knowledge processing with big data and semantic web technologies
TRANSCRIPT
© Insight 2014. All Rights Reserved
Knowledge Processing with Big Data and
Semantic Web TechnologiesAli Hasnain, Narumol Prangnawarat, Stefan Decker, Naoise Dunne
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Presenters and Contributors
Ali Hasnain
Stefan Decker
Narumol Prangnawarat
Naoise Dunne
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Agenda• Motivation• Infrastructure• Data Curation• Query Federation• Analyze• Visualization• Hands On Session
© Insight 2014. All Rights Reserved
Session 0: Motivation
The Web is evolving...
WWW (Tim Berners-Lee)“There was a second part of the dream […] we could then use computers to help us analyse it, make sense of what we re doing, where we individually fit in, and how we can better work together.”
© Insight 2014. All Rights Reserved
A Network of Knowledge● Interconnected● Universal● All encompassing
● assists humans, organisations and systems with problem solving
● enabling innovation and increased productivity
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved 7 of 46
Two Key Ingredients
1. RDF – Resource Description FrameworkGraph based Data – nodes and arcs• Identifies objects (URIs)• Interlink information (Relationships)
2. Vocabularies (Ontologies)• provide shared understanding of a domain• organise knowledge in a machine-comprehensible way• give an exploitable meaning to the data
Why Graphs?Cities:Dublin
84421km2Geo:IslandOfIreland
EU:RepublicOfIrelandGeo:locatedOn
Geo:areaGeo:hasCapital
Geo:hasLargestCityWikipedia.org
Gov.ieEU:RepublicOfIreland
Person:EndaKennyGov:hasTaoiseach Gov:hasDepartment
IE:DepartmentOfFinance
Why Graphs?Cities:Dublin
84421km2Geo:IslandOfIreland
EU:RepublicOfIrelandGeo:locatedOn
Geo:areaGeo:hasCapital
Geo:hasLargestCityWikipedia.org
Gov.ieEU:RepublicOfIreland
Person:EndaKennyGov:hasTaoiseach Gov:hasDepartment
IE:DepartmentOfFinance
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Why Graphs?
TGFβ-3
transforming growth factor, beta 3
Homo sapiens
CCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGG …
14q24
nci:has_description
nih:sequence
nih:organism
nih:location
nih:organism
TGFβ-3
Platelet activation, signalling,aggregation
Response to elevated platelet cytosol Ca2+
Platelet degranulation
rea:process
rea:processrea:process
Gene Database Pathway
Database
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Why Graphs?
TGFβ-3
transforming growth factor, beta 3
Homo sapiens
CCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGG …
14q24
nci:has_description
nih:sequence
nih:organism
nih:location
nih:organism
TGFβ-3
Platelet activation, signalling,aggregation
Response to elevated platelet cytosol Ca2+
Platelet degranulation
rea:process
rea:processrea:process
Gene Database Pathway
Database
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Linked Open Data Cloud
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Life Sciences….
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Cultural Institutions...
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Open Government Data...
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Legacy Data Sources….
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
How to analyse these data?
Heterogeneity in • Data: Different formats• Domains: How to cross discipline borders?• Users: Life Science Data needs different
analysis and visualisation than Cultural Data
An analysis tool for each domain?
© Insight 2014. All Rights Reserved
Information
Action
Networked Data Management
Abstraction,Reasoning,Analytics
Visualisation,Collaboration,Exploitation
Reusable Infrastructure: Knowledge Pipeline
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Challenges for a Knowledge Pipeline
• How to ingest data sets• How to automate and scale processing• How to realise large scale Linked Data processing• How to analyse large data sets• How to visualize large datasets• How to combine different components
© Insight 2014. All Rights Reserved
Session 1: Infrastructuretrends in big linked data infrastructure
© Insight 2014. All Rights Reserved
IntroductionCloud computing frameworks tailored for managing and analyzing big data-sets are powering ever larger clusters of computers.
This presentation will describe the infrastructure that is required to serve a linked data flavour of big data
© Insight 2014. All Rights Reserved
What is Big Data?“Big Data is characterized by High Volume, Velocity
and Variety requiring specific Technology and Analytical Methods for its transformation into Value” - Gartner
• Volume - Data is too big to fit on even largest server
• Velocity - Data need handling based on speed • Variety - heterogeneous Data - comes in
many forms• Veracity - (sometimes) Quality of the data
© Insight 2014. All Rights Reserved Infographic summerizing 4 Vs
© Insight 2014. All Rights Reserved
The qualities of a big data Infrastructure• Distributed
• Data and its processing is shared on large cluster multiple cheap commodity servers
• loose coupling, isolation, location transparency, data locality & app-level composition
• High Utilisation• The infrastructure give the best use of computing resources
• Resilience (handling failure)• The infrastructure stays responsive in the face of failure and can “heal”
• Scalability • grows to meet demand (Elastic), responsive under varying workload (Load
balanced)• Operationally efficient
• Needs to be highly automated, be very easy to maintain
© Insight 2014. All Rights Reserved
DistributedHigh Utilisation & Scalability
The Rise of distributed Datacenter Schedulers
© Insight 2014. All Rights Reserved
Why Datacenter schedulers? Schedulers run your Distributed Apps
• are an operating system kernel for the cloud• Schedulers coordinate execution of work on
cluster• help you to get as many compute resources as
you want whenever you want it• Abstract some scalability and load balancing
issues
© Insight 2014. All Rights Reserved
Benefits of using a Scheduler• Efficiency - best use of computing resources• Agility - change your application mix with no
turnaround• Scalability - grow to the current demand of your
app• Modularity - 2 level schedulers have plugin
frameworks that allow quick repurposing of core and no reliance on one vendor (more later)
© Insight 2014. All Rights Reserved
Datacenter schedulersSchedulers help you focus on your own work and not the infrastructure.“its great to be able to focus on what it is you want
to be doing rather than worrying about how do you get what it is you need in order to be able to get stuff done” - John Wilkes (Google)
© Insight 2014. All Rights Reserved Quick history of distributed schedulers
2004 mapreduce paper
2004 Google Borg
2011 Hadoop1.02003 Google filesystem
2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015
2008 Hadoop released
2013 Yarn
2010 Spark Paper
2010 Nexus (Mesos)
2005 Hadoop started
2013 Mesos Released
2011 Mesos Paper
2014 Kubernetes
2014 Google Omega paper
History of Datacenter Schedulers
2003 Slurm
© Insight 2014. All Rights Reserved
HadoopMonolithic scheduler: Original opensource datacenter scheduler
• jobs are batched and executed
• Designed only to run Mapreduce jobs
• No concurrency between apps
• Evolving into yarn
Hadoop
Linux Server
Linux Server
hadoop- resource management
mesos slavemesos slave
Linked datat m/r job
Linked datat m/r job
Linked datat app
© Insight 2014. All Rights Reserved
Mesos2 level scheduler : More flexible
• Can Schedule many kinds of applications
• Frameworks (such as spark) are delegated the per application scheduling
• Mesos responsible for resource distribution between applications and enforcing overall fairness
• Very modular, due to 2 level scheduling. frameworks manage apps as they like
Mesos
Linux Server
Linux Server
Mesos - resource management
Mesos - scheduler jobs
frameworkchronos
mesos slave
frameworkspark
frameworkmarathon
mesos slave
Hadoop M/R job
Linked data job
Linked datat app
© Insight 2014. All Rights Reserved
Schedulers RecapScheduler allow you to use your cluster as one
machine• ease operations• provide elasticity and load balancing• Can run both batch and longer running jobs• Are Efficient, Agile, scalable and modular
© Insight 2014. All Rights Reserved
Managing Failure in Infrastructure
“Everything fails all the time”Werner Vogels (CTO Amazon)
© Insight 2014. All Rights Reserved
Handling FailureThe harsh reality: all distributed infrastructures must deal with failurefor the designers of applications running on distributed infrastructure (even Mesos), a great number of design mistakes need to be avoided...
© Insight 2014. All Rights Reserved
Fallacies of distributed computing• The most common misconceptions that lead to failure of Network
infrastructure:• The network is reliable.• Latency is zero.• Bandwidth is infinite.• The network is secure.• Topology doesnt change.• There is one administrator.• Transport cost is zero.• The network is homogeneous
All prove to be false in the long run and all cause big trouble and painful learning experiences.
© Insight 2014. All Rights Reserved
How successful infrastructure avoids failureNo Single point of failuremultiple masters, multiple copies of data, and redundancy on all services. Use elections between masters, use distributed locks and thresholds.
Design Applications to Expect FailureApplications should continue to function even if the underlying physical hardware fails.Evolving infrastructure eases this by the use schedulers and container managers.
Special Channel for failuresProvides the means to delegate errors as messages on their own channel or service. Techniques include log aggregation and shared monitoring services.
© Insight 2014. All Rights Reserved
Operationally efficientUsing Containers for better Quality of Service
© Insight 2014. All Rights Reserved
ContainersContainers run your application in isolation in a portable and repeatable fashion“Because of the way that ... containers separate the application constraints from infrastructure concerns, we help solve that dependency hell.” - Docker
© Insight 2014. All Rights Reserved
Why Containers
Containers Are: • Small (footprint)• Portable• Fast
Containers Allow:• Resiliency
• can be redeployed in seconds• Operationally efficiency
• The infrastructure can “heal”• Scalability
• on a single server allows resources (such as CPU) to be dialed up or down
© Insight 2014. All Rights Reserved
Containers vs. VMs
Virtual Machinesemulate a virtual hardware, require considerable overhead in CPU, Disk and Memory
Containersuse shared operating systems much more efficient than hypervisors in system resource terms
© Insight 2014. All Rights Reserved
Containers vs. VMs
© Insight 2014. All Rights Reserved
ContainersBut which container to use.
Many choices exist…LXC, Docker, Rocket
© Insight 2014. All Rights Reserved
Docker - our container of choiceWhy Docker?• Best of breed at the moment• integrates natively with Mesos and Kubernetes • Has great infrastructure including • Docker registry for looking up containers• Docker compose for combining containers
Alternatives• Rockit - More secure as uses init.d but Linux only
© Insight 2014. All Rights Reserved
Container StandardisationBut choosing a container is not a commitment...Looks like standardisation around the corner via open container:
https://www.opencontainers.org/
Initiative Sponsors: Apcera, AT&T, AWS, Cisco, ClusterHQ, CoreOS, Datera, Docker, EMC, Fujitsu, Google, Goldman Sachs, HP, Huawei, IBM, Intel, Joyent, Kismatic, Kyup, the Linux Foundation, Mesosphere, Microsoft, Midokura, Nutanix, Oracle, Pivotal, Polyverse, Rancher, Red Hat, Resin.io, Suse, Sysdig, Twitter, Verizon, VMWare
© Insight 2014. All Rights Reserved
Recap: ContainersContainers Are: • Small (footprint), Portable, Fast• Allow you to repeatedly deploy applications• Work well with schedulers such as Mesos• Help with Resiliency and scalability
© Insight 2014. All Rights Reserved
Putting it all togetherInsights Linked Data infrastructure
© Insight 2014. All Rights Reserved
Linked Data Infrastructure
Mesos
Mesos - scheduler short jobs Mesos - scheduler long run jobs
Spark Fwk Chronos Fwk
Marathon Framework
OS Monitor
Mesos Monitor
Linux Server
Linux Server
Linux Server
Mesos - resource management
mesos client Docker mesos
client Docker mesos client Docker
Resources cpu mem disk Managed by Mesos
Applications work with frameworks to get resources they need
Frameworks Negotiate with mesos to run their jobs
DatastoresHDT, Neo4JgraphX Granatum RevealedGraph
Jobs
Docker manages isolation on Linux servers
© Insight 2014. All Rights Reserved
Linked Data Infrastructure
Mesos
Linux Server
Linux Server
Linux Server
Mesos - resource management
Mesos - scheduler short jobs Mesos - scheduler long run jobs
Spark Fwk
Chronos Fwk
DatastoresHDT, Neo4J
Marathon
graphX
mesos client Docker
OS Monitor
Mesos Monitor
mesos client Docker mesos
client Docker
We use graph X for large graph batch jobs
We use both HDT(RDF Store)Neo4J (Graph)
Granatum Revealed
We deploy specialised linked data applicationsto cluster
© Insight 2014. All Rights Reserved
RecapTo provide linked data at scale and with the right service mix, infrastructures need to consider:
• Services to help application to be Distributed Scalable
• High Utilisation of computing resources • Know how you will handle failure• Operationally efficient
We suggest, using schedulers such as mesos with containers (Docker), use suitable frameworks (GraphX/Spark) and datastores (Neo4J)
© Insight 2014. All Rights Reserved
Data Curation•Ali Hasnain, Narumol Prangnawarat, Naoise
Dunne
© Insight 2014. All Rights Reserved
IntroWe will discuss: •Serialisation formats for RDF•Converting between these…•Mapping to conventional data
• D2RQ• TARQL
© Insight 2014. All Rights Reserved
Serialisation Formats
© Insight 2014. All Rights Reserved
RDF Serialization formats - W3C Standards• Turtle
• a compact, human-friendly format.• N-Triples, N-Quads
• a simple, easy-to-parse, line-based format that is not as compact as Turtle. Nquads: superset of N-Triples, for multiple RDF graphs
• JSON-LD, • a JSON-based serialization
• RDF/XML,• first standard format for serializing RDF.
© Insight 2014. All Rights Reserved
N triples unreadable<http://www.w3.org/2001/sw/RDFCore/ntriples/> <http://purl.org/dc/elements/1.1/creator> "Dave Beckett" .
<http://www.w3.org/2001/sw/RDFCore/ntriples/> <http://purl.org/dc/elements/1.1/creator> "Art Barstow" .
<http://www.w3.org/2001/sw/RDFCore/ntriples/> <http://purl.org/dc/elements/1.1/publisher> <http://www.w3.org/> .
© Insight 2014. All Rights Reserved
RDF Serialization formats - Non StandardNon standard but popular formats
• N3 or Notation3, • a non-standard serialization that is very similar to Turtle, but
has some additional features, such as the ability to define inference rules
• HDT• Compressed Binary RDF, HDT compresses big RDF datasets
while maintaining search and browse operations • Microformats
• Similar to RDF, and can be converted RDF. Uses html pages as both a human readable document and machine readable data, very big on web
© Insight 2014. All Rights Reserved
Converting between standardsAny23
• Created at Deri (Insight) for converting popular serialisation formats.
• Now First class apache project• Online converter http://any23-vm.apache.org/
© Insight 2014. All Rights Reserved
Mapping traditional data to Linked DataTwo very popular tools created at Insight (Deri)D2RQ - http://d2rq.org/Maps relational databases to RDF
TARQLMaps tables (csv) to RDF
© Insight 2014. All Rights Reserved
Why TarqlVery simple mapping syntax.
• Most of the world’s structured data is stored as tables
• Most RDBMS database tables can be denormalized to a single table
• Data cleansing can be an earlier step and make use of best in case for tabular data
• Compared to tools such as D2RQ very easy to learn and use
© Insight 2014. All Rights Reserved
TARQL
General structure of TARQL mapping:
• Normal SPARQL select but has From file parameter
• Can work on selects and constructs.
SELECT DISTINCT ?id ?name FROM <file:filename.csv> WHERE {} LIMIT 100
© Insight 2014. All Rights Reserved
TARQL - Select
Looks very like normal SPARQL, in where clause
• Special Bind statements that bind column name with graph construct
SELECT ... WHERE { BIND (URI(CONCAT('http://example.com/ns#', ?b)) AS ?uri) BIND (STRLANG(?a, 'en') AS ?with_language_tag) }
© Insight 2014. All Rights Reserved
TARQL -Construct
Looks very like normal SPARQL, in where clause
• Special Bind statements that bind column name with graph construct
CONSTRUCT { ?URI a ex:Organization;
ex:name ?NameWithLang;ex:CIK ?CIK;ex:LEI ?LEI;ex:ticker ?Stock_ticker;
} FROM <file:companies.csv> WHERE { BIND (URI(CONCAT('companies/', ?Stock_ticker)) AS ?URI) BIND (STRLANG(?Name, "en") AS ?NameWithLang) }
© Insight 2014. All Rights Reserved
TarqlAny23
• Created at Insight (DERI) for converting popular serialisation formats.
• Online converter http://any23-vm.apache.org/
© Insight 2014. All Rights Reserved
Accessing Data- Query Federation
Ali Hasnain, Narumol Prangnawarat, Naoise Dunne
© Insight 2014. All Rights Reserved
SPARQL Query Federation Approaches
••SPARQL Endpoint Federation (SEF)••Linked Data Federation (LDF)••Distributed Hash Tables (DHTs)••Hybrid of SEF+LDF
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
SPARQL Query Federation Approaches
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
SPARQL Endpoint Federation Approaches• Most commonly used approaches• Make use of SPARQL endpoints URLs• Fast query execution• RDF data needs to be exposed via SPARQL
endpoints• E.g., HiBISCus, FedX, SPLENDID, ANAPSID, LHD
etc.
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
Linked Data Federation ApproachesData needs not be exposed via SPARQL endpoints
Uses URI lookups at runtime
Data should follow Linked Data principles
Slower as compared to previous approaches
E.g., LDQPS, SIHJoin, WoDQA etc.
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
Query federation on top of Distributed Hash Tables•Uses DHT indexing to federate SPARQL queries
•Space efficient
•Cannot deal with whole LOD
•E.g., ATLAS
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
Hybrid of SEF+LDFFederation over SPARQL endpoints and Linked Data
Can potentially deal with whole LOD
E.g., ADERIS-Hybrid
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
SPARQL Endpoint Federation
S1
S2
S3
S4
RDF RDF RDF RDF
Parsing/Rewriting
Source Selection
Federator Optimzer
Integrator
Rewrite query and get Individual Triple
Patterns
Identify capable source against Individual Triple
Patterns
Generate optimized sub-query Exe. Plan
Integrate sub-queries results
Execute sub-queries
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
FedBench (LD3): Return for all US presidents their party membership and news pages about them.
SELECT ?president ?party ?page WHERE {?president rdf:type dbpedia:President .?president dbpedia:nationality dbpedia:United_States .?president dbpedia:party ?party .?x nyt:topicPage ?page .?x owl:sameAs ?president .}
dbpedia
RDF
Source Selection Algorithm
Triple pattern-wise source selection
S1TP1 =
KEGG
RDF
ChEBI
RDF
NYT
RDF
SWDF
RDF
LMDB
RDF
Jamendo
RDF
Geo Names
RDF
DrugBank
RDF
S1 S2 S3 S4 S5 S6 S7 S8 S9
//TP1
//TP3//TP4
//TP5
//TP2
TP2 = S1
Source Selection
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
FedBench (LD3): Return for all US presidents their party membership and news pages about them.
SELECT ?president ?party ?page WHERE {?president rdf:type dbpedia:President .?president dbpedia:nationality dbpedia:United_States .?president dbpedia:party ?party .?x nyt:topicPage ?page .?x owl:sameAs ?president .}
dbpedia
RDF
Source Selection Algorithm
Triple pattern-wise source selection
S1TP1 =
KEGG
RDF
ChEBI
RDF
NYT
RDF
SWDF
RDF
LMDB
RDF
Jamendo
RDF
Geo Names
RDF
DrugBank
RDF
S1 S2 S3 S4 S5 S6 S7 S8 S9
//TP1
//TP3//TP4
//TP5
//TP2
TP2 = S1
TP3 = S1
Source Selection
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
FedBench (LD3): Return for all US presidents their party membership and news pages about them.
SELECT ?president ?party ?page WHERE {?president rdf:type dbpedia:President .?president dbpedia:nationality dbpedia:United_States .?president dbpedia:party ?party .?x nyt:topicPage ?page .?x owl:sameAs ?president .}
dbpedia
RDF
Source Selection Algorithm
Triple pattern-wise source selection
S1TP1 =
KEGG
RDF
ChEBI
RDF
NYT
RDF
SWDF
RDF
LMDB
RDF
Jamendo
RDF
Geo Names
RDF
DrugBank
RDF
S1 S2 S3 S4 S5 S6 S7 S8 S9
//TP1
//TP3//TP4
//TP5
//TP2
TP2 = S1
TP3 = S1 TP4 = S4
Source Selection
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
FedBench (LD3): Return for all US presidents their party membership and news pages about them.
SELECT ?president ?party ?page WHERE {?president rdf:type dbpedia:President .?president dbpedia:nationality dbpedia:United_States .?president dbpedia:party ?party .?x nyt:topicPage ?page .?x owl:sameAs ?president .}
dbpedia
RDF
Source Selection Algorithm
Triple pattern-wise source selection
S1TP1 =
KEGG
RDF
ChEBI
RDF
NYT
RDF
SWDF
RDF
LMDB
RDF
Jamendo
RDF
Geo Names
RDF
DrugBank
RDF
S1 S2 S3 S4 S5 S6 S7 S8 S9
//TP1
//TP3//TP4
//TP5
//TP2
TP2 = S1
TP3 = S1 TP4 = S4
TP5 = S1 S2 S4-S9
Source Selection
Total triple pattern-wise sources selected = 1+1+1+1+8 => 12
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
SPARQL Query Federation Engine•FedX
•SPLENDID
•HiBISCuS+FedX
•HiBISCuS+SPLENDID
•ANAPSID
•BioFed
•LHD
•DARQ
Curtsey Muhammad Saleem (AKSW)
© Insight 2014. All Rights Reserved
Overview of Implementation details of Federated Sparql Query Engines
© Insight 2014. All Rights Reserved
System Features of Federated Sparql Query Engines
© Insight 2014. All Rights Reserved
System’s Support for SPARQL Query Construct
© Insight 2014. All Rights Reserved
Analyze of Linked Data at scale
Narumol Prangnawarat, Ali Hasnain, Naoise Dunne
© Insight 2014. All Rights Reserved
Linked DataA method of publishing structured data so that it can be interlinked.
• Normally represented as RDF• Normally queried using
SPARQL
4 principles of linked data1. Use URIs to name (identify) things.2. Use HTTP URIs so can be looked up3. Provide metadata about what thing is.
- use open standards RDF, SPARQL, etc.
4. Link to other things using their HTTP URI-based names
© Insight 2014. All Rights Reserved
How do I query Linked data
© Insight 2014. All Rights Reserved
Linked data as a graphMany approaches to query and reason over linked data exist
the most popular query language in the RDF community is sparql, but alternatives exist…
… if we think about linked data as a graph
© Insight 2014. All Rights Reserved
Linked data as a graphAs Linked data graphs share graph structure and can be connected we can reason over them using graph algorithms.
Popular approaches to querying graphs are:• Declarative pattern matching - SPARQL • graph traversal languages - Cypher, Gremlin• distributed graph data structures - GraphX
© Insight 2014. All Rights Reserved
Comparing Graph QueryApproaches
© Insight 2014. All Rights Reserved
Comparing Graph Query ApproachesCypher - graph traversalSomewhere between graph traversal and pattern matching runs on Neo4JCharacteristics
• Property graph• index-free adjacency• uses adjacency tables
Prosgreat at localized searches (shortest path for instance)is a databaseIs Expressive languageConsPoor at aggregation
Graph X - message passingDSL rather than language. For “programmers” Scala, Java and Python APIs.Characteristics
• Resilient Distributed Property Graph
• index-free adjacency• Vertex/Edge table
ProsBest (in list) distributed executionPowerful mix of table and traversalhas a set of optimised operators ConsNot a database, data needs to be loaded and stored separately
SPARQL -declarativeDeclarative language, allowing better expression and abstracting the writer from optimisation problemsCharacteristics
• Stores Triples (tuples)• Vendor normally optimise
popular queries.• Often built on RDBMS
ProsIs Expressive languageEasy to express search patternsConsDifficult to scalePoor at traversal
© Insight 2014. All Rights Reserved
Comparing Graph Query ApproachesCypher - graph traversalSomewhere between graph traversal and pattern matching runs on Neo4J
Graph X - message passingDSL rather than language. Scala, Java and Python APIs.
SPARQL -declarativeis a declarative language, allowing better expression and abstracting the writer from optimisation problems
Abstract Concrete
Considerable work (for vendors) to scale Little work to scale
Optimised for aggregation
Optimised for connections
Global Local
© Insight 2014. All Rights Reserved
Other Graph Query LanguagesCypher - graph traversalSomewhere between graph traversal and pattern matching runs on Neo4J
AlternativesGremlinA “pure” graph traversal language based on xpathNetwork XA python DSL for graphs
Graph X - Message passingDSL rather than language. For “programmers” Scala, Java and Python APIs.
AlternativesGraphLabvery powerful commercial productGiraffeA hadoop API for graphs
SPARQL -DeclarativeDeclarative language, allowing better expression and abstracting the writer from optimisation problems
AlternativesCypher(!)Has pattern matching constructs, can do much the same as sparql on Neo4J database
© Insight 2014. All Rights Reserved
Sparql at big data scale
What about using SPARQL in distributed big data infrastructure?
© Insight 2014. All Rights Reserved
Sparql at big data scaleAt big data scales and in distributed infrastructure SPARQL quickly becomes an impedimentWhy?
• It is difficult to optimise SPARQL at scale with fast data
• As optimisations are embedded in query, optimised SPARQL queries become less natural and hard to write.
• SPARQL abstractions “leak”, leading to “hacks” of big data RDF infrastructure
© Insight 2014. All Rights Reserved
Why use Graph algorithms
Why not Sparql • For distributed computing,
declarative languages such as sparql are (for now) problematic
• you cannot know if query is NP or EXP time.
• Difficult to create query plans especially with fast or changing graphs
• Have to rely on federation which is still being researched
Why Graph Traversal• Proven to scale • Graphs traversal lower level
but easier to tune so that it is in P time.
• Most popular algorithm are local (as in) only query neighbouring nodes at any time -thus easier to break up across compute nodes
© Insight 2014. All Rights Reserved
Scaling SparqlSo you still want to use sparql at scaleHow do we query RDF data with SPARQL at Big data scale?Clustering
• Some vendors/platforms provide clustered triple-stores
FederationBecame available in Sparql 1.1 with SERVICE keyword
• Federation emerged with great promises.• For distributed computing, sparql federation has limitations (for
now).• Query planning for SPARQL is NP Complete
© Insight 2014. All Rights Reserved
Alternatives to Scaling SparqlFortunately, both Graph traversal and GraphX
approaches to linked data that work at scale today. We will look at these approaches now.
© Insight 2014. All Rights Reserved
Analysing Linked Data as a Graph
Querying linked data at scale with complementary technologies to sparql
© Insight 2014. All Rights Reserved
Linked data as a graphLinked data can be considered a Heterogeneous
Graph
What do we mean by Heterogeneous Graph?• Linked data graphs share graph structure but have mixed characteristics • Nodes (Vertices) contain different data• Links (Edges) Mix of directed and undirected• Linked Data Graph can be weighted or not• Can have a mix of classes and types from differing Ontologies
What do these graphs look like?
© Insight 2014. All Rights Reserved graphs within a Heterogeneous Graph
© Insight 2014. All Rights Reserved
Linked data as a graphAs Linked data graphs share graph structure and can be connected we can reason over them using graph algorithms using
Popular approaches are:• graph traversal languages - Cypher, Gremlin• distributed graph data structures - GraphX
Declarative pattern matching - SPARQL, but can be hard to scale
© Insight 2014. All Rights Reserved
Cypher graph languageSome basic cypher...
Find the actor named "Tom Hanks"...MATCH (tom {name: "Tom Hanks"}) RETURN tom
Who directed "Cloud Atlas"?
MATCH (cloudAtlas {title: "Cloud Atlas"})<-[:DIRECTED]-(directors) RETURN directors.name
© Insight 2014. All Rights Reserved
Shortest PathShortest path is the problem of finding a path
between two vertices (or nodes) in a graph with the lowest weight (this could be cost or distance).
© Insight 2014. All Rights Reserved
What is DijkstraAn approach for shortest path, using traversal, that changes complexity of problem from NP to P time
naive shortest path between 2 points has complexity of:
O(|V³|)Dijkstra approach we get a worst case complexity of:
O(|E| + |V| log |V|)
© Insight 2014. All Rights Reserved
Dijkstra using CypherMATCH p= shortestPath( (bacon:Person {name:"Kevin Bacon"})-[*]-(meg:Person {name:"Meg Ryan"}))RETURN p
Find the shortest path between a Person with name Kevin Bacon and Meg RyanDEMO
© Insight 2014. All Rights Reserved Cypher Shortest path
© Insight 2014. All Rights Reserved
Another useful algo. Community detectionWhat is community Detectiona Graph is said to have community structure if the nodes of the network can be easily grouped into (potentially overlapping) sets of nodes such that each set of nodes is densely connected internally.
© Insight 2014. All Rights Reserved
Visualisation tools for large graphsOn larger datasets Neo4js UI is too unresponsive for large result sets from queries such as community detection.
• instead you may want to use a visualisation tool such as Gephi.
• We will now demonstrate Louvain Community Detection using the graph visualisation tool Gephi.
© Insight 2014. All Rights Reserved
Using GephiHere is a graph that we calculated using Luvian earlier...
This example shows clustering around Topics discussed on twitter:• graph cluster tweets around the topic under discussion• Each retweet or reply creates a link in the graph
© Insight 2014. All Rights Reserved Gephi Screenshot
© Insight 2014. All Rights Reserved
Using GephiHere is a graph that we calculated using Luvian earlier...
This example shows clustering around Topics discussed on twitter:• we cluster tweets around the topic discussion• Each retweet or reply creates a link in the graph
Once the Luvian analysis is complete, we load the results to gephi and we gain new insights on visualising the clusters around these topics:
• Compared to text analysis we are able to detect deeper community structures from the retweets and replies to tweets
• This gives us a deeper understanding of the individuals and communities
© Insight 2014. All Rights Reserved
Sparql Federation example
Q: How are the protein targets of the gleevec drug differentially expressed, which pathways are they involved in?
PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>PREFIX cco: <http://rdf.ebi.ac.uk/terms/chembl#>PREFIX chembl_molecule: <http://rdf.ebi.ac.uk/resource/chembl/molecule/>PREFIX biopax3:<http://www.biopax.org/release/biopax-level3.owl#>PREFIX atlasterms: <http://rdf.ebi.ac.uk/terms/atlas/>PREFIX sio: <http://semanticscience.org/resource/>PREFIX dcterms: <http://purl.org/dc/terms/>PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#>
SELECT distinct ?dbXref (str(?pathwayname) as ?pathname) ?factorLabel WHERE {
# query chembl for gleevec (CHEMBL941) protein targets ?act a cco:Activity; cco:hasMolecule chembl_molecule:CHEMBL941 ; cco:hasAssay ?assay . ?assay cco:hasTarget ?target . ?target cco:hasTargetComponent ?targetcmpt . ?targetcmpt cco:targetCmptXref ?dbXref . ?targetcmpt cco:taxonomy . ?dbXref a cco:UniprotRef
# query for pathways by those protein targets SERVICE <http://www.ebi.ac.uk/rdf/services/reactome/sparql> { ?protein rdf:type biopax3:Protein . ?protein biopax3:memberPhysicalEntity [biopax3:entityReference ?dbXref] . ?pathway biopax3:displayName ?pathwayname . ?pathway biopax3:pathwayComponent ?reaction . ?reaction ?rel ?protein . }
# get Atlas experiment plus experimental factor where protein is expressed SERVICE <http://www.ebi.ac.uk/rdf/services/atlas/sparql> { ?probe atlasterms:dbXref ?dbXref . ?value atlasterms:isMeasurementOf ?probe . ?value atlasterms:hasFactorValue ?factor . ?value rdfs:label ?factorLabel . }}
© Insight 2014. All Rights Reserved
Why use Graph algorithms
Polynomial timeA lot of queries on linked data can be expressed as well known graph traversal algo. that work in P time such as Dijkstra for positive weighted directed graph. Because these alog are localised suit distributed computed.
© Insight 2014. All Rights Reserved
More pure Dijkstra using CypherMATCH (from: Location {LocationName:"x"}), (to: Location
{LocationName:"y"}) , paths = allShortestPaths((from)-[:CONNECTED_TO*]->(to))WITH REDUCE(dist = 0, rel in rels(paths) | dist +
rel.distance) AS distance, pathsRETURN paths, distance ORDER BY distance LIMIT 1
The other approach used an inbuilt function - this shows a closer approximation of the actual algorithm
© Insight 2014. All Rights Reserved
Dijkstra Psudocodedist[s]←0 (distance to
source vertex is zero)forall v V–{s}∈do dist[v]←∞ (set all other
distances to infinity)S← ∅ (S,the set of visited vert
is initially empty)Q←V (Q,the queue
initially contains all vertices)whileQ≠ ∅ (while the queue
is not empty)dou← mindistance(Q,dist) (select the element of Q with the
min.distance)S←S {u} ∪ (add u to list of
visited vertices)forall v neighbors[u]∈
do if dist[v]>dist[u]+w(u,v) (if new shortest path found)then d[v]←d[u]+w(u,v) (set new value of shortest path)
(if desired,add trace back code)returndist
© Insight 2014. All Rights Reserved
VisualizationAli Hasnain, Stefan Decker, Naoise
Dunne
© Insight 2014. All Rights Reserved
Visualization
• Visualize your Data!• Available Tools
• ReVeaLD• FedViz• Genome Wheel
© Insight 2014. All Rights Reserved
ReVeaLD Search PlatformReVeaLD :- Real-Time Visual Explorer and Aggregator of Linked Data, is a user-driven domain-specific search platform.
Intuitively formulate advanced search queries using a click-input-select mechanism
Visualize the results in a domain–suitable format.
Assembly of the query is governed by a Domain Specific Language (DSL), which in this case is the Granatum Biomedical Semantic Model (CanCO)
© Insight 2014. All Rights Reserved
ReVeaLD Search PlatformAvailability: http://n10.soma.insight-centre.org:31005/explorer
Demo: https://www.youtube.com/watch?v=6HHK4ASIkJM&hd=1
Curtsey Maulik Kamdar
© Insight 2014. All Rights Reserved
DSL Visual RepresentationConcept Map Visualization is used.
© Insight 2014. All Rights Reserved
Visual Query Builder
© Insight 2014. All Rights Reserved
Visual Query Model
© Insight 2014. All Rights Reserved
FedViz: A Visual Interface for SPARQL Queries Formulation and Execution
FedViz is an online application that provides Biologist a flexible visual interface to formulate and execute both federated and non-federated SPARQL queries.
It translates the visually assembled queries into SPARQL equivalent and execute using query engine (FedX).
Availability: http://srvgal86.deri.ie/FedViz/index.html
Curtsey Sana e Zainab
© Insight 2014. All Rights Reserved
FedViz: A Visual Interface for SPARQL Queries Formulation and Execution
© Insight 2014. All Rights Reserved
Using FedViz: Step by Step
© Insight 2014. All Rights Reserved
GenomeSnip PlatformA semantic, visual analytics prototype devised to expedite knowledge exploration and discovery in cancer research.
Idea: ‘Snip’ the human genome informatively in fragments through interaction with an aggregative, circular visualization, the‘Genomic Wheel’ (circular) and introspectively analyze the snipped fragments in a ‘Genomic Tracks’ (linear) display.
Technologies: Web-based client application developed using native technologies like HTML5 Canvas, JavaScript and JSON.KineticJS library, an HTML5 Canvas JavaScript framework, is used for node nesting, layering, caching and event handling.
Availability: http://srvgal78.deri.ie/genomeSnip/
Curtsey Maulik Kamdar
© Insight 2014. All Rights Reserved
Genome Browser
© Insight 2014. All Rights Reserved
Hands On Session
Narumol Prangnawarat, Ali Hasnain, Naoise Dunne
© Insight 2014. All Rights Reserved© Insight 2014. All Rights Reserved
Convert CSV File to RDF using TARQL
Instructions Manual https://goo.gl/xLpF8Y