII, and their
self-pollinated seed was used to derive subsequent generations by selfing. In
37
addition, plants of GAI and GAII progeny were used as parents in direct and
reciprocal crosses to Tx430, the wild type parental cultivar.
Two factorial experiments were designed, at seedling and transition to
reproductive stage, to test response to exogenous GA application in the T3
progeny of GAI and GAII, applying 1250 ppm and 2500 ppm GA. At seedling
stage, a 2x2 design was established with four treatments: 1) GAI + 1250 ppm
GA, 2) GAI+ 2500 ppm GA, 3) GAII+ 1250 ppm GA, and 4) GAII+2500 ppm GA.
Each treatment involved five plants grown under greenhouse conditions, at 26°C
to 28°C day and 21°C to 23°C night temperatures. The plant material was 3
weeks old at treatment, and the two traits evaluated were plant height (PH),
measured as length (cm) from the bottom to the tip of the last and second to last
leaves, and tiller number. Plant height was measured at 42 days after planting,
while number of tillers was recorded at 55 days after planting. Analyses of
variance were conducted to test for significant interaction, or simple effects of the
factors evaluated, using the PROC GLIMMIX procedure (SAS 9.2).
The second experiment consisted of a 2x3 factorial design, with sorghum
progenies and GA dosage as factors. Thus, GAI and GAII progenies were
combined with 0 ppm GA (No GA), 1250 ppm GA, and 2500 ppm GA, and six
treatments were established: 1) GAI + No GA, 2) GAI + 1250 ppm, 3) GAI + 2500
ppm GA, 4) GAII + No GA, 5) GAII + 1250 ppm GA, and GAII + 2500 ppm GA.
Each treatment was applied twice to five plants, at 65 and 80 days after planting,
when the wild type typically starts the reproductive phase; i.e. the dwarf-high
tillering-delay flowering plants were assumed to have reached the reproductive
38
phase, but no flowering was detected. The phenotypic traits measured were:
days to flowering (DFL) after GA application, plant height (PH) (cm), from the
bottom of the plant to the top of the panicle or to the growing point, panicle length
(PL) (cm), and number of tillers (NT) at 30 days after pruning the harvested
plants. Analysis of variance were conducted to test for interaction between the
factors evaluated and, when appropriate, mean comparison tests were carried
out on each trait by the PROC GLIMMIX procedure (SAS 9.2). Both progenies,
GAI and GAII, were PCR screened for presence of the MSH1–RNAi transgene
with primers listed in Table 2.17.These experiments were carried out as a
collaboration with Xuehui Feng.
A non-selected T3 sorghum RNAi-derived population consisting of eleven
progenies was also characterized based on phenotypic traits that included plant
height (PH), leaf variegation (LV), male sterility (MS), and dwarfed-high tillering-
delayed flowering phenotypes in comparison to wildtype. Male sterile plants were
selected from this population to assess male fertility restoration or male sterility
maintenance, by crossing the T3 male sterile plants, transgenic or null, and
pollinated by wildtype or transgenic fertile plants. The following treatment
combinations were then tested: 1) transgene null x WT, 2) transgenic x WT, 3)
transgene null x transgenic, and 4) transgenic x transgenic.
Comparative analyses regarding different phenotypic traits and metabolic
pathways incorporated Arabidopsis msh1 mutants and/or RNAi transgenically
derived lines (Xu et al. 2011; Xu et al. 2012). Arabidopsis Col-0 and msh1 (chm1-
1) mutant lines were obtained from the Arabidopsis stock center and grown in
39
metro mix at 24°C. Development of RNAi suppression lines of tomato and
tobacco (Sandhu et al. 2007), millet and sorghum (Xu et al. 2011), and
Arabidopsis hemi-complementation lines (Xu et al. 2011) is described elsewhere.
Arabidopsis flowering time was measured as date of first visible flower bud
appearance. At this time, total rosette leaf number was also determined as
flowering rosette leaf number.
For studies of metabolism and transcript levels, Arabidopsis plant staging
was carried out based on leaf number, and plants of same age were used for all
experiments. The msh1 mutants are considerably smaller than wild type at the
same age, determined as days after germination. Plant sampling stage was just
before bolting. For sorghum analysis, plants were taken at the 5 to 6-leaf stage.
All plants were grown under controlled growth room conditions. The transcript
and metabolic profiling experiments were conducted and analyzed by Dr. Ying-
Zhi Xu in collaboration with Metabolon.
Microscopy
Samples for stomatal density were prepared from the adaxial and abaxial
surfaces of the middle section of mature sorghum leaves. Samples were
observed under a Nikon Eclipse E800 light microscope (20X), with image area
captured at 0.307 mm2. Stomata number was estimated with ImageJ software
(NIH), and analyzed with the PROC GLIMMIX procedure (SAS 9.2). These
experiments were carried out as collaboration with Dr. Christian Elowsky.
40
RNA Isolation and Real-Time PCR Analysis
Transcript isolation and Real-Time PCR analysis was conducted for Arabidopsis
and sorghum (Xu et al. 2012). Total Arabidopsis and sorghum RNA was
extracted from above-ground tissues of wild-type and mutant or RNAi plants
using TRIzol (Invitrogen) extraction procedure followed by purification on RNeasy
columns (Qiagen).cDNA was synthesized with SuperScriptIII first-strand
synthesis SuperMix for qRT-PCR (Invitrogen). Quantitative PCR was performed
on the iCycler iQ system (Biorad) with SYBR GreenER Supermix (Invitrogen).
PCR primers are listed in Table 2.17. For sorghum assays, primers were
designed to the 3’ region of MSH1. The transcript level of each gene was
normalized to UBIQUITIN10.
RT-PCR analysis also involved multiple plant stages, ranging from 2 week
old to flowering stage, to confirm results observed by global transcriptome
analysis. These experiments were carried out by Dr. Y-Z.Xu.
Small RNA analysis
RNA isolation and miRNA hybridization was performed as described by others
(Park et al. 2002). Total RNA was exacted with TRIzol, and small-sized RNA was
enriched by treatment with 5% PRG8000 in 0.5M NaCl, then precipitated with
ethanol and glycogen. RNA was resolved in 16% denaturing acrylamide gel and
small RNA was detected by 32P-end-labeled specific LNA/DNA probes. These
experiments were carried out by Drs. B. Yu, G. Ren and Y.-Z. Xu.
41
Genomic DNA methylation assay
Genomic DNA (~500 ng) was used for bisulfite treatment using the EpiTect
Bisulfite kit (Qiagen) (Xu et al. 2012). Each sample was bisulfite treated twice
and subjected to a first round of PCR amplification with primers 3-2R and 3-2L
(Table 2.17). The PCR product was re-amplified with nested primers 3-2R and 3-
2L. The conditions used were 46°C for 30 cycles and Accuprime-Taq DNA
polymerase kit (Invitrogen). The amplified products of 250 bp were eluted,
sequenced and aligned against untreated genomic DNA sequence with T-
COFFEE. At least two independent bisulfite treatments and two independent
PCR products per bisulfite treatment were prepared for each sample (four runs
total per line), followed by sequence analysis. These experiments were carried
out by Dr. F. Razvi.
Metabolite Analysis
Metabolic profiling analysis of all samples was carried out in collaboration with
Metabolon according to methods described previously (Oliver et al. 2011). The
global unbiased metabolic profiling platform involved a combination of three
independent platforms: UHLC/MS/MS optimized for basic species,
UHLC/MS/MS2 optimized for acidic species, and GC/MS. Samples in six
replicates were extracted, analyzed with the three instruments, and their ion
features were matched against a chemical library for identification. For sample
extraction, 20 mg of each leaf sample was thawed on ice and extracted using an
automated MicroLab STAR system (Hamilton Company) in 400 µL of methanol
42
containing recovery standards. UPLC/MS was performed using a Waters Acquity
UHPLC (Waters Corporation) coupled to an LTQ mass spectrometer (Thermo
Fisher Scientific Inc.) equipped with an electrospray ionization source. Two
separate UHPLC/MS injections were performed on each sample: one optimized
for positive ions and one for negative ions. Derivatized samples for GC/MS were
analyzed on a Thermo-Finnigan Trace DSQ fast-scanning single-quadrupole MS
operated at unit mass resolving power. Chromatographic separation, followed by
full-scan mass spectra, was performed to record retention time, molecular weight
(m/z), and MS/MS of all detectable ions present in the samples. Metabolites were
identified by automated comparison of the ion features in the experimental
samples to a reference library of chemical standard entries that included
retention time, molecular weight (m/z), preferred adducts, and in-source
fragments, as well as their associated MS/MS spectra. This analysis was
conducted by Metabolon (North Carolina).
For hormone metabolic profiling, four-week old Arabidopsis and 2-week
old sorghum seedlings were collected, frozen and lyophilized. Profiling was
conducted at the National Research Council Plant Biotechnology Institute in
Saskatoon, Saskatchewan, Canada, according to Chiwocha et al. (2005).
43
Results
MSH1 suppression induces similar phenotypic changes in sorghum as in
other plant species.
The properties of MSH1 have been studied by an RNAi suppression approach in
dicot and monocot plant species, in which similar phenotypic changes have been
documented. Dicots tested include Arabidopsis, tobacco, tomato, and soybean,
while millet and sorghum were used as monocot model plants. Novel phenotypes
included male sterility, leaf variegation, dwarfism, reduced internode length,
delayed or non- flowering, and modified branching (Sandhu et al. 2007; Feng,
2008; Shedge et al. 2010); in Arabidopsis, additional changes that were
documented included heat tolerance (Shedge et al. 2010), and secondary growth
and extended juvenility in short day conditions (Xu et al. 2011). In sorghum,
MSH1 suppression produced novel and consistent changes in plant tillering,
height, internode elongation, stomatal density, and altered gibberellic acid
catabolism in dwarf phenotypes. These changes in development, strikingly
consistent across species, were termed developmental reprogramming (MSH1-
dr), due to their cross-species reproducibility and influence on numerous aspects
of plant development.
Phenotypic variants induced in sorghum by MSH1 RNAi suppression are
heritable. Characterization of the non -selected T3 sorghum population allowed
discrimination of independent and separable developmental changes that include
leaf variegation, male sterility, and the MSH1-dr phenotype (Table 2.1, and Table
44
2.2) that appeared at a frequency of 0-26% in the T3 population (Table 2.2).
However, this phenotype, observed in the GAI and GAII individuals selected in
the T2 generation, was consistently co-inherited with enhanced tillering and
flowering delay in derived sorghum lines; i.e. individuals displaying the MSH1-dr
phenotype gave rise to progeny populations fully penetrant for the phenotype
upon genetic segregation of the RNAi transgene (Table 2.3). Mean comparison
between these progenies and wildtype showed significant differences in plant
height, panicle length, flowering rate, and fertility (Table 2.4), as well as in
stomatal density (Table 2.5).These observations permitted the development of
sorghum lines, null for the RNAi transgene, that bred true for the MSH1-dr
phenotype over multiple cycles of self-pollination, with seven generations
confirmed to date (Table 2.3).
The non-selected T3 generation also displayed significant range in plant
height variation (p<0.001), including outstandingly taller plants than wild type; the
maximum individual values observed in the transgenic population was 201 cm,
with the highest interval of 122 cm, compared to the maximum value observed in
wildtype of 150 cm and 44 cm as the interval (Table 2.1; Figure 2.1).
Gibberellic acid partially restores the altered phenotype, with significant
interaction between GA dosage and the RNAi transgene. PCR screening
indicated that GAI was an MSH1-RNAi transgenic line, while GAII derived plants
were null for the transgene (Figure 2.7). Exogenous application of GA at seedling
stage exerted significant interactive effects between GA dosage and the
presence or absence of the transgene for plant height (p<0.001) on the last leaf
45
at 42 days after planting (Figure 2.2A). The strongest effect for plant height was
observed in the combination of the null GAII progeny and 1250 ppm, with a mean
value of 54 cm, whereas, at this concentration, transgenic GAI progeny showed
the lowest response mean value of 38 cm. The response of both progenies at
2500 ppm showed no significant differences for plant height in sorghum
seedlings.
Data from the second to last leaf showed no significant interaction
between GA concentrations and progenies (p>0.70), and non-transgenic GAII
progeny showed the highest response to both plant hormone concentrations with
significant effects (p<0.001) (Figure 2.2B and Table 2.6).The highest mean value
observed, 69 cm, for the second to last leaf measurements in sorghum seedlings
occurred in the combination of GAII progeny and 2500 ppm of gibberellic acid
(Table 2.6).There were no significant differences in number of tillers in the
treatments evaluated at 55 days after planting (p=0.49) (Table 2.6 ).
When MSH1-dr sorghum progenies were tested for the response to GA at
maturity, there were significant interactive effects between GA concentration and
progenies for days to flowering after GA application (p<0.0001), plant height
(p<0.01) and panicle length (p<0.0008); after harvesting, the plant material was
pruned and allowed to re-growth when number of tillers were tested, with no
significant differences (p= 0.9) detected.
The highest response for flowering was observed in GAII progeny treated
with 2500 ppm GA, with a mean value of 50 days after GA application, followed
46
by GAII+1250 ppm that flowered at 65 days after GA application; these
differences were significant (p<0.0001), and no other treatment combinations
flowered (Table 2.7).
The highest response in PH and PL was also observed in the non-
transgenic GAII progeny at either concentration of GA; however, 2500 ppm
induced a significantly stronger effect than 1250 ppm (Table 2.7). In fact, the
absence of the RNAi transgene allowed plant height to be partially restored to the
wildtype phenotype as a response to exogenous GA (Figure 2.3), implying that
the loss of MSH1 functions impacts GA metabolism in the plant.
The MSH1-dr phenotype in transgene-null lines displays enhanced
growth following crosses with wildtype
Direct and reciprocal crossing of the dwarfed sorghum lines, lacking the
transgene, to wildtype (inbred Tx430) resulted not only in complete reversal of
the dwarfed and delayed flowering phenotype in the F1 progeny, but in evidence
of enhanced growth that surpassed the wild type mean value (Figure 2.4, Table
2.8 and Table 2.9). In contrast, the F1 progeny from crosses between non-
dwarfed, male-sterile plants, transgenic or null, with wildtype did not show
differences for enhanced growth (p=0.4) (Table 2.10, Table 2.11), implying that
the MSH1-dr phenotype is a component of this process. Similar lack of enhanced
growth was seen when crosses involved dwarfed transgenic plants to wildtype; in
fact, one such F1 progeny ranked below the mean value of the wildtype line (p<
0.001) (Table 2.12). Thus, MSH1 modulation appears to condition
47
developmental changes within the plant that are heritable through self-pollination
but reversed through crossing to wildtype, when the transgene is no longer
present.
The reciprocal crossing results, showing reversal of phenotypes in either
direction, imply that these heritable changes are not organellar. Moreover,
although genetic segregation of the RNAi transgene did not reverse the altered
dwarf phenotype in sorghum, non-transgenic segregants displayed slight
changes in flowering rate and fertility, suggesting that presence of the transgene
intensifies the phenotype (Table 2.4). Transgenic plants were non flowering and
showed reduced response to the GA treatment relative to transgene null lines,
which were delayed in flowering but did not require exogenous GA application
(Table 2.4).
In non-transgenic plants, MSH1 transcript levels and MSH1 DNA
methylation pattern reverted back to wildtype (Figure 2.5 and Figure 2.6). These
results imply that heritability and transgenerational stability of the altered
phenotypes were not likely a consequence of RNAi-induced stable silencing of
the MSH1 locus.
Fertility restoration occurs with wildtype pollen or in CMS MSH1-RNAi lines
following segregation of the transgene
Male sterility in sorghum was characterized by lack of pollen in shrunken
anthers, and confirmed in 17 out of 118 (14.4 %) T3 plants, whose heads were
48
bagged before anthesis and no seed set was observed afterwards. PCR
screening indicated that six of these male sterile plants were MSH1 minus and
11 plants held the transgene. Then, crosses were conducted using as a source
of pollen wildtype or transgenic plants. The crosses conducted were: five MSH1
(-) x wildtype, six MSH1 (+) x wildtype, nine MSH1 (+) x wildtype, and nine MSH1
(+) x MSH1 (+). The progeny of each type of cross were grown in a variable
number, from 26 to 42, and tested for fertility restoration, or male sterility
maintenance. The analysis of variance indicated significant differences (p<
0.0001) in the fertility rate among the type of crosses, being the F1 progeny of
transgenic x transgenic [MSH1 (+) x MSH1 (+)] which displayed the lowest
fertility value (64%) (Table 2.13). In contrast, the progeny of MSH1 (-) x wildtype,
MSH1 (+) x wildtype, and MSH1 (-) x MSH1 (+) scored 100, 93 and 92% of
fertility rate, with no significant differences among them (Table 2.13). This means
that male sterility showed maternal inheritance, with incomplete penetrance (36%
of the progeny), when the transgene was present in both parents; this maternal
transmission has been also observed in MSH1-RNAi derived lines of tobacco
(Martinez-Zapater et al. 1992; Abdelnoor et al. 2003; Sandhu et al. 2007). In
contrast, fertility is fully restored when an MSH1 female lacking the transgene is
fertilized by wildtype pollen.
Different metabolic pathways are altered by MSH1 suppression
The modified phenotypes showed changes in the expression of different nuclear
genes (Table 2.14) (Xu et al. 2012). These changes, detected by transcript
profiling and RT-PCR, involve pathways associated with dwarfism and include
49
cell cycle regulation and increased GA catabolism (Figure 2.5A, Table 2.14,
Table 2.15), while changes in leaf morphology and branching are likely
consequences of modifications in auxin production and receptor expression
(Willige et al. 2011). Additional effects on flowering and conversion to a
perennial growth pattern were associated with changes in expression of flowering
and vernalization regulators (Fornara et al. 2010); these include increased FLC
and decreased SOC1 expression, and increased miR156 and decreased miR172
levels as well.
Several stress response pathways were similarly altered in expression
with the disruption of MSH1. Both transcript and metabolic profiling experiments
revealed organelle-influenced metabolic changes underlying the variability in
plant growth characteristic of plant response to stress conditions (Tables 2.14
and 2.16) (Xu et al. 2012). Metabolic changes in the sorghum dwarf plants were
concentrated within TCA flux. Increased energy metabolism in the dwarf line
reflected the up-regulation of most compounds of the TCA, NAD and
carbohydrate metabolic pathways, and down-regulation of amino acid
biosynthesis, reflecting altered carbon/nitrogen balance in these plants. In
Arabidopsis, this alteration was most evident in the depletion of sucrose to
undetectable levels. Metabolic priming for environmental stress in sorghum may
be evident in the 1.2 to 5.7-fold elevation of sugar and sugar-alcohol levels, an
effect that stabilizes osmotic pressure in response to stresses like drought
(Ingram and Bartels 1996). Anti-oxidants ascorbate and alpha-tocopherols were
increased, together with the stress-responsive flavones apigenin, apigenin-7-o-
50
glucoside, isovitexin, kaempferol 3-O-beta-glucoside, luteolin-7-O-glucoside and
vitexin. In Arabidopsis, the response included an increase in oxidized
glutathione, as well as sinapate, likely signaling induction of the phenypropanoid
pathway, together with the polyamines 1, 3-diaminopropane, putrescine and
spermidine, which likely influence both stress tolerance and the observed delay
in maturity transition (Gill and Tuteja, 2010).
Chloroplast changes are responsible for the MSH1-dr phenotype. Even
though different nuclear gene networks are modified, MSH1 localizes in the
organelles (Xu et al. 2011). Therefore, genetic hemi-complementation allowed
the discrimination between mitochondrial and plastidial influences on msh1-
associated phenotypes. Hemi-complementation lines were developed in
Arabidopsis by transgenic introduction of a mitochondrial versus plastid-targeted
form of MSH1 to an msh1 mutant (Xu et al. 2011).
Transgenic lines containing the plastid-targeted form of MSH1 undergo
mitochondrial DNA recombination (Xu et al. 2011), but show no evidence of
reduced growth rate, delayed flowering or altered leaf morphology. Lines
containing the mitochondrial-targeted form of MSH1 contain a stable
mitochondrial genome and produce leaf variegation, but also display dwarfing,
changes in leaf morphology and flowering time, and delayed transition to maturity
and senescence (Xu et al. 2011). These observations, supporting plastidial
influence on phenotype, were supported by metabolic profiles from the hemi-
complementation lines. Metabolic profiling of the mitochondrial- versus plastid-
complemented lines showed very little metabolic difference between wildtype and
51
the chloroplast-complemented lines, but produced an array of metabolic changes
conditioned by MSH1-deficient chloroplasts in the mitochondrial-complemented
lines (Xu et al. 2012).
Advanced-generation msh1 mutants in Arabidopsis show evidence of
mitochondrial DNA changes (Davila et al. 2011), whereas chloroplast DNA
rearrangements are extremely low in frequency and restricted to the variegated
sectors (Xu et al. 2011). Analysis of mitochondrial and chloroplast DNA in
transgene-minus sorghum lines by similar Illumina deep sequence-based
analysis to that used in Arabidopsis has revealed no evidence of DNA changes
to date (Xu et al. 2011). No previously reported chloroplast genome mutation has
been shown to produce plant developmental changes similar to those reported
here. These considerations, together with the demonstrated reversal of
phenotype in sorghum lines crossed to wildtype, provide little or no support for
organellar DNA rearrangement underlying the altered growth phenotypes.
Consequently, it is posited that the observed gene expression changes observed
in the sorghum and Arabidopsis dwarfed, delayed flowering lines are a
consequence of changes in organellar signal following MSH1 suppression,
instead of stable organelle genome rearrangement.
Discussion
The results presented, suggesting chloroplast influence on multiple growth traits,
are not entirely surprising, since GA biosynthesis, light response and
52
vernalization pathways involve chloroplast processes (Bouvier et al. 2009).
Mutation of the CND41 gene in tobacco, encoding a chloroplast nucleoid protein
with protease activity, can result in reduction of GA1 levels and a dwarf
phenotype (Nakano et al. 2003). Disruption of HSP90 genes, some of which
encode organellar products, has been associated with dramatic changes in plant
development, including altered chloroplast development (Sangster and Queitsch,
2005). However, HSP90-associated phenotypic changes do not appear to
resemble the processes described here, and HSP90 expression is unchanged in
the msh1 mutant.
What is surprising in MSH1 depletion is not simply the array of phenotypes
that emerge, but the programmed and heritable manner in which these
intersecting nuclear gene networks respond to organelle perturbation. Numerous
genetic mutations are shown to alter chloroplast functions, many producing
variegation phenotypes (Sakamoto, 2003; Yu et al. 2007). Yet, no association
has been reported of these mutations with similar developmental reprogramming,
implying that a specificity of function rather than general organellar perturbation
conditions the msh1 changes.
The hemi-complementation assay reported by Xu et al. (2011) allowed not
only to discriminate between mitochondrial and plastid contribution to the derived
phenotype, but also to assess whether MSH1 might also function within the
nucleus. No nuclear localization is evident in MSH1-GFP reporter transgene
experiments with laser scanning confocal microscopy (Xu et al. 2011). Still, the
trans-generational heritability of observed phenotypic changes implies epigenetic
53
influences on nuclear gene expression. The ability to fully complement the
altered growth phenotype with a plastid-targeted MSH1 transgene (Xu et al.
2011), but not with mitochondrial-targeted, argues against nuclear localization of
MSH1. Rather, these data suggest that changes in plastid state effect the
phenotypic changes that are subsequently heritable, implying that these plastid
changes condition an epigenetic effect.
Components of transgenerational phenotypic plasticity in plants are
maternal (Donohue, 2009; Galloway and Etterson, 2007), and several of these
appear to be adaptive under particular environments. However, there has been
little or no direct evidence of organellar changes underlying these processes.
Suppression of MSH1 expression produces cytoplasmic male sterility and
variegation through direct DNA rearrangement of the chloroplast and
mitochondrial genomes, but the additional phenotypic plasticity described in this
study appears to derive from plastidial signaling. Heritable and cross-species
reproducibility of the phenotypic changes, co-opting well-defined, nuclear-
controlled developmental pathways, and the complete reversal of phenotype with
pollination by wildtype plants, insinuate epigenetic processes. Epigenomic
changes appear to underlie at least some of the environmentally responsive
phenotypic plasticity observed in natural systems (Bonduriansky and Day, 2009).
In fact, MSH1 transcript levels show environmental responsiveness, with
dramatically reduced levels under conditions of stress (Shedge et al. 2010; Xu et
al. 2011; Hruz et al. 2008). Moreover, disruption of MSH1 produces altered
redox state of the plastid (Xu et al. 2011), implying one means of retrograde
54
signaling change in the cell. This suggests that MSH1 modulation operates in
plants, under natural conditions, to link mechanisms for environmental sensing
with genomic response by triggering organellar mediators of the process.
Co-inheritance of variation in flowering time, plant growth rate, branching
patterns, stomatal density changes and maturity transition in sorghum and
Arabidopsis was observed. Phenotypic variation for these quantitative traits has
been the subject of ecological association mapping studies to understand
genotype by environment interactions and plant adaptation in natural
environments (Bergelson and Roux, 2010). These results suggest that
epigenetic processes may support a coordinate modulation of all of these traits in
response to environmental cues, while the enhanced growth response, in either
direction of the crosses between MSH1-dr phenotypes and wildtype, suggests an
important potential for plant breeding.
55
References
Abdelnoor RV, Yule R, Elo A, Christensen AC, Meyer-Gauen G, Mackenzie SA. (2003). Substoichiometric shifting in the plant mitochondrial genome is influenced by a gene homologous to MutS. Proc. Natl Acad. Sci. USA100:5968-5973.
Abdelnoor RV, Christensen AC, Mohammed S, Munoz-Castillo B, Moriyama H, Mackenzie SA. (2006). Mitochondrial genome dynamics in plants and animals: Convergent gene fusions of a MutS homolog. J. Molec. Evol.63:165-73.
Arrieta-Montiel MP, Shedge V, Davila J, Christensen AC, Mackenzie SA. (2009). Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity. Genetics 183:1261-8.
Bergelson J, Roux F. (2010). Towards identifying genes underlying ecologically relevant traits in Arabidopsis thaliana. Nature Rev Genet 11: 867-879.
Bonduriansky R, Day T. (2009). Nongenetic inheritance and its evolutionary implications. Annu Rev Ecol Evol Syst 40:103-125.
Bouvier F, Mialoundama AS, Camara B. (2009). A sentinel role for plastids.The Chloroplast-interactions with the environment. Sandelius A. S. and Aronsson H., (Eds) Springer-Verlag, Berlin: 267-292.
Chiwocha SD, Cutler AJ, Abrams SR, Ambrose SJ, Yang J, Ross AR, Kermode AR. (2005). The etr1-2 mutation in Arabidopsis thaliana affects the abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during maintenance of seed dormancy, moist-chilling and germination. Plant J. 42:35-48.
Danchin É, Charmantier A, Champagne FA, Mesoudi A, Pujol B, Blanchet S. (2011). Beyond DNA: integrating inclusive inheritance into an extended theory of evolution. Nat Rev Genet 12: 475-486.
Davila JI, Arrieta-Montiel MP, Wamboldt Y, Cao J, Hagmann J, Shedge V, Xu Y-Z, Weigel D, Mackenzie SA. (2011). Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis. BMC Biology9:64.
Donohue K. (2009). Completing the cycle: maternal effects as the missing link in plant life histories. Phil Trans R Soc B 364:1059-1074.
Feng X. (2008). The molecular basis of mitochondrial genome rearrangements in pearl millet and sorghum. PhD Dissertation, University of Nebraska, 94 pp.
56
Fornara F, de Montaigu A, Coupland, G. (2010). SnapShot: Control of flowering in Arabidopsis. Cell 141: 550.
Galloway L. (2005). Maternal effects provide phenotypic adaptation to local environmental conditions. New Phytol166: 93-100.
Galloway LF, Etterson JR. (2007).Transgenerational plasticity is adaptive in the wild. Science. 318:1134-1136.
Gill SS, Tuteja N. (2010).Polyamines and abiotic stress tolerance in plants. Plant Signal Behav 5: 26-33.
Ingram J, Bartels D. (1996). The molecular basis of dehydration tolerance in plants. Annu Rev Plant Physiol Plant Molec Biol 47: 377-403.
Johannes F, Colot V, Jansen RC. (2008). Epigenome dynamics: a quantitative genetics perspective. Nat. Rev Genet 9:883-890.
Martínez-Zapater JM, Gil P, Capel J, Somerville CR. (1992). Mutations at the Arabidopsis CHM locus promote rearrangements of the mitochondrial genome. Plant Cell 4(8): 889-99.
Miller FR. (1984). Registration of RTx430 sorghum parental line. Crop Sci. 24: 1224.
Nakano, T, Nagata N, Kimuro T, Sekimoto M, Kawaide H, Murakami S, Kaneko Y, Matsuchima H, Kamiya Y, Sato F, Yoshida S. (2003). CND41, a chloroplast nucleoid protein that regulates plastid development, causes reduced gibberellin content and dwarfism in tobacco. Physiol. Plant. 117:130–136.
Oliver MJ, Guo L, Alexander DC, Ryals JA, Wone BW, Cushman JC. (2011). A sister group contrast using untargeted global metabolomics analysis delineates the biochemical regulation underlying desiccation tolerance in Sporobolus stapfianus. Plant Cell 23: 1231-1248.
Park W, Li J, Song R, Messing J, Chen X. (2002). CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol.12:1484–1495.
Sakamoto W. (2003). Leaf-variegated mutants and their responsible genes in Arabidopsis thaliana. Genes Genet Syst. 78: 1-9.
Sandhu AS, Abdelnoor RV, Mackenzie SA. (2007). Transgenic induction of mitochondrial rearrangements for cytoplasmic male sterility in crop plants. Proc Natl Acad Sci USA 104:1766-1770.
Sangster TA, Queitsch C. (2005). The HSP90 chaperone complex, an emerging force in plant development and phenotypic plasticity. Curr Opin Plant Biol 8:86-92.
57
Shedge V, Arrieta-Montiel M, Christensen AC, Mackenzie SA. (2007). Plant mitochondrial recombination surveillance requires novel RecA and MutS homologs. Plant Cell 19:1251-1264.
Shedge V, Davila J, Arrieta-Montiel MP, Mohammed S, Mackenzie SA. (2010). Extensive rearrangement of the Arabidopsis mitochondrial genome elicits cellular conditions for thermotolerance. Plant Physiol. 152:1960–1970.
Storey JD, Tibshirani R. (2003). Statistical significance for genomewide studies. Proc. Natl. Acad. Sci. USA 100:9440-9445.
Willige BC, Isono E, Richter R, Zourelidou M, Schwechheimer C. (2011). Gibberellin regulates PIN-FORMED abundance and is required for auxin transport–dependent growth and development in Arabidopsis thaliana. Plant Cell 23: 2184–2195.
Xu Y-Z, Arrieta-Montiel MP, Virdi KS, de Paula WB, Widhalm JR, Basset GJ, Davila JI, Elthon TE, Elowsky CG, Sato SJ, Clemente TE, Mackenzie SA. (2011). MSH1 is a nucleoid protein that alters mitochondrial and plastid properties and plant response to high light. Plant Cell 23:3428-41.
Xu Y-Z, de la Rosa Santamaria R, Virdi KS, Arrieta-Montiel MP, Razvi F, Li S, Ren G, Yu B, Alexander D, Guo L, Feng X, Dweikat IM, Clemente TE, Mackenzie SA. (2012). The chloroplast triggers developmental reprogramming when MUTS HOMOLOG1 is suppressed in plants. Plant Physiol 159:710-720.
Yu F, Fu A, Aluru M, Park S, Xu Y, Liu H, Liu X, Foudree A, Nambogga M, Rodermel S. (2007). Variegation mutants and mechanisms of chloroplast biogenesis. Plant Cell Environ 30:350-365.
58
List of figures Chapter 2
Figure 2.1. Plant height distribution in a T3 MSH1 RNAi derived sorghum population and the wildtype cultivar (Tx430). The T3 generation had not been selected for the trait
indicated.
A B
Figure 2.2. Plant height response to gibberellic acid (GA) in seedling stage of MSH1-dr sorghum progenies, based on the last leaf (A) and second to last leaf (B). GAI is a segregant MSH1-RNAi population, while GAII lacks the transgene. Data were taken at 42 days after planting, and three weeks after GA application.
59
Figure 2.3. Wildtype phenotype can be restored for plant height as a response to exogenous gibberellic acid in MSH1-dr sorghum plants lacking the RNAi transgene. The plant at the left is wildtype, at middle is MSH1-dr transgene null sprayed with GA, and at the right is untreated MSH1-dr transgene null.
Figure 2.4. Reversal of the MSH1-RNAi phenotype and enhanced growth by crossing in sorghum. The MSH1-dr altered phenotype is characterized by dwarfed growth, enhanced tillering, altered leaf morphology, delayed flowering, and reduced stomatal density. In either direction of the cross, direct (a), or reciprocal (b) the MSH1-dr phenotype no longer contains the RNAi transgene. Both parental lines shown were derived from Tx430.
60
Figure 2.5. Evidence of transcriptional and metabolic changes in Arabidopsis msh1 mutant and hemicomplementation lines. A, Results from quantitative RT-PCR analysis of the msh1 mutant showing transcript-level changes in several genes controlling growth (cyclin P4:1 and Expansin), GA3 (Gibberellin2 Oxidase6 and GA-STIMULATED ARABIDOPSIS6), and auxin levels (PIN1/PIN7 AUXIN EFFLUX CARRIERS, IAA7 AUXIN-RESPONSIVE PROTEIN, and CYTOCHROME P450 79B3) in the plant. B, Quantitative RT-PCR assay of transcript levels from the four flowering-related genes MIR156, FLC, SOC1), and SHORT VEGETATIVE PHASE (SVP) in Col-0 and msh1 plants. Data are shown as fold change relative to the wild type (Col-0) with means ± SE from three biological replicates. C, RNA gel blot assay of rosette leaf and flower tissues for the flowering-related microRNAs miR156 and miR172. U6 was used as a loading control. D, A heat map with a subset of metabolites assayed in the study, comparing relative accumulation patterns in msh1, the mitochondrial hemicomplementation line (AOX), and the plastid hemicomplementation line (RUBP). Data provided by Drs. Ying-Zhi Xu and Bin Yu.
61
Figure 2.6. MSH1 methylation and gene expression. A, Sample bisulfate sequencing of the RNAi-targeted region of MSH1 in dwarf sorghum plants. Total genomic DNA from T4 dwarf plants with (7.8.1+) and without (22.1-) the MSH1-RNAi transgene, and from wild-type Tx430, was bisulfite treated, PCR amplified, and DNA sequenced. The sequence alignment shows results from wild-type Tx430 untreated DNA (Wtuntreated), wild-type Tx430 bisulfite-treated DNA (Wt), the dwarfed line minus transgene (22.1-) bisulfite-treated DNA, and the dwarfed line plus transgene (7.8.1+) bisulfite-treated DNA. Red boxes designate points at which cytosines were methylated in the presence of the RNAi transgene but reverted to nonmethylated when the transgene was lost. Gray boxes designate points where methylation was present in the wildtype and unaffected by the transgene. The sequence interval shown is that targeted by the RNAi transgene and contained within domain VI of MSH1. B, Quantitative RT-PCR analysis of MSH1 transcript levels in variant-phenotype sorghum plants with (+) and without (-) the MSH1-RNAi transgene relative to wild-type Tx430 (WT). Data from 1-week-old seedlings from three T4 lines containing the transgene (7.25.1+, 7.8.1+, 2.9.1+) and four T4 lines minus the transgene (28.1-, 25.1-, 22.1-, 11.1-) are shown relative to the wild-type inbred Tx430. The results are from three independent experiments. Some variation in transcript levels is evident, so that line 7.25.1+ shows elevated levels of MSH1 transcript relative to the other transgenic selections. This line is hemizygous for the transgene, whereas the other two lines are homozygous. The lines tested are T4 generation plants, where we have shown that the phenotype is stable with or without the transgene. As a consequence, it is assumed that this elevated level of MSH1 segregating within the T4 generation does not noticeably influence phenotype. Data provided by Dr. F. Razvi.
62
Figure 2.7. PCR products derived from T3 sorghum plants displaying the MSH1-dr phenotype. Primers used (Table 2.17) were designed to amplify a 750-bp segment of the RNAi transgene. Lane 10 shows results from wildtype Tx430.
63
List of Tables Chapter 2
Table 2.1. Phenotypic traits of T3 MSH1-RNAi derived progenies and wildtype (TX430) of sorghum. All T3 families are from a single transformation event.
% Leaf Variegation
% Male Sterility
Plant
Height
Progeny N Mean (cm)
Std Error
Max Value
Min Value Range
1 29 0 28 101 3.2 155 64 91 2 10 28 20 97 8.3 125 50 75 3 17 35 29 99 6.4 136 45 91 4 8 75 13 118 3.3 136 110 26 5 4 25 25 115 6.7 129 97 32 6 14 21 25 116 3.0 129 95 34 7 34 26 29 97 5.3 134 50 84 8 6 33 33 143 19.7 201 79 122 9 18 17 28 150 7.3 199 90 109
10 25 0 4 154 5.6 200 78 122 11 18 33 0 92 5.5 129 50 79
TX430 118 0 0 132 0.8** 150 106 44 **: Variances are significant different compared to wildtype (p<0.001).
Table 2.2. Frequency of MSH1-dr sorghum plants arising in T3 families. Eleven individual T3 families, all containing the MSH1-RNAi transgene, were evaluated for presence of the MSH1-dr phenotype (dwarfed stature, enhanced tillering, delayed flowering). In these cases, the identified MSH1-dr plants did not flower without GA application. All T3 families are from a single transformation event.
Family No. Plants No. MSH1-dr T3-1 29 0 T3-2 10 2 (20%) T3-3 17 3 (18%) T3-4 8 0 T3-5 4 0 T3-6 14 0 T3-7 34 9 (26%) T3-8 6 0 T3-9 18 0
T3-10 25 0 T3-11 18 3 (17%)
Total 183 17 (9.3%)
64
Table 2.3. Inheritance of the dwarf phenotype in T3, T4 and T5 generations following initial selection of the MSH1-dr (dwarf, high tillering, delayed flowering, non-transgenic) lines in T2. All plants showing the dwarf trait in each generation also showed enhanced tillering and delayed flowering, so plant height was used as the measure. Although only three generations are shown, stable heritability of the phenotype has been observed over six generations. Lack of the MSH1-RNAi transgene was confirmed in all populations by PCR (Figure 2.7).
Genotype N Plant height mean (cm)
Standard error
Tx430 30 111.8** 3.7 T3MSH1-dr 17 52.4 2.7 T4GAII3 18 43.7 4.3 T4GAII5 18 41.4 5.2 T4GAII6 18 40.5 4.9 T4GAII11 17 59.6 4.5 T4GAII15 19 45.1 5.6 T4GAII22 18 56.1 4.4 T4GAII23 15 55.1 4.6 T4GAII24 17 45.8 4.7 T4GAII25 15 44.0 4.6 T4GAII27 16 52.9 5.5 T4GAII28 18 56.5 4.1 T5GAII3 5 47.0 2.8 T5GAII5 5 43.6 2.3 T5GAII6 5 45.4 3.2 T5GAII11 5 40.8 3.0 T5GAII15 5 45.4 1.5 T5GAII22 5 52.2 5.0 T5GAII23 5 53.2 3.2 T5GAII24 5 53.4 3.2 T5GAII25 5 51.0 4.3 T5GAII27 5 46.8 4.4 T5GAII28 5 52.4 0.5
*All differences relative to TX430 are significant at P <0.001
Table 2.4. Mean comparison of different phenotypic traits between T4 MSH1-drŦ progenies and wildtype (WT) sorghum.
Ŧ: GAII-11 to GAII-28 are MSH1-dr sorghum lines whose nomenclature was maintained based on a preliminary gibberellic acid application screening. PH: Plant height (cm); PL: Panicle length (cm); DFAP: Days to flowering after planting; FR: Flowering rate x 100, based on the number of flowering plants per progeny; F: Fertility rate x 100 of flowering plants; ***, **. *: Significant compared to wild type, (p<0.0001), (p<.0001), and (p<.05), respectively.GAII-15 and GAII-24 showed significant male sterility compared to WT and other MSH1-dr lines.
65
Table 2.5. Mean stomatal number per sample in sorghum non-transgenic MSH1-dr plants versus wildtype TX430. Counts were taken from adaxial and abaxial surfaces of each leaf. Stomatal numbers were significantly lower (P<0.0001) between Tx430 and the MSH1-dr plants for both adaxial and abaxial readings.
Adaxial Abaxial
Genotype N Mean StdDev N Mean StdDev
TX430 20 41** 6 20 54** 11
MSH1-dr 18 21 3 18 30 4
**: Significant differences (p<0.001)
Table 2.6. Plant height (PH) response to gibberellic acid in MSH1-dr sorghum seedlings at 55 days after planting.
PH (cm) Last leaf PH (cm) Second Last leaf
No. of tillers
Progeny 1250 ppm GA
2500 ppm GA
1250 ppm GA 2500 ppm GA 1250 ppm GA
2500 ppm GA
GAI 38 46 52 59 4.8 4.6 GAII 40 48 58 69 5.2 3.8
PH: Plant height mean values as the average of 5 plants in each treatment. Data were taken five weeks after GA application.
Table 2.7. Mean comparison of different traits between MSH1-dr progenies of sorghum at different gibberellic acid concentrations.
DFL: Days to flowering after GA application; Plant height (cm); PL: Panicle length (cm); NT: Number of tillers, 30 days old at re-growth. Mean values followed by different letter within the same column are statistically different. NF †: No flowering detected during the period of the experiment; NA: Not apply. GAI is a segregant population for the MSH1 RNAi trangene, while GAII is MSH1-dr minus transgene.
66
Table 2.8. Plant height of the F1 between sorghum MSH1-dr x Tx430, and parental lines.
Genotype N Mean (cm) SE ∆ (%) GAII11 x Tx430 7 172.4*** 2.1 77 GAII15 x Tx430 15 136.8*** 7.5 40 GAII22 x Tx430 5 122.2 NS 17.3 25 GAII24 x Tx430 19 113.3* 6.4 16 GAII25 x Tx430 12 121.4*** 6.7 24 GAII28 x Tx430 13 124.2** 9.8 27
GAII11 17 59.6*** 4.5 - GAII15 19 45.1*** 5.6 - GAII22 18 56.1*** 4.4 - GAII24 17 45.8*** 4.7 - GAII25 15 44.0*** 4.6 - GAII28 18 56.5*** 4.1 -
WT Tx430 16 97.6 2.3 - *,***: Significant differences compared to wildtype Tx430, p<0.05 and p<0.0001, respectively; NS: Non significant. The MSH1-dr phenotype was non transgenic. ∆ (%): Change in plant height compared to wildtypeTx430.
Table 2.9. Plant height in the F1 of reciprocal crosses (RC) of sorghum TX430 x MSH1-dr, and parental lines.
Genotype N Mean (cm) SE ∆ (%) RC1 Tx430 x GAII22 8 142.8*** 10.4 33 RC2 Tx430 x GAII23 8 123.1 NS 7.5 15 RC3 Tx430 x GAII44 6 172.2*** 3.9 60
GAII22 (P1) 4 50.8*** 12.5 - GAII23(P1) 5 40.0*** 6.3 - GAII44 (P1) 4 34.0*** 1.8 - WT Tx430 13 107.5 3.7 -
P1, P2, and P3: Male parental lines in reciprocal crosses 1, 2, and 3 (RC1, RC2, and RC3), respectively. ***: Differences compared to wildtype TX430 are significant (p<0.0001).Even though the PH mean value of RC2 was not different from Tx430, there were individual values that surpassed the mean of wildtype. The MSH1-dr phenotype was non transgenic. ∆ (%): Change in plant height compared to Tx430.
67
Table 2.10. Plant height of the F1 progeny between non dwarf male sterile sorghum plants (MSH1- or MSH1+) x Tx430.
Trt N PH (Mean cm) SE
1: MSH1 (-) x WT 42 105 NS 3.8
2: (MSH1 (+) x WT 30 105 NS 5.0
3: Tx430 (WT) 13 113 5.0
MSH1 (-) and MSH1 (+) were female plants, male sterile; (-) indicates lack of the MSH1 transgene after genetic segregation; (+): indicates transgenic plants; both parental lines were screened by PCR. NS: non
significant differences compared to WT (p=0.4).
Table 2.11. Plant height mean values of individual F1 progenies between non dwarf male sterile sorghum plants (MSH1-) x Tx430.
Trt N PH SE Max value Min Val Range 1 9 88.7** 5.1 111 63 48 2 9 132.0 11.4 183 90 93 3 8 98.0* 4.9 113 70 43 4 8 102.5 6.0 126 85 41 5 8 103.1 4.3 117 80 37
WT (selfed) 13 107.0 3.7 135 93 42 PH: Plant height (cm); *, **: significant differences compared to wildtype, p<0.05 and p<0.001, respectively.
Table 2.12. Plant height mean values (cm) of F1 between MSH1-dr transgenic sorghum plants pollinated by wildtype pollen.
Genotype N PH (cm) SE
1: St 2.9 xTx430 8 44.6 b *** 12.1 2: St 7.22 x Tx430 8 102.1 a 4.1 3: St 7.7 x Tx430 8 111.8 a 2.1 4: Tx430 (WT) 8 113.1 a 5.0
PH: Plant Height (cm); ***: significant differences, p<0.0001. All the females were MSH1-dr phenotype and RNAi transgenic.
68
Table 2.13. Fertility restoration in the progeny of male sterile T3 plants MSH1 minus or MSH1 plus transgene, pollinated by wildtype, or MSH1 transgenic pollen.
Genotype N FR (%) SE MSH1(-) x (WT) 42 100a 0.0 MSH1(+) x (WT) 30 93a 0.1 MSH1(-) x MSH1(+) 26 92a 0.1 MSH1(+) x MSH1(+) 28 64 b*** 0.1
All the plants used as females were male sterile; ***: significant differences, p< 0.0005; FR (%): Fertility rate x 100; percentage values followed by the same letter are not different statistically.
Table 2.14. Sample Arabidopsis gene expression changes observed in association with altered phenotypes (genes, shown as fold change, significant at FDR<0.1). Shading designates down-regulation, non-shaded up-regulation.
69
Table 2.15. Changes in GA content with loss of MSH1*
Sorghum Arabidopsis
Tx430 MSH1-RNAi Col-0 msh1
GA53 54 ± 12 24 ± 4 7 ± 0 N.D.
GA19 168 ± 7 125 ± 4 11 ± 0 N.D.
GA44 24 ± 7 N.D.
*Sorghum and Arabidopsis lines selected for testing showed dwarf phenotype.
Table 2.16. Metabolite changes in Arabidopsis msh1 and sorghum MSH1-RNAi plants.
70
Table 2.17. Primers used in quantitative PCR and hybridization assays
MIR156a-F 5'- CTC AAG TTC ATT GCC ATT TTT AGG -3'
MIR156a-R 5'- GAG AGA TTG AGA CAT AGA GAA CGA AGA -3'
FLC-F 5'- GGA TGC GTCA CAG AGA ACA G-3'
FLC-R 5'- CGA CAA GTC ACC TTC TCC AA-3'
SVP-F 5'- TGA ATC GGA GAA CGC TGC TGT GTA -3'
VP-R 5'- TCT AAC CAC CAT ACG GTA AGC CGA -3'
SOC1-F 5'- TAA GGA TCG AGT CAG CAC CAA ACC -3'
SOC1-R 5'- AGC ATG TTC CTA TGC CTT CTC CCA -3'
GA2OX6-F 5'- TGAATCACTATCCACCAGCACCGT
GA2OX6-R 5'- AAGGCAGTCACCGACCAATACGAA
CYCP4;1-F 5'- ATC ACT AGT GTC ATG GTC GCT GCT -3'
CYCP4;1-R 5'- GTA GGC GTT GAA TGT GTT TGG CGT -3'
EXPA8-F 5'- TCA ACC ATC ACC GTC ACA GCT ACA -3'
EXPA8-R 5'- ATG CTG AAG AGG AGG ATT GCA CCA -3'
GASA6-F 5'- TGT GGA GGA CAA TGC ACA AGG AGA -3'
GASA6-R 5'- GGA GGG ACA CAA AGG CAT TTA GCA -3'
PIN1-F 5'- TGC TCG TTG CTT CTT ATG CCG TTG -3'
PIN1-R 5'- ACC GCA GTG CTA AGA ATG TCA GGA -3'
PIN7-F 5'- TTG GGC TCT TGT TGC TTT CAG GTG -3'
PIN7-R 5'- TGC CAT ACC AAG ACC AGC ATC AGA -3'
IAA7-F 5'- ACG TTT CTG CTG TTC CCA AGG AGA -3'
IAA7-R 5'- ACC ACT ACT GGT CTT CTG CTG AGT -3'
CYP79B3-F 5'- ACG ACC GTC GCA GGT TAC CAT ATT -3'
CYP79B3-R 5'- AGC ACA TCC TCT CTT TCC GGT ACT -3'
SorMshIRt-Fu1 5’- TGG CTA CTC AAT AGG AGG CAG GAA -3’
SorMshIRt-Ru1 5’- AT GCA CAA GGC TAG CAC CAC TGA -3’
Sb10g028020UBQ10-F 5'- TTG TGA AGA CCC TCA CTG GCA AGA -3’
Sb10g028020UBQ10-R 5'- AAT CAG CAA GGG TAC GAC CAT CCT -3’
3-2L 5’- AAACAACCAAAAAAAAAAACATACCT-3’
3-2R 5’-TGTTATTTTTATTGTAAAGATTTAATAGTTT-3’
3-2Ln 5’-CAAAAAAACTAAAAAACTATATTTAACT-3’
Probes for small RNA gel blot analysis
U6 5’TCATCCTTGCGCAGGGGCCA3’
miR156 5’GTGCTCACTCTCTTCTGTCA3’
miR172 5’ATGCAGCATCATCAAGATTCT3’
Assay for sorghum RNAi transgene
Intron-rev 5’GTGTACTCATCTGGATCTGTATTG3’
msf8 5’GGTTGAGGAGCCTGAATCTCTGAAGA3’
71
Chapter 3
Organelle perturbation alters the epigenome to produce
dramatic and heritable changes in plant growth
Abstract. MUTS Homologue1 is a nuclear- encoded protein that is unique to
plants; it is targeted to mitochondria and plastids where it confers organellar
genome stability. RNAi down regulation of MSH1 expression influences
phenotypic variation in different dicot and monocot species, effecting
developmental reprogramming of numerous morphological traits and metabolic
pathways. In sorghum, the new phenotype, designated MSH1-dr, is
characterized by dwarfing, increased branching, delayed flowering, and
increased catabolism of gibberellic acid. When MSH1-dr plants are crossed
directly or reciprocally with the original cultivarTx430, the F1 progeny show
enhanced performance for grain yield (GY)/panicle, plant height (PH), fresh
biomass yield (FBM), and dry biomass yield (DBY). These differences were also
significant in the tested F2 to F4 generations compared to the wild type cultivar,
with increase of the mean values up to 70% for GY/panicle, 72% for PH, and
100% for FBM and DBY in two cycles of selection. These changes were more
pronounced in an unfertilized, soybean-maize rotation field, than in another
supplemented with Nitrogen, with the exception of PH; significant interaction
effects were seen between environment and the derived sorghum progenies for
GY, FBM and PH. In Arabidopsis ecotype Columbia-0, similar phenotypic effects
were accompanied by changes in DNA methylation status of the genome. It is
72
postulated that the observed changes in plant growth are the consequence of
epigenetic effects following retrograde signaling by the chloroplast. These results
imply a role of plant organelles in plant adaptation to particular environmental
conditions and, perhaps, in expression of heterotic effects as well. We suggest
that this type of analysis might serve to improve current plant breeding systems.
73
Introduction
The epigenome is thought to act as an interface between genotypes and
environmental signals that define the phenotype of living organisms (Bonasio et
al. 2010) by regulating gene expression (Rabinowicz et al. 2005; Makarevitch et
al. 2007). In plants, the signaling processes that participate in the final outcome
of a given phenotype have not been well elucidated, but evidence suggests a
possible role of mitochondria and chloroplasts in retrograde signaling to the
nucleus (Rhoades and Subbaiah, 2007; Nott et al. 2006), raising the question of
how organelle signaling and epigenetic changes might be interlinked to define
plant phenotypy.
Trans-generational inheritance of epigenetic changes is increasingly
evident from numerous studies (Kakutani 2002; Daxinger and Whitelaw, 2010),
and evidence exists for the feasibility to create, in Arabidopsis, new and stable
epigenetic states (Johannes et al. 2009; Reinders et al. 2009; Roux et al. 2012).
In Arabidopsis it is feasible to identify mutations of methyl transferase 1 (met1)
and decresead DNA methylation (ddm) that permit the development of epi-RIL
populations that show both heritability of novel methylation patterning and
epiallelic segregation, underscoring the influence of epigenomic variation in plant
adaptation (Roux et al. 2011).
In maize and Arabidopsis, heritable DNA methylation pattern differences
have been observed among inbred lines (Eichten et al. 2011) and resulting
hybrids that may be related to heterosis (Shen et al. 2012). In natural
populations, the epiallelic variation may be highly dynamic and, in Arabidopsis, is
74
found predominantly in CpG methylation within gene-rich regions of the genome
(Becker et al. 2011; Schmitz, 2011).
Plant organelles have been determined to function as environmental
sensors that trigger metabolic and morphological responses under normal or
stressful conditions (Liu and Butow, 2006; Bouvier et al. 2009). For example,
heat and drought stress induce changes in mitochondrial functions that, in turn,
alter the synthesis of reactive oxygen species (ROS) (Rhoades et al. 2006), and
modify the redox status (Shedge et al. 2010), the electron transport chain (ETC),
and the synthesis of ATP (Xu et al. 2012). Morphological traits derived from
mitochondrial dysfunction include male sterility and changes in heat tolerance
(Hanson and Bentolila, 2004; Shedge et al. 2010). Chloroplasts have been more
extensively studied for their role in photosynthesis (Bouvier et al. 2009), but there
is also evidence that they are involved in modulation of jasmonic acid, gibberellic
acid, C/N ratio, lipids, and amino acids (Sakamoto et al. 1996; Bouvier et al.
2009).
The MutS Homologue1 (MSH1) gene has been shown to participate in
recombination surveillance of the mitochondrial and chloroplast genomes,
conferring organellar genome stability (Arrieta-Montiel et al. 2009). When MSH1
is disrupted, either by RNAi or point mutation, novel phenotypes emerge in
Arabidopsis, soybean, tobacco, tomato, pearl millet, and sorghum that include
leaf variegation, male sterility, delayed flowering, altered branching, reduced
stomatal density, and dwarfing (Martinez-Zapater et al. 1992; Sandhu et al. 2007;
Feng, 2008; Xu et al. 2012). In sorghum, a new phenotype was designated as
75
developmental reprogramming (MSH1-dr, Xu et al. 2012) which combines
dwarfing, delayed flowering, high branching, and increased gibberellic acid
catabolism, and has been observed in different dicot and monocot species.
The objective of this study was to test the performance of sorghum
progenies derived from crosses between MSH1-dr and wild type phenotypes,
with the hypothesis that plant organellar disruption alters the epigenome and
derives heritable phenotypic plasticity, producing new morphological variants
suitable for use in plant breeding programs.
76
Materials and methods
Plant materials
The sorghum germplasm used in these experiments was generated by Feng
(2008). Briefly, Agrobacterium mediated transformation of the commercial
sorghum inbred line Tx430 (Miller, 1984) was conducted with an RNAi construct
to down-regulate MSH1. Phenotypic variation of the transformants was
assessed, with variegation as the first evident change (Feng, 2008; Xu et al.
2012), with derived T2 plants showing evidence of tillering, delayed flowering and
dwarfism; these were defined as Msh1-dr plants. A T3 line consisting of 45
siblings displaying the MSH1-dr phenotype, all lacking the MSH1 RNAi
transgene, was grown under greenhouse conditions and the individual plants
were designated GAII1-GAII45. Six of them, GAII11, GAII15, GAII22, GAII24,
GAII25, and GAII28 were used as females in crosses to wildtype inbred Tx430 to
derive F1 seed, whereas three reciprocal crosses were conducted with plants
GAII22, GAII23, and GAII27. Day temperature in the greenhouse was 26°C to
28°C, and night was 21°C to 23°C.
The F1 progenies were grown in the same greenhouse conditions and
comprised a variable number of individuals; thus, GAII11 x Tx430, GAII15 x
Tx430, GAII22 x Tx430, GAII24 x Tx430, GAII25 x Tx430, and GAII28 x Tx430
were represented by: 7, 15, 5, 19, 12 and 12 plants, respectively. In addition, T4
plants were grown with self-pollinated seed from the six maternal MSH1-dr plants
with 17, 19, 18, 17, 15, and 18 individuals for GAII11, GAII15, GAII22, GAII24,
77
GAII25, and GAII28, respectively; Tx430 was represented by 16 plants. Self-
pollinated seed of every F1 plant was harvested individually to derive epi-lines
corresponding to the F2 generation, following the pedigree system.
Field experiments
During summer 2010 and 2011, the F2 generation was grown in two field
experiments established under rainfed conditions in the Havelock Experiment
Station of University of Nebraska, in Lincoln, NE. They were arranged under an
incomplete block design; the first experiment consisted of one replication, with 15
blocks and 30 entries per block (30 x 15 alpha lattice). Individual lines were
planted under a panicle per row design, with a single row plot of 5 m length and
0.75 m between rows; this allowed collection of F3 seed.
The second experiment comprised seven blocks of 28 entries each (28 x 7
alpha lattice), with three replications allocated in two environments; replications I
and II were fertilized with supplemental Nitrogen at a dosage of 100 kg/ha
(Environment I); the third replication was planted in a plot that had been rotated
with soybean-maize (Environment II). Based on net grain yield per panicle
(NGY), 48 samples from the 2010 experiment were selected to grow the F3 in the
field. Those samples represented the six original crosses and included high and
low grain yield values. Previously, a subgroup of 17 F3 samples had been
selected based on dry panicle weight (DPW) to derive F4 seed under greenhouse
conditions. Thus, the 2011 field experiment comprised: 61, 77, and 42 entries
78
corresponding to the F2, F3 and F4 generations, respectively, and the wild type
cultivar, Tx430, as a control; the F2 included 13 entries from reciprocal crosses.
Phenotypic traits
In both experiments, the phenotypic traits recorded were: plant height (PH), in cm
from the ground to the tip of the panicle, fresh and dry biomass yield (FBY and
DBY) (g), and net grain yield (NGY) (g) per head. Sample size of each trait
varied from five to ten random inner-row plants per plot. Healthy and well
shaped heads were bagged before anthesis for self-pollination, and harvested at
physiological maturity; at this point FPW was measured; the heads were dried at
26oC during 30 days to proceed with NGY records. Biomass samples consisted
of three-plant samples that were bagged and weighed after cutting to obtain
FBW; they were also integrated by random inner-row plants, and completely
dried at 70oC during 15 days to measure DBY.
Statistical analyses
Analyses of variance to test for epiG*E interactions were conducted (GLIMMIX,
SAS 9.2); when appropriate, mean comparison tests were carried out within each
environment for the traits indicated, comparing the sorghum epi-lines versus the
wild type.
79
Genotyping MSH1-dr plants
Presence/absence of the transgene in sorghum was confirmed by PCR
screening with the primers: 5’ GTG TAC TCA TCT GGA TCT GTA TTG-3’ and
5’- GGT TGA GGA GCC TGA ATC TCT GAA GAA C-3’. The conditions of the
reaction were: initial denaturation at 95°C during 5 min, 30 cycles of denaturation
at 95°C during 30 s, annealing at 55°C during 1 min, and extension at 72°C
during 2 min; a final extension was set at 72°C during 10 min. Positive and
negative controls were included in the analysis with transgenic samples and wild
type, respectively.
Arabidopsis Col-0 and msh1 mutant lines were obtained from the
Arabidopsis stock center and grown at 12hr daylight, 22°C. MSH1-epi lines were
derived by crossing MSH1-dr lines with wildtype plants. Arabidopsis plant
biomass and rosette diameters were measured for 4-week-old plants, and
flowering time was measured as date of first visible flower bud appearance. For
hemi-complementation crosses, mitochondrial (AOX-MSH1) and plastid (SSU-
MSH1) complemented homozygous lines were crossed to Col-0 wild type plants.
Each F1 plant was genotyped for transgene and wild type MSH1 allele with
primers: RNAi-F 5’-GTGTACTCATCTGGATCTGTATTG-3’ and RNAi-R 5’-
GGTTGAGGAGCCTGAATCTCTGAAC-3’, and harvested separately. Three F2
families from AOX-MSH1 x Col-0 and two F2 families from SSU-MSH1 x Col-0
were evaluated for growth characters. All families were grown under the same
conditions, and biomass, rosette diameter and flowering time were measured.
Two-tailed Student t-test was used to calculate p-values. The Arabidopsis
80
experiments were carried out by Kamaldeep Virdi, Dr. Maria Arrieta-Montiel and
Dr. Ying-Zhi Xu.
SSR marker screening
Genetic polymorphism was assessed in some epi-lines of the F2, F3, and F4
generations that displayed phenotypic diversity. They were screened by 43
markers that showed polymorphism between sweet sorghum “Wray” and Tx430.
SAM16073 primers were used, and the samples included sweet sorghum “Wray”
and the wild type cultivar Tx430, as positive and negative controls, respectively;
the test included also one MSH1-dr line, transgene null, displaying the dwarfed,
tillered, delayed flowering phenotype; DNA samples were isolated with the urea
method, in experiments that were conducted by Dr. Yashitola Wamboldt, Hardik
Kundariya and Omar Lozano.
Results
The MSH1-dr sorghum phenotype is fully penetrant under self-pollination,
and derives enhanced growth in crosses to wildtype, with expanded
phenotypic variation.
Figure 3.1 shows the transgene and mutant crossing process that was
used in this study for both sorghum and Arabidopsis. In sorghum, all experiments
were conducted with the inbred line Tx430 (Miller, 1984), whereas Arabidopsis
experiments were carried out in the inbred ecotype Columbia-0.
81
MSH1-dr sorghum plants that no longer contain the MSH1-RNAi
transgene display normal MSH1 transcript levels (Xu et al. 2012). However, they
maintain the altered growth phenotype through multiple generations of self-
pollination, and when crossed directly or reciprocally to the wild type inbred
Tx430 line, produce progeny that are restored to normal phenotype (Figure 3.2).
The derived F1 progeny, designated MSH1-epiF1, no longer show the dwarfed,
high tillering, and late flowering phenotype; in fact, many of the plants grow taller
and set more seed than the wildtype (Xu et al. 2012, Figure 3.2A). Self-
pollination of the MSH1-epiF1 plants produces an F2 population (MSH1-epiF2)
that is strikingly variable in plant phenotype (Table 3.1), with bimodal distribution
for plant height and grain yield (Figure 3.3 for plant height), but shows low
frequency, 1-2 %, of the MSH1-dr phenotype. A small proportion of greenhouse-
grown MSH1-epiF3 families showed the MSH1-dr phenotype at a frequency of
ca. 8% (Table 3.2) that may be derived from inadvertent selection; however, no
dwarf phenotype appeared in the epi-F4 lines.
Derived epi-lines show enhanced growth for agronomic traits with
significant environmental interaction effects.
The MSH1-epiF2 lines and subsequent populations derived by self-
pollination, show variation for agronomic performance traits. The allocation of the
experiment in two growing conditions permitted to make inferences about
interactions between epi-lines and environment. Environment I was
supplemented with 100 kg of Nitrogen/ha, whereas the Environment II was not
82
fertilized, but had been rotated in previous seasons between soybean and maize
crops. The analyses of variance indicate significant interaction effects between
epi-lines and environments for grain yield/panicle, plant height, and above-
ground fresh biomass, p< 0.0001, p< 0.05, and p< 0.05, respectively; dry
biomass, in contrast, shows no interaction with environment (p<0.08). The
highest mean values for grain yield, and fresh and dry biomass yield were
recorded in the non-fertilized field (Figure 3.4 for grain yield in F2 epi-lines), while
the highest values of plant height were observed under nitrogen
supplementation. Within both environments, different epi-lines of each
generation, from F2 to F4, show higher mean values than wildtype for grain yield
and biomass yield; significantly higher grain yield was combined with either tall
plants or epi-lines that grow like wildtype (Table 3.3), and the changes observed
in the traits recorded were up to 70% for GY, 72% for PH, and 100% for FBM
and DBY; moreover, the outstanding response of the epi-lines with fertilization
indicates that they are more responsive to Nitrogen than wildtype, and suggest
they display a better Nitrogen use efficiency rate, even in absence of Nitrogen
supplementation.
Enhanced growth is also observed in derived progenies of msh1 mutant x
wildtype Arabidopsis
Similar changes in growth were observed in Arabidopsis populations derived
from crossing the msh1 mutant with wild type, followed by selection for the
homozygous MSH1/MSH1 F2 plants and serial self-pollination (Figure 3.5; Table
3.4).
83
Earlier studies showed that altered plant development in sorghum MSH1-
dr and Arabidopsis msh1 mutant lines, including variation in growth rate,
branching, maturation and flowering, was conditioned by chloroplast changes (Xu
et al. 2012). We were interested in assessing the relationship of MSH1-epiF2
variation to these organellar influences. Arabidopsis MSH1 hemi-
complementation lines, derived by introducing a mitochondrial- versus
chloroplast-targeted MSH1 transgene to the msh1 mutant line (Xu et al. 2011),
distinguish mitochondrial and chloroplast contributions to the phenomenon. Both
mitochondrial and chloroplast hemi-complementation lines were crossed as
females to wild type (Col-0) to produce F1 and F2 progeny. F1 plants from crosses
to the chloroplast-complemented line produced phenotypes similar to wildtype,
although about 25% of the F1 plants showed altered leaf curling and delayed
flowering (Figure 3.5). This curling phenotype may be a consequence of MSH1
over expression, since F1 plants contain both the wild type MSH1 allele and the
transgene. The phenotype resembles effects of altered salicylic acid pathway
regulation, an epigenetically regulated process (Stokes et al. 2002), and is being
investigated further. F1 progeny from crosses to the mitochondrial complemented
line displayed phenotypic variation in plant growth, with over 30% of the plants
showing enhanced growth, larger rosette diameter, thicker floral stems and
earlier flowering time, similar to MSH1-epiF4 phenotypes (Figure 3.6). These
results were further confirmed in the mitochondrial vs. chloroplast-complemented
F2 populations (Figure 3.5B-E), and suggest that the MSH1-epiF4 enhanced
84
growth changes derive from restoring MSH1 function to plants that have
undergone the MSH1-dr developmental reprogramming phenomenon.
The phenotypic traits are responsive to selection
PH displayed the highest stability since tall entries were observed in the three
generations tested with increased uniformity through generations. Although
GY/panicle was subjected to less rigorous selection during growth in the
greenhouse to obtain the sorghum F4, response to selection was observed in GY
(Figure 3.7 for high GY, and Figure 3.8 for low GY). These results suggest a high
degree of heritability and selection response for the variation observed, with
changes for grain yield around 16 to 21% per cycle of selection for either high or
low grain yield.
MSH1-dr and derived epi-lines are not polymorphic compared to wildtype
Samples of the wild type cultivar Tx430, a Tx430 MSH1-dr line (transgene null),
and selected F2, F3 and F4 derived epi-lines that were assayed for DNA
polymorphism with different SSR markers show uniformity for all markers (Figure
3.9 ; Table 3.5); these results support our conclusion that the range of phenotypic
variation observed is non-genetic.
85
Discussion
Results of this study are evidence of organellar effects over epigenetic variation
that condition phenotypic variability, with novel traits subject to selection based
on the transgenerational inheritance observed. Moreover, RNAi down-regulation
of MSH1 is a mechanism to disrupt plant organelles, initiate these phenotypic
changes, and derive a series of phenotypes in different plant species.
Outstandingly, the heritability of the new traits, as demonstrated in
sorghum and Arabidopsis, remains after genetic segregation of the transgene;
i.e.in both species, enhanced growth is observed in the F1 and derived progenies
from the cross between MSH1-dr and wildtype phenotypes. Therefore, the
MSH1-dr phenotype, lacking the MSH1 transgene, and characterized by
dwarfing, delayed flowering, high branching, and increased GA catabolism is a
crucial component of this response, since enhanced growth is not observed, as
tested in sorghum, in crosses between wildtype and MSH1-dr transgenic plants
or those transformant transgene null lines that undergo normal growth (see
chapter 2). The enhanced growth observed in Arabidopsis through genetic hemi-
complementation was associated with plastid perturbation (Xu et al. 2012), as
well as with changes in the methylome status of the genome (Xu et al.
unpublished). In contrast, in sorghum, enhanced growth was observed in crosses
of MSH1-dr individuals after segregation of the transgene, either in direct or
reciprocal crosses; this observation indicates that the improved performance of
derived progenies is not from organellar effects, and suggests heritable
epigenetic effects, since the genetic background in both parents is Tx430; this
86
was confirmed by the lack of polymorphism in SSR marker screening between
wildtype Tx430 and derived epi-lines.
Disruption of MSH1 produces developmental alterations in the plant, and
genetic data to date show that these derive from plastid changes (Xu et al. 2012).
The behavior of the MSH1-dr phenotype, showing independence from the
transgene and involvement of multiple developmental pathways, implies that
MSH1-dr changes are epigenetic. The most dramatic natural reprogramming of
the epigenome in plants occurs during reproductive development (Hsieh et al.
2009; Gehring et al. 2009). MSH1 expression is highest during reproduction, with
transcripts detected in both ovule and anther tissues (Shedge et al. 2007). MSH1
steady state transcript levels are also markedly reduced in response to
environmental stress (Xu et al. 2011; Shedge et al. 2010). Consequently, it is
plausible that MSH1 participates in the environmental sensing mechanism of the
plant, presumably acting via its direct interaction with the chloroplast.
MSH1 suppression represents a novel means of altering phenotype
behavior in plant lines; the approach elucidates variation within a plant lineage
that is heritable and selection-responsive. It is conceivable that MSH1
participates in plant phenotypic canalization and epigenetic remodeling, serving
as a means of relaxing genetic constraint on phenotype to meet conditions of
environmental change (Kalisz and Kramer, 2008). The surprisingly high levels of
variation derived within a single inbred sorghum genotype in this study suggest
that the process could be readily integrated to a crop breeding program for
enhancing productivity, improving stress tolerance and directly identifying epi-
87
alleles that underlie phenotypic variation for agronomic performance. We
observed significant increase in grain yield, above-ground biomass, and plant
height in sorghum epi-lines derived from Tx430 following two generations of mild
selection. Whether all of this is feasible across a range of crops, and stable under
larger scale analysis, will be a crucial question for future investigation.
88
References
Abdelnoor RV, Yule R, Elo A, Christensen AC, Meyer-Gauen G, Mackenzie SA. (2003). Substoichiometric shifting in the plant mitochondrial genome is influenced by a gene homologous to MutS. Proc. Natl. Acad. Sci. USA 100:5968-5973.
Abdelnoor RV,Christensen AC, Mohammed S, Munoz-Castillo B, Moriyama H, Mackenzie SA. (2006). Mitochondrial genome dynamics in plants and animals: convergent gene fusions of a MutS Homologue. J Mol Evol 63:165–173.
Arrieta-Montiel MP, Shedge V, Davila J, Christensen AC, Mackenzie SA. (2009). Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity. Genetics 183:1261–1268.
Becker C, Hagmann J, Müller J, Koenig D, Stegle O, Borgwardt K, Weigel D. (2011). Spontaneous epigenetic variation in the Arabidopsis thaliana methylome. Nature 480:245-249.
Bonasio R, Tu S, Reinberg D. (2010). Molecular signals of epigenetic states.
Science 330: 612-616. Bouvier F, Mialoundama AS, Camara B. (2009). A sentinel role for plastids.The
Chloroplast-interactions with the environment.Sandelius A. S. and Aronsson H., (Eds) Springer-Verlag, Berlin: 267-292.
Daxinger L, Whitelaw E. (2010). Transgenerational epigenetic inheritance: More questions than answers. Gen. Res 20:1623–1628.
Eichten SR, Swanson-Wagner RA, Schnable JC, Waters AJ, Hermanson PJ, et al. (2011). Heritable Epigenetic Variation among Maize Inbreds. PLoS Genet 7(11): e1002372.
Feng X. (2008). The molecular basis of mitochondrial genome rearrangements in pearl millet and sorghum. PhD Dissertation. University of Nebraska-Lincoln. 94 pp.
Gehring M, Bubb KL, Henikoff S. (2009). Extensive demethylation of repetitive elements during seed development underlies gene imprinting. Science 324: 1447-1451.
Hanson MR, Bentolila S. (2004). Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell 16:S154–S169.
89
Hsieh T-F, Ibarra CA, Silva P, Zemach A, Eshed-Williams L, et al. (2009). Genome-wide demethylation of Arabidopsis endosperm. Science 324:1451-1454.
Johannes F, Porcher E, Teixeira FK, Saliba-Colombani V, Simon M, et al.
(2009). Assessing the impact of transgenerational epigenetic variation on complex traits. PLoS Genet 5:6:e1000530.
Kakutani T. (2002). Epi-alleles in plants: inheritance of epigenetic information over generations. Plant Cell Physiol. 43:10: 1106–1111.
Kalisz S, Kramer EM. (2008). Variation and constraint in plant evolution and development. Hered. 100: 171-177.
Krueger F, Andrews SR. (2011). Bismark: a flexible aligner and methylation caller
for Bisulfite-Seq applications. Bioinformatics 27:1571-1572 (2011). Lister R, O'Malley RC, Tonti-Filippini J, Gregory BD, Berry CC, Millar AH,et al.
(2008). Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133:523-36.
Liu Z, Butow RA. (2006). Mitochondrial Retrograde Signaling. Annu. Rev. Genet. 2006. 40:159–85.
Mackenzie S, McIntosh. (1999). Higher Plant Mitochondria. Plant Cell11: 571–585.
Makarevitch I, Stupar RM, Iniguez AL, Haun WJ, Barbazuk WB, Kaeppler SM, and Springer NM. (2007). Natural variation for alleles under epigenetic control by the maize chromomethylase Zmet2. Genetics 177: 749–760.
Martínez-Zapater JM, Gil P, Capel J, Somerville CR. (1992). Mutations at the
Arabidopsis CHM locus promote rearrangements of the mitochondrial genome. Plant Cell 4(8):889-99.
Miller FR. (1984). Registration of RTx430 sorghum parental line. Crop Sci.
24:1224. Nott A, Jung H-S, Koussevitzky S,Chory J. (2006). Plastid-to-nucleus retrograde
signaling.Annu. Rev. Plant Biol.2006. 57:739–59. Notredame C, Higgins DG, Heringa J. (2000). T-Coffee: A novel method for fast
and accurate multiple sequence alignment. J Mol Biol. 302:205-217.
90
Paszkowski J, Grossnikl U. (2011). Selected aspects of transgenerational epigenetic inheritanceand resetting in plants. Current Opinion in Plant Biology 2011, 14:195–203.
Rabinowicz PD, Citek R, Budiman MA, Nunberg A, Bedell JA, et al. (2005).
Differential methylation of genes and repeats in land plants. Gen Res, 15:1431–1440.
Reinders J, Wulff BBH, Mirouze M, et al. (2009). Compromised stability of DNA
methylation and transposon immobilization in mosaic Arabidopsis epigenomes. Genes Dev 23:939-950.
Richards EJ. (2006). Inherited epigenetic variation —revisiting soft inheritance
Nat. Rev. Genet: 7:395-401. Rhoades DM, Subbaiah CC. (2007). Mitochondrial retrograde regulation in
plants. Mitochondrion 7: 177-194. Roux F, Colomé-Tatché M, Edelist C, Wardenaar R, Guerche P, et al. (2011).
Genome-wide epigenetic perturbation jump-starts patterns of heritable variation found in nature. Genetics: 188: 1015–1017.
Sakamoto W, Kondo H, Murata M, Motoyoshi F. (1996). Altered mitochondrial gene expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast mutator. Plant Cell 8:1377–1390.
Sakamoto W. (2003). Leaf-variegated mutations and their responsible genes in Arabidopsis thaliana. Gen Genet Syst 78: 1-9.
Shedge V, Arrieta-Montiel M, Christensen AC, Mackenzie SA. (2007). Plant mitochondrial recombination surveillance requires unusual RecA and MutS homologs. Plant Cell 19: 1251-1264.
Shedge V, Davila J, Arrieta-Montiel MP, Mohammed S, Mackenzie SA. (2010). Extensive rearrangement of the Arabidopsis mitochondrial genome elicits cellular conditions for thermotolerance. Plant Physiol. 152:1960–1970.
Shen H, He H, Li J, Chen W, Wang X, et al. (2012). Genome-wide analysis of DNA methylation and gene expression changes in two Arabidopsis ecotypes and their reciprocal hybrids. Plant Cell 24:875-892.
Schmitz RJ, Schultz MD, Lewsey MG, O’Malley RC, Urich MA, et al. (2011).
Transgenerational epigenetic instability is a source of novel methylation variants. Science 334:369-373.
91
Stokes TL, Kunkel BN, Richards EJ. (2002). Epigenetic variation in Arabidopsis disease resistance. Genes Dev 16, 171-182.
Storey JD, Tibshirani R. (2003). Statistical significance for genome wide studies.
Proc. Natl. Acad. Sci. USA 100:9440-9445. Tani E. Polidoros AN, Nianiu-Obeidat I, Tsaftaris AS. (2005). DNA methylation
patterns are differently affected by planting density in maize inbreds and their hybrids. Maydica 50:19-23.
Xu Y-X, Arrieta-Montiel MP, Virdi KS, de Paula WBM, Widhalm JR, Basset GJ,
Davila JI, Elthon TE, Elowsky CG, Sato SJ, Clemente TE, Mackenzie SA. (2011). MutS HOMOLOG1 is a nucleoid protein that alters mitochondrial and plastid properties and plant response to high light. Plant Cell 23:3428-3441.
Xu Y-Z, de la Rosa Santamaria R, Virdi KS, Arrieta-Montiel MP, Razvi F, Li S,
Ren G, Yu B, Alexander D, Guo L, Feng X, Dweikat IM, Clemente TE, Mackenzie SA. (2012). The chloroplast triggers developmental reprogramming when MUTS HOMOLOG1 is suppressed in plants. Plant Physiol 159:710-720.
Youngson NA, Whitelaw E. (2008).Transgenerational epigenetic effects. Annu.
Rev. Genom. Human Genet 9:233-257.
92
List of Figures Chapter 3
Figure 3.1. Deriving MSH1-‐epiF2 populations of sorghum and Arabidopsis. MSH1-‐dr phenotypes transgene minus were pollinated by wild type pollen.
Figure 3.2. Enhanced growth phenotype of MSH1-‐dr-‐epi-‐lines of sorghum. (A) The phenotype of the F1 progeny derived from crossing sorghum MSH1-‐dr x Tx430; Tx430 on left, F1 on center, and MSH1-‐dr on right. (B) MSH1-‐dr phenotype is maintained through generations of selfing, (C) MSH1-‐dr epiF3 and epiF4 of sorghum, (D) Panicles from Tx430 (on left) versus epiF2 (on right), and (E) Seed yield from panicles shown in D.
93
Figure 3.3. Plant height distribution in F2 sorghum epi-‐lines; the original cross was MSH1-‐dr x Tx430 phenotypes. Five epi-‐lines, (GAII-‐11 to GAII-‐28) displaying a bimodal distribution, and wildtype (WT) Tx430 are illustrated.
Figure 3.4. Grain yield (GY) of F2 MSH1-‐dr epilines grown in two field environments, 2011. Environment 1 (Env 1) is a plot supplemented with 100 kg/ha Nitrogen; Environment 2 (Env 2) is a plot not fertilized, rotated between soybean-‐maize in previous seasons.
94
Figure 3.5. MSH1-‐epi enhanced growth in Arabidopsis is associated with chloroplast effects. (A) Mitochondrial hemi-‐complementation line AOX-‐MSH1 x Col-‐0 F1; (B) Plastid-‐complemented SSU-‐MSH1 x Col-‐0 F2 appears identical to Col-‐0 wild type; (C) Rosette diameter and fresh biomass of SSU-‐MSH1-‐derived F2 lines relative to Col-‐0; (D) Mitochondrial-‐complemented AOX-‐MSH1 x Col-‐0 F2 showing enhanced growth; (E) Rosette diameter and fresh biomass of AOX-‐MSH1-‐derived F2 lines is significantly greater (P<0.05) than Col-‐0. (F) Enhanced growth phenotype in the F2 generation of A0X-‐MSH1 x Col-‐0. This experiment was conducted by Dr. M. Arrieta-‐Montiel, K. Virdi, and Dr. Y. Xu.
95
Figure 3.6. Evidence of enhanced growth in Arabidopsis. (A) Rosette growth in an epiF4 line, (B) Arabidopsis epiF4 plants show enhanced plant biomass, rosette diameter, and stem diameter relative to Col-‐0. Data shown as means ± from >6 plants, C) The Arabidopsis epiF4 at flowering. Courtesy of Dr. Y-‐Z Xu and K. Virdi.
Figure 3.7. Grain yield is responsive to selection in derived MSH1-‐dr sorghum epi-‐lines. A) Epi-‐line 1 selected for high grain yield and grown under Nitrogen supplementation, B) Epi-‐line 2 selected for high grain yield and grown in a field under soybean-‐maize rotation. Both epi-‐lines were grown during summer 2011, and the selection started in the F2 generation (Cycle 0). The value of each point is the average of 15 to 20 random inner-‐row plants. A and B correspond to lineage MSH1-‐epi11 and MSH1 epi15, respectively.
96
Figure 3.8. Two MSH1-‐dr epi-‐lines selected for low grain, and grown under Nitrogen supplementation. Values used to plot individual points of each line are the average of five to ten inner-‐row plants. The decrease in the mean value in the epi-‐line 1, blue line, is around 36% from the F2 (Cycle 0) to the F3 generation (Cycle1); both lines correspond to the lineage MSH1-‐epi24.
Figure 3. 9. Sample SSR marker analysis of sorghum genomic DNAs prepared from wild type Tx430, Tx430-‐dr line (transgene null, dwarfed, high tillered, and delayed flowering), one epi-‐F2, and seven F4 epi-‐lines selected for phenotypic diversity. Sweet sorghum “Wray” was included as a control. The SSR marker shown is generated with SAM16073 primers. Arrow shows detected DNA polymorphism. M designates marker lane, with fragment sizes (bp) shown at left. The 1500 and 35 bp fragments are internal markers used to calibrate each line. The screening was conducted by Dr. Y. Wamboldt, H. Kundariya and O. Lozano.
97
List of Tables Chapter 3
Table 3.1. Phenotypic variation increases for different traits in the F2 sorghum MSH1-dr epi-lines compared to wild type.
Plant Height
Grain Yield/Panicle
Year Family n Mean (cm) SE Mean (g) SE MSH1-‐epi
11 30 166 8.4*** 51.3 3.5***
MSH1-‐epi 15
40 135 5*** 33.7 2.5***
2010 MSH1-‐epi 22
27 156 8.1*** 35.8 2.8***
MSH1-‐epi 24
89 140 3.4* 34.4 1***
MSH1-‐epi 28
88 141 3.6** 23.8 1.6***
Tx430 10 132 2.4 24.2 0.9 MSH1-‐epi
11 60
187 3.9*** 54 1.6* 2011 MSH1-‐epi
15 110
177 2.4*** 53.7 0.9 MSH1-‐epi
22 20
181 10.6*** 56.6 2.6* MSH1-‐epi
24 130
155 2*** 47.9 1.2 MSH1-‐epi
28 80
157 3.6*** 47.5 1.3 Tx430 90 135 0.6 43 1.1
*, **, ***: Variances are different based on Levene’s test, p<.05, <.001, <.0001, respectively.
98
Table 3.2. Frequency of the MSH1-dr phenotype (8.4%) in epi-F3 families derived from sorghum Tx430 MSH1-dr x Tx430, grown in the greenhouse. Derived epi-F4 families showed no evidence of the MSH1-dr phenotype.
99
Table 3.3. Mean value samples of agronomic traits in three generations of MSH1 epi-lines derived from crosses between MSH1-dr x Tx430 (WT) sorghum phenotypes, tested in two environments during 2011, Lincoln, NE.
GY: Grain Yield/panicle; PH: Plant height; FBY: Fresh biomass yield/plant; DBY: Dry Biomass Yield/plant; Env I: Environment I, fertilized with 100 Kg N/ha; Environment II, non-‐ fertilized field, and rotated with soybean-‐maize in previous seasons. Digits in brackets indicate the number of treatment to differentiate epi-‐lines within lineages in the experiment. *, **, and ***: significant differences compared to wildtype Tx430, p< 0.05, 0.01, and 0.0001, respectively. F2 RC Epi22 (184) is the progeny of a reciprocal cross. WT Tx430: is the wildtype cultivar used for plant transformation and deriving all of the epi-‐lines. The MSH1-‐dr plants were transgene null.
100
Table 3.4. Analysis of phenotypic data from individual Arabidopsis F2 families derived by crossing hemi-complementation lines x Col-0 wildtype. SSU-MSH1 refers to lines transformed with the plastid-targeted form of MSH1; AOX-MSH1 refers to lines containing the mitochondrial-targeted form of the MSH1 transgene. In all genetic experiments using hemi-complementation, presence/absence of the transgene was confirmed with a PCR-based assay.
†P values are based on two-‐tailed Student t-‐test comparing to Col-‐0 NS = Not Significant
Courtesy of Dr. M. Arrieta-‐Montiel, K. Virdi, and Dr. Y. Xu.
101
Table 3.5. SSR marker polymorphism data for 43 markers. Markers were scored as + or – relative the pattern of Tx430 wild type. SSR markers were selected based on their polymorphic behavior in comparisons of Tx430 and ‘Wray’. Assays included a transgene- null Tx-430 line displaying the developmental reprogramming phenotype (dr), one epi-F2, two epi-F3 and seven epi-F4 lines.
102
103
Conclusion
Suppression of MSH1 has been associated to leaf variegation, male sterility, and
dwarfism in different dicot and monocot species. In sorghum, the MSH1-dr
phenotype that combines dwarfism, high branching and delayed flowering is
initiated by MSH1 RNAi down regulation, but is attributed to changes in the
epigenome elicited by organellar signaling rather than organellar genome
rearrangements. After genetic segregation of the RNAi transgene, the novel
phenotype represents an important source of germplasm to improve agronomic
traits such as grain yield, plant height, and biomass yield, with significant
response to selection. Enhanced growth observed in the progeny of crossing
parental lines with the same genetic background, as demonstrated in sorghum in
this study, has not been documented previously, whereas the evidence of plastid
disruption and changes in the methylation status, observed in the Arabidopsis
genome, illustrates the transcendental role the chloroplast plays to exert
retrograde signaling and induce epigenetic variation that underlie heritable
phenotypic variation. These results could help to understand better the genotype
by environment interactions, and optimize current plant breeding systems.
Moreover, MSH1 down regulation is an efficient mechanism to create phenotypic
variation under narrow genetic diversity.
Further studies, however, are required to know the extent of the response
to selection, the stability of the improved traits, and their reproducibility in other
crop species as well. Whereas the MSH1-dr phenotype is fully penetrant through
generations of selfing, an arising question refers to the performance of derived
104
lines from advanced generations after crossing the MSH1-dr phenotype
transgene null to widltype. Selection practiced in early generations suggests the
feasibility of creating stable outstanding sorghum epilines; however, this must be
confirmed under more diverse environmental conditions that include different
types of abiotic factors, as well as their response in biotic defense. Components
of higher grain yield and above biomass yield require also to be elucidated, in
combination with transcript profiling of different genes involved in physiological
and metabolic pathways such as starch and sugar synthesis, and plant
hormones additional to GA. The performance test and selection of epi-lines per
se or in crosses with other epi-lines, related or not, could be optimized by current
molecular techniques to identify epi-alleles or epiQTLs that underlie the observed
phenotypic variation; in this context, the correct phenotypic characterization of
the novel plant material will keep being crucial for a successful enterprise.
Despite these challenges, we believe that a new era in the plant breeding field
has started, in which organellar retrograde signaling and epigenetic variation will
play essential roles by expanding the phenotypic variation suitable for artificial
selection.