john patrick publishing...2021/01/03  · guitar group lector: ruem tan 3 #179 responsorial psalm...

8
3 January 2021

Upload: others

Post on 27-Feb-2021

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

3 January 2021

Page 2: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130

Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner PASTOR EMERITUS Reverend Msgr. Francis X. Dreger PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond PRINCIPAL Sister Catherine Irene Masino , IHM VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS

Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. Attendance at a Pre-Jordan class is required for first time parents. Please register for class by contacting the Rectory at 215-725-1240.

Marriage Couples must contact a priest six months prior to the wedding.

Reconciliation Saturdays from 4:00 to 4:45pm

Homebound Visitation Please contact the Rectory.

Be the reason someone smiles

today! Love your neighbor as yourself

Please remember to wear a facemask in church and practice social distancing by

staying 6 feet apart.

9:30am every Sunday

Sunday Vigil 5:00pm (Saturday)

6:30am, 8:00am, 9:30am, 11:00am Monday through Friday

6:30 and 8:30 am Saturday 8:30 am

Please send information for the Sunday bulletin by Monday to: [email protected]

Mass Schedule ~ January 9 & 10 Saturday (Vigil) Celebrant: Fr. Bonner 5:00pm Lector: Zach Demusz 6:30am Celebrant: Fr. Lucas Lector: Colleen Demusz 8:00am Celebrant: Fr. Lucas Lector: Richard McIvor 9:30am Celebrant: Fr. Bonner Lector: Rose Messina 11:00am Celebrant: Fr. Bonner Guitar Group Lector: Ruem Tan

Page 3: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

#179 3

Responsorial Psalm

Lord, every nation on earth will adore you.

First Reading ~ Isaiah 60:1-6

Rise up in splendor, Jerusalem! Your light has come, the glory of the Lord shines upon you. See, darkness covers the earth, and thick clouds cover the peoples; but upon you the LORD shines, and over you appears his glory. Nations shall walk by your light, and kings by your shining radiance. Raise your eyes and look about; they all gather and come to you: your sons come from afar, and your daughters in the arms of their nurses.

Then you shall be radiant at what you see, your heart shall throb and overflow, for the riches of the sea shall be emptied out before you, the wealth of nations shall be brought to you. Caravans of camels shall fill you, dromedaries from Midian and Ephah; all from Sheba shall come bearing gold and frankincense, and proclaiming the praises of the LORD.

The word of the Lord. Thanks be to God.

Gospel according to Matthew 2:1-12

When Jesus was born in Bethlehem of Judea, in the days of King Herod, behold, magi from the east arrived in Jerusalem, saying, "Where is the newborn king of the Jews? We saw his star at its rising and have come to do him homage." When King Herod heard this, he was greatly troubled, and all Je-rusalem with him. Assembling all the chief priests and the scribes of the people, he inquired of them where the Christ was to be born. They said to him, "In Bethlehem of Judea, for thus it has been written through the prophet: And you, Bethlehem, land of Judah, are by no means least among the rulers of Judah; since from you shall come a ruler, who is to shepherd my people Israel." Then Herod called the magi secretly and ascertained from them the time of the star's appearance. He sent them to Bethlehem and said, "Go and search diligently for the child. When you have found him, bring me word, that I too may go and do him homage." After their audience with the king they set out. And behold, the star that they had seen at its rising preceded them, until it came and stopped over the place where the child was. They were over-joyed at seeing the star, and on entering the house they saw the child with Mary his mother. They prostrated themselves and did him homage. Then they opened their treasures and offered him gifts of gold, frankincense, and myrrh. And having been warned in a dream not to return to Herod, they departed for their country by another way.

The Gospel of the Lord. Praise to you, Lord Jesus Christ.

Second Reading Letter of St. Paul to Ephesians 3:2-3, 5-6

Brothers and sisters: You have heard of the stewardship of God's grace that was given to me for your benefit, namely, that the mystery was made known to me by revelation. It was not made known to people in other generations as it has now been revealed to his holy apostles and prophets by the Spirit: that the Gentiles are coheirs, members of the same body, and copartners in the promise in Christ Jesus through the gospel.

The word of the Lord. Thanks be to God.

The Epiphany of the Lord January 3, 2021

FOCUS: The Epiphany points the way toward life.

Today the Church celebrates the Epiphany of the Lord: the manifestation to the Gentiles (in the persons of the Magi) of the life of God himself. God, who in the person of Jesus, shared in our humanity in order to allow us to share in his divinity forever. Like the Magi, each person’s journey to Christ has its own direction and trail; and for each who pays Christ homage and offers the treasures one holds, the reward is the same: a path away from the dangers of sin and death and toward life.

LITURGY OF THE WORD: In the first reading, the prophet Isaiah calls the people to rise up because the light (God) has come and they will praise the Lord with overflow-ing hearts. In St. Paul’s Letter to the Ephesians, we hear that the mystery which was not revealed to other generations has been made known and that all are co-heirs and co-partners in the work and promises of Christ. Today’s Gospel is the ac-count of the Magi who journey far as they seek out the long-awaited Christ, encountering King Herod in Jerusalem along the way, and then finding the child Jesus in Bethlehem. REFLECTION: Foreigners led to the Christ child’s home do him homage. National boundaries and differences dissolve when we respond to God’s invitation to come to Christ. We are always welcome into God’s presence and in gratitude our commitment is to Christian hospitality throughout this year – to welcome visitors as we would welcome Christ. So we ask ourselves:

How do I practice hospitality?

Have I ever been treated as an outsider?

Do I treat any people or groups as outsiders?

Page 4: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

#179 4

Nicene Creed I believe in one God, the Father almighty, maker of heaven and earth, of all things visible and invisible.

I believe in one Lord Jesus Christ, the Only Begotten Son of God, born of the Father before all ages. God from God, Light from Light, true God from true God, begotten, not made, consubstantial with the Father; through him all things were made. For us men and for our salvation he came down from heaven,

(all bow) and by the Holy Spirit was incarnate of the Virgin Mary, and became man.

For our sake he was crucified under Pontius Pilate, he suffered death and was buried, and rose again on the third day in accordance with the Scriptures. He ascended into heaven and is seated at the right hand of the Father. He will come again in glory to judge the living and the dead and his kingdom will have no end. I believe in the Holy Spirit, the Lord, the giver of life, who proceeds from the Father and the Son, who with the Father and the Son is adored and glorified, who has spoken through the prophets. I believe in one, holy, catholic and apostolic Church. I con-fess one Baptism for the forgiveness of sins and I look forward to the resurrection of the dead and the life of the world to come. Amen.

Dear God, Thank you for helping us to make it through this difficult year. Thank you that you’ve carried us through the uncer-tainty of deep waters, through the flames of trials, and

through the pain of hard losses. We are constantly aware of how much we need you, your grace, your strength, your power working through even the toughest days.

Help us to remember that the gift of Christ, Immanuel, is our greatest treasure, not just at Christmas, but for the whole year through. Fill us with your joy and the peace of your Spirit. Direct our hearts and minds towards you. Thank you for your reminder that both in seasons of celebration and in seasons of brokenness, you’re still with us. For you never leave us. Thank you for your daily powerful Presence in our lives, that we can be assured your heart is towards us, your eyes are over us, and your ears are open to our prayers. Thank you that you surround us with favor as with a shield, and we are safe in your care.

In Jesus' name, Amen.

Roman Catholic High School is pleased to announce the following students from our parish have achieved Academic Honors for

the First Quarter of 2020-2021. First Honors: William Wranovsky

Second Honors: Thomas Hirst, Joshua Iamuri, Edward Kiely, Andy Cruz, Christopher McLaughlin, Ryan O’Neill

Saint Cecilia School NewsThroughout the years, many foun-dations and organizations have provided financial assistance to the students and their families attending our school. We want to acknowledge them and share with you the amount of their generosi-ty. For the 2020-2021 school year the following have provided sup-

port to our students and their families.

Children’s Scholarship Fund Philadelphia $170,756.38 BLOCS $37,750 Archdiocese of Phila. Superintendent’s Grant $1,000 BRIDGE $2.500 Foundation for Catholic Education $5,000 Heritage of Faith—Vision of Hope $8,800 St. Cecilia Memorial $13,316 Sponsor a Student $13,344 Colleen P. Smith Foundation $825 Anonymous Donors $2,000 In addition to the above, there was COVID Relief Aid from BRAVO, Foundation Ambassador, BLOCS, and Children’s Scholarship Fund Phila. amounting to $96,913.

More than half our students have received assistance from these wonderful organizations. We also have Lisa Hnat, our Tuition Coordinator to thank for seeking out much of this assistance for our families.

So many of our families sacrifice to send their children to a Catholic school and if it wasn’t for all these foundations working tirelessly to gather these funds, this would not be possible. So, we take this time to say ‘Thank You’ to the many people who help our students and their families.

Now that you have your 2021 calendar ~ here are some dates to remember……

January 6 What should parish evangelization look like?

January 17 Holy Hour with the Good Shepherd

February 4-7 FOCUS Seek Conference

Visit phillyevang.org/events for more details and info.

Page 5: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

#179 5

To set up your FREE account - - - 1. Visit FORMED.org 2. Click Sign Up 3. Select “I Belong to a Parish or Organization” 4. Type in St. Cecilia Parish Community 5. Enter your email ~ and you are in!

Page 6: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

After

Now Hiring friends and family caregivers.www.Bayada.com/careathome

Quality Senior Home Care Services since 1975.

Call today to learn more!(215) 419-7868

MONDAY, January 4 6:30am – Eunice Henwood 8:30am – John Munnelly

TUESDAY, January 5 6:30am – Tammi Kissinger 8:30am – Martin & Catherine Griffith

WEDNESDAY, January 6 6:30am – Kimberly Markowski 8:30am – Anna May De Filippis

THURSDAY, January 7 6:30am – Michael J. McKee 8:30am – Camillo & Martha DiNezza

FRIDAY, January 8 6:30am – Nino & Rosina D’Aveni & Family 8:30am – Debbie Mitchell Walsh

SATURDAY, January 9 8:30am – Edward Urewich 5:00pm – Living & Dec’d members of MacNew family

Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Stephanie Morgan Kirsten Hosack-Edling James Potts Mary Benson Mary Jane Brough Esther Sharp Leo Wuestkamp Stephen Ruczynski Helen Tobin Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Gregory Farrell Lisa Kovacs-Breuer Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Josephine O’Donnell Mary Matthews Jack Vogler Marguerite Zeltman Eileen Gaynor Alberta DeMasi Marian Diel Kathi Silcox Eleanor DeNoble Eugenia DiSilva Alonso Castillo Connie Merkel Catherine Needham Betty Harding Bill Scott Catherine Davis Theresa Halbherr Isabel Schmidt Robert McGrody Vincent Florian Fran McManus Helen Flood Clare Gilchrist Lou Baldwin John Carr Joseph Smyth Brendan Roth Bea Ferrara Tina Coyne-Torres Gina Slobogin Marie Slobogin Sharon Gilespie Gerald Plewes Ursula Begley

Page 7: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBSCITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help

Save you money with your monthly payments on your commercial property. Multi-Family, Retail,

Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four season customer

service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

Page 8: John Patrick Publishing...2021/01/03  · Guitar Group Lector: Ruem Tan 3 #179 Responsorial Psalm Lord, every nation on earth will adore you. First Reading ~ Isaiah 60:1-6 Rise up

IT'S TAX TIME!Be Confi dent In Your Accountant

For pricing & appointments at your home or my offi ce call:

215-603-4535 or 215-572-0529

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net