of February 12, 2018.This information is current as )carpio

CyprinusMASP2 in the Common Carp (Mannose-Binding Lectin Associated withIdentification of Two Homologs of the Lectin Pathway of Bony Fish Complement:

Nakata, Teizo Fujita and Tomoki YanoSomamoto, Yoko Kato-Unoki, Misao Matsushita, Munehiro Miki Nakao, Takayuki Kajiya, Yuho Sato, Tomonori

http://www.jimmunol.org/content/177/8/5471doi: 10.4049/jimmunol.177.8.5471

2006; 177:5471-5479; ;J Immunol 

        average*  

4 weeks from acceptance to publicationSpeedy Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

?The JIWhy

Referenceshttp://www.jimmunol.org/content/177/8/5471.full#ref-list-1

, 16 of which you can access for free at: cites 50 articlesThis article

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2006 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on February 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Lectin Pathway of Bony Fish Complement: Identification ofTwo Homologs of the Mannose-Binding Lectin Associated withMASP2 in the Common Carp (Cyprinus carpio)1,2

Miki Nakao,3* Takayuki Kajiya,* Yuho Sato,* Tomonori Somamoto,* Yoko Kato-Unoki,*Misao Matsushita,† Munehiro Nakata,† Teizo Fujita,‡ and Tomoki Yano*

The lectin pathway of complement is considered to be the most ancient complement pathway as inferred from identification ofancient homologs of mannose-binding lectin (MBL) and MBL-associated serine proteases (MASPs) in some invertebrates. MBLhomologs with galactose selectivity and an MASP3-like sequence also occur in bony fish, linking the evolution of the lectincomplement pathway from invertebrates to higher vertebrates. However, these cannot be considered authentic complementcomponents until confirmatory functional evidence is obtained. Here, we report the isolation and characterization of two MBLhomologs from a cyprinid teleost, the common carp, Cyprinus carpio. One, designated GalBL, corresponds to the MBL-likemolecule with the galactose specificity. The other is an authentic MBL with mannose specificity. Both were found to associate witha serine protease that cleaves native human C4 into C4b but not C4i with a hydrolyzed thioester. Molecular cloning and phylo-genetic analysis revealed this C4-activating protease to be carp MASP2, indicating that MASP2 arose before the emergence ofbony fish. Database mining of MBL-like genes reveals that MBL and GalBL genes are arranged in tandem in the zebrafish genomeand that both lectins are conserved in the distantly related puffer fish. These results imply that bony fish have developed a divergedset of MBL homologs that function in the lectin complement pathway. The Journal of Immunology, 2006, 177: 5471–5479.

T he lectin pathway of mammals is an Ab-independent ac-tivation route of the complement system, relying on rec-ognition of pathogen-associated molecular patterns by

two distinct groups of lectins, mannose-binding lectin (MBL)4 andficolins. These serum lectins associate with novel serine proteases,termed MBL-associated serine proteases (MASPs), that proteolyti-cally activate the complement components C4, C2, and C3. Inhumans, the lectin pathway is considered to be crucial in innateimmunity, especially in infants and children, providing an imme-diate defense against microbial infections (reviewed in Refs. 1 and2).

MBL is an oligomeric lectin. Each of its subunits is composedof four distinct domains: 1) a cysteine-rich N-terminal region re-

sponsible for disulfide-linked oligomerization; 2) a collagenousregion characterized by Gly-X-Y repeats (X and Y stand for anyamino acids); 3) a neck region; and 4) a C-type lectin-like carbo-hydrate recognition domain (CRD) at the C-terminal that places itwithin the collectin family. MBL preferentially binds to terminalD-mannose and N-acetyl-D-glucosamine (GlcNAc) of oligosaccha-rides and polysaccharides. Ficolin is also a homo-oligomer of sub-units with domain organization similar to MBL, although the Cterminus has a fibrinogen-like domain instead of a C-type lectin.This fibrinogen-like domain shows significant amino acid se-quence similarity to that of tachylectin 5 from horseshoe crab (3),and is responsible for carbohydrate recognition by ficolins. Liketachylectin 5, the fibrinogen-like domain usually recognizes acety-lated sugars, such as GlcNAc and N-acetyl-D-galactosamine (4),enabling ficolins to recognize a spectrum of pathogens distinctfrom that by MBL. Thus, together, MBL and ficolins seem tofacilitate pattern recognition of a wide variety of pathogens (5).

MASPs are homologous to the subcomponents of the comple-ment components C1, C1r, and C1s, because they share the samedomain organization: two C1r/C1s/Uegf/bone morphogenetic pro-tein 1 domains that are interrupted by an epidermal growth factor-like domain, followed by two short consensus repeat modules anda serine protease domain. Three different forms of MASPs havebeen identified in mammals, namely MASP1, MASP2, andMASP3 (2). MASP1 and MASP3 share the N-terminal five do-mains but differ in the C-terminal serine protease domain as aresult of alternative splicing (6). The serine protease domain ofMASP1 is a common type encoded by multiple exons and containsthe histidine loop structure and the active serine residue encodedby a TCN codon. Conversely, the MASP3 serine protease domainis encoded by a single intronless exon, in which the histidine loopis missing, and an AGY codon is used for the active serine (2).MASP2 has a MASP3-like serine protease domain but is encodedby a distinct gene, MASP2, that also produces a truncated molecule,

*Laboratory of Marine Biochemistry, Department of Bioscience and Biotechnology,Kyushu University, Hakozaki, Fukuoka, Japan; †Institute of Glycotechnology andDepartment of Applied Biochemistry, Tokai University, Hiratsuka, Kanagawa, Japan;and ‡Department of Biochemistry, Fukushima Medical University School of Medi-cine, and Core Research for Evolutional Science and Technology, Japan Science andTechnology Agency, Fukushima, Japan

Received for publication November 10, 2005. Accepted for publication August1, 2006.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported in part by grants from the Ministry of Education, Science,Sports, and Technology of Japan.2 The nucleotide sequence data reported in this paper are available in the DNA Da-tabase of Japan, European Molecular Biological Laboratory, and GenBank databaseswith the following accession numbers: AB110825 for MBL1, AB110826 for MBL2(clone 3), AB110827 for MBL2 (clone 10), and AB234294 for carp MASP2.3 Address correspondence and reprint requests to Dr. Miki Nakao, Department ofBioscience and Biotechnology, Kyushu University, Hakozaki, Fukuoka 812-8581,Japan. E-mail address: miki_n@agr.kyushu-u.ac.jp4 Abbreviations used in this paper: MBL, mannose-binding lectin; MASP, MBL-associated serine protease; CRD, carbohydrate recognition domain; GlcNAc,N-acetyl-D-glucosamine; GalBL, galactose-binding lectin with MBL-like structure;MetMan, methyl-�-D-mannopyranoside; ORF, open reading frame; UT, untranslatedregion; MRP, MASP-related protein; UPM, universal primer mix.

The Journal of Immunology

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

termed small MBL-associated protein or MAp19, by alternative poly-adenylation and splicing (7–9). Several lines of functional evidencehave shown that MASP2 is responsible for activation of C4 and C2 toform C3-convertase, a C3-cleaving enzyme complex, whereasMASP1 directly activates C3 (2). However, the natural substrate ofMASP3 is still unknown and the exact molecular composition ofMBL/ficolins and MASPs have yet to be determined.

Recently, complement components, C3 and factor B, have beenidentified in the horseshoe crab (an arthropod) (10), and a C3-likegene has been found in coral (a cnidarian) (11). These findingsindicate that some complement components arose well before thedivergence of the protostomes and deuterostomes, and a comple-ment pathway, albeit in a primordial form, may have a muchlonger evolutionary history than previously thought. Although nei-ther an MBL-like lectin nor a MASP-like protease has been foundin these primitive animals, the lectin pathway is now widely re-garded as the ancestral mechanism of complement activation, andis the form seen in several extant deuterostome invertebrates (12).Structural and functional analyses of the complement componentsC3 (13), an MBL-like novel glucose-binding lectin (14), MASP1-like serine proteases (15), and a mammalian CR3-like receptor (16,17) in the Japanese solitary ascidian suggest that these componentsconstitute a prototype complement system and that the lectin path-way plays an essential role in C3-mediated opsonization forphagocytes in primitive animals. The presence of the lectin path-way has also been indicated in cephalochordates by the identifi-cation in Amphioxus of the lectin pathway components, MASP1,MASP3, and C3 (18). These close ancestral relatives of vertebratesare believed to lack MASP2-like components, because an MASP2-like gene is absent from the genome of another member of uro-chordates, the sea squirt, Ciona intestinalis (19, 20). This is con-sistent with the lack, in the urochordates, of C4 and C2, naturalsubstrates of MASP2 in mammals. In the lamprey, an agnathanthat occupies a more ancient taxonomic position than cartilaginousor bony fish, both an MBL-like and a novel C1q-like moleculehave been reported to function as lectins that activate C3 throughan MASP3-like serine protease, MASP-A (21, 22). This points tothe lectin pathway playing a crucial role in complement activationin animals lacking adaptive immunity (21).

Although cartilaginous and bony fish are thought to possess afunctional lectin pathway (2, 23), this belief is supported only bysome fragmentary structural and functional data at the molecularlevel: principally, the presence of a putative MBL-like collectin incarp, zebrafish, and goldfish (24) and a putative MASP3-like mol-ecule in banded hound shark and carp (25). However, the primarystructure of the teleost MBL-like lectin predicts that it has selec-tivity for galactose, unlike mammalian MBL, which recognizesmannose and GlcNAc (24), so this lectin might be better desig-nated as galactose-binding lectin (GalBL), as it is throughout thispaper. With regard to MASP-like molecules, the putative carp C1r/C1s/MASP2-like sequences may be more closely allied to mam-malian C1r (26, 27) than MASP. To date, there is no evidence atthe protein level to indicate the presence of functional lectin path-way in either cartilaginous or bony fish. By contrast, amphibianshave acquired a full lectin pathway similar to that of mammals,because ficolin, MASP1/3, and MASP2 genes have all been iden-tified in Xenopus (25, 28). In birds, although MBL, MASP2, andMASP3 have been found, MASP1 has not and may be absent(29–31). Thus, cartilaginous and bony fish represent the missinglink in the evolution of the lectin pathway from the minimumprototype present in invertebrates to the more sophisticated onepresent in mammals.

The present study was aimed at obtaining molecular and func-tional data to ascertain the presence of a true lectin pathway in fish,using the common carp (Cyprinus carpio) as the model species.

Materials and MethodsCarp serum

Carp weighing �1 kg were purchased from a local fish farm and bled fromthe caudal vessels. Serum was collected as described elsewhere (32), fro-zen in liquid nitrogen, and stored at �80°C until use.

Carp IgM and anti-carp IgM

Carp IgM was purified from serum as described for rainbow trout IgM (33).Briefly, carp serum was fractionated by precipitation with 5–15% polyeth-ylene glycol 4000, and the resulting precipitate was dissolved in 100 mMTris-HCl (pH 8.2) before gel filtration through a Superdex 200 pg column(1.6 � 60 cm), pre-equilibrated with the same buffer. The IgM-rich frac-tions in the void volume were pooled, diluted 10-fold with water, and thensubjected to anion-exchange chromatography on a linear NaCl gradientranging from 0 to 300 mM in 10 mM Tris-HCl buffer (pH 8.0) in a Q-Sepharose FF column (1.6 � 5 cm). The carp IgM, eluting at �100 mMNaCl, was homogenous as judged by SDS-PAGE under reducing condi-tions, giving a 74-kDa H chain band and a 25-kDa L chain band (data notshown). The purified IgM was then emulsified with CFA and injected s.c.into a rabbit at weekly intervals over 3 wk. A month after the last injection,the rabbit was bled, and IgG in the antiserum was purified by affinitychromatography on a HiTrap protein A column (Amersham Biosciences)as described in the manufacturer’s instructions. The anti-carp IgM rabbitIgG (8 mg) was then fixed to an N-hydroxysuccinimide-activated HiTrapcolumn (1 ml) (Amersham Biosciences), following the manufacturer’sinstructions.

Purification of carp MBL

Carp MBL was purified closely following the method for lamprey MBLand C1q (21). Briefly, pooled carp serum (300 ml) was made 7% in poly-ethylene glycol 4000, and the precipitate was separated by centrifugation at10,000 � g for 20 min at 4°C. It was dissolved in 50 mM Tris-HCl buffer(pH 7.8) containing 200 mM NaCl and 10 mM CaCl2 and applied to acolumn (1.5 � 3 cm) of GlcNAc-agarose (Sigma-Aldrich) equilibratedwith the same buffer. After washing the column with the same buffer,adsorbed proteins were successively eluted with buffers containing 5, 50,and 300 mM methyl-�-D-mannopyranoside (MetMan).

The eluate with 50 mM MetMan-containing buffer was applied to theanti-carp IgM-HiTrap column equilibrated with TBS containing 10 mMCaCl2. After washing the column with this buffer, the adsorbed IgM waseluted with 0.2 M glycine-HCl (pH 2.5). The purified carp MBL, presentin the flow-through fraction, was dialyzed against 50 mM Tris-HCl buffer(pH 7.4) containing 100 mM NaCl, 2 mM CaCl2, and 0.02% NaN3.

Purification of a GalBL

To purify a GalBL, a column (1.5 � 2 cm) of acid-treated agarose wasprepared according to a published method (34) except that Bio-Gel A 1.5m(Bio-Rad) was used instead of Sepharose 6B and equilibrated with thesame starting buffer as used for GlcNAc-agarose. The flow-through frac-tion from the GlcNAc column was applied to the acid-treated agarose col-umn and eluted with buffer containing 20 mM D-galactose, before passingthrough the anti-carp IgM column as described above.

C4 activation assays

The ability of carp MBL-MASP complex to cleave C4 into C4b was ex-amined as follows: 2 �g of human C4, purified as described before (35),was incubated with varying amount of the purified carp lectins in 50 mMTris-HCl buffer (pH 7.4) containing 100 mM NaCl and 2 mM CaCl2 at25°C for 1 h. C4 activation was monitored by appearance of ��-chain afterSDS-PAGE under reducing conditions. For the negative control substrate,C4i, an inactivated form of C4 in which the thioester is hydrolyzed, wasprepared by incubating C4 with 5 mM methylamine in 20 mM Tris-HClbuffer (pH 9.0) at 37°C for 2 h (36).

General protein analyses

SDS-PAGE was performed under either reducing or nonreducing condi-tions as previously described (37), and the polypeptide bands were stainedwith Coomassie Blue R-250. Two-dimensional SDS-PAGE (first dimen-sion under nonreducing conditions and second dimension under reducingconditions) was performed as described in Ref. 38. N-terminal amino acid

5472 THE INITIATION COMPLEXES OF THE LECTIN PATHWAY IN CARP

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

sequences of the separated polypeptides were determined after electrob-lotting onto a polyvinylidene difluoride membrane (Bio-Rad) using a gas-phase protein sequencer (PPSQ-21; Shimadzu).

Assay of carp MBL binding to oligosaccharides andneoglycoproteins

Carp MBL was labeled with 125I, and its ability to bind neoglycolipids andneoglycoproteins was analyzed as described elsewhere (39). The neogly-colipids were prepared by reductive amination from dipalmitoylphophati-dylethanolaamine and oligosaccharides derived from various glycoproteinssuch as OVA, RNase B, IgG, fetuin, and �1-acid glycoprotein. The testneoglycoproteins included BSA conjugated with mannose, glucose, Glc-NAc, galactose, maltose, cellobiose, or lactose. Human MBL purified asdescribed (40) was used as control.

Complementary DNA cloning of carp MBL and MASP2

Poly(A)� RNA was isolated from carp hepatopancreas using a Quick PrepmRNA purification kit (Amersham Biosciences) and reverse-transcribedwith Moloney murine leukemia virus-reverse transcriptase and oligo(dT)primer (Invitrogen Life Technologies), according to the manufacturer’sinstructions. First-strand cDNA served as a template for PCR amplificationusing two pairs of degenerated oligonucleotide primers: P1 (CARGGNCCNCCNGGNAA encoding QGPPGK) and P2 (CANGGNACRTCRTTCCA complementarily encoding WNDVPC) for MBL, and P3 (ATNCCNTGGCARGTNATGAT coding for IPWQVMI) and P4 (CCCCANGANACDATNCCNCC complementarily encoding GGIVSW) for MASP2.PCR amplification was conducted using AmpliTaq Gold DNA polymerase(PerkinElmer) on Astec Thermocycler PC800 under the following conditions:initial denaturation at 95°C for 10 min, 40 cycles of (95°C for 0.5 min, 45°Cfor 0.5 min, and 72°C for 1 min), and a final extension at 72°C for 5 min. Theamplified products were gel-purified and subcloned into pGEM-T vector (Pro-mega). Nucleotide sequencing was performed on a model 377 sequencer (Ap-plied Biosystems).

The following gene specific primers were designed to known MBL-likeand MASP-like cDNA sequences and synthesized for RACE: P5 (ATAGGACCACCGGGTGTTGC) and P6 (AGTTAATGGTCGGTCACTCATATATCCAC) for MBL, and P7 (GGCCATCGGTTCATCGGTGGA) andP8 (GCCCATCTTCAGCTGCAGGTT) for MASP2. A SMART RACEcDNA Amplification kit (Clontech) was used for both 5�-RACE and 3�-RACE, following manufacturer’s protocols. A high fidelity DNA polymer-ase (KOD plus; Toyobo) was used for the RACE-PCR, and the amplifiedproducts were gel-purified, adenylated at the 3�-ends with TaqDNA poly-merase (Sigma-Aldrich), and subcloned, as above, for sequencing. Theentire open reading frame (ORF) of MBL was amplified from the 3�-RACE-ready cDNA using a sense strand primer, P9 (GAGTGCTGATCGCCAGGCCTGA), which corresponds to the 5�-end sequence ofthe 5�-RACE products in combination with universal primer mix (UPM),to exclude a possibility that the sequences of 3�-RACE and 5�-RACE prod-ucts might be misassembled. Authenticity of the MASP2 sequence assem-bly was confirmed by PCR using primers corresponding to the 5�-end (P10,GAAGTCTGTGGCGTTCTGGAATAATG) and near the 3�-end (P11,ATAGTCTATGACTGTCACATGCAAAGC).

Southern hybridization

Carp genomic DNA (10 �g) isolated from the erythrocytes was digested tocompletion with BamHI, HindIII, or EcoRI, electrophoresed on a 1% aga-rose gel, transferred to a Hybond N� membrane (Amersham Biosciences),and hybridized with digoxygenin-labeled cDNA probe, essentially as de-scribed (41). The probes were prepared with PCR-DIG Probe Synthesis kit(Roche Diagnostics).

Phylogenetic analyses and database mining

ClustalX 1.82 software (42) was used to generate multiple sequence align-ments and to construct neighbor-joining phylogenetic trees (43) with theaid of NJplot software. All gaps inserted in the alignment were ignored forthe tree construction.

Online database searches were conducted using the following web sites:NCBI blast server (�www.ncbi.nlm.nih.gov/BLAST/�), Fugu genome blastserver (�www.fugu-sg.org/�), and GenomeNet blast server (�http://blast.genome.jp/�). In all the searches, BLOSUM62 was used as a scoringmatrix.

ResultsIsolation and identification of carp serum lectins

Carp serum was fractionated by polyethylene glycol precipitationand GlcNAc-agarose chromatography in a similar manner to thatused for lamprey MBL (22). As shown in Fig. 1, lane 1, the frac-tions eluting from the affinity column with 50 mM MetMan showtwo major bands with molecular masses of 30 and 74 kDa, respec-tively, indicating contamination with IgM. Accordingly, the eluatewas passed through the anti-IgM column to remove this contam-ination. The final MBL preparation was confirmed to be free ofIgM by SDS-PAGE. This produced a major band of 30 kDa and afaint band of 55 kDa under reducing conditions (Fig. 1, lane 2).The N-terminal amino acid sequence of the 30-kDa polypeptideshows a significant similarity to that of MBL-like lectin from carpreported previously (24) because it contains four repeats of thecollagen-like sequence signature (Gly-X-Y). Because digestion ofcarp MBL with collagenase (type III from Clostridium histolyti-cum; Sigma-Aldrich), performed as described (21), generates a22-kDa polypeptide with an N-terminal sequence of GVAGLKG-DKG (data not shown), carp MBL probably contains a collagenousregion similar to that in other collectins.

To examine whether the MBL homolog (24) thought to be spe-cific for galactose is actually expressed as a mature protein, wesearched for the corresponding protein in carp serum by affinitychromatography using acid-treated agarose, which exposes termi-nal galactose residues. As shown in Fig. 1, lane 3, the proteineluted from the acid-treated agarose column gave a 32-kDa bandafter removal of IgM. N-terminal sequence of the 32-kDa polypep-tide contains three repeats of the Gly-X-Y motif and shows strik-ing similarity to that deduced from the cDNA sequence of thereported carp MBL-like lectin (24).

FIGURE 1. SDS-PAGE analysis of purified carp serum MBL andGalBL. Carp serum was subjected to 7% polyethylene glycol precipitationfollowed by affinity chromatography using GlcNAc-agarose and acid-treated agarose. Proteins bound to GlcNAc-agarose column were elutedwith 50 mM MetMan (lane 1). The eluated fractions were passed througha column of immobilized anti-carp IgM to yield purified MBL (lane 2). Theunbound fraction from the GlcNAc-column was applied to the acid-treatedagarose column and eluted with 20 mM D-galactose, followed by removalof IgM to give a final preparation of GalBL (lane 3). Lanes M denotemarker proteins, of which molecular masses (in kildaltons) are shown. Allthe SDS-PAGE analyses were performed under reducing conditions. Com-parison of N-terminal amino acid sequences of MBL (30 kDa; lower row)and GalBL (32 kDa; upper row) with those of carp MBL-like lectin (Gen-Bank accession number AF227737; middle row) are inserted between thetwo panels, where shared residues are shown by upright bars.

5473The Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

Binding specificity of carp MBL

Binding specificity of carp MBL was compared with that of humanMBL using neoglycolipids bearing oligosaccharides and BSA-based neoglycoproteins as ligands. Both lectins show similar oli-gosaccharide-binding spectra (Fig. 2A) and also recognize thesame set of neoglycoproteins conjugated with mannose, glucose,GlcNAc, maltose, or cellobiose (Fig. 2B). These results are sug-gestive of carp MBL purified in this study being a direct functionalcounterpart of mammalian MBL.

C4 activation by carp MBL and GalBL

Because the MBL and GalBL purified above were expected toassociate with MASP-like proteases, we next examined whether ornot the two lectin preparations initiate MASP-mediated lectinpathway activation. The purified lectin preparation was incubatedwith human C4 or C4i and cleavage of their �-chain into ��-chainwas monitored by SDS-PAGE. As shown in Fig. 3, both lectinpreparations yielded ��-chain (85 kDa) from human C4 but notfrom human C4i. This indicates that carp MBL and GalBL areassociated with a MASP2/C1s-like serine proteases, which is ac-tive against only native C4 with an intact thioester.

cDNA cloning of carp MBL

RT-PCR amplification from carp hepatopancreas RNA with de-generate primers (P1 and P2) yields a single band of the expectedsize for MBL (�550 bp). The DNA was subcloned into pGEM-Tvector. Among a random selection of 10 clones, one clone, des-ignated CM1, showed high similarity to mammalian MBL over themiddle collagenous region and CRD (data not shown). Gene-spe-cific primers, P5 and P6, based on the CM1 sequence were used for3�-RACE and 5�-RACE, respectively, in combination with UPMsupplied in the SMART RACE kit. Three and five distinct cDNAsequences were isolated by 3�-RACE and 5�-RACE, respectively.Next, full-length cDNA encoding carp MBL was amplified fromthe 3�-RACE-ready first-strand cDNA using a sense strand primer,P9, which corresponds to 5�-untranslated sequence shared by all ofthe 5�-RACE products, and UPM. After cloning the RACE product(�1 kbp long) into pGEM-T vector, 12 clones were sequencedover the entire region, resulting in three distinct sequences, desig-

nated MBL1 (913 bp; AB110825) and MBL2 (1023 bp;AB110826 for clone no. 3; 965 bp, AB110827 for clone no. 10).Clone nos. 3 and 10 of MBL2 share an identical ORF but differfrom each other in the 5�- and 3�-untranslated regions (UTs). Thenucleotide sequence of MBL1 is distinct from those of MBL2 overboth ORF and UTs.

The deduced amino acid sequences of MBL1 and MBL2 ofcarp, GalBL of carp and zebrafish, and MBL of humans werealigned using ClustalX software (Fig. 4). Carp MBL1 and MBL2share 97% amino acid identity with a typical MBL-like domainorganization. From the N terminus, there is a sequence stretchcontaining a Cys residue for the interchain disulfide linkage, andthen a collagenous region composed of Gly-X-Y repeats, followedby a neck region showing substantial divergence, and finally aC-type lectin-like CRD at the C terminus. Amino acid sequence ofcarp MBL1 and MBL2 share 46% identity with GalBL from carpand goldfish. They also share 48% identity with zebrafish GalBL,37% with human MBL, 41% with chicken MBL, 31% withMBL-A from mouse and rat, 32% with mouse MBL-C, 34% ratMBL-C, and 26% with lamprey MBL. All of these MBL homologs

FIGURE 2. Binding specificity of carp MBL. A, Binding of carp andhuman MBL to neoglycolipids bearing oligosaccharides released from var-ious glycoproteins and developed by TLC. OVA and RN indicate laneswhere neoglycolipids prepared from oligosaccharides released from OVAand RNase B, respectively, were developed. asIgG, asFib, asFet, andasaAGP indicate where neoglycolipids prepared from desialylated oligo-sacchareides derived from IgG, fibrinogen, feruin, and �1-acid glycopro-tein, respectively, were developed. B, Binding of carp and human MBL toneoglycolipids bearing oligosaccharides: BSA conjugated with mannose(Man), glucose (Glc), N-acetyl-D-glucosamine (GlcNAc), galactose (Gal),maltose (Mal), cellobiose (Cel), and lactose (Lac).

FIGURE 3. Activation of C4 by MBL and GalBL purified from carpserum. Purified carp MBL and GalBL (2 �g each) were incubated with 2�g of human C4 or C4i at room temperature for 30 min, and then analyzedby SDS-SDS-PAGE to monitor the appearance of ��-chain of C4.

FIGURE 4. Multiple alignment of the deduced amino acid sequences ofMBL homologs. Dots show residues identical with carp MBL1, and dashesdenote gaps introduced for maximum matching. Assignments and bound-aries of the domains are shown above the sequences. Amino acid sequencesobtained from protein sequencing of purified carp MBL and GalBL areunderlined. EPN and QPD motifs, as a primary determinant of carbohy-drate specificity, are marked by asterisks.

5474 THE INITIATION COMPLEXES OF THE LECTIN PATHWAY IN CARP

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

possess conserved amino acid residues responsible for coordina-tion of Ca2� and ligand binding in the CRD (44). Notably, carpMBL1/MBL2 and human MBL both possess an EPN motif.

Identification of zebrafish MBL-like genes by database mining

The entire amino acid sequence of carp MBL1 was used as a queryfor the TBLASTN search of GenBank nucleotide sequence data-base, yielding a best hit of zebrafish genomic contig, AL954692.Four distinct genes that show close similarities with carp MBLwere identified in its 101,677-bp sequence and are designated gene1, gene 2, gene 3, and gene 4, respectively. Their putative exon-intron organizations are predicted primarily on the basis of theso-called GT/AG rule, as shown in Table I and Fig. 5A. All of thegenes are arrayed in the same transcriptional direction.

As shown in Fig. 5B, the predicted sequences of gene 1 and gene2 are very similar to each other but different from gene 3. The gene4-encoding sequence diverges more from the other three. CarpMBL1 shows a substantially higher similarity (81%) to gene 4 thanto genes 1–3 (46–49%), suggesting that gene 4 encodes zebrafishMBL (Fig. 5B). This interpretation is supported by the presence ofan EPN motif in the putative CRD sequence of gene 4 that predicts

an MBL-like sugar specificity (Fig. 5C). By contrast, the deducedsequence of zebrafish GalBL is almost identical with that deducedfrom gene 3, indicating that gene 3 encodes GalBL (24). Interest-ingly, gene 1 and gene 2 show moderate amino acid identity (63–67%) to zebrafish GalBL and contain the QPD motif present inGalBL. These results indicate that zebrafish has at least a singlecopy of MBL gene and three copies of GalBL, probably as a resultof tandem gene duplications. The GalBL sequence from carp ismore similar to gene 1 and gene 2 than to gene 3.

Phylogenetic tree of MBL homologs

A phylogenetic tree of MBL homologs was constructed using theneighbor-joining method with ascidian glucose-binding lectin in-cluded as an outgroup. As shown in Fig. 6, bony fish MBL-likelectins form a clade that probably diverged from the clade that ledto MBLs of higher vertebrates. In the bony fish clade, MBLs forma cluster separate from that of GalBLs indicating that GalBL is acreation of the bony fish lineage. Because of their extremely highidentity, zebrafish GalBL (24), gene 4 sequence predicted here,and the sequence with accession number Q504I3 probably repre-sent allotypic variants of the same gene. In the cluster of GalBLs,

Table I. Zebrafish MBL-like genes identified in a genomic contig AL964692a

Gene name Base Number Length (bp) Encoding Domain

Gene 1Exon 1 22,836–23,043 208 M-ColExon 2 23,137–23,214 78 ColExon 3 23,981–24,712 476 � 256b N � CRD � 3�-UT (to 2nd polyA)

Gene 2Exon 1 25,575–25,782 208 M-ColExon 2 25,875–25,952 78 ColExon 3 26,281–26,686 473 � 933b N � CRD � 3�-UT (to 1st polyA)

Gene 3Exon 1 31,053–31,260 208 M-ColExon 2 31,338–31,415 78 ColExon 3 31,549–32,185 467 � 171b N � CRD � 3�-UT (to 2nd polyA)

Gene 4Exon 1 36,570–36,756 187 M-ColExon 2 36,871–36,957 87 ColExon 3 38,894–38,977 84 NExon 4 39,074–39,655 377 � 205b N � CRD � 3�-UT (to 2nd polyA)

a Abbreviations for domain names: M, the initiation methlonine; Col, collagenous region; N, neck region; CRD, carbohydraterecognition domain; UT, untranslated region.

b Length of the amino acid coding region � 3�-UT.

FIGURE 5. Identification of zebrafish MBL and GalBL genes. A, Arrangement of genes encoding zebrafish MBL and GalBL. A part of a zebrafishgenomic contig (GenBank accession number AL954692) is shown as a horizontal line with nucleotide numbers from the beginning of the contig. Boxesstand for exons predicted on the basis of sequence alignment and the GT/AG rule for intron-exon boundaries. B, Amino acid sequence identity betweenMBL-like lectins of zebrafish and carp. C, Alignment of the amino acid sequences of a part of the MBL-like lectin domain encoded by the zebrafish genes1-4 in A. Primary determinant residues for sugar specificity are shown in boldface. Consensus residues for the C-type lectin domain and residue numbersin human MBL-C (Swiss-Prot accession no. P11226) are shown above and below in the alignment, respectively.

5475The Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

GalBL and genes 1 and 2 probably diverged before the separationof zebrafish, goldfish, and carp from their common ancestor. Thus,GalBL probably arose during the early stages of bony fish evolu-tion and after the MBL/GalBL duplication.

Identification of carp MASP2 associated with MBL and GalBL

To identify the protease responsible for C4 activation by purifiedcarp MBL, carp MBL was analyzed by two-dimensional SDS-PAGE followed by N-terminal sequencing. As shown in Fig. 7A,Coomassie blue staining reveals two minor polypeptide spots withmolecular masses of 55 kDa (spot 2) and 29 kDa (spot 3) alongsidea major 30-kDa spot of MBL (spot 1). N-terminal sequences ofspot 2 and spot 3, respectively, show significant similarities tothose of H chain and L chain of human MASP2 (Fig. 7B).

A cDNA fragment encoding a part of the L chain was amplifiedusing a pair of degenerated primers (P3 and P4). P3 encodes anamino acid sequence stretch (IPWQVMI) in the N-terminal se-quence of the L chain, whereas P4 complementarily encodes awell-conserved sequence (GGIVSWG) near the active serine res-

idue of the L chain, which is the serine protease domain in humanMASP2. RT-PCR amplification from carp hepatopancreaspoly(A)� RNA yielded a single band with expected size (630 bp).The amplified product was subcloned and sequenced, resulting inisolation of a cDNA fragment similar to human MASP2 (data notshown). A full-length cDNA sequence was then obtained by 5�-RACE and 3�-RACE performed using SMART RACE cDNA am-plification kit and gene-specific primers, P7 and P8, designed fromthe cDNA fragment sequence. After the sequences of the RACEproducts were assembled on the basis of a 100-bp-long overlap,authenticity of the assembly was verified by amplification of theentire coding region with the primer pair, P10 and P11.

FIGURE 6. Phylogenetic tree of MBL homologs drawn by the neigh-bor-joining method. Only bootstrap percentages �100% are inserted. Ab-breviations for species: Cyca, the common carp; Gaga, chicken; Hosa,human; Mumu, mouse; Rano, rat; Haro, the solitary Japanese ascidian;Dare, zebrafish; Caau, goldfish; Leja, lamprey. Database accession num-bers of the sequences are as follows: Haro GBL, AB000805; Cyca GalBL,AF227737; Caau GalBL, AF227739; Dare GalBL, AF227738; RanoMBL-C, P08661; Mumu MBL-C, P41317; Bota MBL-C, O02659; HosaMBL-C, P11226; Rano MBL-A, P19999; Mumu MBL-A, P39039; LejaMBL, AB196797. Dare Q504I3 is a translated sequence of zebrafish ex-pressed sequence tag in the trEMBL database.

FIGURE 8. Alignment of deduced amino acid sequence of carp MASP2with carp MASP3, carp C1r/s-A, human MASP1, and human MASP2.Domain names are shown above the sequences. Amino acid sequencesdetermined from protein sequencing are underlined. The catalytic triadresidues in the serine protease domain are marked by open circles, and theresidue that confers a trypsin-like substrate specificity at the S1-site isdenoted by a plus mark. The cleavage site for activation into H and L chainis shown by an arrow.

FIGURE 7. Identification of MASP2-like serine protease associatedwith carp MBL. A, Purified carp MBL was analyzed by two-dimensionalSDS-PAGE (first dimension, nonreducing conditions; second dimension,reducing conditions). B, N-terminal amino acid sequences determined fromthe spots. Residues identical with those of H and L chains of humanMASP2 are shown in bold.

5476 THE INITIATION COMPLEXES OF THE LECTIN PATHWAY IN CARP

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

In the full-length sequence of MASP2-like carp cDNA (2307bp), an ORF of 2055 bp specifies 685 aa. As shown in Fig. 8, thealignment of the deduced protein sequences of carp MASP2 withother members of MASP/C1r/C1s family reveals conservation oftheir domain structure. Importantly, carp MASP2 shows a closersimilarity to that of human MASP2 than to human MASP1,MASP3, C1r, or C1s at the amino acid level (Table II). It shouldbe noted that the serine protease domain of carp MASP2 lacks thetwo cysteine residues that form the histidine loop, and an AGYcodon encodes the active center serine residue as does humanMASP2, C1r, and C1s.

The assignment of carp MASP2 is also supported by the neigh-bor-joining phylogenetic tree (Fig. 9), in which carp MASP2 formsa cluster with MASP2 molecules from higher vertebrates, such asXenopus, mouse, and humans, with a high bootstrap value (97%).

Genomic Southern hybridization of carp MBL, GalBL, andMASP2

Genomic Southern hybridization was performed to estimate thenumber of MBL, GalBL, and MASP2 genes in carp, which has apseudotetraploid origin. As shown in Fig. 10, MBL and GalBLprobes hybridized with one to two common bands in each digest,in addition to minor bands specific for each probes (marked by thearrowheads in Fig. 10). These results suggest that MBL and GalBLgenes, which may be present as a single or duplicated copies, aretandemly located in close proximity, as in the zebrafish genome(Fig. 5A). In contrast, MASP2-probe hybridized with two bands ineach digest, indicating that carp have duplicated MASP2 genes.

DiscussionAmong the lectin pathway components identified in mammals, anMBL homolog or GalBL (24) and a MASP3-like serine protease(25) have been characterized at the cDNA level in bony fish. Un-like mammalian MBL, the bony fish MBL homolog is synthesizedmainly in spleen and predicted to have a selectivity for galactose.(Accordingly, the lectin is designated GalBL in this paper.) Be-cause the natural substrates of MASP3 have not been determinedfor any animal species, it remains unclear whether or not bony fishhave a functional lectin pathway linked with C3 or C4 activationand, if so, which components construct this pathway. In this report,we show that a MBL-MASP2 complex and a GalBL-MASP2 com-plex purified from carp serum activate C4, suggesting that at leasttwo distinct collectins, which differ in the binding specificity,comprise the lectin complement pathway of carp. The identifi-cation of MASP2 is supported by both structural and functionallines of evidence. Certainly, sequence similarity and phylogenyare sufficiently convincing to assign the carp protease asMASP2. In addition, specific cleavage of C4, but not of C4i,into fragment C4b by MBL- or GalBL-MASP2 complexes is areliable indicator of MASP2 activity and rules out the possibil-ity that fragmentation could be catalyzed by nonspecific pro-teases contaminating the purified MBL and GalBL. Because noprotease inhibitor was included in the MBL purification proce-dures, the MASP2 associated with the purified MBL and GalBL

FIGURE 10. Genomic Southern blotting analysis of carp MBL, GalBL,and MASP2. Carp genomic DNA was digested with BamHI (B), HindIII(H), or EcoRI (E), and electrophoresed on a 1% agarose gel, followed byblotting to a Hybond N� membrane. The digests on the membrane werehybridized with DIG-labeled cDNA probes corresponding to the C-typelectin domains of carp MBL (nucleotide number 489–820 in AB110826)and GalBL (nucleotide number 469–837 in AF227737) and to the serineprotease domain of carp MASP2 (nucleotide number 1393–2082 inAB234294). After stringent washing, the hybridized probes were visual-ized with alkaline phosphatase-conjugated anti-DIG and Lumiphos Pluschemiluminescent substrate. Sizes and positions of �/HindIII marker DNAare shown on the left. The black and white arrowheads show MBL-specificbands (5.2 kbp in BamHI-digest and 2.7 kbp in HindIII digest) and GalBL-specific band (3.8 kbp in HindIII digest), respectively, in comparison be-tween MBL and GalBL probes.

Table II. Amino acid sequence identity of carp MASP2 with othermembers of the MASP/Clr/Cls family

Species

Identity with Carp MASP2 (%)a

MASP1 MASP2 MASP3 C1r C1s

Human 38.1 46.5 40.6 37.7 35.1Mouse 39.5 45.5 41.3 34.8 35.8Xenopus 39.8 43.2 42.8/42.9b

Carp 37.4 34.8/33.4c

Trout 35.8Shark 39.9Lamprey 37.4Ascidian 29.0/29.6b

Amphioxus 36.5 34.5

a Calculated on the basis of pair-wise alignments.b Identity with the a/b isotypes.c Identity with the A/B isotypes.

FIGURE 9. Phylogenetic tree of the MASP/C1r/C1s family drawn byneighbor-joining method. Only bootstrap percentages �100% are inserted.Abbreviations for animal species are as in Fig. 6, except for Onmy (rain-bow trout), Xela (Xenopus laevis), Laja (lamprey), Trsc (banded hound-shark), and Brbe (amphioxus).

5477The Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

were in an activated from, as shown by the two-chain structureseen in Fig. 7.

Thus, the present study clearly shows that bony fish have anauthentic MBL in the sense that it shows the same carbohydratespecificity with human MBL. Recently, a similar authentic MBLmolecule associated with MASP-A has been identified from lam-prey and shown to activate lamprey C3 (22). Therefore, it is likelythat MBL was created before the emergence of lamprey and hasbeen conserved as a recognition molecule of the lectin pathwaythroughout vertebrate evolution. Moreover, MBL-A and MBL-Cmust have diverged after the common ancestor of tetrapods hadseparated from bony fish, so the MBL-A/MBL-C-duplication wasprobably an independent event in the mammalian lineage.

With regard to phylogeny of MASPs, carp have been reported topossess MASP3-like and C1r-like serine proteases among themembers of MASP/C1r/C1r family (25, 26). However, in thepresent study, neither of these was detected by N-terminal se-quencing performed on the purified MBL and GalBL preparationsunder the conditions used, although MASP2 was clearly identified.MASP-related protein (MRP) (45), a truncated form of MASP3,was also undetectable. It remains to be discovered whether thecomplexes contain MASP1, MASP3, and MRP, even at a very lowlevel. The absence of MASP1 has recently been reported for chick-en; MASP1-specific serine protease exons are missing in thechicken genome (31). Possibly this could also be the case for carp,although it has yet to be proven by genomic analysis.

One of the unique features of the bony fish complement systemis the diversity of its components. In various fish species, multiplecopies of C3 and factor B genes have been isolated and suggestedto produce functionally differentiated isoforms (23, 46). Carp com-plement, in particular, has multiple copies of gene coding for C3(47), factor B/C2 (48), C1r/s (26), MASP3/MRP (45), C4 (49), C5(50), and factor I (51). It is therefore intriguing that two homolo-gous, but distinct, coding sequences of MBL have been clonedfrom carp. As two clones (nos. 3 and 10) differing only in UTs canbe grouped into MBL2, which has a coding sequence distinct fromthat of MBL1, it is likely that carp MBL1 and MBL2 are encodedby distinct genes, whereas clones nos. 3 and 10 may representallotypes of MBL2 gene. The phylogenetic tree (Fig. 6) indicatesthat MBL1 and MBL2 diverged after carp and zebrafish had sep-arated, and therefore the MBL1/MBL2 duplication is likely to haveoccurred during tetraploidization of the ancestral carp, or could bean even more recent event. Because the deduced amino acid se-quences of MBL1 and MBL2 share 97% similarity and both haveconsensus residues responsible for ligand binding, it is possiblethat the two isoform proteins do not functionally diverged. How-ever, MBL1 and MBL2 could differ in their expression with MBL2as the dominant form, because collagenase digestion of purifiedMBL gives a single N-terminal sequence matching the collagenousregion of MBL2 rather than MBL1 (Fig. 4).

The gene cluster of the MBL-homolog found in zebrafish (Fig.5) demonstrates the diversified isotypes of MBL with distinct car-bohydrate specificity. Sequence similarity (Fig. 5B) and phyloge-netic tree analysis (Fig. 6) of zebrafish MBL-like genes 1–4 implythe mechanism of the MBL-like gene diversification as follows:Bony fish duplicated the MBL gene in a certain stage and mutatedthe extra copy to acquire galactose-binding capability, thereby es-tablishing GalBL and making it the common ancestor of genes1–3. Then the GalBL gene duplicated into gene 3, the direct an-cestor of genes 1 and 2. The gene 1/gene 2 duplication event prob-ably occurred independently from carp in the zebrafish lineage.Although it has yet to be established whether the GalBL homologsalso duplicated in carp, the branching pattern of the GalBL mem-bers in the phylogenetic tree (Fig. 6) predicts that carp also possess

a zebrafish gene 3-like GalBL in addition to the gene 1/2-likeGalBL. Because bony fish MBL and GalBL sequences have beenidentified only from cyprinid species (a family of carp relatives),confirmation of the presence of the two MBL homologs in otherbony fish taxa awaits data from other teleost groups, e.g., salmo-nids (trout), tetraodontes (puffer fish), etc. Notwithstanding,BLAST searches of Tetraodon nigroviridis (the green puffer) andTakifugu rubripes (the tiger puffer) genome databases using carpGalBL as the query yield putative transcripts encoding both a col-lagenous region and a QPD-type CRD (GSTENP00034526001from Tetraodontes and SINFRUP00000162013 from Takifugu). Incontrast, similar searches using carp MBL as the query give aputative transcript that spans a neck region and an EPN-type CRD(SINFRUP00000158981) from Takifugu. These in silico findingsimply that both MBL and GalBL are conserved in the puffer fishspecies. The apparent lack of a collagenous region-encoding se-quence of MBL in the Takifugu draft genome (the fourth assem-bly) could be due to an incomplete assembly of the contigs andscaffolds, which might ensue from the presence of repetitive se-quences, such as those encoding collagenous regions (Gly-X-Yrepeats).

In conclusion, carp complement has a functional lectin pathway,which is armed with MBL and GalBL, both of which associatewith MASP2 to catalyze C4 activation. The biological significanceof the MBL/GalBL diversity in fish is of great relevance to gainingan insight into evolution of the lectin pathway-mediated innateimmunity in vertebrates.

AcknowledgmentsWe thank Hayami Maeda for technical assistance and Dr. Valerie J. Smith(University of St. Andrews, St. Andrews, Scotland) for critically readingthe manuscript. Dr. Kenichi Honjo helped us in developing x-ray films inSouthern hybridization. The BoxShade server (�www.ch.embnet.org/soft-ware/BOX_form.html�) was utilized to format the multiple alignments.

DisclosuresThe authors have no financial conflict of interest.

References1. Walport, M. J. 2001. Complement: first of two parts. N. Engl. J. Med. 344:

1058–1066.2. Fujita, T., M. Matsushita, and Y. Endo. 2001. The lectin-complement pathway—

its role in innate immunity and evolution. Immunol. Rev. 198: 185–202.3. Kawabata, S., and R. Tsuda. 2002. Molecular basis of non-self recognition by the

horseshoe crab tachylectins. Biochim. Biophys. Acta 1572: 414–421.4. Krarup, A., S. Thiel, A. Hansen, T. Fujita, and J. C. Jensenius. 2004. L-ficolin is

a pattern recognition molecule specific for acetyl groups. J. Biol. Chem. 279:47513–47519.

5. Ma, Y. G., M. Y. Cho, M. Zhao, J. W. Park, M. Matsushita, T. Fujita, andB. L. Lee. 2004. Human mannose-binding lectin and L-ficolin function as specificpattern recognition proteins in the lectin activation pathway of complement.J. Biol. Chem. 279: 25307–25312.

6. Dahl, M. R., S. Thiel, M. Matsushita, T. Fujita, A. C. Willis, T. Christensen,T. Vorup-Jensen, and J. C. Jensenius. 2001. MASP-3 and its association withdistinct complexes of the mannan-binding lectin complement activation pathway.Immunity 15: 127–135.

7. Thiel, S., T. Vorup-Jensen, S. M. Stover, W. Schwaeble, S. B. Laursen,K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, U. Holmskov, et al. 1997. Asecond serine protease associated with mannan-binding lectin that activates com-plement. Nature 386: 506–510.

8. Takahashi, M., Y. Endo, T. Fujita, and M. Matsushita. 1999. A truncated form ofmannose-binding lectin-associated serine protease (MASP)-2 expressed by alter-native polyadenylation is a component of the lectin complement pathway. Int.Immunol. 11: 859–863.

9. Schwaeble, W., M. R. Dahl, S. Thiel, C. Stover, and J. C. Jensenius. 2002. Themannan-binding lectin-associated serine proteases (MASPs) and MAp19: fourcomponents of the lectin pathway activation complex encoded by two genes.Immunobiology 205: 455–466.

10. Zhu, Y., S. Thangamani, B. Ho, and J. L. Ding. 2005. The ancient origin of thecomplement system. EMBO J. 24: 382–394.

11. Dishaw, L. J., S. L. Smith, and C. H. Bigger. 2005. Characterization of a C3-likecDNA in a coral: phylogenetic implications. Immunogenetics 57: 535–548.

12. Fujita, T. 2002. Evolution of the lectin-complement pathway and its role in innateimmunity. Nat. Rev. Immunol. 2: 346–353.

5478 THE INITIATION COMPLEXES OF THE LECTIN PATHWAY IN CARP

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

13. Nonaka, M., K. Azumi, X. Ji, C. Namikawa-Yamada, M. Sasaki, H. Saiga,A. W. Dodds, H. Sekine, M. K. Homma, M. Matsushita, et al. 1999. Opsoniccomplement component C3 in the solitary ascidian, Halocynthia roretzi. J. Im-munol. 162: 387–391.

14. Sekine, H., A. Kenjo, K. Azumi, G. Ohi, M. Takahashi, R. Kasukawa,N. Ichikawa, M. Nakata, T. Mizuochi, M. Matsushita, et al. 2001. An ancientlectin-dependent complement system in an ascidian: novel lectin isolated fromthe plasma of the solitary ascidian, Halocynthia roretzi. J. Immunol. 167:4504–4510.

15. Ji, X., K. Azumi, M. Sasaki, and M. Nonaka. 1997. Ancient origin of the com-plement lectin pathway revealed by molecular cloning of mannan binding pro-tein-associated serine protease from a urochordate, the Japanese ascidian, Halo-cynthia roretzi. Proc. Natl. Acad. Sci. USA 94: 6340–6345.

16. Miyazawa, S., K. Azumi, and M. Nonaka. 2001. Cloning and characterization ofintegrin � subunits from the solitary ascidian, Halocynthia roretzi. J. Immunol.166: 1710–1715.

17. Miyazawa, S., and M. Nonaka. 2004. Characterization of novel ascidian � inte-grins as primitive complement receptor subunits. Immunogenetics 55: 836–844.

18. Endo, Y., M. Nonaka, H. Saiga, Y. Kakinuma, A. Matsushita, M. Takahashi,M. Matsushita, and T. Fujita. 2003. Origin of mannose-binding lectin-associatedserine protease (MASP)-1 and MASP-3 involved in the lectin complement path-way traced back to the invertebrate, amphioxus. J. Immunol. 170: 4701–4707.

19. Azumi, K., R. De Santis, A. De Tomaso, I. Rigoutsos, F. Yoshizaki, M. R. Pinto,R. Marino, K. Shida, M. Ikeda, M. Ikeda, et al. 2003. Genomic analysis ofimmunity in a Urochordate and the emergence of the vertebrate immune system:“waiting for Godot.” Immunogenetics 55: 570–581.

20. Shida, K., D. Terajima, R. Uchino, S. Ikawa, M. Ikeda, K. Asano, T. Watanabe,K. Azumi, M. Nonaka, Y. Satou, et al. 2003. Hemocytes of Ciona intestinalisexpress multiple genes involved in innate immune host defense. Biochem. Bio-phys. Res. Commun. 302: 207–218.

21. Matsushita, M., A. Matsushita, Y. Endo, M. Nakata, N. Kojima, T. Mizuochi, andT. Fujita. 2004. Origin of the classical complement pathway: lamprey orthologueof mammalian C1q acts as a lectin. Proc. Natl. Acad. Sci. USA 101:10127–10131.

22. Takahashi, M., D. Iwaki, A. Matsushita, M. Nakata, M. Matsushita, Y. Endo, andT. Fujita. 2006. Cloning and characterization of mannose-binding lectin fromlamprey (Agnathans). J. Immunol. 176: 4861–4868.

23. Nakao, M., J. Mutsuro, M. Nakahara, Y. Kato, and T. Yano. 2003. Expansion ofgenes encoding complement components in bony fish: biological implications ofthe complement diversity. Dev. Comp. Immunol. 27: 749–762.

24. Vitved, L., U. Holmskov, C. Koch, B. Tisner, S. Hansen, and K. Skjodt. 2000.The homologue of mannose-binding lectin in the carp family Cyprinidae is ex-pressed at high level in spleen, and the deduced primary structure predicts affinityfor galactose. Immunogenetics 51: 955–964.

25. Endo, Y., M. Takahashi, M. Nakao, H. Saiga, H. Sekine, M. Matsushita,M. Nonaka, and T. Fujita. 1998. Two lineages of mannose-binding lectin-asso-ciated serine protease (MASP) in vertebrates. J. Immunol. 161: 4924–4930.

26. Nakao, M., K. Osaka, Y. Kato, K. Fujiki, and T. Yano. 2001. Molecular cloningof the complement C1r/C1s/MASP2-like serine proteases from the common carp(Cyprinus carpio). Immunogenetics 52: 255–263.

27. Wang, T., and C. J. Secombes. 2003. Complete sequencing and expression ofthree complement components, C1r, C4 and C1 inhibitor, of the classical acti-vation pathway of the complement system in rainbow trout Oncorhynchusmykiss. Immunogenetics 55: 615–628.

28. Kakinuma, Y., Y. Endo, M. Takahashi, M. Nakata, M. Matsushita,S. Takenoshita, and T. Fujita. 2003. Molecular cloning and characterization ofnovel ficolins from Xenopus laevis. Immunognetics 55: 29–37.

29. Laursen, S. B., J. E. Hedemand, S. Thiel, A. C. Willis, E. Skriver, P. S. Madsen,and J. C. Jensenius. 1995. Collectin in a non-mammalian species: isolation andcharacterization of mannan-binding protein (MBP) from chicken serum. Glyco-biology 5: 553–561.

30. Laursen, S. B., T. S. Dalgaard, S. Thiel, B. L. Lim, T. V. Jensen,H. R. Juul-Madsen, A. Takahashi, T. Hamana, M. Kawakami, and J. C. Jensenius.1998. Cloning and sequencing of a cDNA encoding chicken mannan-binding

lectin (MBL) and comparison with mammalian analogues. Immunology 93:421–430.

31. Lynch, N. J., S. U. Khan, C. M. Stover, S. M. Sandrini, D. Marston, J. S. Presanis,and W. J. Schwaeble. Composition of the lectin pathway of complement in Gal-lus gallus: absence of mannan-binding lectin-associated serine protease-1 inbirds. J. Immunol. 174: 4998–5006.

32. Yano, T., and M. Nakao. 1994. Isolation of a carp complement protein homol-ogous to mammalian factor D. Mol. Immunol. 31: 337–342.

33. Nonaka, M., N. Yamaguchi, S. Natsuume-Sakai, and M. Takahashi. 1981. Thecomplement system of rainbow trout (Salmo gairdneri). I. Identification of theserum lytic system homologous to mammalian complement. J. Immunol. 126:1489–1494.

34. Allen, H. J., and E. A. Z. Johnson. 1976. The isolation of lectins on acid-treatedagarose. Carbohydrate Res. 50: 121–131.

35. Dodds, A. W. 1993. Small-scale preparation of complement components C3 andC4. Methods Enzymol. 223: 46–61.

36. Dodds, A. W., S. L. Smith, R. P. Levine, and A. C. Willis. 1998. Isolation andinitial characterisation of complement components C3 and C4 of the nurse sharkand the channel catfish. Dev. Comp. Immunol. 22: 207–216.

37. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227: 680–685.

38. Nakao, M., T. Uemura, and T. Yano. 1996. Terminal components of carp com-plement constituting a membrane attack complex. Mol. Immunol. 33: 933–937.

39. Matsushita, M., Y. Endo, S. Taira, Y. Sato, T. Fujita, N. Ichikawa, M. Nakata,and T. Mizuochi. 1996. A novel human serum lectin with collagen- and fibrin-ogen-like domains that functions as an opsonin. J. Biol. Chem. 271: 2448–2454.

40. Matsushita, M., and T. Fujita. 1992. Activation of the classical complement path-way by mannose-binding protein in association with a novel C1s-like serineprotease. J. Exp. Med. 176: 1497–1502.

41. Nakao, M., Y. Fushitani, K. Fujiki, M. Nonaka, and T. Yano. 1998. Two divergedcomplement factor B/C2-like cDNA sequences from a teleost, the common carp(Cyprinus carpio). J. Immunol. 161: 4811–4818.

42. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins.1997. The CLUSTAL X windows interface: flexible strategies for multiple se-quence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876–4882.

43. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method forreconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–425.

44. Quesenberry, M. S., and K. Drickamer. 1992. Role of conserved and noncon-served residues in the Ca2�-dependent carbohydrate-recognition domain of a ratmannose-binding protein: analysis by random cassette mutagenesis. J. Biol.Chem. 267: 10831–10841.

45. Nagai, T., J. Mutsuro, M. Kimura, Y. Kato, K. Fujiki, T. Yano, and M. Nakao.2000. A novel truncated isoform of the mannose-binding lectin-associated serineprotease (MASP) from the common carp (Cyprinus carpio). Immunogenetics 51:193–200.

46. Sunyer, J. O., I. K. Zarkadis, and J. D. Lambris. 1998. Evolution and diversity ofthe complement system of poikilothermic vertebrates. Immunol. Rev. 166: 39–57.

47. Nakao, M., J. Mutsuro, R. Obo, K. Fujiki, M. Nonaka, and T. Yano. 2000.Molecular cloning and protein analysis of divergent forms of the complementcomponent C3 from a bony fish, the common carp (Cyprinus carpio): presence ofvariants lacking the catalytic histidine. Eur. J. Immunol. 30: 858–866.

48. Nakao, M., M. Matsumoto, M. Nakazawa, K. Fujiki, and T. Yano. 2002. Diver-sity of complement factor B/C2 in the common carp (Cyprinus carpio): threeisotypes of B/C2-A expressed in different tissues. Dev. Comp. Immunol. 26:533–541.

49. Mutsuro, J., N. Tanaka, Y. Kato, A. W. Dodds, T. Yano, and M. Nakao. 2005.Two divergent isoforms of the fourth complement component from a bony fish,the common carp (Cyprinus carpio). J. Immunol. 175: 4508–4517.

50. Kato, Y., M. Nakao, J. Mutsuro, I. K. Zarkadis, and T. Yano. 2003. The com-plement component C5 of the common carp (Cyprinus carpio): cDNA cloning oftwo distinct isotypes that differ in a functional site. Immunogenetics 54: 807–815.

51. Nakao, M., S. Hisamatsu, M. Nakahara, Y. Kato, S. L. Smith, and T. Yano. 2003.Molecular cloning of the complement regulatory factor I isotypes from the com-mon carp (Cyprinus carpio). Immunogenetics 54: 801–806.

5479The Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from