jezik života

Download Jezik života

Post on 03-Aug-2015

1.301 views

Category:

Education

2 download

Embed Size (px)

TRANSCRIPT

1. . , 28. 1953. 2.

  • ?
  • () ?
  • ?
  • , , ?
  • ?

3.

  • , , , 4 ( , ) .
  • , , , - .

4.

  • , .
  • , , .
  • , ,GC .
  • 20 .
  • .

5.

  • (et) -AUG . .
  • , .
  • , . "" (eng.nonsence).
  • UAA ,UGAUAG . , . .
  • , , , , , .

6.

  • http://www.bionet-skola.com/w/Translacija http://www.youtube.com/profile?user=ndsuvirtualcell#p/u/16/5bLEDd-PSTQ

7. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC iRNK Met 8. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC Ala Met -Ala 9. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC RF Met AlaTrpThrRF 10.

  • -
  • () () AUG
  • .
  • - , - .
  • - -
  • - .
  • ()

T 11. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC iRNK Met 12. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC Ala Met -Ala 13. AUUAUGGCCUGGACUUGAAGC AUU AUGGCCUGGACUUGAAGC RF Met AlaTrpThrRF 14.

  • ?
  • ?
  • ?

Recommended

View more >