On the Wegener granulomatosis associated region on chromosome 6p21.3

Download On the Wegener granulomatosis associated region on chromosome 6p21.3

Post on 06-Jul-2016

217 views

Category:

Documents

4 download

Embed Size (px)

TRANSCRIPT

  • ral

    ssBioMed CentBMC Medical Genetics

    Open AcceResearch articleOn the Wegener granulomatosis associated region on chromosome 6p21.3Pawe Szyld1, Peter Jagiello1,2, Elena Csernok3, Wolfgang L Gross3 and Joerg T Epplen*1

    Address: 1Human Genetics, Ruhr-University, Bochum, Germany, 2Clinical Molecular Biology, Christian-Albrechts-University Kiel, Germany and 3Rheumatology, University Hospital Luebeck and Rheumaklinik Bad Bramstedt, Germany

    Email: Pawe Szyld - szyld@list.pl; Peter Jagiello - pjag@gmx.de; Elena Csernok - csernok@rheuma-zentrum.de; Wolfgang L Gross - gross@rheuma-zentrum.de; Joerg T Epplen* - joerg.t.epplen@rub.de

    * Corresponding author Equal contributors

    AbstractBackground: Wegener granulomatosis (WG) belongs to the heterogeneous group of systemic vasculitides. The multifactorialpathophysiology of WG is supposedly caused by yet unknown environmental influence(s) on the basis of genetic predisposition.The presence of anti-neutrophil cytoplasmic antibodies (ANCA) in the plasma of patients and genetic involvement of the humanleukocyte antigen system reflect an autoimmune background of the disease. Strong associations were revealed with WG bymarkers located in the major histocompatibility complex class II (MHC II) region in the vicinity of human leukocyte antigen(HLA)-DPB1 and the retinoid X receptor B (RXRB) loci. In order to define the involvement of the 6p21.3 region in WG in moredetail this previous population-based association study was expanded here to the respective 3.6 megabase encompassing thisregion on chromosome 6. The RXRB gene was analysed as well as a splice-site variation of the butyrophilin-like (BTNL2) genewhich is also located within the respective region. The latter polymorphism has been evaluated here as it appears as a HLAindependent susceptibility factor in another granulomatous disorder, sarcoidosis.

    Methods: 150180 German WG patients and a corresponding cohort of healthy controls (n = 100261) were used in a two-step study. A panel of 94 microsatellites was designed for the initial step using a DNA pooling approach. Markers withsignificantly differing allele frequencies between patient and control pools were individually genotyped. The RXRB gene wasanalysed for single strand conformation polymorphisms (SSCP) and restriction fragment length polymorphisms (RFLP). Thesplice-site polymorphism in the BTNL2 gene was also investigated by RFLP analysis.

    Results: A previously investigated microsatellite (#1.0.3.7, Santa Cruz genome browser (UCSC) May 2004 Freeze localisation:chr6:31257596-34999883), which was used as a positive control, remained associated throughout the whole two-step approach.Yet, no additional evidence for association of other microsatellite markers was found in the entire investigated region. Analysisof the RXRB gene located in the WG associated region revealed associations of two variations (rs10548957 pallelic = 0.02 andrs6531 pallelic = 5.20 10-5, OR = 1.88). Several alleles of markers located between HLA-DPB1, SNP rs6531 and microsatellite1.0.3.7 showed linkage disequilibrium with r2 values exceeding 0.10. Significant differences were not demonstrable for thesarcoidosis associated splice-site variation (rs2076530 pallelic = 0.80) in our WG cohort.

    Conclusion: Since a microsatellite flanking the RXRB gene and two intragenic polymorphisms are associated significantly withWG on chromosome 6p21.3, further investigations should be focussed on extensive fine-mapping in this region by denselymapping with additional markers such as SNPs. This strategy may reveal even deeper insights into the genetic contributions of

    Published: 09 March 2006

    BMC Medical Genetics2006, 7:21 doi:10.1186/1471-2350-7-21

    Received: 29 July 2005Accepted: 09 March 2006

    This article is available from: http://www.biomedcentral.com/1471-2350/7/21

    2006Szyld et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 11(page number not for citation purposes)

    the respective region for the pathogenesis of WG.

  • BMC Medical Genetics 2006, 7:21 http://www.biomedcentral.com/1471-2350/7/21

    BackgroundWegener granulomatosis (WG) is a granulomatous disor-der belonging to the heterogeneous group of systemic vas-culitides (SV). A common feature of SV is theinflammation of the endothelium [1,2]. SV are classifiedaccording to the size of affected vessels and the type ofauto-antibodies, namely anti-neutrophil cytoplasmicantibodies (ANCAs), which are used for differential diag-nosis [3,4].

    WG has an annual incidence of 510/million individualsin Caucasians [5]. The pathophysiology of WG stillremains largely unknown with a supposedly multifacto-rial basis [6,7]. Presence of ANCA in the plasma of ~90%of WG patients reflects autoimmune background of thedisease. In WG patients ANCAs are mostly directed againstproteinase 3 (PRTN3), presented in primary azurophilgranules of polymorph nuclear neutrophils (PMN) andlysosomes of monocytes [8,9]. After cytokine priming ofPMN, PRTN3 translocates to the cell surface where ANCAscan bind and activate PMN resulting in a respiratory burstand release of proteolytic enzymes [10]. This may thenlead to a self sustaining inflammatory process.

    Several candidate genes such as PRTN3, 1-antitrypsine,adhesion molecule CD18 or interleukin 1 and its receptorhave been investigated for WG association [11-15]. Inaddition, there is genetic evidence that the human leuko-cyte antigen (HLA) system is involved in WG develop-ment [16-19]. Yet, mostly these studies showedexclusively spurious WG associations. Recently, anextended association screen (EAS) revealed strong WGassociation of a microsatellite marker (UCSC May 2004Freeze chr6:31257596-34999883) located in major histo-compatibility complex class II (MHCII) region in theimmediate vicinity of the HLA-DPB1 and retinoid X recep-tor (RXRB) genes in two German populations [20]. Gen-otyping 19 alleles of the HLA-DPB1 gene with increasedfrequency of the HLA-DPB1*0401 allele supported theevidence that this region harbours at least one genetic fac-tor for WG. But further association mapping encompass-ing a region of ~280 kb with additional microsatellite andSNP markers did not allow to decide between severalalternatives. Either this region harbours one major locusfor WG, encompasses two susceptibility loci or the associ-ation of specific marker alleles is due to linkage with acausative locus at some distance. In this context, the com-plex linkage disequilibrium (LD) patterns are crucial withareas of densely packed recombination hot spots as wellas large LD blocks on chromosome 6p thus further com-plicating to define associations in this region [21,22]. In arecent study on the granulomatous disorder sarcoidosis, afine mapping approach using SNPs led to the definition of

    regions encompassing defined associations in order toevaluate aforementioned considerations on extended LDon chromosome 6, i.e. how far an association can extend,or HLA independent risk factors. Here, we expanded asso-ciation mapping to a 3.6 mb region encompassing theWG associated 6p21.3 as well as adjacent regions withadditional microsatellites. This study was carried out in atwo-step population based design using pooled DNA forthe initial scan and, subsequently individual genotypingof markers that differed statistically significantly betweenWG patients and controls.

    Furthermore, we focussed on two candidate genes onchromosome 6, RXRB and butyrophilin-like 2 (BTNL2)located in the vicinity or even in the respective WG-asso-ciated region [20]. RXRB presents as a good candidate asthe protein binds to hormone nuclear receptors such asthe vitamin D receptor (VDR) [24]. VDR and its ligand cal-citriol have widespread influence on immuno-regulatorysystems [25-28]. Thereby, RXRB variation may beinvolved in the pathogenesis of WG. In order to find func-tionally relevant polymorphisms the entire coding regionand ~593 bp of the promoter were screened for variations.Furthermore, a recently described splice-site polymor-phism of the BTNL2 gene has been reported to representa HLA independent risk factor for another granulomatousdisorder affecting the lung, namely sarcoidosis [23].BTNL2 is located on 6p21.3 in the vicinity of the HLA-DRB1 locus. On the basis of sharing traits in WG and sar-coidosis such as granulomas and pulmonary affections,the functionally relevant splice-site polymorphism wasgenotyped in our cohorts.

    MethodsPatientsGerman WG patients were clinically diagnosed accordingto international standards by applying the 1990 classifica-tion criteria of the American College of Rheumatology[29] and the definitions of the 1994 Chapel Hill Consen-sus Conference [3]. All patients have defined ANCA-status(npositive = 151; nnegative = 30). WG was biopsy-proven inthe German reference centre for vasculitis (Department ofPathology, University of Schleswig-Holstein Campus Lue-beck, Germany) by 2 different observers. Control groupscomprised healthy adults from northern Germany and theRuhr area (Germany). The institutional Ethics Committeeof Bochum Ruhr-University approved this study.Informed consent was obtained from all individuals.

    Pooling of DNADNA pooling was performed as described before [20].Briefly, DNA concentrations were measured spectropho-tometrically in 4 steps, and samples were diluted accord-Page 2 of 11(page number not for citation purposes)

    an HLA independent genetic factor, BTNL2 [23]. Thisstudy underlines the necessity of investigations on larger

    ingly. The final DNA concentration in pools was 50 ng/l.In order to control for artefacts during pooling, 150

  • BMC Medical Genetics 2006, 7:21 http://www.biomedcentral.com/1471-2350/7/21

    ANCA-positive patients were divided into 3 sub-pools and100 controls from the northern German cohort into 2sub-pools, respectively.

    Microsatellite marker panelA panel of 94 markers was designed encompassing theWG associated 6p21.32 and flanking regions (annotatedby Santa Cruz genome browser (UCSC):chro6:31255920-34938760, May 2004 freeze, see [30]).Microsatellites were chosen utilizing the simple-repeatoption of UCSC. The average distance between microsat-ellite markers was 41 kb (standard deviation ~30 kb) withfive gaps of distances 100 kb (

  • BMC Medical Genetics 2006, 7:21 http://www.biomedcentral.com/1471-2350/7/21

    ther studies. In addition, intra-population differenceswere tested by comparing WG pools with each other aswell as both control pools.

    Individual genotypingIn order to exclude false positive significances, patientsand controls were individually genotyped for respectivemarkers. Genotyping was performed on the BeckmanCoulter CEQ8000 8-capillary system using 'FragmentAnalysis Module' software (Beckman Coulter, Inc., Fuller-ton, USA). Reaction mix contained 1 PCR buffer (Qia-gen), 0.75 pmol fluorescent labelled F, 0.2 mM eachdNTP, 3 mM MgCl2, 0.2 pmol tailed F, 1.5 pmol reverseprimer, 0.25 U Qiagen Hot Start Taq (Qiagen) and 50 ngDNA. Parameters for amplification were used as describedabove. Allele and genotype frequency of WG patients andcontrols were compared by 2-testing. Additionally,Hardy-Weinberg equilibrium was tested using Genepopsoftware [20].

    Screening of the coding and a 593 bp promoter region in the RXRB geneThe coding and promoter regions (593 bp) of the RXRBgene were initially screened by single strand conformationpolymorphism (SSCP) with 48 patient (ANCA-positive)and 48 control DNAs. The RXRB sequence was down-loaded from UCSC database (NM021976, July 2003Freeze). Oligonucleotides were designed using PrimerExpress 2.0 Software (Applied Biosystems) with an opti-mal annealing temperature of 57C (see table 1). PCR wasperformed using Qiagen HotStar Taq (Qiagen) with aninitial denaturation at 95C for 15 min, 35 cycles of 94Cfor 30 sec -57C for 30 sec -72C for 30 sec and a finalextension at 72C for 10 min. PCR conditions were cho-sen as recommended by Qiagen. Fragments were labelledwith -dATP (exons 210; Hartmann Bioanalytics, Braun-schweig, Germany) and -dCTP (exon 1a and 1b; Hart-mann Bioanalytics). SSCP were analysed on 6% and 5%polyacrylamide gels with either 5% or 10% glycerol. Thegels were run at room temperature at 35 W. Amplificatescontaining obvious band shifts were sequenced using dyeterminator cycle sequencing on an ABI377 automaticsequencer (Applied Biosystems). Statistical comparisonsof allele frequencies and genotypes were based on the 2test. In addition, Hardy-Weinberg equilibrium has beentested for all SNPs.

    Genotyping of rs6531The sequence variation rs6531 was genotyped in 151ANCA-positive patients and 201 controls by RFLP analy-sis. A restriction site for DdeI (NewEnglandBiolabs, Ips-wich, USA) was generated by using the tailed mismatcholigonucleotide, mmantisense-CATCGCTGATTCGCACAT-

    mmantisene-primer, an oligonucleotide corresponding tothe tail and the forward oligonucleotide sense-CCGATCTTTAGTGACCCCAGT. Restriction with DdeIresults in a 226 bp fragment (T allele) and in case of the Callele in 2 fragments of 192 and 34 bp, respectively. Elec-trophoresis was done on a 3% agarose gel containingethidium bromide. The results were analysed with the 2test and Hardy-Weinberg equilibrium was controlled.

    Genotyping of the Val95Ala polymorphism in the RXRB geneThe previously reported the Val95Ala polymorphism [34]was genotyped by RFLP analysis in 94 patients and 90controls. Fragments were amplified using oligonucle-otides Val95Ala sense-CGGTGGGGTATTAGAGAATT andVal95Ala antisense-CCCATGGAAGAACTGATGACTGG.PCR was performed with Qiagen HotStar Taq (Qiagen) asdescribed above with an annealing temperature of 5560C and different MgCl2-concentrations generating a300bp fragment. The 2 alleles (Val, T allele; Ala, C allele)are detected as 232 bp and 193 bp bands, respectively.

    Electrophoresis was done in ethidium bromide contain-ing 2% agarose gels. In order to control the results of theRFLP analysis, DNAs of 15 patients and 20 controls weresequenced as described above. Association was verifiedwith the 2 test and Hardy-Weinberg equilibrium.Genotyping the functionally relevant BTNL2 variation rs2076530Primer extension analysis was used to genotype the trun-cating splice site mutation in 180 patients and 261 con-trols. Two primers were designed for amplification,forward TCCAGATACTCAGTGCCAGA, reverse: TTGTC-CAGGAACTAGCATATT. PCR conditions were: 1 PCRbuffer (Qiagen), 0.2 mM each dNTP, 0.2 pmol forwardprimer, 0.2 pmol reverse primer, 0.25 U Qiagen Hot StartTaq (Qiagen) and 50 ng DNA. The reaction was per-formed with initial denaturation at 95C for 15 min, 35cycles of 94C for 30 sec -60C for 30 sec -72C for 30 secand a final extension at 72C for 10 min The product waspurified with magnetic beads system (AMPure; ABgene,Epsom, UK). A primer extension reaction was performedwith the interrogation primer:...