m delbo et al. nature 000 , 1-4 (2014) doi:10.1038/nature13153

M Delbo et al. Nature 000, 1-4 (2014) doi:10.1038/nature13153 Crack growth in meteorites due to laboratory temperature cycling.

Upload: hamish

Post on 05-Jan-2016

33 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

Crack growth in meteorites due to laboratory temperature cycling. M Delbo et al. Nature 000 , 1-4 (2014) doi:10.1038/nature13153. - PowerPoint PPT Presentation

TRANSCRIPT

M Delbo et al. Nature 000, 1-4 (2014) doi:10.1038/nature13153

Crack growth in meteorites due to laboratory temperaturecycling.

GI Motility online (May 2006) | doi:10.1038/gimo48

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

GI Motility online (May 2006) | doi:10.1038/gimo6

17 September 2009 doi:10.1038/nature08355 LETTERS

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Published in Nature Materials (2016) doi:10.1038/nmat4569

GI Motility online (May 2006) | doi:10.1038/gimo46

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

doi:10.1038/nature05150 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

doi:10.1038/nature06481 LETTERS

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Biotechnology: doi:10.1038/nbt