Upload File

one gene's intron is another gene's exon

2

Upload: leslie-a

Post on 29-Jul-2016

216 views

Category:

Documents


3 download

Report

TRANSCRIPT

Page 1: One gene's intron is another gene's exon
Page 2: One gene's intron is another gene's exon

© Nature Publishing Group1981


Intron correlations evolution intron/exon

Genomic Analysis and Classification of Exon and Intron ...pds-fiuner.wdfiles.com/local--files/descargas/GSP3.pdfMohammed Abo-Zahhad, Sabah M. Ahmed, Shimaa A. Abd-Elrahman Electrical

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

Exon coconversion biases accompanying intron homing ...genesdev.cshlp.org/content/10/17/2158.full.pdf · Exon coconversion biases accompanying intron homing: battle of the ... Intron-containing

FACULDADE DE ENGENHARIA DE ILHA SOLTEIRA · 2017-08-07 · Exon 2 Intron 1 Exon 1 P R O M O T O R TTAAGATAGTAAAGCCACGTA ... raízes marrons são devidas ao alelo dominante B e raízes

YNYUR A Y (YYYYY) · (YYYYY) n Branch Point Polypyrimidine Tract ~40 nts YNYUR A Y Intron Exon A B Figure 1 . Intron de˜nition Exon de˜nition Splice-site recognition Exon A Exon

2000 by Cell Press Piccolo, a Presynaptic Zinc Finger Protein ...Piccolo, a Presynaptic Zinc Finger Protein 205 Table 1. Exon–Intron Boundaries of Human PCLO Gene Exon Encoded Exon

Jenseits des Genoms – Alternatives Spleißen erhöht … · vierten Basen GU gekennzeichnet, der Übergang vom Intron zum Exon ... Die Regulation des alternativen Spleißens −

Apresentação - IMM 13-04-2010 - final...Exon 1 Exon 2 Exon 3 X Human -globin mRNA (AR) (AR) (AD) NMD NMD Splicing AUG Ter EJC EJC 50 - 54 nts Intron 1 Intron 2 5 ’ 3 ’ AUG Ter

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

Intron Evolution: Testing Hypotheses of Intron Evolution

Supplementary Information Mutations affecting components ... · MAQ; 4) variants that were non-synonymous changes or splice site mutations (±2 bp from the exon/intron boundary) and

Genetic Diseases3.1 x 109 bp In Mitochondria 16,569 bp Gene Coding Sequences (Exon) Non coding Sequences (Intron) Non-gene (Extragenetic) Repetitive DNA Tandem repeats (satellite,

Hypoxia-induced alternative splicing: the 11th Hallmark of ...Splicing initiates with spliceosome recruitment to the 5′ exon-intron splice junction and subsequent phosphodiester

Diversified clinical presentations associated with a novel ... · Mutation analysis: Direct sequencing was performed to cover all exons and intron-exon boundaries of the SALL4 gene

Die Vorausetzungen für die Zulassung zur Prüfung und einen ... · •u.a. die in silico Analyse von Rohsequenzdaten [promoter-exon-intron prediction (gene finding), FASTA & BLAST

CSE182-L10 Gene Finding. Gene Features ATG 5’ UTR intron exon 3’ UTR Acceptor Donor splice site Transcription start Translation start

Exon/intron organization and complete nucleotide sequence ... · CommunicatedbyBarujBenacerraf, October19, 1981 ... complex(MHC;HLA-A,-B, and-Cin man, H-2K,D, andLin mouse) has made

Supplemental Figure 1. Alternative splicing in AT5G65685 ... · L1) and pollen (P3) RNA-Seq data showing exon skipping or exon inclusion in the final intron. Values on the y axis

Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT

Macromolecular Synthesis · Macromolecular Synthesis 2 FIND CHAP TOC O H O N O O 5′exon 5′ G Intron Intron Lariat G 3′ Group I GOH A RNA Introns B Protein inteins exon A G 3′

Modern Biology and Bioinformatics - bio.gnu.ac.krbio.gnu.ac.kr/lecture/bi/bi_intro_bi/Intro.pdf · Transcriptomics (전사체학): Exon-Intron 구조로 인하여 한개의 유전자가

Splicing defects in ABCD1 gene leading to both exon skipping and partial intron retention in X-linked adrenoleukodystrophy Tunisian patient

Progress report Yiming Zhang 02/10/2012. All AS events in ASIP Intron retention Exon skipping Alternative Acceptor site NAGNAG AltA Alternative Donor

Gene's SOD Presentation

Exon amplification: strategy to isolate mammalian on splicing · Whenafragment containing anentire exon with flanking intron sequence in the sense orientation is inserted into the

Intron correlations evolution intron/exonProc. Natl. Acad. Sci. USA Vol. 92, pp. 12495-12499, December 1995 Evolution Intronphasecorrelations andthe evolutionofthe intron/exon structure

Alternative Splicing Genomic DNA Sequence GmGm AAAAA Exon Intron Exon GmGm AAAAA Transcription mRNA RNA Processing pre-mRNA

Vocabulary Key Terms DNA DNA replication Codon Intron Exon Translation Central Dogma Transcription RNA mRNA tRNA Anticodon Genes Nucleotide Nitrogen base

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

Biochemical and molecular characterization of 3 ... · carboxylase 2, beta) genes was performed by PCR, fol-lowed by direct sequencing of all exons and exon-intron ... variations

Gene's Extra Section:Oct

Exon-intron circular RNAs regulate transcription in the nucleusstaff.ustc.edu.cn › ~shange › publications › 2013~ › 1.pdf · 2015-03-09 · Correspondence should be addressed

The putatively functional Mkrn1-p1pseudogene is neither ...The putatively functional Mkrn1-p1pseudogene is ... and continue into intron 3 (exon 3b). (B) BLAST sequence similarity with