LATGChapters 8 & 9

Molecular Biology and Genetics

Molecular Biology

• …is the study of biology at the molecular level

• …focuses specifically on DNA, RNA, and protein

• …is a tool used to study genetics

Some Definitions

• Genetics …is the study of how genes interact (with each other AND their environment) to produce the inherited characteristics that we see every day

• Genome …the entire collection of genes an organism has.

More Definitions:

• Genotype = the genetic makeup of an organism– Every person (every mouse, every cow) has two

copies of each gene, one from each parent• “Homozygous normal” = two normal copies (aka

Wildtype)• “Heterozygote” = one normal & one abnormal copy• “Homozygous abnormal” = two abnormal copies (in

transgenics, aka “Knock-Out”

There’s still more...

• Phenotype = the physical features of an organism (i.e., tall/short; red/white etc)

• Mutation = any change in the DNA of a gene

• Genetic Engineering...is the term used to describe the manipulation of the genetic make-up of an organism

Where is your DNA located?

Chromosomes from a human female

Where is your DNA?

• DNA is in the nucleus of the cell, on structures called chromosomes.

• Chromosomes are made of genes

• Genes are made of DNA

Structure of DNA• DNA is a long string (polymer) of 4 bases• These bases universal!

– A = Adenosine– T = Thymine– C = Cytosine– G = Guanine

• The order (sequence) of the bases is what makes one gene different from another gene.

DNA Structure, cont’d

• A -- T• C -- G• GATTCC CTAAGG• DNA exists as a double helix

(twisted ladder)• Each rung of the ladder is a base

pair

How do cells transmit their genetic information?

• Replication = the process by which a cell duplicates its DNA.

• When a cell divides,one copy gets passed onto the new cell

How do cells interpret the information in the DNA?

• Transcription: the process by which the DNA code is “read”.– DNA is transcribed into RNA in the nucleus

Transcription

• RNA has 4 bases:

• Adenine A=U

• Guanine G=C

• Cytosine

• Uracil*** (Uracil is used instead of Thymine)

• Unlike DNA, RNA is single-stranded

Translation

• Occurs outside the nucleus, via ribosomes

• RNA is “read” in groups of three bases called “codons.”

• Each codon corresponds to an amino acid

Information Flow in the Cell

Techniques

• Extraction of DNA

• Restriction Digestion

• PCR

• Electrophoresis

• Southern blotting

Extraction of DNA

• Enzymes “digest” cell walls and release DNA into solution

• Add phenol to remove proteins

• Spin to separate DNA from proteins

• Add ethanol

Restriction enzymes

• These are enzymes that cut (digest) DNA at specific sites (sequences).

• Examples:– Eco RI only cuts the sequence …

GAATTC…– Pst 1 only cuts the sequence …CTGCAG

• Because everyone’s DNA is comprised of the same 4 nucleotides (A,T, C, G), you can attach one species to another...

Cloning (using RE)

Mouse Bacteria

CGAAGGAATTCCGTAG TGATTGAATTCTTAACGCTTCCTTAAGGCATC ACTAACTTAAGAATTG

+ Eco R1

CGAAG AATTCCGTAG TGATTG AATTCTTAACGCTTCTTAA GGCATC ACTAACTTAA GAATTG

+ ligase (another enzyme that attaches the m/c)

CGAAG AATTCTTAAC GCTTCTTAAGAATTG

Polymerase Chain Reaction (PCR)

• Based on the fact that A=T and C=G• Need only a tiny bit of DNA• ***Must know some of the sequence of the

gene of interest• Three simple steps: heat, add primers etc,

cool solution so bases will bind, repeat!• Can amplify a piece of DNA a million-fold!

PCR

Detection of DNA

• Use agarose gels

• Gel acts like a filter: DNA separates by size

• Stain the gel with a dye to make the DNA to make it fluoresce under UV light.

Blotting

• Southern Blot – DNA cut with enzymes– transferred to membrane– hybridized to probe that is specific to gene

of interest– exposed to film– if gene is present, you will see a band on

the film

Types of Blots

• Southern blotting -- DNA

• Northern blotting -- RNA

• Western blotting -- protein

Genetic Engineering of Mice– Two types

• Transgenic - a gene is added via pronuclear injection

– This is used to “overexpress” a gene– ex: Alzheimer’s and Beta-amyloid

• Targeted Mutation (aka “KO”) - a gene altered then added to the genome using ES cells

– This is used to delete a gene– ex: ERKO--estrogen receptor KO mice

Transgenic mice

• Created through pronuclear injection

• Need 4 groups of mice– superovulated females– stud males– vasectomized males– pseudopregnant females

The Mice• Superovulated females --given hormone

injections to make them release more eggs than usual (30-60)

• Stud Males --are mated with the s.o.females so that a lot of embryos are produced

• Pseudopregnant females --a female is mated to a sterile male so that her body will produce hormones that prepare it for pregnancy

Procedure

Transgenic Mice

• Transgene can integrate ANYWHERE in the mouse genome.

• Integrates in 1-several hundred copies• Must screen pups (PCR) to determine

which pup have the transgene, and will pass it on.

• Must observe transgenic mice carefully to observe phenotype

Phenotype

• Depends on the gene you’re overexpressing

• Sometimes it’s obvious, sometimes it’s not.

• Must observe these mice carefully

Knockout Mice

• Knockout mice --a gene is deleted

• Similar to transgenic mice, must carefully observe for phenotype

• Need the same 4 groups of mice, plus ES cells

• ES cells = embryonic stem cells– totipotent

Embryonic Stem Cells

• Are from the inner cell mass of a blastocyst

• can develop into any part of the body

• “totipotent”

KnockOut Mice• Culture ES cells from white (129) mice

and target gene using electric current

• Mate black mice; insert “white” ES cells into black blastocyst

• Pups = chimeras (black and white)

• Mate chimera to black mouse.

• If white pups are produced, targeted gene has been passed on!

Transgenic Animals and You

• You are very important!!

• These mice are expensive/time-consuming to make

• You must carefully observe the animals for phenotype changes– strange gait, spinning, too fat, too thin,

scaly skin…

Good Luck!