investigating genetic gene expression and proteomic ... · iv investigating genetic, gene...
TRANSCRIPT
Investigating genetic, gene expression and proteomic changes over temperature gradients in intertidal Nerita species i
INVESTIGATING GENETIC, GENE
EXPRESSION AND PROTEOMIC CHANGES
OVER TEMPERATURE GRADIENTS IN
INTERTIDAL NERITA SPECIES
Shorash Amin
Bachelor of Biomedical Science (1A Honours)
Submitted in fulfilment of the requirements for the degree of
Doctor of Philosophy
School of Biomedical Sciences
Faculty of Health
Queensland University of Technology
2018
ii Investigating genetic, gene expression and proteomic changes over temperature gradients in intertidal Nerita species
Keywords
De novo assembly; digital gene expression; genomics; heat shock protein; Ion torrent;
transcriptome; Nerita albicilla; Nerita melanotragus; molluscs; proteome; RNAseq;
thermal stress; Nerita melanotragus, Illumina.
Investigating genetic, gene expression and proteomic changes over temperature gradients in intertidal Nerita species iii
Abstract
A key area of research in physiological genomics is understanding the gene
expression and proteomic responses of specific species to abiotic change in their
habitat. In order to investigate these responses, an appropriate group of organisms is
required that is distributed across an environmental gradient. One such group of
organisms that meet this requirement are class Gastropoda, which are distributed
globally in a range of different environments. This highly speciose group are important
socially, economically and ecologically. Species from this taxonomic group form a
large component of intertidal zone fauna in many areas, globally.
The intertidal zone is amongst the harshest of environments on Earth, with
constant changes in temperature, pH, sea level and UV exposure. Furthermore, species
inhabiting these areas are periodically submerged due to the tidal cycle. The intertidal
zone can be further subdivided into the spray, upper, mid and lower intertidal sub
zones. Abiotic stresses also vary across these habitats as does the level of
submergence. As a consequence, species have adapted to sub zones within the
intertidal area resulting in a strong zonation of organisms among sub zones. It is
suggested that zonation of species is determined in a large part by their physiological
limits, with many intertidal species living near their upper thermal limits. This may
suggest that organisms within these areas are under extreme physiological stress.
Some intertidal organisms possess physiological defense mechanisms which
allow them to cope when faced with external stressors. This is of particular importance
for organisms inhabiting the intertidal zone as they are presented with continuous and
varying levels of stress. Although some species have adapted to these stressors through
standing genetic variation, others respond through gene expression or protein
abundance changes to these specific stressors. In order to gain further understanding
of how environmental stress affects intertidal grastropod species, studies are required
to determine how environmental stress influences the gene repertoire, gene expression
patterns and protein abundance in these species. Nerita melanotragus and N.
albicilla are widespread intertidal gastropod species, distributed across a number of
temporally and spatially fluctuating environmental gradients, including abrupt changes
in temperature over a tidal cycle. These species differ in their ecology, as N.
iv Investigating genetic, gene expression and proteomic changes over temperature gradients in intertidal Nerita species
melanotragus is a mid-littoral species, while N. albicilla is a low-littoral species.
Colonisation of different areas in the intertidal zone means that N. melanotragus (mid-
littoral) is likely to sustain longer periods of temperature stress than N. albicilla (low-
littoral), but N. albicilla is likely to experience more acute temperature stress when
exposed to high temperatures. Consequently, these two species present an interesting
case to examine differences in the gene repertoire, gene expression and protein
abundance patterns of intertidal gastropod species in response to the same temperature
stress conditions. Therefore the aim of this project was to investigate and compare the
physiological response of two closely related intertidal marine snails from the
genus Nerita to temperature stress using a combination of RNAseq and proteomic
experiments. To achieve this, I undertook three separate but inter-related experiments.
The first experiment was to optimize the assembly of next generation sequencing
(NGS) data and determine which assembler produced the best quality assemblies for
gastropod species. The sequencing, de novo assembly and annotation of transcriptome
datasets generated with next generation sequencing (NGS) has enabled biologists to
answer physiological questions in non-model species with unprecedented ease.
Reliable and accurate de novo assembly and annotation of transcriptomes, however, is
a critically important step for transcriptome assemblies generated from short read
sequences. Typical benchmarks for assembly and annotation reliability have been
performed with model species. To address the reliability and accuracy of de novo
transcriptome assembly in a non-model gastropod species, an RNAseq dataset was
generated for an intertidal gastropod mollusc species, Nerita melanotragus, and
compared the assembly produced by four different de novo transcriptome assemblers;
Velvet, Oases, Geneious and Trinity, for a number of quality metrics and redundancy.
Both the Trinity and Oases de novo assemblers produced the best assemblies based on
all quality metrics including fewer contigs, increased N50 and average contig length
and contigs of greater length. Overall, the BLAST and annotation success of the
assemblies was not high with only 15-19% of contigs assigned a putative function.
The second experiment examined differences in the expressed gene families of
N. melanotragus and N. albicilla under normal temperature conditions. Deep
transcriptome sequencing was undertaken for both species to determine differences
in the expressed gene compliment under natural living conditions. Samples were
collected from King’s Beach, Caloundra, Australia and RNA was extracted and
Investigating genetic, gene expression and proteomic changes over temperature gradients in intertidal Nerita species v
sequenced on an Illumina Hiseq 2500. A total of 6.2 Gbp and 7.4 Gbp of sequence
data was produced for N. melanotragus and N. albicilla respectively. Ortholog
analysis of the two Nerita species with Crassostrea gigas and Lottia gigantea
revealed a total of 6,457 orthologs in common. The two Nerita species shared a total
of 8,501 orthologs, with 3,618 unique orthologs in N. melanotragus and 2,280 in
Nerita albicilla. Gene set enrichment of the common genes between the Nerita
species revealed two over-represented terms (activation of protein kinase B and
positive regulation of guanylate cyclase activity), however, neither is directly related
to stress. Overall a larger number of stress transcripts were found to be expressed in
N. albicilla under normal conditions when compared to N. melanotragus.
The third experiment examined differences in the gene expression and protein
abundance patterns in response to the three temperature stress conditions in N.
melanotragus and N. albicilla. For the RNAseq component of this experiment, nine
individual samples from each of N. melanotragus and N. albicilla were randomly
allocated into three treatments (14 °C, 22 °C and 31 °C) with three replicates in each
treatment. Five temperature treatments (14 °C, 22 °C, 31 °C, 38 °C and 45 °C) were
used for the proteomic experiment with five replicate individuals in each treatment
for each species. Treatment animals were euthanized, RNA/protein extracted and
each individual was sequenced on an Illumina Hiseq 2500 or run on a TripleTOF
5600+ mass spectrometer (Sciex) coupled with an Ekspert nanoLC 400 system
(Eksigent). The two species had highly divergent patterns of gene expression and
protein abundance under specific treatment conditions. Few differentially expressed
genes/proteins (~22 and 109 respectively, ) were observed in Nerita albicilla, and
these were dominated by molecular chaperones. More differentially expressed genes
but fewer proteins (~131 and 80 respectively) were observed in N. melanotragus, but
no dominant class of genes was observed in either datatset. Little overlap existed
between differentially expressed transcripts and differentially abundant proteins in
either species.
The molecular data generated in these experiments is the largest produced for
the genus Nerita. Overall the data generated from these three experiments has
enabled us to determine that N. albicilla, the lower intertidal species iniates a thermal
stress response at much lower temperatures than N. melanotragus. This supports the
idea that low-littoral species undergo thermal stress at lower temperatures than mid-
vi
littoral species. Using a genome wide approach, this study has established that lower
intertidal species may be far more susceptible to future climate change due to a more
acute temperature stress response.
vii
Table of Contents
KEYWORDS ......................................................................................................................................... II ABSTRACT .......................................................................................................................................... III TABLE OF CONTENTS .................................................................................................................... VII LIST OF FIGURES .............................................................................................................................. IX LIST OF TABLES ................................................................................................................................. X LIST OF PUBLICATIONS ................................................................................................................. XI STATEMENT OF ORIGINAL AUTHORSHIP ................................................................................ XIII ACKNOWLEDGEMENTS ............................................................................................................... XIV
CHAPTER 1: LITERATURE REVIEW ............................................................ 15 1.1 BACKGROUND ......................................................................................................................... 15 1.2 CLIMATE CHANGE AND ENVIRONMENTAL STRESS ...................................................... 18 1.3 MARINE ANIMAL RESPONSE TO ENVIRONMENTAL STRESS ....................................... 20 1.4 THE CELLULAR STRESS RESPONSE ................................................................................... 22 1.5 MARINE GASTROPODS AS A SYSTEM TO INVESTIGATE TEMPERATURE STRESS . 23 1.6 PHYSIOLOGICAL INVESTIGATION INTO REPRESENTATIVE SPECIES FROM THE GENUS NERITA ................................................................................................................................... 24 1.7 RESEARCH QUESTION AND APPROACH ........................................................................... 26
1.7.1 Research objective 1 ....................................................................................................... 26 1.7.2 Research objective 2 ....................................................................................................... 26 1.7.3 Research objective 3 ....................................................................................................... 27
CHAPTER 2: ASSEMBLY AND ANNOTATION OF A NON-MODEL GASTROPOD (NERITA MELANOTRAGUS) TRANSCRIPTOME: A COMPARISON OF DE NOVO ASSEMBLERS ................................................... 29 2.1 BACKGROUND ......................................................................................................................... 29 2.2 METHODS .................................................................................................................................. 31
2.2.1 Sample acquisition and sequencing ................................................................................ 31 2.2.2 Assembly and annotation ................................................................................................ 32
2.3 RESULTS .................................................................................................................................... 34 2.3.1 Ion torrent sequencing and reads assembly .................................................................... 34 2.3.2 Functional annotation of contigs ..................................................................................... 35 2.3.3 PCR validation of contigs ............................................................................................... 41
2.4 DISCUSSION ............................................................................................................................. 42 2.5 CONCLUSION ........................................................................................................................... 44
CHAPTER 3: COMPARATIVE TRANSCRIPTOMICS AND CHARACTERIZATION OF GENES AND GENE FAMILIES INVOLVED IN ABIOTIC STRESS RESPONSE FROM TWO INTERTIDAL MARINE SNAILS 45 3.1 BACKGROUND ......................................................................................................................... 45 3.2 METHODS .................................................................................................................................. 46
3.2.1 RNA extraction, sequencing and read processing .......................................................... 46 3.2.2 Transcriptome quality and completeness ........................................................................ 48
viii
3.2.3 Identification of unique and common genes ................................................................... 49 3.2.4 Identification and comparative analysis of full length candidate genes .......................... 49
3.3 RESULTS .................................................................................................................................... 49 3.3.1 Sequencing results, reads assembly and functional annotation of contigs ...................... 49 3.3.2 Unique and common genes ............................................................................................. 51 3.3.3 Identification and comparative analysis of candidate genes ........................................... 52
3.4 DISCUSSION ............................................................................................................................. 54 3.4.1 Comparative copy number analysis of stress genes ........................................................ 55 3.4.2 Conclusion ...................................................................................................................... 56
CHAPTER 4: DIFFERENTIAL GENE EXPRESSION OF TWO INTERTIDAL SNAILS IN RESPONSE TO TEMPERATURE STRESS ......... 58 4.1 BACKGROUND ......................................................................................................................... 58 4.2 METHODS .................................................................................................................................. 60
4.2.1 Organism conditioning and treatment ............................................................................. 60 4.2.2 RNA extraction and sequencing ..................................................................................... 60 4.2.3 Assembly and annotation ................................................................................................ 61 4.2.4 Differential gene expression analysis ............................................................................. 61 4.2.5 Orthologous transcript identification .............................................................................. 61 4.2.6 Proteome analysis ........................................................................................................... 61
4.3 RESULTS .................................................................................................................................... 63 4.3.1 Sequencing, assembly and annotation ............................................................................ 63 4.3.2 Differential gene expression changes under temperature treatments .............................. 64 4.3.3 Frontloading of HSP Genes ............................................................................................ 75 4.3.4 Differential protein abundance under temperature stress ................................................ 75 4.3.5 Correlation of gene expression and protein abundance .................................................. 88
4.4 DISCUSSION ............................................................................................................................. 90 4.4.1 Transcriptome changes in response to heat stress ........................................................... 90 4.4.2 Proteome changes in response to heat stress ................................................................... 92 4.4.3 Conclusion ...................................................................................................................... 94
CHAPTER 5: GENERAL DISCUSSION ........................................................... 95 5.1 DE NOVO ASSEMBLERS IN MOLLUSC TRANSCRIPTOME ASSEMBLIES .................... 95 5.2 STRESS GENE EXPANSION IN LOW VS MID INTERTIDAL SPECIES ............................. 97 5.3 GENE EXPRESSION IN INTERTIDAL ZONES ...................................................................... 98 5.4 RESILIENCE UNDER FUTURE CLIMATES .......................................................................... 99 5.5 PROTEIN AND GENE CORRELATION ................................................................................ 100 5.6 CONCLUSION ......................................................................................................................... 101
REFERENCES ....................................................................................................... 102
APPENDIX A – POSTER PRESENTATIONS .................................................. 118
APPENDIX B – OUTCOMES FROM ASSOCIATED WORKS ..................... 122
ix
List of Figures
Figure 1. The intertidal zone ..................................................................................... 16
Figure 2. Nerita melanotragus and N. albicilla distribution ..................................... 18
Figure 3. Black nerite (Nerita melanotragus) ........................................................... 31
Figure 4. Nerita melanotragus transcriptome functional annotation based on Trinity Blast2GO analysis ........................................................................... 37
Figure 5. Nerita melanotragus transcriptome functional annotation based on Oases Blast2GO analysis ............................................................................ 38
Figure 6. GO category assignment ............................................................................ 39
Figure 7. GO category assignment ............................................................................ 40
Figure 8. Visualisation of PCR products ................................................................... 41
Figure 9. Orthologous genes between Nerita melanotragus, N. albicilla, Crasosstrea gigas and Lottia gigantea at 88% similarity cutoff ................ 52
Figure 10. GO Classification of stress related genes for N. melanotragus and N. albicilla ....................................................................................................... 53
Figure 11. WEGO plot for differentially expressed genes of N. melanotragus and N. albicilla ............................................................................................ 65
Figure 12. WEGO plot for differentially expressed proteins of N. melanotragus and N. albicilla ............................................................................................ 87
Figure 13. Scatterplot comparison of gene expression and protein abundance for BWN (Nerita albicilla) and BN (Nerita melanotragus) at 14 °C, 22 °C and 31 °C .......................................................................................... 88
x
List of Tables
Table 1. Primer sequences for β-actin and NADH dehydrogenase subunit 5 ........... 33
Table 2. Assembly quality metrics ............................................................................ 34
Table 3. Annotation results ...................................................................................... 35
Table 4. Synonymous to non-synonymous substitution calculations ....................... 54
Table 5. Mean expression values for N. melanotragus differentially expressed genes under different temperature treatments ............................................. 66
Table 6. Mean expression values for N. albicilla differentially expressed genes under different temperature treatments ....................................................... 73
Table 7 Mean baseline expression of eat shock protein in Nerita melanotragus and N. albicilla ............................................................................................ 75
Table 8. List of proteins that show differential expression profiles, the name of their top BLAST hit and their putative functions for N. melanotragus ...... 76
Table 9. List of proteins that show differential expression profiles, the name of their top BLAST hit and their putative functions for N. albicilla ............... 80
xi
List of Publications
PEER REVIEWED PUBLICATIONS
Amin S, Prentis PJ, Gilding EK, and Pavasovic A. 2014. Assembly and annotation of
a non-model gastropod (Nerita melanotragus) transcriptome: a comparison of
de novo assemblers. BMC Research Notes 7:488.
CONFERENCE POSTER PRESENTATIONS
Amin S, Prentis PJ, Gilding EK, Collet C, and A Pavasovic. Identifying genes
involved in physiological adaptation of Nerita melanotragus to temperature
stress using comparative transcriptome sequencing. International Marine
Biotechnology Conference, Brisbane Convention and Entertainment Centre,
Brisbane 2013.
Amin S, Prentis PJ, Gilding EK, Collet C, and A Pavasovic. Comparative
transcriptomics and characterisation of temperature stress genes in two
intertidal marine snails from the genus Nerita. Big Biology and Bioinformatics
Symposium, QUT Brisbane 2014.
Amin S, Prentis PJ, Gilding EK, Collet C, and A Pavasovic. Comparative analysis of
differentially expressed genes in two intertidal marine snails from the genus
Nerita under different temperatures. Lorne Genome Conference Mantra Lorne,
Victoria 2015.
Amin S, Prentis PJ, Gilding EK, Collet C, and A Pavasovic. De novo sequencing and
comparative analysis of temperature stress genes in two intertidal marine snails
from the genus Nerita. B3 Symposium, QUT Brisbane 2015.
xii
SEMINARS
Trinity De Novo Assembler. Systems Biology, QUT Brisbane 2014.
xiii
Statement of Original Authorship
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To
the best of my knowledge and belief, the thesis contains no material previously
published or written by another person except where due reference is made.
Signature: QUT Verified Signature
Date: September 2018
xiv
Acknowledgements
This thesis is dedicated to my father, Nazeer and my mother, Dilvin, who have
supported and guided me throughout my life, I love you both. I would also like to thank
my three younger sisters for their support.
Firstly, I would like to thank my supervisory team, Dr. Ana Pavasovic, Dr. Peter
Prentis, Associate Professor Christopher Collet and Dr. Edward Gilding, for their
support throughout the years. It is due to their excellent supervision, guidance and
advice that I was able to complete this journey. I would like to take this moment to
express my utmost gratitude to Ana and Peter for their time devoted to weekly
meetings and their constant support and guidance. You have both helped me discover
my capabilities and guided me in using them, both as my supervisors in the university
but also as friends outside the campus.
Secondly, I would like to thank my colleagues from the ePGL group for creating
such a warm and welcoming atmosphere to work in. It has been a joy to have worked
with each and everyone of you.
Thirdly, I would like to thank QUT for providing me with the opportunity to
conduct my studies. In particular, the School of Biomedical Science and the Faculty
of Health. I would also like to thank QUT’s Molecular Genomics Research Facility
(MGRF) for providing the utilities to conduct my experiments.
Finally, I would like to thank a special person who entered my life and supported
me up until the final stages, my loving wife Shiva.
15
Chapter 1: Literature Review
1.1 BACKGROUND
Phylum Mollusca is one of the most morphologically diverse animal groups. It
is the second largest animal phylum following Arthropoda. Mollusc species comprise
a great proportion of marine biodiversity, making up over 23% of all currently
recognised marine organisms [Giribet et al., 2006; Fiedler et al., 2010]. This highly
speciose group is important both ecologically and economically; as a fisheries
commodity, a source of bioactive and medically important compounds, being used as
models in the study of neuroscience, and in the study of adaptation to environmental
extremes [Hold et al., 2013; Feng et al., 2009; Asta Lakshmi, 2011].
The better-known classes within this morphologically diverse phylum are
Cephalopoda (e.g. squid, cuttlefish and octopus), Bivalvia (e.g. oysters, mussels and
arkshells), Polyplacophora (e.g. chitons) and Gastropoda (e.g. snails, limpets and
nudibranchs) [Passamaneck et al., 2004]. Gastropods represent the most diverse class,
both in number (80% of all taxa) and life form (hard shell, soft shell, colouration and
life history) and have colonised many geographically and ecologically diverse regions,
including the tropical and polar biomes [Faulkner, 2011]. With such great diversity, it
is not surprising that gastropods have successfully colonised a wide range of terrestrial
and aquatic environments, including some of the harshest environments on earth such
as hot thermal vents, cold seeps and the intertidal zone [Khripounoff et al., 2017;
Sigwart et al., 2017]. Gastropod species are most common in marine environments,
and are particularly abundant in the rocky intertidal zone (Figure 1) [Miloslavich et
al., 2013]. The rocky intertidal zone is defined as “the part of the seafloor that lies
between the highest high tide and the lowest low tide” (Castro & Huber, 2003). It is
periodically submerged and exposed by daily tides (Barnwell, 1968). The intertidal
zone is a rapidly changing environment with great changes in both biotic and abiotic
conditions over a tidal cycle. Consequently, it is characterised as an extreme
environment, with great variation in air and water temperature, salinity, oxygen and
food availability, as well as constant pounding from wave energy [Gracey et al., 2008].
The rocky intertidal zone can be further subdivided into four distinct areas at
characteristic heights or distance from the shoreline. These areas are the spray zone,
16
upper intertidal zone, mid intertidal zone, and lower intertidal zone (Figure 1). This
subzonation results from changes in biological and physical characteristics associated
with tidal dynamics, wave exposure, temperature, salinity, substrate orientation and
composition, amongst others (Castro & Huber, 2003; Harly & Helmuth, 2003; Miura
et al., 2014). The upper intertidal zone is only immersed at the peak of high tide, and
the splash zone is almost never immersed, with wave splash the only source of
moisture (Reece & Campbell, 2011). The mid and lower intertidal zones are
submerged much of the time, but have high wave energy and strong currents
Temperature, food availability, and dissolved oxygen levels also vary greatly among
the subzones.
Figure 1. The intertidal zone, illustrating organism exposure to the tidal cycle. Adapted from https://www.oceanclassrooms.com/ms101_u7_c2_sd_1-.
The changes in environmental conditions among the zones also leads to large
changes in the composition, density and diversity of gastropod species across the areas
(Shotwell, 1950; Haven, 1970). This often leads to strong habitat partitioning of
gastropod species among these zones, which is a process referred to as zonation
(Underwood & Jernakoff, 1981). As a consequence, intertidal gastropods from
17
different areas will have marked differences in their exposure to changes in many
environmental variables including temperature, pH, salinity, dissolved oxygen and the
availability of food as tidal conditions change [Firth et al., 2011; Van Dyck et al.,
2015]. Fluctuating abiotic conditions are key regulators of metabolic activity in marine
gastropod species and are fundamental in controlling the rate of numerous biological
processes such as development rate, physiology and survival [O’Connor et al., 2007].
Intertidal gastropod species have a range of physiological adaptations to cope,
survive and thrive in these different areas. These adaptations include the extensive
duplication of heatshock protein 70 and inhibition of apoptosis proteins, as observed
in the Pacific oyster (Crassostrea gigas) [Wang et al., 2012], as well as the
frontloading of stress response genes in species from the upper intertidal zone that
encounter prolonged periods of thermal stress [Dong et al., 2008]. Another example
in a non-model organism is the RNA-seq experiment in the marine snail Chlorostoma
funebralis, revealing differing stress responses across populations of the same species
[Gleason and Burton, 2015]. Specifically, this experiment found differences in the
onset and expression of heat shock proteins between the two populations, with the
more resilient population having upregulation of genes in response to stress under
baseline conditions. This phenomenon better known as frontloading of expression is
suggested to have resulted from an evolutionary history of frequent heat exposure.
These examples show some of the mechanisms and physiological adaptations
proposed to allow gastropod species to withstand extreme environmental conditions in
the intertidal zone. While this recent research has started to illustrate how mollusc
species persist in stressful environments, physiological genomic research focusing on
physiology of gastropod species is limited.
Research into the physiological genomics of gastropod species has lagged
largely because the genomic, proteomic or expressed sequence tag (EST) resources
required to conduct this type of research have not yet developed for most species. In
fact, only a few marine invertebrate species have had significant genomic resources
developed for this purpose, including the California sea hare (Aplysia californica)
[Heyland et al., 2011], the striped venus clam (Chamelea gallina) (Coppe et al., 2012),
the owl limpet (Lottia gigantea) [Simakov et al., 2013] and the California two-spot
octopus (Octopus bimaculoides) [Albertin et al., 2015]. While genomic resources
developed for mass cultured invertebrates such as the Pacific oyster (C. gigas) [Wang
18
et al., 2012] may be applied to their non-model relatives, this does not provide a
comprehensive foundation to undertake physiological genomic studies in these
species. Two non-model marine gastropod species Nerita melanotragus and Nerita
albicilla (Figure 2 (A and B)) are both found in the intertidal zone and have large
geographic distributions in Australia and New Zealand (Figure 2 (C)) [Crandall et al.,
2008]. Currently, little is known about how the physiological genomics of N.
melanotragus and N. albicilla show specific genetic changes to allow them to persist
in intertidal environments. This paucity of knowledge is primarily due to a lack of
genomic resources for both species, which are required to measure gene expression
and proteomic changes in response to environmental variables. This genetic data will
enable for the first time, an insight into the molecular physiology of these species and
which genes and pathways are important for their survival and persistence in an
extreme and dynamic environment.
Figure 2. Nerita melanotragus and N. albicilla distribution. N. melanotragus (A) and N. albicilla (B) (Amin, S) distribution across Australia and New Zealand, including the collection site which is indicted with the arrow (C) (adapted from http://noavg.me/map-of-australia-and-nz/new-zealand-map-blank-political-with-cities-throughout-of-australia-and-nz/). N. melanotragus distribution is highlighted in blue, while N. albicilla distribution is represented in orange.
1.2 CLIMATE CHANGE AND ENVIRONMENTAL STRESS
Under many climate change scenarios, marine species are expected to experience
increased environmental stress in their habitats as a result of changes in environmental
19
conditions [Roessig et al., 2004; Harley et al., 2006]. For example, species that occur
in coastal ecosystems will experience possible increases in water temperatures and sea
level, reduced pH and decreased oxygen availability [Scavia et al., 2002]. Publications
such as IPCC (International Panel on Climate Change) provide extensive reporting on
predicted future climate change scenarios and based on this and a multitude of research
articles, ocean temperatures are expected to increase by at least 3 °C over the next
century with cold water habitats expected to be the most affected [Hungate et al., 2003;
Zeh et al., 2012; Albright and Mason, 2013]. Large increases in sea surface
temperatures will also affect a number of other biotic and abiotic variables in the ocean
including, primary productivity and oxygen saturation [Hinrichsen et al., 2011].
Changes in oxygen saturation and water temperature are likely to have negative
consequences on a range of stress sensitive species, including some species of
cnidarians, molluscs, arthropods and other marine invertebrates [Jakubowska and
Normant, 2015; Wijgerde et al., 2014].
Intertidal gastropod species are likely to be subjected to sea level increases,
higher temperatures and decreasing pH levels [Fabry et al., 2008; Pörtner and Peck,
2010; De Wit and Palumbi, 2013] associated with environmental warming increases
in sea surface temperatures as a consequence of climate change [Burrows et al., 2011;
Lima and Wethey, 2012]. Specifically, mollusc species are identified as one of the
most sensitive taxa (Helmuth et al., 2006; Byrne et al., 2013; Przeslawski et al., 2015).
These environmental changes will have a large impact on a range of biological
processes in these species [O’Connor et al., 2007], which may also result in the
contraction or expansion of species ranges [Southward et al., 1995]. Based on the
predicted changes in marine environments under climate change, it is also likely that
the extent of environmental stress experienced by many marine gastropod species will
increase dramatically in the near future. As a result, it is predicted that a broad range
of marine species will be affected in terms of growth, reproduction and survival
[Pespeni et al., 2013]. Consequently, it is important to better understand how marine
species currently cope with environmental stress, to better understand how species may
respond in the future.
20
1.3 MARINE ANIMAL RESPONSE TO ENVIRONMENTAL STRESS
Marine organisms occurring in the intertidal zone frequently experience
fluctuations in environmental abiotic factors such as water temperature, tidal
immersion, desiccation, oxygen levels, ultraviolet radiation and humidity [Menge and
Branch, 2001]. However, how marine species respond to changes in environmental
conditions is likely to be both varied and complex, even in closely related species.
Some species will likely be able to adapt to future climatic conditions from standing
genetic variation, while others may respond to climate variability through changes in
gene expression or even in extreme cases, go locally extinct if they are already close
to their upper thermal maxima. While many studies have attempted to determine how
marine species will respond to environmental variability e.g., Harley et al., 2006, for
the purposes of the current review, recent representative examples from key marine
taxa will be the focus.
The most well studied marine organisms are corals, a group characteristically
sensitive to temperature stress and ocean acidification [Alley et al., 2003]. In a recent
study, Barshis et al., (2013) examined genome wide patterns of gene expression in
thermally sensitive and thermally resilient populations of Acropora hyacinthus, under
projected future temperature conditions. The study focused on the molecular pathways
contributing to stress response differences between the two groups of corals.
Interestingly, resilient coral populations had higher baseline expression of 60 genes
that showed lower levels of up-regulation when compared to sensitive populations
under thermal stress. These 60 genes were enriched for those involved in stress
response such as heat shock proteins, antioxidant proteins and genes involved in
apoptosis regulation. This data suggests that higher baseline expression (referred to as
frontloading) of stress response genes may make marine species more resilient to
environmental stress. Overall, such data provides a strong indication that a species
response to environmental stress is not limited to a specific gene or gene family, but
rather a suite of genes involved in diverse physiological processes.
In contrast to the previous example, a study on multiple populations of the model
echinoderm species, purple sea urchin (Strongylocentrotus purpuratus), investigated
their response to climate change and environmental stress under realistic future CO2
levels [Pespeni et al., 2013]. The study found little evidence of morphological or
developmental changes to elevated CO2 levels, but did find genetic changes. At a
21
genetic level, substantial allelic change was observed in 42 functional classes of
proteins, with an excess of amino acid replacements detected in all populations. The
set of genes that showed an excess of amino acid replacements was enriched for
proteins involved in biomineralization, lipid metabolism, and ion homeostasis. This
result is intuitive as these gene classes are involved in exoskeleton formation and
maintenance, and pH regulation. These are all processes known to be affected by ocean
acidification. Results of this study found that all populations were able to rapidly adapt
to these conditions and were resilient to increased environmental stress associated with
ocean acidification. Standing genetic variation at physiologically important genes,
therefore, may allow select marine species to adapt to future climates in some cases.
Different developmental stages of biphasic organisms may respond to climate
change in different ways as well. An example of this comes from the widespread
sponge species, Rhopaloeides odorabile, a species whose adult form is highly sensitive
to temperatures above 32 °C, yet their larvae can withstand temperatures above 36 °C
[Webster et al., 2013]. This study examined gene expression changes that underpin
these contrasting thermal tolerances and found that heatshock proteins were
significantly up-regulated in adults at lower temperatures than in larval stages.
Importantly, this study also found that genes involved in signal transduction, protein
synthesis/degradation, oxidative stress and detoxification were all down regulated in
adults exposed to temperature stress. This data provides important baseline
information about the effects of temperature stress across different developmental
stages. Coupled with phenotypic data, this can be used to monitor the long-term impact
of climate change on sponge population dynamics.
There is now clear evidence that environmental variability associated with
climate change and climate variability induces significant stress on an organism’s
ability to persist in their habitat (Lathlean & Minchinton, 2012). This is often most
evident in exothermic species whose metabolic processes are highly dependent on
external temperatures [Van Dyck et al., 2015]. Therefore, identifying the genes or
pathways that are responsible for maintaining internal homeostasis within organisms
is important for understanding how marine invertebrates cope with changes within
their environments [Walsh and Jefferis, 2006]. Studying which molecular processes
are impacted by environmental stress is significant and provides a basis for
22
understanding how species respond to such stress and persist in their habitats [Lemos
et al., 2010].
1.4 THE CELLULAR STRESS RESPONSE
The cellular stress response (CSR) is a universal cellular defence mechanism
which is initiated in response to changes in the extracellular environment [Kültz,
2005]. Depending on the duration and severity of stress, cells either reinstate the
process of cellular homeostasis to the previous state or take on a distorted state in the
new and changed environment [Booth and Bilodeau-Bourgeois, 2009]. The response
includes control of the cell cycle, DNA and chromatin stabilization and repair, removal
of damaged proteins, protein chaperoning and repair, as well as various metabolism
functions [Kültz, 2003]. Consequently, different stressors and levels of stress can
generate different cellular responses, which can induce alternative mechanisms of cell
repair that allow the cell to re-establish normal function [Bakkenist and Kastan, 2004].
The CSR is comprised of a large suite of genes/proteins involved in multiple
cellular processes, with key proteins responsible for major functions being conserved
across phyla within a kingdom [Kültz, 2005]. In fact, over 300 stress related proteins
are considered to be highly conserved at the amino acid level among metazoans, with
44 having known functions in CSR [Kültz, 2005]. The proteins that have been
functionally categorised through gene ontologies have been shown to contribute to
different aspects of the cellular stress response. Among the genes/proteins that have
been functionally categorised are those involved in redox regulation, DNA damage
sensing/repair, molecular chaperones, protein degradation, fatty acid/lipid metabolism
and energy metabolism (Fulda et al., 2010).
The expression of several conserved genes involved in the CSR, have been
shown to be strongly induced under periods of stress [Beck et al., 2000], such as
HSP60, HSP70, peroxiredoxin and superoxide dismutase. Induction of expression for
these genes has been linked to changes in abiotic factors such as temperature, oxidative
stress and water contamination among others [Snyder et al., 2001; Cong et al., 2009;
Casellato et al., 2012]. Although some components of the CSR such as the heat shock
proteins (HSP’s) have been extensively studied and their expression patterns in
response to stress well established, the function and expression of many genes
involved in the CSR are yet to be examined in many taxa. Novel proteins have also
23
been found to play a role in CSR in some lineages, suggesting that more information
can be discovered by investigating stress response in non-model organisms [Kültz,
2005] such as marine molluscs. The stress response of numerous marine species has
been understudied and this is particularly true of diverse invertebrate phyla such as
cnidarians and molluscs.
1.5 MARINE GASTROPODS AS A SYSTEM TO INVESTIGATE TEMPERATURE STRESS
To investigate which genes are important components of stress response in
marine gastropods will require detailed studies of how environmental stress influences
patterns and levels of gene expression and protein abundance [Mohamed et al., 2014].
Currently, genome wide studies on stress response in marine mollusc species have
been largely restricted to the economically important species, such as the Pacific oyster
(Crassostrea gigas) and far fewer exist for gastropod species. Examinations of genome
wide patterns of gene expression and protein abundance in response to environmental
stress are only recently being investigated in intertidal gastropods [but see; Gleason
and Burton, 2015; Sun et al., 2012].
In the bivalve mollusc (C. gigas) Wang et al., (2012) sequenced multiple
transcriptomes for multiple individuals in both ambient and high temperature
treatments to investigate genome-wide responses to temperature stress. Transcript
abundance could be compared among thermally stressed and control groups using
patterns of gene expression derived from direct RNA sequencing. In individuals
subject to thermal stress, there was an almost 2,000 fold induction in multiple heat
shock protein 70 genes, indicating that these genes play an important role in thermal
stress in intertidal bivalve mollusc species. A number of other genes involved in
cellular homeostasis, including calreticulin and calnexin, were also up-regulated under
thermal stress. This indicates that genes involved in protein quality control and
refolding are critical to the thermal stress response in this species and may be one
reason that C. gigas can tolerate dramatic changes in temperature during tidal cycles
[Wang et al., 2012].
Sequencing of the C. gigas genome also revealed it contained an expanded
number of stress response genes when compared to humans and other terrestrial and
marine species. In fact, the oyster genome was found to contain 88 functional heat
shock protein 70 genes (HSP70) compared to 17 in the human genome and 39 in the
24
sea urchin genome [Wang et al., 2012]. Wang et al., (2012) also conducted
phylogenetic analyses and found that 71 of the HSP70 genes formed their own cluster,
indicating that the expansion may be specific to the oyster or bivalve lineage. The
oyster genome also contained 48 duplicate copies of inhibition of apoptosis proteins
compared to 8 in humans and 7 in sea urchins, which suggests that oysters may have
a powerful anti-apoptosis system [Reusch, 2014]. Several other stress related genes
were found to have undergone expansions in the oyster genome, including cytochrome
P450, multi-copper oxidase and extracellular superoxide dismutases. This study
highlights that although many aspects of stress response are conserved between
species, many lineage specific mechanisms may also play a large role in response to
environmental stress [Brierley and Kingsford, 2009].
While this landmark study has begun to elucidate the genomic and gene
expression response of intertidal mollusc species to environmental stress, there have
been few in depth characterisations of stress response at a genetic level in molluscs
beyond model taxa [but see Gleason and Burton, 2016]. It remains unknown whether
the findings from this study can be applied to most gastropod species or if stress
response varies widely among different species, particularly those from different areas
of the intertidal zone. As a consequence, we are unable to predict how marine
gastropod species from different intertidal areas will respond to increased
environmental stress associated with global climate change.
1.6 PHYSIOLOGICAL INVESTIGATION INTO REPRESENTATIVE SPECIES FROM THE GENUS NERITA
Understanding gene expression and proteomic responses of specific species to
temporal and spatial changes in their external environments is a key area of research
in physiological genomics. To conduct this research, it requires an appropriate group
of species that inhabit a temporally and spatially fluctuating environment. The genus
Nerita is a highly diverse and abundant group of organisms in the class gastropoda,
with an extensive pantropical distribution [Crandall et al., 2008]. Members of this
genus are abundant components of the intertidal fauna in a range of areas around the
world [Spencer et al., 2007]. Across their range, Nerita have exploited a variety of
environmental niches (different areas of the intertidal zone), and thrive in intertidal
habitats, which exhibit extreme fluctuations in temporal and spatial conditions
[Chapperon et al., 2013]. One common feature of Nerita species inferred from
25
biogeographic studies is that most species that occur in sympatry are ecologically
segregated into different areas of the intertidal zone [Crandall et al., 2008].
Nerita melanotragus and N. albicilla are widespread intertidal gastropod
species, which co-occur in south-east Queensland, and are distributed across a number
of temporally and spatially fluctuating environmental gradients, including a variety of
mean water temperatures (Waters et al., 2005; Postaire et al., 2014). These two species
have colonised different areas of the intertidal zones, with N. melanotragus in the mid
intertidal zone, while N. albicilla inhabits the low intertidal zone. Colonisation of
different areas of the intertidal zone means that N. melanotragus is more likely to
sustain long periods of temperature fluctuation, while N. albicilla is more frequently
subjected to immersion and more buffered from temperature fluctuation.
Consequently, these two species present an interesting case to examine their repertoire
of stress-related genes, patterns of differential gene expression and protein abundance
when placed in different thermal environments.
Understanding the genetic basis of physiological traits that are associated with
environmental variations has been limited by a lack of genomic resources for both
species. This study aims to conduct large scale sequencing of the N. melanotragus and
N. albicilla transcriptomes to generate genomic resources for functional genomic and
proteomic analyses. This resource will also allow us to determine if there is variation
in copy number of stress related genes between the two species. A large-scale gene
expression and proteomic study will then examine which genes and proteins are
differentially expressed/abundant in response to temperature changes. Despite the fact
that gastropod species are key indicator species for a suite of stressors, little research
has been undertaken on the physiological genomics of these species or how the
expression of these genes are affected by abiotic environmental variables [but see
Wang et al., 2008, Gleason and Burton, 2015]. The data generated from this research
will provide a significant contribution to the understanding of physiological
mechanisms that gastropod species use to cope with thermal stress, which has
applications in the development of indicator species that can be used to measure
thermal stress in marine environments.
26
1.7 RESEARCH QUESTION AND APPROACH
This project focused on investigating the molecular stress response of two key
intertidal gastropod species, Nerita melanotragus and a closely related warm water
species N. albicilla. To achieve this, genomic resources were developed, and this data
was interrogated to determine candidate genes involved in physiological adaptation
and stress response to abiotic environmental conditions on both temporal and spatial
scales. In addition, the project measured patterns of gene expression and protein
abundance of the key genes/proteins and pathways involved in temperature stress
response in these species, in a series of in vivo experiments providing a basis for our
understanding of physiological response to thermal stress in marine gastropod species.
In order to increase our understanding of stress response and adaptation in
marine invertebrates, this study addressed key knowledge gaps by focusing on two
representative gastropod species, N. melanotragus and N. albicilla. The study
consisted of the following objectives:
1.7.1 Research objective 1
Establishment of a reliable, efficient and accurate de novo assembler for Nerita
spp.
This objective corresponds to the first study of the project. The key objective of
this study is to critically compare the reliability and accuracy of current de novo
assemblers and to establish the most suitable, for species from the genus Nerita. Using
several quality metrics, four de novo assemblers (Geneious, Velvet, Oases and Trinity)
will be used to reconstruct a transcriptome assembly from curated raw read data. The
establishment of a reliable and accurate assembler will ensure the quality of
downstream analysis when investigating the gene repertoire, gene expression and
protein abundance patterns of the Nerita spp. under different temperatures.
1.7.2 Research objective 2
Development of genomic resources and comparative analysis of expressed stress
genes in Nerita melanotragus and N. albicilla.
This objective corresponds to the second study of the project. The key objective
of this study was to generate transcriptome assemblies from the two species from the
genus Nerita, to address the lack of genomic resources available for both species, and
27
gastropods in general. Nerita melanotragus is a temperate, cold water adapted species,
while N. albicilla is a tropical, warm water adapted species. Simultaneous sequencing
of the two species provided data for comparative genomic analysis to identify
candidate genes that were involved in temperature stress response, as well as an array
of other genes that regulate physiological processes. This comparative genomic
approach, in combination with annotation to specific gene ontologies allowed us to
determine the copy number of expressed genes important in thermal stress response in
these two intertidal gastropod species. Downstream application of this data
encompassed identification of potential stress response biomarkers and an extensive
set of candidate genes were used in a detailed investigation of the response of N.
melanotragus and N. albicilla towards temperature fluctuations.
1.7.3 Research objective 3
Comparative transcriptomic and proteomic characterization of genes/proteins
and gene families involved in the abiotic stress response of two intertidal marine snails
inhabiting different areas of the intertidal zones.
This objective will correspond to the third study of this project. The objectives
of this study are to identify genes involved in temperature stress response, i.e. those
that are differentially expressed in the two Nerita species under different temperature
conditions. This study will focus on gene expression and protein abundance at different
temperatures that correspond to the extreme range of water temperatures that these
species endure during periods of thermal stress. The information generated by this
study will help to better understand if species from lower intertidal zone experience
thermal stress at lower tempertures, compared to those from the mid-upper intertidal
zones.
29
Chapter 2: Assembly and Annotation of a Non-Model Gastropod (Nerita melanotragus) Transcriptome: a Comparison of De novo Assemblers
2.1 BACKGROUND
The phylum Mollusca is a highly abundant group of marine animals accounting
for over 23% of all marine species (Ponder and Lindberg, 1997; Hou et al., 2011), and
as such are a dominant taxa of many marine ecosystems. Some of these organisms are
also of significant economic importance as a source of bioactive compounds in
addition to being aquaculture and fisheries commodities. Molluscs also serve as
valuable models for behavioural neurobiology, respiration and feeding in animals
(Peterson, 2002; Herpin et al., 2004; Feng et al., 2009; Sadamoto et al., 2012).
Consequently, molluscs are very important both economically and ecologically.
However, genomic resources remain scarce for Mollusc species, with transcriptome
data available for only selected species such as Crassostrea gigas, Macoma balthica,
Aplysia californica and Lymnaea stagnalis (Fiedler et al., 2010; Feng et al., 2009 Pante
et al., 2012; Zhao et al., 2012). Despite the availability of these genomic resources,
this group of organisms remains relatively poorly studied at the genomic level.
Research into the genomics of gastropod molluscs has lagged, because genomic
resources are not developed for many species in this class of organisms. Next
generation sequencing platforms such as Illumina and Ion Torrent have recently been
used to rapidly characterise transcriptome sequences from a number of non-model
organisms (Chiara et al., 2013; Li et al., 2013; Hook et al., 2014; Schunter et al., 2014).
In this study, the Ion Torrent platform is employed, an efficient and cost effective
platform to sequence the Nerita melanotragus transcriptome, a non-model species
without a reference genome.
30
Precise and accurate de novo assembly and annotation of transcriptomes,
however, is a commonly overlooked but critically important step for assemblies
generated from short reads (~100-150 bp). Recently, many de novo assemblers have
been developed with specific algorithms for transcriptome assembled from Illumina
short reads., nonetheless their effectiveness for de novo assembly of Ion Torrent data
remains relatively unexplored as the Ion Torrent technology is newer and still gaining
acceptance in the research community. Accurate assembly of short reads into longer
contigs is important for the functional annotation of ESTs in non-model organisms. In
fact, one of the major challenges for genomic research in mollusc species is that many
genes remain unannotated. In this study, these issues are addressed by comparing the
performance of a number of short read de novo transcriptome assemblers, specifically
using Ion Torrent sequence data in Nerita melanotragus.
The black nerite (N. melanotragus) is a marine gastropod within the phylum
Mollusca. This species inhabits the intertidal zone and has a large geographic
distribution from central Queensland, Australia to southern New Zealand (Crandall et
al., 2008). Specifically, these species are found in rockpools where they are found to
occur in groups. This gastropod species is identified as a herbivore, grazing algae from
rocks. The environmental conditions that this species is exposed to change temporally
and spatially, on both micro and macro geographic scales. Thus, this organism is a
good candidate to explore the genetic and gene expression changes, which allow it to
persist in such a dynamic environment. Little is known about adaptation genetics and
plastic gene expression changes in N. melanotragus due to an explicit lack of genomic
resources. To address this issue, the first de novo assembly of the N. melanotragus
transcriptome is reported here. Specifically, this study focuses on addressing the
following aims: 1. to generate genomic resources for this species through whole
organism transcriptome sequencing; and 2. to assess the accuracy and precision of four
different short read de novo transcriptome assemblers using specific quality metrics.
31
2.2 METHODS
2.2.1 Sample acquisition and sequencing
Five Black nerite, N. melanotragus, (Figure 3), individuals were collected from
the rocky intertidal zone at Caloundra, Queensland, Australia (26°48′17“S
153°8′28”E). Ethics approval and collection permits/licenses were not required for
specimen collection. Individual animals were classified as N. melanotragus based on
operculum colour (Waters et al., 2005). A single individual was snap frozen in liquid
nitrogen (LN2) and stored at −80°C until RNA extraction. The frozen tissue sample
from the whole organism was homogenised in LN2 and total RNA was extracted using
a Trizol/Chloroform extraction protocol followed by a clean-up using an RNeasy
Minikit (Qiagen). RNA samples were treated using Turbo DNase (Ambion), according
to manufacturer’s protocol.
Figure 3. Black nerite (Nerita melanotragus). Black nerite displaying external morphology (A), and black nerite displaying tan/brown colouration of its operculum (B).
To check the quantity and integrity of the total RNA, the sample was run on a
Bioanalyzer 2100 RNA Nano chip (Agilent Technologies). Messenger RNA was
isolated from total RNA using the Dynabeads mRNA Purification Kit (Life
Technologies). A Bioanalyzer 2100 Pico chip (Agilent Technologies) was used to
determine the quality and quantity of isolated mRNA.
High quality mRNA (100–500 ng) was fragmented into 200–700 bp pieces using
RNase III (Life Technologies) and Agincourt beads were used to remove small RNA
fragments from two samples. The yield and size distribution of fragmented RNA was
determined on a Bioanalyzer 2100 using an RNA 6000 Pico chip (Agilent
Technologies). Library construction was conducted on a single sample as per the Ion
A B
32
Total RNA-Seq Kit (Life Technologies) for whole transcriptome libraries and cDNA
yield and size was determined using a Bioanalyzer 2100 high sensitivity DNA chip.
Template preparation for sequencing was conducted on a single sample
according to the OneTouch Ion™ Template Kit (Life Technologies). Ion Torrent
sequencing was conducted using the Ion PGM 200 Sequencing Kit (Life
Technologies) on an Ion Torrent Personal Genome Machine (PGM, Life
Technologies) using a 318-chip (Ion 318TM chip, Life Technologies).
2.2.2 Assembly and annotation
Raw sequencing reads were converted to FastQ files and assessed for quality
scores. Reads were accepted based on a quality threshold (Q > 20, ambiguous bases
less than 1%), and adapter sequences were removed prior to downstream analyses. To
critically assess the quality of this Ion Torrent data, a number of analytical approaches
described by Wheat and Vogel, 2011 were conducted, including the sequencing depth
and coverage for expressed genes from the publically available mitochondrial genome
of N. melanotragus using Geneious Pro (Version 5.6) (Drummond et al., 2010).
High quality reads were assembled into contiguous sequences (contigs) using
four different short read de novo assemblers, which included the following: 1)
Geneious Pro (Version 5.6) (Drummond et al., 2010); 2) Velvet short read assembler,
Version 1.2.08 (Zerbino and Birney, 2008); 3) Oases short read assembler, Version
0.2.08 (Schulz et al., 2012) and 4) Trinity short read assembler (Grabherr et al., 2011).
All assemblers except Geneious used the following assembly parameters: kmer hash
length = 25, coverage cut-off = 3x; minimum contig length = 100 bp. In the Geneious
software, kmer hash length and coverage cut-off could not be changed, so default
settings were used with a minimum contig length of 100 bp. The assembly created by
the four different assemblers were compared for three different parameters; the number
of contigs produced, the N50 statistic and the longest contig to determine which
assembler performed best.
To determine the redundancy of the assemblies produced by the four different
assemblers, assembled datasets were remapped to the mitochondrial reference gene set
from N. melanotragus (publically available from NCBI). All contigs produced by the
four different assemblers were remapped to this gene set and the overall number of
hits was calculated as a quality score.
33
Following contig generation, the transcriptome assemblies for Trinity and Oases
were referenced to the NR database at NCBI as BLASTx queries using the Blast2GO®
software suite (Conesa et al., 2005). In order to be used in downstream analyses,
BLASTx hits had to be below an E-value of 1 × 10−6. Annotation analyses were
performed at levels 2 and 3. The Blast2GO software suite was also used to predict the
functions of contigs with BLASTx hits and assign Gene Ontology (GO) terms to the
sequences. To determine which of the short read assemblers produced the best
assembly of our Ion Torrent data, BLAST and annotation success of these different
datasets was compared.
To validate the reliability and accuracy of the assembly and annotation, two
contigs (annotated as β (beta) - actin and NADH dehydrogenase subunit 5) were
randomly chosen for primer design and for PCR and Sanger sequencing. Primers were
designed using BatchPrimer3 (Version 1.0) using settings as per (Sexton et al., 2010).
Details of the primer sequences are provided in Table 1. PCR was performed according
to the MyTaq (Bioline) protocol with the following concentrations of reagents 1 × PCR
Buffer, 1 μM of each primer, 0.1 units of MyTaqTM DNA Polymerase (Bioline) and
20 ng of template genomic DNA (from same individual that was sequenced) in a total
volume of 25 μL. PCR conditions were as follows: 3 min at 94°C, followed by 30
cycles of 30 sec at 94°C, 30 sec at 52°C, 30 sec 72°C, 3 min at 72°C. Amplicons were
purified using the Isolate PCR Kit (Bioline) and cycle sequencing was carried out
using BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies). After a
MgSO4 clean-up, the amplicons were run on an ABI 3500 Genetic Analyzer (Life
Technologies). Sequences were visualised and edited by eye using Geneious Pro
Version 5.6. These sequences were then used as BLASTn queries against the
nucleotide database at NCBI and were compared for differences against the original
sequences.
Table 1. Primer sequences for β-actin and NADH dehydrogenase subunit 5. Primers were designed to validate the reliability and accuracy of our assembly and annotation.
Primer name Primer sequence Fragment length (bp)
Beta-actin-Nm (F) GAAGCTGTGCTATGTTGTCCTC 450
Beta-actin-Nm (R) GATCTTGATCTTCATGGTGCTG 450
NADH (F) GGCGCATTAGCATCTCAAAT 414
NADH (R) GCTCCTGCAAGGGTAACTGA 414
34
2.3 RESULTS
2.3.1 Ion torrent sequencing and reads assembly
Transcriptome sequencing of mRNA from N. melanotragus on the Ion Torrent
PGM platform generated a total of 249.67 Mbp of sequence from 1,883,624 raw reads
(accession number SRR1054996). Mean length of reads was 133 bp, with the longest
read being 392 bp. Sequence reads that did not meet our strict quality criteria (Q < 20,
ambiguous bases > 1%) were excluded and 84.19 Mb of high quality data was retained
for downstream analysis, as low quality bases are likely to reduce the accuracy of
transcriptome assemblies.
Based on high quality reads, a total of 112, 762, 78, 306, 10, 886 and 3, 090
contigs were generated using the following four different assemblers Geneious,
Velvet, Trinity and Oases, respectively (Table 2). Overall, the Oases assembly
produced the longest contig at 1700 bp closely followed by Trinity at 1618 bp. The
longest contigs produced by Geneious and Velvet were over 700 bp shorter than the
other two de novo assemblers (Table 2). The length of the N50 statistic in the Geneious,
Velvet and Oases assemblies were noticeably shorter than that calculated for the
Trinity assembly (Table 2). Average contig length showed a similar trend, with the
Trinity assembly also having the longest average contig length.
Table 2. Assembly quality metrics. Assembly statistics for the transcriptomes produced by the four different short read de novo assemblers
Both Velvet and Geneious assemblies had a greater number of contigs remapped
to the mitochondrial expressed gene set with 450 and 420 hits respectively, compared
to 37 and 25 hits for Trinity and Oases, respectively. The coverage of the contigs
produced by both Trinity and Oases was greater than 95%, while the coverage
produced by the Geneious and Velvet contigs was less than 55% for both assemblies.
Assembly Statistic AssemblerOases Trinity Velvet Geneious
Number of contigs 3 090 10 886 78 306 112 762 Average contig length 175 293 111 140 Longest contig 1 700 1 618 458 711 N50 149 258 107 124
35
The Geneious and Velvet assemblies were found to be highly redundant and produced
more fragmented contigs. As the reliability of these two assemblies was not be
established, , they were disregarded from further analyses.
Remapping of high quality reads to the transcribed genes in N. melanotragus
mitochondrial genome resulted in an assembly with an average of approximately 374
× read depth and greater than 99.5% coverage. The sequencing depth was highest for
the 16S rRNA gene with >2000 × read depth. All genes had coverage of greater than
98% with the lowest coverage occurring in NADH dehydrogenase subunit 2, which
contained a 40 bp region with no coverage.
2.3.2 Functional annotation of contigs
Of the 10886 and 3090 contigs queried against the NR database only 2069 and
475 returned significant hits at greater than 1 × 10−6 stringency (Table 3). This meant
that approximately 19 and 15.4% of contigs could be assigned putative functions for
the Trinity and Oases assemblies, respectively.
Table 3. Annotation results. The number of contigs allocated to different annotation categories for the Trinity and Oases assemblies.
Annotation category Annotation result (number of sequences)
Trinity Oases
Without blast result 0 (0%) 0 (0%) Without blast hits 8823 (81%) 2615 (84.6%) With blast result 301 (2.7%) 66 (2.1%) With mapping result 177 (1.6%) 28 (0.9%) Annotated sequences 1585 (14.5%) 381 (12.3%) Total sequences 10886 3090
Despite the limited number of contigs assigned BLAST hits, the contigs
generated by both Trinity and Oases captured a broad range of different types of
transcripts, as indicated by the variety of Gene Ontology (GO) terms assigned. A total
functional annotation dataset is provided in Figures 4 and 5, while the results for the
top 20 GO terms for each category are presented in Figure 6. The GO category with
the highest number of terms assigned was molecular function, followed by cellular
component while biological process had the least contigs assigned terms. The most
commonly assigned GO terms in the molecular function GO category were the
housekeeping genes involved in ATP binding, protein binding and structural
constituent of ribosome for both assemblies. Oxidation-reduction process, translation
36
and translational elongation were the most commonly assigned terms for the biological
process GO category. The three most commonly assigned GO terms for cellular
component were cytosol, cytoplasm and nucleus, and cytoplasm, integral to membrane
and mitochondrion for the Trinity and Oases assembly, respectively. Over 65% of
BLAST hits were made up of different mollusc species as presented in Figure 7. The
Pacific oyster, C. gigas, which made up 27 and 34% of BLAST hits for the Oases and
Trinity assemblies, dominated top BLAST hits. Other molluscs including Haliotis
discus and H. diversicolor were also in the top four species that made up top BLAST
hits for both assemblies.
37
Figure 4. Nerita melanotragus transcriptome functional annotation based on Trinity Blast2GO analysis. Functional annotation results indicate the relative amount of each category of contigs with protein hits. The results are summarized as follows: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC).
38
Figure 5. Nerita melanotragus transcriptome functional annotation based on Oases Blast2GO analysis. Functional annotation results indicate the relative amount of each category of contigs with protein hits. The results are summarized as follows: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC).
39
Figure 6. GO category assignment. Comparative analysis and functional classification of the top 20 GO terms for the Trinity and Oases assembly.
40
Figure 7. GO category assignment. Comparative analysis and functional classification of the top 20 GO terms for the Trinity and Oases assembly.
41
2.3.3 PCR validation of contigs
The PCR primer pairs designed for beta-actin and NADH dehydrogenase subunit
5 amplified a single product of the correct size, images provided in the Figure 8. High
quality sequence was obtained for both amplicons using both forward and reverse
primers. The BAC and NAD sequences were assigned top nucleotide BLAST hits for
beta-actin from Aplysia californica and NADH dehydrogenase subunit 5 from N.
melanotragus, respectively. Protein BLAST confirmed this result with an E-value of
greater than 1 × 10−27. Alignment of the beta-actin and NADH dehydrogenase subunit
5 sequences to the contigs from which they were designed resulted in a perfect match
for beta-actin and the presence of a single one base pair indel for NADH
dehydrogenase subunit 5, in an adenosine homopolymer region. PCR validation gene
sequences are available under the accession number KM025036 (beta-actin) and
KM025037 (NADH dehydrogenase subunit 5).
Figure 8. Visualisation of PCR products. Agarose electrophoresis gel showing two candidate genes beta-actin (A) and NADH dehydrogenase (B) (Molecular marker Hyperladder IV).
500 bp300 bp200 bp
100 bp
42
2.4 DISCUSSION
The availability and throughput of next generation sequencing technologies has
enabled the rapid and efficient sequencing of transcriptomes for model and non-model
species. The majority of de novo transcriptome assemblies in non-model organisms
have in the past been produced using the long reads (300-600 bp) generated using
Roche 454 (Gibbons et al., 2009). With the recent developments in sequencing
technology, short read sequencers (90-400 bp), such as Illumina and Ion Torrent, are
starting to be more commonly used for the generation of large next generation
sequencing data sets, as the costs are much lower for the same output (Li et al., 2010).
Consequently, the use of short read sequencers to generate de novo transcriptome
assemblies for non-model organisms may lead to a more complete gene set for these
species at a lower cost. The reliability of de novo transcriptome assemblies generated
from short read sequencers, however, needs to be validated to ensure that assemblies
are accurate and won’t compromise the downstream applications of next generation
sequencing projects. This chapter focuses on comparing a number of de novo
assemblers to demonstrate that short read RNA-seq data generated by an Ion Torrent
PGMTM sequencing system can reliably and accurately be assembled for a non-model
organism.
Accurate de novo assembly of transcriptomes is crucial for next generation
sequencing projects in non-model organisms. Of particular importance is finding short
read assembly algorithms that produce accurate and reliable assemblies from the short
reads produced by Ion Torrent or Illumina sequencers. In this comparison of four
different short read assemblers using Ion Torrent data, it was found that Trinity and
Oases outperformed Velvet and Geneious in all performance metrics, including longer
N50 and average contig lengths, producing fewer and longer contigs and having less
redundant contigs. Overall, these results are similar to those obtained when comparing
Trinity or Oases against other short read assemblers in simulation studies and
empirically, with Illumina data (Martin and Wang, 2011). Even though Trinity and
Oases outperformed the other assemblers in all metrics, their respective assemblies
performed better for different quality metrics. For example, Trinity had a longer N50,
while Oases produced fewer contigs with less redundancy.
43
The de novo assemblies generated by both Trinity and Oases produced N50 and
average contig lengths similar to many past transcriptome sequencing studies (Li et
al., 2013; Hook et al., 2014; Schunter et al., 2014). The N50 and average contig size
of the Trinity assembly is also similar to that reported for the recently sequenced
transcriptome of the common pond snail, Radix balthica (Feldmeyer et al., 2011). In
contrast, the N50 and average contig size (>1200 bp) reported for a transcriptome
sequence of a different pond snail, Lymnaea stagnalis (Sadamoto et al., 2012) are 6x
larger than that of the Trinity assembly for this dataset. A few differences between this
transcriptome assembly and that for the L. stagnalis transcriptome assembly may
account for this difference. Firstly, their dataset had approximately 40x more 100 bp
Illumina sequences than in this study. Secondly, the L. stagnalis study was conducted
for a single tissue type, the central nervous system, while this study utilized the whole
animal. These two factors may explain much of the difference in N50 and average
contig length between the two studies. Therefore, it is highly likely that de novo
assemblies generated with a similar amount of Ion Torrent data could result in
assemblies with more comparable N50 and average contig lengths.
The blast and annotation success for both the Trinity and Oases assemblies was
quite low (15-19%). This level of annotation success is much lower than that often
reported in the literature even for non-model species (Li et al., 2010). The level of
annotation success achieved in this study, however, is in a similar range to that reported
for two recently sequenced gastropod transcriptomes using short read technologies (R.
balthica 17% and L. stagnalis 20.1%) (Feldmeyer et al., 2011; Sadamoto et al., 2012).
One of the reasons put forward to explain the low degree of annotation success is the
fact that few reference genome sequences exist for mollusc species (Sadamoto et al.,
2012). Furthermore, it is hypothesised that an improvement in annotation success of
gastropod species will require more representative gastropod reference genome
sequences and an increase in mollusc protein sequences in public databases.
This chapter describes an EST collection generated by Ion Torrent sequencing
and de novo assembly to characterize the transcriptome of a non-model gastropod
species, N. melanotragus. This marine gastropod is a common component of the
intertidal zone on rocky substrates and distributed from Mackay (Queensland,
Australia) to southern Tasmania (Australia) and New Zealand. Across this large
44
geographic distribution N. melanotragus spans a number of environmental gradients
such as clines in water temperature, oxygen concentration and substrate type (Waters
et al., 2005). The environment of this species also varies temporally on a micro
geographic scale between tidal cycles and consequently N. melanotragus is exposed
to large changes in a number of environmental factors including temperature, pH,
salinity and dissolved oxygen (Waters et al., 2005). Therefore generating genomic
datasets such as in this study is crucial as research efforts towards understanding
genetic and gene expression changes responsible for species adaptations.
2.5 CONCLUSION
The large number of contigs annotated and functionally characterized in this
study provides a first step towards a systems biology approach to physiological
genomics in gastropod species. By identifying a wide variety of genes from a number
of different GO classes, it is now possible to determine which genes are important for
adaptation across broad environmental changes and for stress response to micro
geographic environmental fluctuations. This is very important because we still know
remarkably little about the physiology and evolution of many marine organisms and
in particular the physiological basis of adaptation to both spatial and temporal
environmental variation in intertidal zone species (Chapperon and Seuront, 2011;
Place et al., 2012).
45
Chapter 3: Comparative transcriptomics and characterization of genes and gene families involved in abiotic stress response from two intertidal marine snails
3.1 BACKGROUND
While a core metazoan geneset is found in almost all animals, it is becoming
apparent that gene loss and gain within lineages is more common than originally
thought [Markov et al, 2015]. The evolution of new genes occurs primarily through
gene duplication and can lead to large increases in gene copy number in specific
lineages. In molluscs, for example, this has been observed in Crassostrea gigas, where
tyrosinase genes have been extensively duplicated (26 copies) when compared to
Homo sapiens (2 copies) and Caenorhabditis elegans (1 copy) [Wang et al., 2012].
While some lineage specific expansions appear random, many also seem to have an
adaptive basis. For example, an expansion of protocadherins has been observed in
Octopus bimaculoides (Albertin et al., 2015). Protocadherins are involved in neuronal
development and this correlates with an increase in nervous system complexity
observed in octopods. More research is required, however, to determine which genes
are expanded in specific mollusc lineages and whether they are likely to have an
adaptive basis.
Many lineage specific expansions in expressed genes have often been observed
in gene families with roles in stress response or immune function [Lespinet et al.,
2002] and this can have major implications for stress tolerance in particular species
[Wang et al., 2012]. In molluscs, multiple expansions of different heat shock proteins
(HSPs) have been observed, including the expansion of HSP70 in C. gigas [Wang et
al., 2012] and HSP90 in Aplysia californica (Pantzartzi et al., 2013), where they have
been associated with physiological adaptation of these organisms to thermal stress.
Similarly, immune related genes, such as toll-like receptors (TLR), appear to have
undergone extensive duplication in C. gigas and also in the echinoderm
46
Strongylocentrotus purpuratus [Wang et al., 2015]. These TLRs appear functionally
divergent and show differences in expression under bacterial or viral challenge. The
study of the expansion and contraction of gene families has largely been limited to
those mollusc species with significant genomic resources but for many mollusc
species, information on copy number within specific gene families is still lacking.
The genus Nerita is a highly diverse and abundant group of gastropod molluscs
with an extensive pantropical distribution [Frey and Vermeij, 2008]. Across their
range, Nerita species have exploited a variety of ecological niches and thrive in the
intertidal zone, where they are a common component of rocky intertidal communities.
Two common yet ecologically divergent Nerita species found in Southeast
Queensland are Nerita melanotragus and Nerita albicilla (N. melanotragus is a mid
littoral species, while N. albicilla is a low littoral species [Frey, 2010]). This means
that N. melanotragus is more likely to sustain far longer periods of thermal stress than
N. albicilla. Consequently, these two species present an interesting case to examine if
increases in gene copy number (lineage specific expansions) of expressed stress
response genes may underpin some of the physiological differences. Specifically, this
study aimed to test whether N. melanotragus had higher copy number of stress related
genes expressed under normal conditions when compared to N. albicilla, as N.
melanotragus is more likely to sustain far longer periods of thermal stress than N.
albicilla. To achieve this, examinations were made into lineage specific differences in
the copy number of stress related genes. Specifically, the two Nerita species’
transcriptome sequences were interrogated to investigate these differences.
Furthermore, investigations were made to examine if any of the stress genes showed
evidence of selection, which would indicate whether changes in gene copy number
may have an adaptive basis in these species.
3.2 METHODS
3.2.1 RNA extraction, sequencing and read processing
Two representative individuals of N. melanotragus and N. albicilla were
collected from King’s Beach, Caloundra, Australia (GPS coordinates: 153°8'14"E,
26°48'17"S). The collection site represents an overlap in the distribution of N.
melanotragus and N. albicilla (Figure S1). Two whole animals from each speies were
47
snap frozen in liquid nitrogen and stored at -80 °C. Prior to transcriptome sequencing,
species were verified based on sequences for the DNA barcode CO1 (cytochrome
oxidase 1) using the primers HCO-2198 and LCO-1490 [Folmer et al., 1994]. DNA
extraction was undertaken on two whole organism samples from each species using an
ISOLATE II Genomic DNA Kit (Bioline). PCR conditions for amplification of the
CO1 gene were as follows: 1 min at 95°C, 1 minute at 40°C, and 90 sec at 72°C for a
total of 35 cycles, followed by a final extension step at 72°C for seven minutes.
Amplicons were purified using ISOLATE II PCR and Gel Kit (Bioline), followed by
cycle sequencing using BigDye® Terminator v3.1. Sequences were resolved on an
ABI 3500 Genetic Analyzer (Life Technologies) and edited using Geneious [Kearse
et al., 2012]. Sequences were then referenced as BLASTn queries against the
nucleotide database at NCBI for species validation.
Figure S 1. Distribution of N. melanotragus (highlighted in blue) and N. albicilla (highlighted in orange). Collection point of specimens is indicated with the arrow.
Three samples from each species were homogenized in liquid nitrogen before
total RNA was extracted using a trizol/chloroform extraction protocol (Invitrogen),
followed by a silica membrane based column clean-up (Qiagen) as per Amin et al.,
2014. RNA integrity was determined using a Bioanalyser 2100 (Agilent). RNA
sequencing was performed on a single sample for each species using 91bp paired-end
chemistry on an Illumina HiSeq 2000 platform following the protocols of Prentis and
Pavasovic (2014).
48
3.2.2 Transcriptome quality and completeness
Sequence reads were converted to FastQ files and only reads that met a quality
criteria of Q > 20 and ambiguous bases < 0.5% were retained for further analysis.
These high quality reads were assembled into contigs using two software packages:
CLC Genomics Workbench [CLC Genomics Workbench
(https://www.qiagenbioinformatics.com/)] and Trinity short read de novo assembler
[Haas et al., 2013]. Once assembled, contigs were filtered for redundancy and
chimeras using CD-Hit [Huang et al., 2010]. To create the combined assembly,
sequences with 95% similarity or higher were clustered into a single contig while
unique genes were retained as singletons.
To determine the completeness of our assemblies, the number of full length and
partial ultra-conserved core eukaryotic gene set sequences (CEGs) in each assembly
using CEGMA were identified [Parra et al., 2007]. Open reading frames (ORFs) of
greater than 300 bp in length were batch extracted using TransDecoder [Haas et al.,
2013]. Final assemblies were then used as BLASTx queries against the NR database
using BLAST+ [Camacho et al., 2009]. BLAST hits were retained if they met a
stringency E-value of 10-5. BLAST2GO [Conesa et al., 2005] and Trinotate [Haas et
al., 2013] were used to assign gene ontologies (GOs). In addition, contigs were used
as BLASTx queries while extracted and translated ORFs were used as BLASTp
queries against the Swiss-Prot and TrEMBL databases. Protein family (PFAM)
domains were assigned using HMMER [Finn et al., 2011] searches while signalP
[Petersen et al., 2011] was used to predict signal peptides. A Trinity script was also
used to assess the number of full-length transcripts with 100 % coverage in both
assemblies. This was undertaken through BLASTx searches with a stringency E-value
of 10-20 which was used to determine the amount of predicted proteins from our
assemblies that had 100 % coverage for the top matching entries. Contigs matching
known parasitic species of gastropods (Chelonia mydas, Schistosoma japonicum and
S. mansoni) were removed based on top BLAST hit information. A total of 70 contigs
in N. melanotragus and 51 contigs in N. albicilla had top BLAST hits to parasites and
were removed from downstream analysis. WEGO [Ye et al., 2006] was used to
categorise and visualise GO terms for both species. Gene set enrichment analysis
(GSEA) was then performed to determine if transcripts from a particular GO class
were over-represented in either species, using GOSeq within the Trinotate suite.
49
3.2.3 Identification of unique and common genes
To identify common orthologs encoding proteins in our datasets, the predicted
peptide sets for N. melanotragus, N. albicilla, Lottia gigantea and Crassostrea gigas
were used. Peptide files for all four species were analysed using OrthoVenn [Wang et
al., 2015]. An E-value of 10-5 was used with an inflation value of 1.5. Gene set
enrichment analysis was then undertaken to find gene ontologies which are
significantly over-represented in the orthologs shared between the two Nerita species
as well as those unique to each Nerita species using a hypergeometric test with a
significance level of p < 0.05.
3.2.4 Identification and comparative analysis of full length candidate genes
In order to identify candidate genes associated with stress response, annotations
were exported from BLAST2GO. Gene ontology terms associated with stress were
obtained from the Gene Ontology Consortium [Ashburner et al., 2000] and used to
identify candidate genes (Table S2). Select candidate gene families (HSP90, HSP70,
HSP60, HSP20, catalase and nitric oxide synthase) were then investigated for
differences in copy number in the transcriptome sequences of both species.
In order to test whether specific candidate genes showed signatures of selection
the ratio of synonymous to non-synonymous substitutions was calculated, homologs
of interest were extracted from our datasets. Nucleotide sequences from each species
were entered into an automated KaKs online calculation tool using default paramters
(Zhang et al 2006). A KaKs ratio of greater than 1 indicates positive selection on the
gene, a value of less than 1 indicates purifying selection and values equal to 1 indicate
neutral evolution.
3.3 RESULTS
3.3.1 Sequencing results, reads assembly and functional annotation of contigs
CO1 barcoding confirmed the identity for each species (GenBank: KP981645,
KP981646) with 100 % identity to the N. melanotragus haplotype (EU732275) and N.
albicilla (EU253341), respectively.
Transcriptome sequencing of N. melanotragus and N. albicilla using Illumina
91bp paired end sequencing chemistry produced a total of 6.2 Gbp and 7.4 Gbp of
sequence from 68,678,334 and 61,367,256 raw reads, respectively. Greater than 99.99
50
% of reads were retained after quality trimming. Reads from N. melanotragus and N.
albicilla were assembled into 77,098 and 78,577 contigs, respectively, using CLC
Genomics Workbench and 127,068 and 124,992 contigs, respectively, using Trinity
software (see Table S1 for the complete assembly metrics). Merged assemblies
produced a total of 159,523 and 159,506 non redundant contigs for N. melanotragus
and N. albicilla, respectively. From these, 45,438 (28.48 %) and 44,887 (28.14 %)
contigs returned significant hits for known genes, within N. melanotragus and N.
albicilla, respectively. Over 75 % of top BLAST hits for both Nerita species were
assigned to molluscs (Figure S2).
Table S 1. Assembly quality metrics. Assembly statistics for the transcriptomes produced by the different short read de novo assemblers.
Assembly statistics N. melanotragus N. albicilla
CLC Genomics
Trinity Combined CLC Genomics
Trinity Combined
Number of contigs 77,098 127,068 159,523 78,577 124,992 159,506
Longest contig 14,653 14,718 14,718 15,413 15,538 15,538
N50 800 995 897 776 887 801
Figure S 2. BLAST top hit species distribution. The 20 species most commonly represented in BLAST hits for
N. albicilla and N. melanotragus assemblies.
A total of 203 (81.85 %) and 207 (83.55 %) full length proteins were identified
based on the 248 CEGs. In the overall dataset, however, 2566 (5.6 %) and 2296 (5.1
%) full length proteins were observed for N. melanotragus and N. albicilla,
51
respectively. The distribution of GO terms across the three broad categories biological
process, cellular component and molecular function are presented in Figure S3. Gene
set enrichment analysis revealed no significant enrichment of GO terms between the
two datasets.
Figure S 3. Gene ontology (GO) functional classification. Distribution of annotated contigs for N. melanotragus and N. albicilla across three main GO categories; including cellular component, molecular
function and biological process. The left Y axis indicates the percentage of transcripts assigned to a GO term, and the right Y axis represents the number of transcripts within the same category.
3.3.2 Unique and common genes
Overall, 6457 orthologs were found in common amongst the two Nerita species,
L. gigantea and C. gigas, while 3321, 10561 and 8134 were in common among three
species comparisons, two species comparisons or only found in individual species,
respectively (Figure 9). In total, the two Nerita species shared 8501 orthologs with
each other, and Nerita melanotragus had 3618 unique orthologs, while N. albicilla had
2280 unique orthologs. A total of 636 orthologs were shared among N. melanotragus,
C. gigas and L. gigantea while fewer orthologs were shared between C. gigas and N.
melanotragus (183) than L. gigantea and N. melanotragus (312). Crassostrea gigas
52
and L. gigantea share only 392 orthologs with N. albicilla, and when comparing two
species, C. gigas and L. gigantea share 155 and 259 orthologs with N. albicilla,
respectively.
Figure 9. Orthologous genes between Nerita melanotragus, N. albicilla, Crasosstrea gigas and Lottia gigantea at 88% similarity cutoff.
Geneset enrichment analysis found two terms over-represented for orthologs
shared between the two Nerita species (activation of protein kinase B activity and
positive regulation of guanylate cyclase activity), but neither are directly related to
stress. For orthologs unique to N. melanotragus only a single GO term was over-
represented (phosphoribosylglycinamide formyltransferase activity), while for N.
albicilla no GO terms were over-represented.
3.3.3 Identification and comparative analysis of candidate genes
The functional annotation of contigs allowed the identification of a number of
candidate genes associated with stress based on multiple GO terms. From these GO
terms, 447 and 604 genes with one or more of the stress GO terms were identified for
N. melanotragus and N. albicilla, respectively. In the specific “response to stress” GO
53
term N. melanotragus and N. albicilla had 99 and 262 genes, respectively. Similar
numbers of genes in the “response to heat” GO term were observed for N.
melanotragus (40) and N. albicilla (33) (Figure 10). When examining expansions in
specific gene families, heat shock protein 90 was expanded in N. albicilla, while Heat
shock protein 20 was expanded in N. melanotragus (Table 4). Nitric oxide synthase
and catalase showed similar number of gene copies across N. melanotragus and N.
albicilla. Other classic stress response genes such as heat shock protein 60, 70 and 90
were also expanded in N. albicilla. Analysis into the ratio of synonymous to non-
synonymous substitutions of these genes within the Nerita species showed patterns of
nucleotide variation consistent with the action of purifying selection (Table 5).
Figure 10. GO Classification of stress related genes for N. melanotragus and N. albicilla.
Table 4. Candidate gene counts. A list of candidate gene counts for Nerita melanotragus, N. albicilla, Crasosstrea gigas and Lottia gigantea.
Gene Count
Nerita melanotragus
Nerita albicilla
Crasosstrea gigas
Lottia gigantea
0 50 100 150 200 250 300
response to biotic stimulus
response to activity
response to abiotic stimulus
detection of stimulus
response to stress
response to external stimulus
response to endogenous stimulus
cellular response to stimulus
immune response
protein activation cascade
positive regulation of response to stimulus
negative regulation of response to stimulus
response to chemical
response to dietary excess
response to heat
Stress Gene GO Term Classification
N. albicilla
N. melanotragus
54
HSP90 (with isoforms)
10
13
3
3
HSP90 (without isoforms)
5
10
3
3
HSP20 (with isoforms)
58
43
17
10
HSP20 (without isoforms)
19
16
17
10 Catalase (with isoforms)
2
2
3
1
Catalase (without isoforms)
2
2
3
1
Nitric oxide synthase (with isoforms)
12
15
5
16 Nitric oxide synthase (without isoforms)
7
8
5
16
Table 4. Synonymous to non-synonymous substitution calculations.A list of synonymous to non-synonymous substitution calculations for select candidate genes.
Annotation Ka Ks Ka/Ks Cellular process
Heat shock protein 90 0.0036 0.0043 0.8381 Response to stress
Heat shock protein 70 0.0044 0.0049 0.9025 Response to stress
Heat shock protein 60 0.0047 0.0060 0.7785 Response to stress
Heat shock protein 20 0.0090 0.0132 0.6835 Response to stress
Catalase 0.0067 0.0082 0.8205 Response to stress
Nitric oxide synthase 0.0077 0.0087 0.8807 Response to stress
Globin 0.0092 0.0128 0.7150 Transport
3.4 DISCUSSION
This study expanded on the currently available genomic resources (Adamson et
al 2015; De Oliveira et al 2016; Ip et al 2016) for Class Gastropoda by describing two
whole organism transcriptomes of the ecologically divergent neritid species, N.
melanotragus and N. albicilla. This data provides the first largely complete
transcriptomes for the highly speciose Neritimorpha lineage of gastropods. Overall,
55
the N50 metrics generated in this study are similar to a recent transcriptome study of
the gastropod Lottia kogamogai (817 bp; De Oliveira et al 2016), but less than that
reported for the intertidal whelk Reishia clavigera (2236 bp; Ip et al 2016). A reason
for the observed difference in N50 between this study and that of Ip et al (2016) could
be the difference between contigs generated. This study generated ~ 150 000 contigs
for both the neritid species, while the study by Ip et al (2016) generated less than 40
000 total transcripts. This study and those of (Adamson et al 2015; De Oliveira et al
2016; Ip et al 2016) had similar BLAST and annotation success. This resource has
allowed us to examine comparative genomic analysis with other mollusc species and
whether lineage specific gene expansions in gene families involved in stress response
had occurred in either species. Changes in gene copy number and over representation
of specific GO classes in unique orthologs in both species may also support the
physiological basis of the ecological differentiation (which intertidal zones they
occupy) observed between the two neritid species.
Comparative analysis of ortholog distribution showed that many genes were
shared among the four mollusc species, but that a larger number were unique to the
two neritid species. This is not surprising as the other two species, C. gigas and L.
gigantea, are quite divergent from the two Nerita species. Furthermore, no evidence
of any stress gene ontologies over represented in genes unique to the Nerita species
were observed. An explanation for this may be that all the species used here are
intertidal and therefore have reasonably similar gene sets, but this remains to be
formally tested.
3.4.1 Comparative copy number analysis of stress genes
Overall, it was found that genes involved in response to stress were expanded in
the low intertidal species compared to the mid intertidal species. This finding did not
support the hypothesis that N. melanotragus should have higher stress gene copy
number as this species is more likely to sustain far longer periods of thermal stress
than N. albicilla. While at first glance this result may appear counter-intuitive, i.e., the
species that receives less exposure to higher temperatures has a larger number of stress
genes expressed under normal conditions. This observed pattern likely results from the
fact that lower intertidal species exhibit thermal stress more quickly than mid to upper
intertidal species at lower temperatures (Tomanek, 2002). Therefore, increased
56
numbers of stress response genes expressed in N. albicilla, may help this species to
cope with acute thermal stress encountered by low intertidal species when exposed at
low tides. Other molecular mechanisms, such as frontloaded expression of stress genes
[Barshis et al., 2013] may be an alternative explanation of why fewer stress response
genes are expressed in N. melanotragus.
Changes in the number of stress response genes within specific gene families
were also observed among N. melanotragus and N. albicilla. Of these gene families,
specific heat shock proteins (HSPs) gene families showed much of the variation. This
diverse family of proteins are known to assist in the repair, folding and translocation
of proteins damaged under various stresses, as well as the folding and translocation of
newly synthesized proteins [Fulda et al., 2010]. In N. albicilla, the largest increases in
HSPs expressed relative to N. melanotragus were those with molecular masses of 60,
70 and 90. These three classes of HSPs have been the most extensively investigated
[Sumizawa and Igisu, 2008; Jurgen et al., 2011; Rupik et al., 2011; Xu and Qin, 2012]
and show facultative expression in response to multiple stressors including thermal
stress [Boone and Vijayan, 2002]. This reinforces the previous finding that increases
in gene copy number of expressed stress related genes may occur in species that exhibit
acute thermal stress rather than those that experience a greater duration of exposure to
stress on a regular basis.
All of the stress response genes that were tested for evidence of selection
including those with changes in gene copy number were found to be under purifying
selection. This result is not surprising as many stress response genes are highly
conserved among metazoan taxa in general [Beck et al., 2000]. In fact, the vast
majority of stress response genes form part of the cellular stress response a universal
molecular mechanism largely conserved across all metazoan lineages (Kültz, 2005) to
maintain cellular homeostasis in organisms. Therefore, it is likely that increased copy
number in lower intertidal species is associated with increased gene expression under
stressful conditions.
3.4.2 Conclusion
The present study corresponds to initial attempts in providing genomic data for
two closely related gastropod species. This study has identified the difference in stress
57
related genes for species inhabiting low and mid intertidal zones under normal living
conditions. Furthermore, results from this study suggest lower intertidal species
express more stress related genes than those from the mid intertidal zone. In addition,
this study presents an ideal foundation for further investigation into stress related gene
expression in intertidal species.
58
Chapter 4: Differential Gene Expression of Two Intertidal Snails in Response to Temperature Stress
4.1 BACKGROUND
Examining how marine mollusc species respond at a genetic and proteomic level
to temporal and spatial changes in their abiotic environments is central to our
understanding of their physiology. Some marine molluscs undergo larval dispersal and
are largely sedentary in their post larval developmental stages [O'Connor et al., 2007].
As a consequence, these organisms need to possess mechanisms to survive and cope
with dynamic and changing environmental conditions. This area is between the low
tide and high tide marks, where organisms are exposed to dramatic fluctuations in a
number of environmental variables such as temperature, pH, salinity, dissolved oxygen
and the availability of food. In fact, recent research has determined that many intertidal
molluscs inhabit areas near the upper range of their thermal limits [Tomanek &
Somero, 1999; Tomanek & Zuzow, 2010] and are particularly vulnerable to thermal
stress. Physiological adaptations, such as the extensive duplication of heatshock
protein 70 and inhibition of apoptosis proteins in the Pacific oyster (Crassostrea gigas)
[Wang et al., 2012] and distinct changes in gene expression profiles or protein
abundance [Wang et al., 2014] have been proposed to allow mollusc species to
withstand the extreme environmental fluctuations present in the intertidal zone. While
this recent research has started to demonstrate how intertidal mollusc species persist
in such stressful environments, more research into the transcriptomic and proteomic
response of other mollusc species is required.
A consistent pattern that has been observed among closely related marine
molluscs is that mid to high intertidal species tend to have higher baseline expression
patterns and protein abundance for candidate stress response genes, where as low
intertidal species showed an induction of these genes under mild thermal stress. Such
a pattern has been observed in closely related marine snail species, Chlorostoma and
in Lottia where baseline levels heat shock protein 70 expression were higher in mid to
high intertidal species. Such a pattern has been found in a wide range of species that
59
display physiological resilience to thermal stress [e.g., Barshis et al, 2013]. In marine
molluscs, however, genome wide patterns of gene expression and protein abundance
have not been compared among closely related species that inhabit different areas of
the intertidal zone under thermal stress.
Nerita albicilla and Nerita melanotragus are widespread intertidal snails,
distributed across a number of temporally and spatially fluctuating environmental
gradients, including latitudinal clines in water temperature and abrupt changes in water
temperature over a tidal cycle. These two species differ in their ecology and geographic
ranges, as N. melanotragus is a mid intertidal species, which ranges from temperate to
subtropical climes, while N. albicilla is a low intertidal species found in tropical and
subtropical regions. While the distribution of these two species marginally overlaps in
subtropical regions, colonisation of different intertidal areas means that one species
(mid intertidal) is more likely to sustain long periods of temperature fluctuation, while
the other (low intertidal) is more frequently subjected to flooding and more buffered
from temperature fluctuation. Consequently, these two species present an interesting
case to examine patterns of differential gene expression and protein abundance when
placed in different thermal environments. Therefore, in this study, the aim was to
examine if N. albicilla (low intertidal species) had a more acute transcriptomic and
proteomic thermal stress response compared to N. melanotragus (mid intertidal
species) under the same temperature conditions.
60
4.2 METHODS
4.2.1 Organism conditioning and treatment
Nine individuals each of N. melanotragus (Figure 1a) and N. albicilla (Figure
1b) were collected from Coolum Beach (Queensland), GPS position: 26°31'42"S,
153°5'26"E. Only snails of 2cm circumference and greater were collected for this
experiment. Snails were allowed to acclimatise for 10 days in a glass tank filled with
seawater (pH: 6.7 salinity: 34%). Algae had developed in the storage tanks and were
readily available for consumption during acclimation. Following this, snails were
placed into three groups, each containing three individuals and placed into one of three
temperature conditions, 14 °C, 22 °C and 31 °C, for each respective species.
Temperatures were raised or lowered from 22 °C to the target temperatures over 1 hr
and organisms were completely submerged in 500 mL beakers containing seawater.
After three hours, organisms were euthanized and foot tissue extracted. Collected
tissue samples were immediately snap frozen in LN2 and stored at -80 °C for RNA
extractions.
4.2.2 RNA extraction and sequencing
Total RNA was extracted from foot tissue using a trizol/chloroform extraction
protocol (Invitrogen), followed by a column based cleanup (Qiagen Midi).
Specifically, each sample was homogenised using LN2, added to 1 ml of Trizol and
allowed to incubate at room temperature for five minutes. Following this, 0.2 ml of
chloroform was added and the mixture was centrifuged at maximum speed (25
200RCF) for 10 minutes. Supernatant was isolated and placed into a mixture of 2 ml
RLT buffer (Qiagen) and 2ml 70% ethanol combined. The samples were then placed
into an RNeasy column for a series of subsequent wash steps as per the RNeasy Midikit
(Qiagen) manufacturer’s instructions. Upon completeion, quality and quantity of RNA
samples were tested on a Bioanalyzer 2100.
Messenger RNA (mRNA) was isolated using the Dynabeads mRNA Purification
Kit (Life Technologies) as per manufacturer’s instructions. Following this, samples
were sent to Beijing Genomics Institute (BGI) for sequencing on an Illumina paired-
end sequencing platform.
61
4.2.3 Assembly and annotation
Raw sequence reads were received as paired-end FastQ files. Raw reads were
concatenated to create combined left and right read files for each respective species.
These combined files were assembled de novo using Trinity software, specifically
chosen for the availability of downstream pipelines (Haas, 2013). Assemblies were
conducted using two minimum contig cut-off lengths for comparison (200 bp & 300
bp) to limit redundancy. Default assembly parameters were used, with the exception
of a –trimmomatic command to enable filtering of raw reads prior to assembly.
Following this, transcriptomes were annotated by referencing them to the NR database
at NCBI as BLASTx queries using an E-value of 10-5. Gene ontology (GO) terms were
retained for mapping and used to create GO maps.
4.2.4 Differential gene expression analysis
The assembled transcriptomes were analysed for differentially expressed genes
using Trinity perl scripts, RSEM and edgeR as per Haas (2013). Specifically, raw reads
from each individual were mapped back to the assembled file for transcript abundance
estimation using RSEM. Following this, differentially expressed transcripts were
identified using edgeR, standard parameters were used with the biological replicates
option. In order to analyse differentially expressed transcripts and create heat maps,
differentially expressed matrix files were analysed using the analyze_diff_expr.pl perl
script and edgeR with a minimum abs fold change of two and p-value cut-off of 0.001.
4.2.5 Orthologous transcript identification
In order to identify orthologous transcripts between differentially expressed
transcripts from each temperature treatment for respective species, ProteinOrtho was
used. Files containing nucleotide sequences of differentially expressed genes were
translated to amino acid sequence using EMBOSS TranSeq. Files containing amino
acid sequences were then entered into Proteinortho for ortholog identification using a
hit similarity threshold of 88%.
4.2.6 Proteome analysis
A total of 25 samples each of N. melanotragus and N. albicilla were collected
from Coolum Beach (Queensland), GPS position: 26°31'42"S, 153°5'26"E. Organisms
size and acclimation conditions were as above. Snails were placed into groups of five
62
and assigned to one of five temperature settings, 14 °C, 22 °C, 31 °C, 38 °C and 45 °C
for each species. Temperatures were gradually raised or lowered from 22 °C to the
target temperatures over 1 hr and organisms were completely submerged in beakers
containing seawater. After 3 hours, organisms were euthanized and foot tissue was
extracted. Collected tissue samples were immediately snap frozen in LN2 and stored
at -80 °C. Following this, foot tissue was homogenized in LN2 and proteins extracted
as per Wisniewski et al., [2009] with the following modifications. Samples were
physically disrupted in extraction buffer containing protease (Thermo) and
phosphatase (Pierce) inhibitor cocktails (150 µL per 25 mg) using 18 gauge blunt
ended needles (Terumo) due to high sample viscosity. Protein concentration of each
sample was estimated using a Bradford assay kit according to the manufacturer’s
instructions (Pierce) and visualised using colloidal Coomassie following SDS-PAGE,
with pre-cast Novex NuPAGE 4-12% Bis-Tris 1 mm gradient gels run under
manufacturer’s recommendations (Life Technologies).
The supernatant of homogenised tissue was added to the filter of 3 kDa
ultracentrifugation tubes along with 200 µL of 8 M urea (Sigma, U5128) in 0.1 M
Tris/HCl, pH 8.5, 0.025 M DTT (UA buffer), allowed to stand at RT for 60 min and
then spun at 14,000 x g for 15 min. Cysteine alkylation was performed with 100 µL of
0.05 M iodoacetamide in UA buffer for 20 min in the dark prior to centrifugation at
14,000 x g for 10 min. Subsequent washing was performed with UA buffer (x3) and
0.05 M triethylammonium bicarbonate (TEAB) (x3) and centrifuged at 14,000 x g for
15 and 10 min, respectively. An aliquot of 40 µL trypsin (1:100 enzyme to protein
ratio) was added to the filter and incubated in a humidified chamber for 18 hours.
Peptides were collected into fresh tubes via 2 centrifugation steps at 14,000 x g for 10
min with 40 µL TEAB added in the latter. Peptides were acidified with formic acid to
a final concentration of 0.1%.
An aliquot from each temperature group was pooled with its respective replicates
and proteins were separated by isoelectric point across a 24 cm non-linear pH 3-10
immobilised pH gradient gel (GE) using an 3100 OFFGel fractionator (Agilent) as per
manufacturer’s instructions. Each fraction and whole samples were subsequently
digested using the filter-aided sample preparation technique [Wisniewski et al., 2009]
using 30 kDa NMW cut-off filters (Millipore). Peptides were de-salted using stage-
63
tips prepared in-house [Rappsilber et al., 2007]. Data dependent acquisition (DDA)
was performed on the fractions and a representative un-fractioned sample using a
TripleTOF 5600+ mass spectrometer (Sciex) coupled with an Ekspert nanoLC 400
system (Eksigent). Peptides were washed on a C18 trap column (ChromXP 150 µm x
10 cm 3 µm, Eksigent) and then separated using a 90 min gradient (Buffer A = 0.1%
formic acid, 2% acetonitrile; Buffer B = 80% acetonitrile in 0.1% formic acid; 2-40%
Buffer B in 60 min, 40-95% Buffer B over 10 min, 95% Buffer B for 10 min before
re-equilibration in Buffer A for 10 min) on a C18 resolving column (ChromXP 150
µm x 10 cm 3 µm, Eksigent) prior to electrospray ionisation. Mass spectrometry data
were acquired using a looping cycle of single MS1 scan between 350-1350 m/z
followed by up to 40 MS2 scans between 100-1250 m/z with a dynamic exclusion
window of 10 sec. Data independent acquisition (DIA) was performed on the whole
samples only using the same system and gradient above, except with 100 variable
SWATH windows.
Raw DDA data were queried in ProteinPilot (Sciex) employing the Paragon
algorithm (Sciex) against custom protein databases, which were generated using batch
extracted and translated open-reading frames from both assemblies with TransDecoder
[Haas et al., 2013]. Amino acid substitutions and modifications were included and a
False Discovery Rate (FDR) was calculated using a forward-reverse database search.
Identification of proteins was based on a 1% global FDR and the detection of ≥ two
distinct peptides per protein.
4.3 RESULTS
4.3.1 Sequencing, assembly and annotation
Transcriptome sequencing of mRNA from N. melanotragus and N. albicilla on
the Illumina sequencing platform produced an average of 15 million raw paired end
reads, per sample. Raw sequence reads were filtered and data failing to meet quality
criteria (Q < 20, N bases < 1%) was excluded, but on average greater than 97% of high
quality reads were retained per sample.
High quality reads from N. melanotragus and N. albicilla were assembled into
268,819 and 239,421 contigs respectively using Trinity software. The assembled
64
contigs from the respective species produced a longest contig of 14,653 bp and 15,413
bp. The N50 statistic for N. melanotragus and N. albicilla were similar at 1,159 and
1,160.
Of the 268,818 and 239,420 contigs referenced against the NR database at NCBI
using BLAST+ software, 41,753 (15.53%) and 39,637 (16.55%) received hits with
greater than the specified E-value stringency of 10-5, for Nerita melanotragus and N.
albicilla respectively. GO terms categorisation revealed highest abundance of genes
in cell, cell part and catalytic categories for both species (Figure s4).
Figure S 4. Gene ontology (GO) functional classification. Distribution of all annotated contigs for N. melanotragus and N. albicilla.
4.3.2 Differential gene expression changes under temperature treatments
A total of 131 and 22 genes were differentially expressed with a FDR cut-off of
0.001 for Nerita melanotragus and N. albicilla, respectively. Specifically, at 14 °C, 22
°C and 31 °C respectively, 61, 68 and 63 genes were up-regulated in Nerita
65
melanotragus and a total of 5, 7 and 17 genes were up-regulated in N. albicilla. A
comparison of the gene ontologies present in the differentially expressed genes for N.
melanotragus and N. albicilla revealed a broadly similar overall presence of GO terms.
Some GO categories were overabundant in one species and these were translation
regulator, death and viral reproduction in Nerita albicilla (Figure 11) and envelope,
virion, virion part, structural molecule, transcriptional regulator, transporter, biological
adhesion and rhythmic process in N. melanotragus.
Figure 11. WEGO plot for differentially expressed genes of N. melanotragus and N. albicilla.
BLASTx analysis of these genes revealed biological functions for 53 of 131
differentially expressed genes for Nerita melanotragus and 17 of 22 for N. albicilla.
Therefore, whilst most genes in N. albicilla were able to be assigned putative functions
(77.2%), only 40.5% of the genes from N. melanotragus returned BLASTX results
and/or domains results that made it possible to identify the possible function of the
predicted proteins. For a full list of all the genes that show differential expression
profiles, the name of their top BLAST hit and their putative functions please see Table
6 and 7.
66
Table 5. Mean expression values for N. melanotragus differentially expressed genes under different temperature treatments.
Contig description Probable function(s) 14°C 22°C 31°C
---NA--- N/A 1.498583 2.913832 -1.36515
---NA--- N/A -2.09959 2.588479 -0.48889
---NA--- N/A -1.00375 0.941993 0.061759
---NA--- N/A -0.75334 -0.75334 1.506684
tetratricopeptide repeat
protein 8
Probable role in signal transduction via
primary cilia, possibly related to
sight/smell senses or kidney chemical
sensing.
0.310041 1.227388 -1.53743
tetratricopeptide repeat
protein 8
Probable role in signal transduction via
primary cilia, possibly related to
sight/smell senses or kidney chemical
sensing.
1.648767 0.205366 -1.85413
---NA--- N/A -0.92598 1.851968 -0.92598
---NA--- N/A -2.95539 1.827476 1.127917
---NA--- N/A -0.53241 -1.79825 2.330661
sco-spondin precursor Probable involvement in neural axon
structuring.
1.049608 -0.83834 -0.21127
wd repeat-containing protein
87
Possible involvement in signal
transduction related to cell cycle and
apoptosis regulation.
1.209321 -1.00288 -0.20645
---NA--- N/A 0.152571 1.694429 -1.847
---NA--- N/A 1.910321 -1.26962 -0.6407
tar dna-binding protein 43-
like
Probable role in transcriptional repression
of certain genes, alternative splicing,
recruitment of mRNA into ribosomes,
and/or miRNA biogenesis. This particular
protein has a possible focus on neural cells
and/or relation to stress granule formation.
-0.72221 0.941615 -0.2194
transmembrane protein 164 Molecule signalling/transport 0.495679 -0.68357 0.187888
transmembrane protein 164 Molecule signalling/transport 1.551974 -1.23453 -0.31745
---NA--- N/A -0.19089 -1.00974 1.200629
---NA--- N/A 0.786183 0.514089 -1.30027
electroneutral sodium
bicarbonate exchanger 1-like
Probable role in pH regulation by
bicarbonate regulation, possible focus on
neurons specifically.
0.771589 -0.19295 -0.57863
67
zinc finger fyve domain-
containing protein 26
Probable role in regulating abscission
during cytokinesis, possible role in DNA
break repair.
-0.4681 1.504489 -1.03639
---NA--- N/A -0.86811 -0.01672 0.884827
peregrin-like protein dorsal/ventral axon guidance -2.08523 0.74095 1.344282
---NA--- N/A -1.50362 1.802018 -0.2984
c16orf52 homolog b Probable role in the movement of
organelles and other intracellular objects
and/or role in cilia/flagella motility.
1.704829 -1.73112 0.026295
c16orf52 homolog b Probable role in the movement of
organelles and other intracellular objects
and/or role in cilia/flagella motility.
-1.4657 0.969876 0.49582
dynein heavy chain
axonemal
Probable role in the uptake and/or removal
of substrates for cellular activity.
0.141787 -0.93798 0.796197
uncharacterized transporter -
like
Probable role in the uptake and/or removal
of substrates for cellular activity.
0.767624 -0.78974 0.022117
cyclin-dependent kinase-like
2
Probable role in modulating dynein
proteins to enable cilia/flagella motility.
-1.57109 1.30349 0.267599
coiled-coil domain-
containing protein c16orf93
homolog
Probable role in maintaining the structural
organisation of cilia.
-0.95818 0.594478 0.363703
enolase-like protein eno4 N/A -1.20317 -0.59012 1.793288
---NA--- N/A -0.91968 -0.91968 1.839367
---NA--- Probable role in nuclear import of
ribosomal proteins for ribosome synthesis,
histones for DNA formation, and/or
transcriptional regulators.
-1.22457 0.520842 0.703732
importin-7 Ran-dependent transport cycle 2.602112 -1.01921 -1.5829
---NA--- N/A 0.928927 -1.14942 0.22049
---NA--- N/A -2.79042 2.217037 0.573384
---NA--- Probable role in eventual formation of
nitric oxide and/or neurotransmitters such
as dopamine or serotonin.
0.397061 0.734933 -1.13199
gtp cyclohydrolase 1 hydrolysis of guanosine
triphosphate (GTP)
0.025557 -1.32752 1.301963
---NA--- N/A -0.12553 -0.95228 1.077806
---NA--- N/A -2.86374 5.305254 -2.44152
---NA--- N/A 1.358908 -2.38264 1.02373
68
---NA--- Probable role as a transcriptional regulator
for certain genes, possibly associated with
the cell cycle and apoptosis.
-1.17385 -0.28607 1.459914
thap domain-containing
protein 4
Probable role as an apoptotic regulator 1.40605 -1.93739 0.531339
---NA--- N/A -1.33766 1.649973 -0.31231
---NA--- N/A 0.741576 -1.41762 0.676049
hypothetical protein
LOTGIDRAFT_232099
N/A -2.25993 0.395171 1.864757
---NA--- N/A 0.972101 -0.66456 -0.30754
protein arrd- isoform b N/A -0.88837 0.860892 0.027482
protein arrd- isoform b N/A -0.96505 0.96305 0.001995
---NA--- N/A -1.15856 -2.49996 3.658517
---NA--- N/A 1.799665 -0.32581 -1.47386
---NA--- N/A -1.76184 0.641936 1.119899
---NA--- N/A 1.571831 0.068855 -1.64069
---NA--- N/A -1.17244 1.580824 -0.40838
kinesin-related protein 1 Cellular function support 0.961943 -0.88881 -0.07313
kat8 regulatory nsl complex
subunit 1
Probable role in transcriptional activation -2.41931 0.513858 1.905452
tripartite motif-containing
protein 2
Probable role in host defense transcription
activation
-0.51674 -2.73753 3.254271
---NA--- N/A 0.406376 0.935107 -1.34148
hypothetical protein
HPF30_0708
N/A -0.3718 -0.91216 1.28396
hypothetical protein
HPF32_0596
SLIT/ROBO transcriptional activator,
possible involvement in neuron axon
regulation, cell cycle regulation, and/or
actin cytoskeleton organisation. Exact
function is uncertain.
1.088905 -0.83779 -0.25112
slit-robo rho gtpase-
activating protein 1
Mediate cell communication -1.51207 1.755028 -0.24296
sarcoplasmic reticulum
histidine-rich calcium-
binding
Probable role in regulation of the septin
filaments of the cytoskeleton in
ciliogenesis and collective cell migration.
1.201298 -0.25639 -0.94491
wd repeat-containing and
planar cell polarity effector
protein fritz homolog
Probable role in DNA repair, signalling
pathways, and/or transcription and
translational regulation.
0.794859 2.095552 -2.89041
69
heterogeneous nuclear
ribonucleoprotein a1-like
Probable role in maintaining the structural
organisation of cilia.
-1.33905 0.97899 0.36006
intraflagellar transport
protein 88 homolog
Probable role in transcriptional regulation
via chromatin remodelling, possibly
neuron focused role.
-0.00894 -0.88358 0.892519
swi snf complex subunit
smarcc2 isoform x3
Probable transcription factor binding
domain
-1.1036 0.560214 0.543391
tpr repeat-containing protein
ddb_g0287407-like
Probable role in neural signalling and/or
signal transduction pathways involving G-
protein coupled receptors.
-0.54238 0.791001 -0.24862
calcium-activated potassium
channel slowpoke-like
Negative regulator of TGF-beta pathway,
possible role in cell cycle regulation,
motility, and/or apoptosis.
0.070542 0.974957 -1.0455
ski oncogene Negative regulator of TGF-beta pathway,
possible role in cell cycle regulation,
motility, and/or apoptosis.
0.617868 1.20275 -1.82062
ski oncogene Probable role in cell cycle regulation via
the degradation of G1 cyclins and Cdk
inhibitors.
0.618962 -0.1415 -0.47747
f-box wd repeat-containing
protein 7
Probable role in cell cycle regulation via
ubiquitin-mediated degradation.
-0.47076 1.631734 -1.16097
---NA--- Probable role in mitochondrial
homeostasis and apoptosis.
0.644007 -0.6113 -0.0327
leucine-rich repeat serine
threonine-protein kinase 1
Probable involvement in the anchoring of
proteins into the cellular membrane.
-0.62762 -0.62762 1.255248
fer3-like protein Probable function in cell development -1.56726 1.01173 0.555525
hypothetical protein
CGI_10007431
Probable role in the removal of phosphate
groups from nucleosides, possibly for
nutritional purposes.
1.509177 -0.53581 -0.97337
5 -nucleotidase Frizzled-type receptor protein involved in
Wnt signalling pathway, possibly involved
in ciliogenesis.
1.604721 -1.32599 -0.27873
frizzled homolog 7b Possible involvement in signal
transduction related to cell cycle and
apoptosis regulation.
-0.58024 -0.58455 1.164783
dmx-like protein 2-like Probable role in Notch signalling pathway 0.284347 0.750848 -1.0352
zinc finger protein Molecule binding -1.78057 2.601294 -0.82073
u6 snrna-associated sm-like
protein lsm6
Probable role in pre-mRNA splicing 0.737259 -0.93816 0.200898
70
pre-mrna-splicing regulator
female-lethal d
Rab GTPase pathway activator, probably
involved in resulting intracellular
transport of vesicles along the
cytoskeleton.
0.477878 0.221834 -0.69971
small g protein signaling
modulator 1
Possible involvement in ciliary
organisation and function, though
uncertainty exists regarding this protein’s
function.
-1.14507 1.281308 -0.13624
leucine-rich repeat-
containing protein 48-like
Probable involvement in the anchoring of
proteins into the cellular membrane.
1.061098 1.027505 -2.0886
cadherin-23 isoform x1 Probable involvement in the incorporation
of histones H3 and H4 into new DNA or
DNA under repair.
2.151927 -1.46405 -0.68787
probable histone-binding
protein caf1-like
Probable role in DNA binding 1.089292 -1.38529 0.296
---NA--- N/A -2.56225 2.658204 -0.09596
---NA--- N/A -0.86644 0.785913 0.080524
---NA--- Probably involvement in the breakdown of
fatty acids for energy.
-1.03298 1.227206 -0.19423
3-ketoacyl- mitochondrial Probable role in RNA binding -0.99933 0.572135 0.427198
leucine-rich repeat-
containing protein 9-like
Probable involvement in the anchoring of
proteins into the cellular membrane.
-0.27596 1.322998 -1.04704
caax prenyl protease 2-like Probable involvement in the anchoring of
proteins into the cellular membrane.
-0.5213 0.488286 1.268568
caax prenyl protease 2-like Probable involvement in the anchoring of
proteins into the cellular membrane.
0.977371 -0.89009 -0.08728
farnesyl pyrophosphate
synthase-like
Possibly involvement in transcriptional
regulation of the Wnt signalling pathway
(such as that involved in c151559_g1_i3).
0.840878 -0.61403 -0.22684
mediator of rna polymerase
ii transcription subunit 12-
like protein
Probable transcription coactivator -0.6969 -0.36525 1.062149
---NA--- Probable role in the uptake and/or removal
of substrates for cellular activity,
otherwise uncertain role.
-0.5158 -0.85558 1.371381
solute carrier family 45
member 3-like isoform x1
Transmembrane transportation -1.25549 1.007915 0.247571
71
---NA--- Probable stress response role, possible
involvement in actin cytoskeleton
regulation.
1.19628 -0.59814 -0.59814
serine threonine-protein
kinase osr1-like
Probable role in phosphorylation -1.22247 0.593551 0.628921
zinc finger protein 318 Molecule binding 0.048031 -0.76392 0.715891
e3 ubiquitin-protein ligase
dtx4
Probable component of nuclear pores,
structures involved in the transport of
proteins and RNA in and out of the
nucleus and retention of immature mRNa.
1.089058 0.217575 -1.30663
nuclear pore complex
protein nup153-like
Probable involvement in
absorbtion/reabsorbtion of sugars in the
intestines and/or kidneys.
-0.06958 1.389346 -1.31976
sodium glucose
cotransporter 4
Possible involvement in the attachment of
cells to one another and/or to the
extracellular matrix.
1.019557 -0.74725 -0.27231
notch gene homolog 3-like Possible involvement in signal
transduction related to cell cycle and
apoptosis regulation, possible involvement
in platelet formation.
-1.18616 0.281792 0.904363
wd repeat-containing protein
66
Rab GTPase pathway activator, probably
involved in resulting intracellular
transport of vesicles along the
cytoskeleton.
-0.52416 -0.52416 1.048328
tbc1 domain family member
24-like isoform 1
Probale role in GTPase signalling -0.50646 0.633157 -0.12669
deubiquitinating protein
vcip135
Protease involved in ubiquitin cleaving -1.506 1.474988 0.031013
---NA--- N/A -0.69151 1.383025 -0.69151
---NA--- N/A 0.019061 0.841447 -0.86051
flocculation protein flo11-
like
Possible role in cell-cell adhesion -1.16424 0.802226 0.362013
PREDICTED:
uncharacterized protein
LOC101845475
Probable involvement in the transport of
ornithine into the inner mitochondrial
matrix as part of the urea cycle.
-0.08926 -0.78372 0.872986
PREDICTED:
uncharacterized protein
LOC101845475
Probable involvement in the transport of
ornithine into the inner mitochondrial
matrix as part of the urea cycle.
0.309428 -0.96577 0.656337
72
mitochondrial ornithine
transporter
Probable role in cell transport 1.602121 -0.23944 -1.36268
---NA--- N/A 1.084683 1.038366 -2.12305
---NA--- Probable involvement in inhibition of
apoptosis.
0.930956 -0.65659 -0.27437
---NA--- N/A 0.549234 -1.07695 0.527719
---NA--- Probable involvement in recognition of
mRNA with nonsense mutations leading
to subsequent degradation.
0.318546 0.686917 -1.00546
regulator of nonsense
transcripts 2-like
Probable involvement in the transport of
materials across the cell membrane.
-1.30069 0.623101 0.677586
copine-8 Probable involvement in the proper
functioning of lysosomes.
1.607827 -0.65992 -0.9479
lysosome membrane protein
2-like
Probable role in cell regulation 0.560005 -0.81783 0.257822
receptor-type tyrosine-
protein phosphatase mu-like
Probable role in regulation of cellular
processes as signalling molecules
1.081427 -0.93349 -0.14794
receptor-type tyrosine-
protein phosphatase t
Probable role in regulation of cellular
processes as signalling molecules
0.35996 -1.43062 1.070665
ankyrin repeat and sam
domain-containing protein
1a isoform x7
Probable role in protein-protein mediation -1.60627 1.744439 -0.13817
---NA--- N/A -0.82104 1.135895 -0.31486
microprocessor complex
subunit dgcr8-like
Required for miRNA processing 0.851314 -1.79653 0.945214
---NA--- N/A 1.266738 -1.55975 0.293014
---NA--- N/A 1.509309 -0.44546 -1.06385
---NA--- Probable pro and/or anti-apoptosis
functionality.
1.650166 -0.36384 -1.28632
baculoviral iap repeat-
containing protein 7
Probable role in transferring of ubiquitin
to proteins for subsequent degradation.
-0.29789 -1.35421 1.652098
protein rmd5 homolog a-like Probable role in the recognition of
destabilising proteins, resulting in
ubiquitination and degradation.
-0.36677 1.48637 -1.1196
e3 ubiquitin-protein ligase
ubr4
Cellular cytoskeleton organising protein -1.14482 0.449571 0.695247
spectrin beta brain 4 Probable role in homeostasis 1.027521 0.789944 -0.04839
---NA--- N/A -0.98688 1.035267 -0.04839
73
Table 6. Mean expression values for N. albicilla differentially expressed genes under different temperature treatments.
Contig description Probable function(s) 14°C 22°C 31°C
coup transcription factor 2
isoform x3
Probable function in development 2.272 3.519
-2.896
heat shock protein Probable involvement in the preventation of
protein denaturation and aggregation.
-1.667 1.357 2.881
serine threonine-protein
phosphatase 2a 56 kda
regulatory subunit delta
isoform
Serine/threonine-protein phosphatase,
possible involvement in cell cycle regulation
and/or cell upkeep.
-1.902 1.295
2.511
cugbp elav-like family member
2-like
Possible involvement in the regulation of
alternative splicing, as well as in maintaining
stability and promoting translation of mRNA
transcripts.
1.4501 -2.889 1.439
78 kda glucose-regulated
protein
Possibly located in the ER and involved in
protein folding and the prevention of
damaged proteins leaving the ER.
-1.743 4.817 2.379
heat shock protein beta-1-like
isoform 1
Probable involvement in the prevention of
protein denaturation and aggregation.
-2.004 3.437 3.482
---NA--- ---NA--- -2.63636 5.730 4.178
mitogen-activated protein
kinase kinase kinase 9
Tyrosine protein kinase, possible involvement
in cell cycle regulation, cell upkeep, and/or
cell motility.
-2.009 2.504 1.515
heat shock protein 90 Probable involvement in protein folding and
refolding of damaged proteins, with possible
focus on protein kinases and steroid hormone
receptors.
-1.501 7.496 2.201
eukaryotic translation initiation
factor 4h
Possible involvement in the recruitment of
mRNA transcripts into ribosomes, generally
increases the rate of transcript translation.
0.293 3.369 -1.831
protein furry-like Probable regulation of the actin cytoskeleton
structure.
-1.253 3.760 -1.253
heat shock protein 70 Possibly located in the ER and involved in
protein folding and the prevention of
damaged proteins leaving the ER.
-3.445 4.047 5.017
74
heat shock protein 70 Possibly located in the ER and involved in
protein folding and the prevention of
damaged proteins leaving the ER.
-3.814 3.103 5.688
transmembrane and coiled-coil
domains protein 1
Probable functions in endoplasmic reticulum -1.637 0.991 2.283
leucine-rich repeats and
calponin homology domain
containing 3
Probable regulation of the actin cytoskeleton
structure.
2.344 -0.490 -1.854
hypothetical protein
LOTGIDRAFT_159013
---NA--- -0.837 -1.688 2.525
lim domain-binding protein 3 Potential role in neurone development -1.344 -0.564 1.908
nitric oxide synthase Probable production of nitric oxide, possible
involvement in neural signalling or
neuroendocrine stress response.
-0.623 -2.082 2.706
nitric oxide synthase Probable production of nitric oxide, possible
involvement in neural signalling or
neuroendocrine stress response.
0.933 4.725 -2.829
rho guanine nucleotide
exchange factor 17
Probable activator of RhoA GTPase, possible
downstream resulting stress fibre formation
and actin cytoskeleton regulation.
-2.257 1.905 0.352
fras1-related extracellular
matrix protein 2-like isoform
x2
Possible involvement in basement membrane
structure and function.
-2.008 -0.473 2.482
polyketide synthase Probable involvement in polyketide synthesis.
The polyketide’s function is unknown.
-2.187 0.547 1.640
Expression values of differentially expressed genes revealed differing patterns
for the two Nerita species particularly at the highest temperature treatment (31 °C).
The higher temperature treatment for Nerita melanotragus primarily reveals up-
regulation of transport, signalling and transcriptional regulatory genes and the down
regulation of genes involved in apoptosis and sensory functions. Of the differentially
expressed genes showing up-regulation at the 31 °C treatment, five are involved in
cellular transport, four are involved in transcription related functions, one in cell
signalling and eight with unknown functions. In contrast, majority of differentially
expressed genes in Nerita albicilla were molecular chaperones of different molecular
weight. In fact, of the 13 genes found to only be up-regulated at 31 °C, six were
75
molecular chaperones and three were transcripts encoding heats shock protein 70. Of
the genes up-regulated in the 31 °C treatment, none were found in common between
the species.
4.3.3 Frontloading of HSP Genes
Of the seven heat shock proteins found to be differentially expressed in Nerita
albicilla only six had clear orthologs in N. melanotragus. Two of the heat shock protein
70 transcripts had the same ortholog in N. melanotragus, which meant only five unique
comparisons could be made. Of the five heat shock protein genes in common between
the species, there was little evidence of frontloading in three (Table 8). The three heat
shock proteins to show front loading were both N. albicilla heat shock protein 70
transcripts with the same ortholog in N. melanotragus and heat shock protein Beta in
N. albicilla (Table 8).
Table 7 Mean baseline expression of eat shock protein in Nerita melanotragus and N. albicilla.
Gene Nerita melanotragus Nerita albicilla
heat shock protein 1.538 1.356
78 kda glucose-regulated
protein
5.739 4.817
heat shock protein beta-1-
like isoform 1
1.499 3.437
heat shock protein 90 7.083 7.496
heat shock protein 70 1.103 4.047
4.3.4 Differential protein abundance under temperature stress
A total of 80 and 109 proteins showed differential abundance in Nerita
melanotragus and N. albicilla respectively. BLASTp analysis of these genes revealed
biological functions for 75 of 80 proteins in Nerita melanotragus and 103 of 109 for
N. albicilla. Proteins assigned with GO terms were compared between species (Figure
S5). For a full list of all the proteins that show differential abundance profiles, the
name of their top BLAST hit and their putative functions please see Table 9 and 10.
76
Table 8. List of proteins that show differential expression profiles, the name of their top BLAST hit and their putative functions for N. melanotragus.
Protein Description Probable function(s)
---NA--- N/A
sarcoplasmic calcium-binding
proteins and iv-like
Intracellular storage and release of calcium
from the sacroplasmic reticulum.
macpf domain-containing protein
4
Probable roles in immunity.
micos complex subunit mic10 Associated with the formation and
maintainence of mitochondrial cristae.
peptidoglycan binding domain-
containing protein
Peptidoglycan binding function.
protein crumbs partial Probable role in epithelial integrity.
deleted in malignant brain tumors
1 protein
Probable role in immunity.
transcription factor btf3 homolog
4
Probable role in transcriptional initiation. This
particular protein forms a stable complex with
RNA polymerase.
---NA--- N/A
---NA--- N/A
protein 1 N/A
peptidase m20 domain-containing
protein 2
Probable role in the regulation of cellular
proteins.
choline acetyltransferase Involved in the synthesis pathway of the
neurotransmitter aceytlcholine
vwa domain-containing protein Proabable functions in blood.
---NA--- N/A
williams-beuren syndrome
chromosomal region 27
N/A
signal transduction protein Functions in cell signal transduction. These
particular proteins have possible roles in
stress response.
77
coiled-coil-helix-coiled-coil-helix
domain-containing protein 2
Probable functions in stress response.
calmodulin-like protein 5 isoform
x1
Involved in calcium binding. Probable role in
stress response.
deleted in malignant brain tumors
1
Probable role in immunity.
ef-hand domain-containing
protein d2
Calcium binding protein. Probable role in
calcium regulation.
perlucin-like isoform x1 N/A
transmembrane emp24 domain-
containing protein 7
Probable functions in plasma membrane and
vesicular protein trafficking.
protein pif-like N/A
---NA--- N/A
ribonucleoprotein ptb-binding 2 Probable role in nucleotide binding.
multifunctional methyltransferase
subunit trm112-like protein
Functions in methylation of protein and tRNA
species.
chromobox protein homolog 1-
like
Functions in inner nuclear membrane.
chloride intracellular channel
protein 5-like
Probable function as chloride transporter.
universal stress protein a-like
protein
Probable functions in stress response.
sentrin-specific protease 8 Probable role in endopeptidase activity.
macpf domain-containing protein
4
Probable role in immunity.
metal binding protein Possible role in storage and transport of
proteins.
sushi domain-containing protein 2 Probable role in immunity.
sarcoplasmic calcium-binding
proteins and vii-like
Probable role in movement.
regucalcin Probable role in calcium homeostasis.
78
inter-alpha-trypsin inhibitor heavy
chain h4 isoform x4
Probable role in response to inflammation.
transforming growth factor-beta-
induced protein ig-h3-like
Probable role in cell adhesion.
cathepsin l1-like Plays a role in intracellular protein
catabolism.
---NA--- N/A
ump-cmp kinase mitochondrial Possible involvement in mtDNA depletion.
thap domain-containing protein 4 Probable role as an apoptotic regulator
retinoid-inducible serine
carboxypeptidase
Possible involvement in vascular wall and
kidney homeostasis.
clathrin light chain b-like isoform
x2
Probable role in peptide binding.
methylcrotonoyl- carboxylase
beta mitochondrial-like
Possible function in acid catabolism.
collagen alpha-2 chain Involved in extracellular matrix structure.
death-associated protein 1 Probable function as a cell death mediator.
low quality protein: sco-spondin Probable involvement in neural axon
structuring.
nucleolysin tiar-like isoform x4 RNA binding protein.
ribonuclease uk114 Possible involvement in mRNA cleaving.
glycerol-3-phosphate
mitochondrial-like isoform x1
Probable role in calcium binding.
tyrosine aminotransferase-like Probable function in tyrosine breakdown.
adp-ribose mitochondrial Probable role in modulating mitochondrial
activity.
apextrin-like protein Possible function in bacterial recognition.
programmed cell death protein 6-
like isoform x2
Probable function in programmed cell death.
deleted in malignant brain tumors
1
Probable role in immunity.
79
PREDICTED: uncharacterized
protein LOC101862525
N/A
deleted in malignant brain tumors
1 protein
Probable role in immunity.
beta-arrestin-1-like isoform x1 Probable functions in regulating agonist-
mediated G-protein coupled receptor.
c-binding protein Possible roles in RNA binding.
cleavage and polyadenylation
specificity factor subunit 6
Probable role in mRNA processing.
universal stress protein sll1388-
like isoform x1
Probable functions in stress response.
sorting nexin-12 Probable roles in membrane association.
microtubule-associated protein
tau-like isoform x7
Possible promoter of microtuble assembly and
stability.
carnitine o-acetyltransferase Possible function as an acetyl-CoA
transporter.
integrin alpha-4 Possible involvement in ligand binding.
ras-related c3 botulinum toxin
substrate 1
Functions in enzyme binding.
coatomer subunit beta partial Probable function in protein transport.
carnosine synthase 1 Probable role as a catalyst.
fibrillin-2-like Probable function as a regulator of elastic
fiber assembly.
choline transporter-like protein 2 Probable role as a choline transporter.
fibrillin-2-like Probable function as a regulator of elastic
fiber assembly.
cytochrome p450 family Probable function in the metabolization of
toxic compounds. Possible role in stress
response.
aspartate--trna cytoplasmic Probable role as a catalyst.
vacuolar protein sorting-
associated protein 13c isoform x3
Probable function in mitochondrial function.
Possible involvement in protein transport.
80
PREDICTED: uncharacterized
protein LOC105325083
N/A
trichohyalin-like isoform x2 Possible role in the organisation of the cell
envelope.
calmodulin-like protein 5 Involved in calcium binding. Probable role in
stress response.
rhomboid-related protein 2-like Probable involvement in regulated
intramembrane proteolysis
Table 9. List of proteins that show differential expression profiles, the name of their top BLAST hit and their putative functions for N. albicilla.
Protein Description Probable function(s)
low-density lipoprotein
receptor-related protein 5-like
Probable role in skeletal homeostasis
---NA--- ---NA---
serine threonine-protein
phosphatase 2a 56 kda
regulatory subunit epsilon
isoform
Probable involvement in the anchoring of
proteins into the cellular membrane.
PREDICTED: uncharacterized
protein LOC106876016
---NA---
3-ketoacyl- mitochondrial Probable role in lipid metabolism.
coronin-2b-like isoform x2 Possible role in vesicular transportation.
tyrosine--trna cytoplasmic Possible role in RNA binding
---NA--- ---NA---
---NA--- ---NA---
lambda-crystallin homolog Probable role in fatty acid metabolism.
PREDICTED: uncharacterized
protein LOC106078900
---NA---
collagen alpha-1 chain-like Probable role in the strengthening and support of
cartilage, bone, tendon and skin
---NA--- ---NA---
81
calcium calmodulin-dependent
protein kinase type 1-like
Probable role In the regulation of transcription
activators.
---NA--- ---NA---
uv excision repair protein
rad23 homolog b
Probable role in global genome nucleotide
excision repair.
endoglucanase 4-like isoform
x2
Probable function in cellulose activity.
---NA--- ---NA---
nadh dehydrogenase Involved in mitochondrial electron transport.
Possible functions in response to stress.
catenin delta-1-like isoform x7 Probable role in cell adhesion. Binds to and
inhibits the transcriptional repressor ZBTB33.
legumain Probable function as a catalyst.
hypothetical protein
LOTGIDRAFT_232799
---NA---
regucalcin Probable role in calcium uptake and
homeostasis.
---NA--- ---NA---
cysteine-rich secretory protein
2-like
Possible role in ion channel regulation.
titin- partial Probable role in stabilizing filaments.
PREDICTED: raftlin-like May play a pivotal role in the formation and/or
maintenance of lipid rafts
l-galactose dehydrogenase-like Possible role in catalyzing the oxidation of L-
galactose to L-galactono-1,4-lactone in the
presence of NAD
hydroxyacid-oxoacid
mitochondrial
Probable role in molecular hydrogen transport
---NA--- ---NA---
---NA--- ---NA---
hypothetical protein
LOTGIDRAFT_229978
---NA---
82
tryptophan -dioxygenase-like Probable role in the protein synthesis.
---NA--- ---NA---
epidermal growth factor
receptor kinase substrate 8-like
protein 2 isoform x1
Probable function as an actin
cytoskeleton regulator.
---NA--- ---NA---
epimerase family protein
sdr39u1
---NA---
upf0047 protein ---NA---
---NA--- ---NA---
proteasome subunit alpha type-
7-like
Probable involvement in the proteolytic
degradation of most intracellular proteins.
caveolin-1-like Probable function as a scaffolding protein within
caveolar membranes.
uncharacterized oxidoreductase Possible functions in phosphogluconate
dehydrogenase (decarboxylating) activity.
eukaryotic translation initiation
factor 3 subunit f-like
Probable function in the initiation of protein
synthesis.
dnaj homolog subfamily c
member 10-like
Probable involvement in both the correct folding
of proteins and degradation of misfolded
proteins.\
fibril-forming collagen alpha
chain-like
Functions in extracellular matrix as a
key structural protein.
fibril-forming collagen alpha
chain-like
Functions in extracellular matrix as a
key structural protein.
heat shock protein 70 Possibly located in the ER and involved in
protein folding and the prevention of damaged
proteins leaving the ER.
deleted in malignant brain
tumors 1
Probable role in immunity.
dead-box helicase dbp80 Probable functions in mRNA transport.
glutaryl- mitochondrial-like Possible role as a catalyst.
83
heat shock protein 68-like
isoform x13
Probable involvement in the prevention of
protein denaturation and aggregation.
hypothetical protein
CAPTEDRAFT_174341
---NA---
sco-spondin-like isoform x1 Possible role in development.
ribonuclease h1 Probable role in the degradation of RNA in
RNA-DNA hybrids
oxysterol-binding protein 1-
like isoform x2
Probable function as a lipid transporter involved
in lipid countertransport between the Golgi
complex and membranes of the endoplasmic
reticulum.
PREDICTED: uncharacterized
protein LOC101860536
---NA---
cellulase Probable function as an enzyme involved in the
breakdown of cellulose.
ran gtpase-activating protein 1 Possible role as a GTPase activator for the
nuclear RAS-related regulatory protein Ran,
converting it to the putatively inactive GDP-
bound state.
heat shock protein partial GTPase activator for the nuclear Ras-related
regulatory protein Ran, converting it to the
putatively inactive GDP-bound state.
sorting nexin-4 Possible involvement in several stages of
intracellular trafficking.
stomatin-like protein
mitochondrial
Mitochondrial protein that probably regulates
the biogenesis and the activity of mitochondria.
sorting nexin-4-like Possible involvement in several stages of
intracellular trafficking.
integrin alpha-m-like Possible roles in various adhesive interactions of
monocytes,
rhomboid-related protein 2-like Possible involvement in regulated
intramembrane proteolysis and the subsequent
84
release of functional polypeptides from their
membrane anchors.
cathepsin l-like Probable role in cellular turnover.
tumor protein p63-regulated
gene 1-like protein
---NA---
peroxisomal sarcosine oxidase-
like
Possible role in receptor binding.
short-chain collagen c4-like
dipeptidyl peptidase 1 Probable function as both an exopeptidase and
endopeptidase
xaa-pro partial Probable function in collagen metabolism.
cytochrome b5 Probable function function as an electron carrier
for several membrane bound oxygenases.
Sites
hypothetical protein ---NA---
syntaxin-7-like isoform x1 Possible involvement in protein trafficking from
the plasma membrane to the early endosome
(EE) as well as in homotypic fusion of endocytic
organelles.
---NA--- ---NA---
PREDICTED: uncharacterized
protein LOC106868605
isoform X3
---NA---
cathepsin l1-like Probable role in cellular turnover.
semaphorin-2a isoform x2 Probable role in axon function.
calponin homology domain-
containing protein
ddb_g0272472-like
Possible function as cytoskeletal and signal
transduction proteins.
voltage-dependent calcium
channel subunit alpha-2 delta-
2-like isoform x3
Possible function as a calcium regulator.
85
cysteine--trna cytoplasmic
isoform x4
Possible role in ATP binding.
aldose 1-epimerase-like Probable functions in glycolysis
and gluconeogenesis.
---NA--- ---NA---
cathepsin b Probable role in cellular turnover.
synaptosomal-associated
protein 25-like isoform x3
Probable role in the molecular regulation of
neurotransmitter release.
aminopeptidase b-like Possible functions in peptide binding.
zinc metalloproteinase nas-13-
like
Possible role in metal ion binding.
gtpase imap family member 7-
like
Probable functions GTP binding.
trichohyalin- partial Probable role in the organization of the cell
envelope.
ef-hand domain-containing
protein 1-like
Possible role as a regulator of cell morphology.
caspase-2 isoform x1 Probable role in apoptosis.
calcium binding protein Probable functions in calcium binding.
lipoyltransferase mitochondrial Possible role in transferase activity.
receptor-type tyrosine-protein
phosphatase alpha-like
Probable function as a signalling molecule.
mucin-like protein Probable function in secretory proteins.
dsba-like thioredoxin domain
containing protein
Possible role as a secretory protein,
alpha-l-fucosidase-like Probable role in the degradation of glycans.
erlin-1 Possible Involvement in regulation of cellular
cholesterol homeostasis.
exoglucanase -like Probable function in degrading cellulose.
2-oxoisovalerate
dehydrogenase subunit
mitochondrial
Possible functions in glyoxylate metabolic
processes.
86
hydroxymethylglutaryl-
mitochondrial-like
Probable functions in ketone synthesis.
adipocyte plasma membrane-
associated protein
Possible role in adipocyte differentiation.
kremen protein 2-like Possible role as a dependance receptor.
ankyrin repeat domain-
containing protein 40-like
Probable role in DNA binding.
leukotriene a-4 hydrolase Probable function in arachidonic acid
metabolism.
neurotrypsin- partial Possible role in neuronal plasticity.
von willebrand factor d and egf
domain-containing
Possible functions in the extracellular region.
exoglucanase -like Probable function in degrading cellulose.
microtubule-actin cross-linking
factor 1-like isoform x5
Possible role in delivery of transport vesicles
containing GPI-linked proteins from the trans-
Golgi network.
Of the 80 differentially abundant proteins in Nerita melanotragus, 65 revealed
decreased abundances and 15 showed increased abundances at 31 °C. At 45 °C, 58
proteins showed decreased abundances and 22 increased abundance. Of these, a
number of calcium regulatory proteins showed decreased abundance while a signal
transduction protein showed increased abundance. In N. albicilla, 109 proteins showed
differential abundance, of which 89 showed decreased abundance and 20 increased
abundance at 31 °C. At 45 °C, 92 showed decreased abundance and 17 increased
abundance. The higher temperature treatments revealed increased abundances of
proteins involved in cytoskeleton function/regulation. Large differences in GO terms
were observed when comparing differentially abundant proteins from both species
with a large over-representation of many GO categories in N. albicilla (Figure 12).
From the 80 and 109 differentially abundant proteins in the respective species, a
number of stress related proteins were identified. In particular, these included two
universal stress proteins, two calmodulin proteins, a cytochrome p450 protein, and a
coiled coil domain containing protein for Nerita melanotragus. For Nerita albicilla,
87
these includ a regucalcin protein and three heat shock proteins (HSP70, HSP68-like
and an unannotated heat shock protein).
Figure 12. WEGO plot for differentially expressed proteins of N. melanotragus and N. albicilla.
A comparison of differentially expressed genes and differentially abundant
proteins revealed little overlap between each species for both datasets (Figure S5). A
comparison of differentially expressed genes and differentially abundant proteins in
Nerita melanotragus revealed an overlap of a spondin protein and a thap domain-
containing protein. Nerita albicilla revealed an overlap of 3 heat shock proteins, a
serine threonine-protein phosphatase and a eukaryotic translation initiation factor.
When comparing the differentially expressed genes and differentially abundant
proteins across the Nerita species, only four proteins showed overlap. These include
regucalcin, a deleted in malignant brain tumor protein, a rhomboid-related protein and
a cathepsin protein. No differentially expressed transcripts were found in common
between the species.
88
Figure S 5. Venn diagram highlighting overlap of differentially expressed genes and proteins for N. melanotragus and N. albicilla.
4.3.5 Correlation of gene expression and protein abundance
Comparison of gene expression and corresponding protein abundance for each
species revealed a small but significant correlation between the proteome and
transcriptome (Figure 13). The linear regression indicates that the relationship between
protein and transcript abundance is positive, but is weak.
Figure 13. Scatterplot comparison of gene expression and protein abundance for BWN (Nerita albicilla) and BN (Nerita melanotragus) at 14 °C, 22 °C and 31 °C.
89
90
4.4 DISCUSSION
This study provides a physiological understanding of two ecologically important
neritid species, N. melanotragus and N. albicilla. Specifically, the data generated here
has allowed the examination of the molecular response for two closely related species
that occur in different areas of the intertidal zone under thermal stress. A strong thermal
stress response was observed in the transcriptomic data for the low intertidal zone
species, N. albicilla, but not in the mid intertidal zone species, N. melanotragus. Some
evidence of a thermal stress response was observed in the quantitative proteomic data
for both species, but different proteins were involved in this process for both species.
Little concordance was observed between the quantitative transcriptomic and
proteomic datasets within either species. The transcriptomic dataset supports the
hypothesis that low intertidal species undergo thermal stress responses at lower
temperatures compared to those that live higher in the intertidal zone, but this pattern
is far weaker in the proteomic dataset.
4.4.1 Transcriptome changes in response to heat stress
Nerita albicilla (low intertidal zone) displayed an expression pattern consistent
with a thermal stress response at 31°C. This can be seen through the up-regulation of
a suite of heat shock proteins (HSP20, HSP Beta, HSP70 and HSP90) and other stress
response genes, such as Mitogen-activated protein kinase kinase kinase 9 and
polyketide synthase. The mitogen-activated protein kinase 9 gene (MAP3K9) is part
of a super-family of MAP kinases that play a key role in regulation of gene expression
and intracellular signal transduction in response to changes in the environment,
including heat stress [Schaeffer & Weber, 1999; Kyriakis et al., 1994]. In fact, the
over-expression of genes in the MAPK pathway has been previously observed in
molluscs experiencing thermal stress [Kefaloyianni et al., 2005]. The MAP3K9 gene
has previously been shown to have an adaptive response to heat stress [Kyriakis et al.,
1994], potentially as a protective measure against premature cell death (anti-apoptosis
signalling), but also as an inducer of cell death (pro-apoptosis) when necessary
[Dhanasekaran & Reddy, 2008]. Consequently, the over-expression of MAP3K9 at
higher temperatures in N. albicilla is likely also an adaptive response to stress.
Polyketide synthase is an enzyme (or enzyme complex) responsible for the
synthesis of polyketides [Hopwood & Sherman, 1990]. Polyketides are a class of
91
secondary metabolites generated from a wide array of complex compounds that can
have a range of properties, such as anti-fungal, anti-biotic and immuno-suppressive
properties in some species [Hopwood & Sherman, 1990]. While it is not clear from the
transcriptome results which polyketide metabolite was being produced through the
increased of polyketide synthase under higher temperatures in N. albicilla, it is
interesting that this secondary metabolite producing gene was up-regulated during a
period of environmental stress. It also remains unclear whether the increased
expression of polyketide synthase is an adaptive response to stress or a detrimental
result of stress in this species.
The strong induction of heat shock proteins has been observed in other intertidal
mollusc species exhibiting thermal stress [Wang et al., 2012; Gleason & Burton, 2015]
including the induction of HSP70 in Crassostrea gigas [Wang et al., 2012]. Heat shock
proteins (HSPs) contain a number of highly conserved superfamilies of proteins
(HSP20, HSP Beta, HSP70 and HSP90) originally found to be expressed during
periods of heat stress [Schlesinger, 1990], but have since been discovered to be
expressed under a range of stresses [Morimoto et al., 1996]. During periods of heat
stress (and other forms of stress), proteins may not fold correctly or may denature and
unfold, posing a threat to cellular functioning. Under these conditions, HSPs are
rapidly expressed at high levels and work to stabilise and re-fold damaged or denatured
proteins [Parsell & Lindquist, 1993]. In N. albicilla, it is likely that the induction of
HSPs provides an adaptive protective response under thermal stress.
Heat shock proteins are also present in cells under normal environmental
conditions and are essential for cellular metabolism, acting as molecular chaperones
and aiding in folding newly synthesised proteins [Morimoto, 1996]. Some recent
studies have correlated the high baseline expression of HSPs (front loading) with
thermal stress resilience in a number of intertidal and marine species [Barshis et al,
2013]. Front loading usually occurs in species that experience chronic thermal stress,
but here, it was found that the only front loaded HSPs occurred in N. albicilla, which
were opposite to the pattern hypothesised as N. melanotragus experiences greater
periods of exposure as a mid intertidal species. Currently, there is no explanation as to
why front loading in N. melanotragus was not observed, but it may be that this species
uses other processes to escape thermal stress [Chapperon and Seuront, 2011].
92
Nerita melanotragus showed little evidence of a transcriptional response to
thermal stress at 31°C. The only indication of stress response was that this species
exhibited down-regulation of a protein translation promoting gene, which has been
seen previously during thermal stress response [Ribeiro et al., 2012]. Apart from this
gene, there does not appear to be a clearly defined molecular response in N.
melanotragus that would be associated with thermal stress. In part, this is not
surprising as previous research has shown that mid intertidal species do not experience
a thermal stress response at the same temperatures as low intertidal species. Overall,
this may indicate that N. melanotragus may be more resilient to thermal stress than N.
albicilla, particularly at the temperatures compared in the transcriptome sequencing
experiment.
4.4.2 Proteome changes in response to heat stress
Overall, only limited evidence of a thermal stress response was observed in the
proteome of either Nerita species. Three proteins that have previously been implicated
in a thermal stress response in other intertidal molluscs were found to be differentially
abundant in N. albicilla (Liu & Chen, 2013; Snyder et al., 2001). These proteins were
all heat shock proteins which are known to play an important role in thermal stress
response in mollusc species from the low intertidal zone (see discussion in section
4.5.1 for an explanation of function and their role in thermal stress response). Besidex
these three proteins, very few other differentially abundant proteins from N. albicilla
have been implicated as having a direct role in stress response in other organisms. In
N. melanotragus, six differentially abundant proteins have previously been shown to
play a role in stress response. These six proteins included two universal stress proteins,
two calmodulin proteins, a cytochrome p450 protein and a coiled coil domain
containing protein. Of these, those with the best known association with stress
response are the universal stress proteins (Nachin et al., 2005). Universal stress
proteins show increased abundant under a range of stress conditions, including thermal
stress, and are associated with increased resistance to stress in a range of organisms
[Timmins-Schiffman et al., 2014; Tkaczuk et al., 2013; Nachin et al., 2005]. The
mechanism by which universal stress proteins act in N. melanotragus are still largely
unknown. Further study is required to determine if universal stress proteins provide
93
resilience to thermal stress in mid intertidal species when compared to low intertidal
species.
Calcium signalling is considered a crucial process in response to a number of
abiotic and biotic stressors [Wu & Jinn, 2012]. An increased abundance of calmodulin
proteins in response to stress has been mostly documented in plant species and they
play important roles in the activation of cell signalling machinery during stress [Gupta
et al., 2014]. Due to a lack of studies of calmodulin in mollusc species, it is unknown
whether these proteins play a similar role in these species. Coiled coil proteins have
been found to be involved in crucial interactions such as transcriptional control [Mason
& Arndt, 2004]. Similarly, there is a lack of documentation of coiled coil proteins in
mollusc species, making it difficult to understand their function. Although not directly
involved in thermal stress response, cytochrome p450 differential abundance has been
identified in relation to hydrocarbon exposure [Snyder et al., 2001]. These proteins are
primarily involved in the metabolism of chemical compounds in mollusc species
[Gagnaire et al., 2010], so may only have a limited role in the thermal stress response
of these species.
There was a lack of overlap between the transcriptome/transcriptome, and
proteome/proteome among species as well as the transcriptome/proteome datasets
within species. Large differences in comparisons among species was expected as
previous research has shown that low and mid intertidal mollusc species have largely
different gene expression and protein responses to heat stress (Somero, 2002; Stillman
and Somero, 1996). This study only reinforces the idea that mid and low intertidal
species have very different thermal responses to similar temperatures and that low
intertidal species experience thermal stress at lower temperatures.
What was more interesting though was the lack of concordance between the
transcriptome/proteome datasets within species, with only a few differentially
expressed genes/proteins in common in both species. The genes/proteins found to be
in common in N. albicilla were dominated by heat shock proteins (3/5), confirming
the importance of these proteins to thermal stress response in this species. The two
genes in common between the transcriptome and proteome dataset in N. melanotragus
are a spondin protein and a thap domain-containing protein which have not previously
been implicated in a thermal stress response in molluscs. Similar patterns of low or no
94
overlap between protein and transcriptome datasets have been observed in a range of
other organisms [Lu et al. 2007; Fagerberg et al. 2014] and an almost complete lack
of overlap was observed in the marine coral species, Seriatopora hystrix [Mayfield et
al., 2016]. In S. hystrix, only two differentially abundant proteins and differentially
expressed genes were found in common across a temperature stress experiment. The
very weak overlap observed in a marine species during a thermal stress response
experiment strongly supports the results reported here.
For the same temperature treatments within species (Figure 12) a significant but
weak positive relationship was observed between transcript and protein abundance.
This indicates translation of only few transcripts to protein controlled by mechanism
which regulates the translation of transcript to protein, such as those involved in
transcription, translaton and post-translational modification.
4.4.3 Conclusion
The large amount of transcriptomic and proteomic data generated from two
temperature stressed Nerita species provide a novel insight into the potential effects of
future climate change. This study has found that low intertidal species exhibit a more
pronounced thermal response at lower temperatures than those from the mid intertidal
zone. The preliminary investigations into proteomic data from these species provides
little evidence of a thermal response and indicates the need for further research in this
area. Furthermore, by combining proteomic and genomic approaches, this study has
identified the limitations of comparing these datasets.
95
Chapter 5: General Discussion
The importance of genomic resources in the study of physiology and evolution
is well recognised [Mochida and Shinozaki, 2010; Ramos et al, 2015; Shivhare and
Lata, 2017]. Traditional approaches such as Sanger sequencing have been superseded
by next generation sequencing technologies, allowing for more robust and efficient
studies of the gene repertoire and gene expression patterns in non-model species
[Morozova and Marra, 2008]. A fundamental requirement for large sequence data sets
is the reliable and accurate assembly, especially for organisms with no previous
genomic data. Such assemblers allow for downstream analyses into gene expansions
and contractions, investigations into gene expression patterns and can facilitate
proteomic studies, as well. Collectively, these studies allow for a better understanding
of the molecular response of non-model organisms to stress conditions, how species
adapt to extreme environments and potentially, how species may respond to future
climate change and variability.
5.1 DE NOVO ASSEMBLERS IN MOLLUSC TRANSCRIPTOME ASSEMBLIES
The demand for genomic resources for many non-model species has fuelled the
development of next generation sequencing technologies, which produce vast amounts
of sequencing data for lower costs compared to traditional sequencing approaches
[Schadt et al., 2010]. These sequencers, however, produce short fragmented sequences
which must be assembled before they are able to be used in downstream applications
[Everett et al., 2011]. As a result, large amounts of raw data are produced that must be
assembled to develop gene sets for down-stream analysis. These gene sets allow
insight into the genetic and functional information used by organisms. Currently, a
large number of assemblers exist, however, the accuracy and reliability of these
assemblers requires validation [Zerbino and Birney, 2008; Kearse et al., 2012; Luo et
al., 2012; Haas et al., 2013]. This is especially true for non-model organisms due to a
lack of a reference genome, so that they require a de novo assembly to be undertaken.
The use of several assembly statistics are used in order to determine the accuracy
and reliability of de novo assemblies. These include, N50, average contig length,
96 Error! No text of specified style in document.
longest contig length and the number of overall contigs which may indicate a large
number of redundant sequences. Assemblers such as SOAPdenovo, Velvet-Oases and
Trans-ABySS are widely available examples of current de novo assemblers; however
all are extensions of earlier developed assemblers. The development of Trinity
provided a novel method for the reconstruction of transcripts from raw read data [Haas,
2013]. When comparing the accuracy and reliability of these assemblers, Trinity and
Oases outperformed Geneious and Velvet in all metrics. When comparing Trinity and
Oases, however, Trinity had a longer N50 while Oases had less redundancy. Although
Oases showed less redundancy, software such as CD-HIT is available to address this
issue for Trinity assemblies [Huang, 2010]. Furthermore, Trinity has an active
developer community, providing excellent support and updates, constantly increasing
both efficiency and accuracy [Haas, 2013].
The use of Trinity [Haas, 2013] as a short read de novo assembler has been
extensively documented in a range of studies and taxa [Gutierrez-Gonzalez et al.,
2013; Tassone et al., 2016 Thunders and Cavanagh, 2017]. This assembler consists of
three consecutive modules and employs the use of de Bruijn graphs to reconstruct
transcripts. Furthermore, Trinity accounts for alternatively spliced isoforms from
either single end or paired end reads making it particularly effective in the study of
physiological genomics in non-model species. Specifically, this allows the potential
identification of expansions in gene families, which is crucial to the understanding of
the driving forces underlying adaptations to environmental extremes [Zhang, 2015;
Nock, 2016].
The use of k-mers (inconsistent throughout) in de novo assembly of datasets is a
key component of the assembly process. The goal of the k-mer is to enable the
determination of the number of occurances each fixed-length word of length k in a
DNA data set [Marçais and Kingsford, 2011]. The efficiency of k-mer counting plays
a cruicial role in de novo assemblies [Zhang, 2014]. Although k-mers facilitate
efficient reconstruction of datasets, they can also provide erroneous data if incorrectly
set. The Velvet/Oases package requires the user to preset a k-mer for each assembly.
Although it allows the combining of multiple k-mers, each set of raw reads is unique
in its size, error rate and composition. Consequently, this may cause an inaccurate
dataset with too few contigs, where many have been missed, or one with high numbers
of contigs and large amounts of chimeric contigs. In contrast, Trinity initially employs
97
the use of a third party package, Jellyfish to build a k-mer catalog [Haas, 2013]. As
each set of raw reads is unique, this method provides optimum k-mer selection.
The use of an efficient, accurate and reliable de novo assembler is extremely
important for studies in all fields. Although assemblers such as Velvet/Oases can
provide assemblies with less redundancy, Trinity creates contigs with a longer N50,
has a larger support system and employs an efficient k-mer optimisation method.
These factors make the use of Trinity highly suitable as a de novo assembler for the
study of evolution and physiology in non-model organisms.
5.2 STRESS GENE EXPANSION IN LOW VS MID INTERTIDAL SPECIES
The intertidal zone consists of a lower, middle, upper and spray subzones. Of
these, the lower subzones represent areas where the resident species are submerged in
water more frequently and for longer periods than those that occur in the upper
subzones. Consequently, the upper intertidal zones are where organisms experience
the the most prolonged exposure to stressors, due to tidal cycles and constant air and
sun exposure. Furthermore, organisms inhabiting these zones are faced with greater
maximum temperatures [Tomanek, 2002]. Such environmental pressure coupled with
gene duplication events may lead to the expansion of gene families involved in stress
response. Such expansions of stress response gene families have been observed in the
Pacific Oyster (Crassostrea gigas), where an extensive duplication of heat shock
protein 70 and inhibition of apoptosis gene families has occurred [Wang, 2012]. It is
suggested this expansion may enable this species to be able to persist in the harsh
environment of the intertidal zone. Studies on species from the genus Pinctada also
support the idea that interitidal species have an expanded repertoire of stress related
genes [Takeuchi, 2016]. Few studies, however, have examined if species that inhabit
different areas of the intertidal zone have different numbers of expressed genes under
normal conditions.
Differences in expressed gene copy number in species that inhabit different areas
of the intertidal zone could occur if reduced gene copy number is beneficial in species
that encounter less frequent stress conditions (lower intertidal) than those found in the
upper intertidal areas. An alternative scenario of increased of expressed copy number
in species from the lower intertidal zone could also be beneficial if the level of stress
is more acute in organisms inhabiting the lower areas. Our data supports the second
98 Error! No text of specified style in document.
idea as the mid intertidal zone species N. melanotragus had fewer stress related genes
expressed when compared to the low intertidal species N. albicilla. This may indicate
N. melanotragus is a more resilient species and has a higher stress tolerance than that
of Nerita albicilla which exhibits a more acute heat stress response.
5.3 GENE EXPRESSION IN INTERTIDAL ZONES
Investigating the physiological changes of species in response to stress is a
crucial step in the understanding how an organism copes in a harsh environment.
Organisms can employ gene expression changes as a defence mechanism to cope with
abiotic stressors such as temperature changes [Liu, 2017]. Of particular interest are
environments such as the intertidal zone, where organisms are presented with a suite
of stressors affecting virtually all physiological processes to some degree [Helmuth,
2006]. Furthermore, organisms inhabiting these areas often exhibit strong vertical
zonation [Chappuis, 2014]. Therefore, studies focusing on organisms inhabiting
intertidal zones present a great opportunity to increase our current understanding of
gene expression patterns under stress conditions.
The two study species used here N. albicilla and N. melanotragus occur in the
lower and mid intertidal zones, respectively. Distinct differences in expression patterns
were observed in these species and N. albicilla appeared to have a classic stress
response at a lower temperature than N. melanotragus based on gene expression data.
In fact, many of the genes expressed by N. albicilla are part of the cellular stress
response, a universal cellular defence mechanism which is initiated in response to
changes in the extracellular environment [Kültz, 2005]. This indicates that N. albicilla
displayed a more acute stress response when compared with the mid intertidal species
N. melanotragus. Overall this observation provides further evidence to suggest that N.
melanotragus is more resilient to temperature stress than the lower intertidal species.
A study by Madeira et al ., (2014) investigating the expression of heat shock
protein 70 in crabs from three different thermal niches revealed that species occupying
more stable niches present peaks of cellular stress responses at lower temperatures,
when compared with those that inhabit more variable environments [Madeira et al.,
2014]. As N. albicilla is submerged for far longer periods of time, it may be that lower
temperatures are also needed to illicit a thermal stress response in this species as well.
A lack of a thermal stress response in N. melanotragus may indicate that the
99
experimental temperatures used in this study are within the specie’s tolerable range.
This may also indicate that N. melanotragus is able to cope with greater temperatures
than N. albicilla. Overall, this pattern is consistent with previous studies which have
highlighted low intertidal species undergo a thermal stress response at lower
temperatures than mid intertidal species [Dong & Somero, 2009].
5.4 RESILIENCE UNDER FUTURE CLIMATES
Future climate change implications pose a host of issues for marine species.
Marine habitats are expected to become more stressful for inhabitants through changes
in abiotic stressors, such as increased water temperature. The implications of this
change on organisms are severe and in some cases may cause the local extinction of
populations. Our gene expression study in N. melanotragus and N. albicilla revealed
a much more pronounced stress response in N. albicilla as opposed to N. melanotragus
under current extreme temperature conditions. The implications suggest that N.
albicilla is less resilient to stress when compared to N. melanotragus and is also more
likely to be sensitive to future increases in temperature. In fact, thermally sensitive
species are more likely to be adversely affected under scenarios of increased
environmental temperatures. For example, a temperature stress experiment on
thermally sensitive and thermally resilient populations of Acropora hyacinthus
highlighted differences in stress gene expression patterns, and this was ultimately
linked to mortality in the thermally sensitive population in the more stressful
environment [Barshis et al., 2013]. Based on this experiment, there are implications
that many thermal sensitive species may potentially face local extinction if
environmental stress increases in their habitats.
The proteomic experiment which examined current and future extreme
temperatures, however, did not find clear cut results in terms of the stress response of
either species. Both species displayed some evidence of a thermal stress response, but
it was not strong in either species. In contrast, the transcriptomic experiment revealed
an expression pattern consisten with thermal stress in N. albicilla, however, in N.
melanotragus, there was no defined thermal stress response. Evidently, differences in
transcript/protein expression also correlated with little overlap between the two.
100 Error! No text of specified style in document.
5.5 PROTEIN AND GENE CORRELATION
Recent advances in proteomics have allowed the large scale discovery of
proteins from complex samples using protein digests [Yates et al., 2009]. Using
predicted peptide sets from transcriptome data enables the generation of a proteome
data set. These data sets are currently being interrogated in a range of taxa and in a
number of studies, and some have been used to test the thermal stress response of
particular species [Poirier et al., 2014; Xie et al., 2015; Khondee et al., 2016].
Furthermore, these proteome datasets can allow indepth investigations into any given
tissue of an organism under stress conditons [Kosová et al., 2014]. Proteomic and
transcriptomic data, however, often seem to only show weak overlap or correlation
with each other in many experiments.
Although it is expected that a large portion of mRNA is translated into protein,
studies are finding that this may not always be the case [Lu et al. 2007; Fagerberg et
al. 2014; Mayfield et al., 2016]. There are a number of regulatory mechanisms that
influence the abundance of mRNA transcripts before the production of proteins, other
regulatory mechanisms that protein translation [Mayfield, 2016]. These mechanisms
include those involved in transcription, translation, post-translation modification,
processing and transport, that are governed by different temporal profiles and
regulatory pathways [Mayfield, 2016]. For example, the up-regulation of genes due to
thermal intervention may not result in increased protein production, as not every
transcript is actively translated. Many forms of RNA are known to actively regulate
transcribed mRNA before it is translated into protein. This includes small interfering
RNAs (siRNAs) and microRNAs (miRNAs) which can reduce the abundance of
mRNA transcripts and reduce translation into proteins [Rossbach, 2010]. Post
transcriptional regulation of mRNA transcripts may be one factor that accounts for
some of the variability observed between proteomic and transcriptomic datasets, but
other factors such as protein localisation also play a role in this variability.
Protein localisation, including storage and secretion, may also contribute to the
low correlation between transcriptome and proteome datasets, as it introduces a
temporal-spatial element into the distribution of proteins within cells, tissues and the
organism. Moreover, protein localisation may impact on negative and positive
feedback loops within the cellular system, as biochemical thresholds often need to be
met and exceeded for feedback loops to inhibit the expression of genes again
101
increasing variability between proteomic and transcriptomic data in many
experiments.
Other forms of protein regulation can also influence protein abundance in cells
and tissues. For example, the ubiquitin-proteosome pathway ensures that ubiquinated
proteins are actively degraded, even those that have been recently translated. A
degraded protein is unlikely to be quantitatively measured if the subsequent peptides
lack the tryptic cleavage site. Consequently, this may contribute to a large number of
proteins not accounted for due to degradation.
Furthermore, factors such as protein and mRNA half-life may also impact correlations
[Wu et al., 2008]. Protein half-lives vary with the stability of the polypeptide,
involvement in complexes, active enzymes, temperature and chemical constituents of
the microenvironment (e.g. reactive oxygen species, hydrogen ions, acids and bases,
etc.).
Finally, the difference in number of genes sequenced and proteins assayed differs
immensely with 10 000s of genes sequenced versus 1 000s of proteins assayed. These
characteristics, provide a reasonable overview that can explain the disparity between
the transcriptome and proteome and suggest comparisons between proteomic and
transcriptomic datasets have not completely matured.
5.6 CONCLUSION
By identifying the most suitable de novo assembler, it can accurately and reliably
assemble datasets for mollusc species. This is important as all downstream analyses
rely on the quality of the dataset. Consequently, any errors in the initial reconstruction
of the dataset will reflect upon downstream analyses.
The comparative transcriptome data generated has provided genomic resources
for a phylum lacking thereof. Very little is known about the physiology of organisms
from the phylum mollusca, however, genomic resources produced have provided a
step forward in this field. Furthermore, the discovery that lower intertidal zone species
exhibit a more pronounced stress response under normal conditions paves way for
expression studies which may provide a further understanding of the biology of closely
related organisms inhabiting the intertidal zone.
102 Error! No text of specified style in document.
By stress inducing two closely related marine snail species from the genus
Nerita, a further investigation into their physiology was able to be discovered.
Although transcriptomic data revealed a higher number of stress genes in the low
intertidal zone inhabiting species, the temperature stress related expression data further
confirmed the finding that the lower intertidal species is less resilient to heat stress.
Although the proteomic data generated did not correlate with the transcriptomic data,
it provides a step towards investigating not only the genomics of these species, but
also the proteomics, in order to obtain a complete systems understanding of the
physiological adaptation of these organisms.
References
Adamson KJ, Wang T, Zhao M, Bell F, Kuballa AV, Storey KB, Cummins SF: Molecular insights into land snail neuropeptides through transcriptome and comparative gene analysis. BMC Genomics 2015, 16:308.
Albertin CB, Simakov O, Mitros Td, Wang ZY, Pungor JR, Edsinger-Gonzales E, Brenner S, Ragsdale CW, Rokhsar DS: The octopus genome and the evolution of cephalopod neural and morphological novelties. Nature 2015, 524:220-224.
103
Albright R, Mason B: Projected Near-Future Levels of Temperature and pCO2 Reduce Coral Fertilization Success. PLoS ONE 2013, 8:e56468.
Alley RB, Talley LD, Wallace JM, Marotzke J, Nordhaus WD, Overpeck JT: Abrupt Climate Change. Science 2003, 299:2005-2010.
Amin S, Prentis PJ, Gilding EK, Pavasovic A: Assembly and annotation of a non-model gastropod (Nerita melanotragus) transcriptome: a comparison of De novo assemblers. BMC Research Notes 2014, 7:488.
Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G: Gene ontology: Tool for the unification of biology. Nature Genetics 2000, 25:25-29.
Asta Lakshmi S: Wonder molluscs and their utilities. International Journal of Pharmaceutical Sciences Review and Research 2011, 6:30-33.
Bakkenist CJ, Kastan MB: Initiating cellular stress responses. Cell 2004, 118:9-17.
Barnwell FH: The role of rhythmic systems in the adaptation of fiddler crabs to the intertidal zone. Integrative and Comparative Biology 1968, 8:569-583.
Barshis DJ, Ladner JT, Oliver TA, Seneca FO, Traylor-Knowles N, Palumbi SR: Genomic basis for coral resilience to climate change. Proceedings of the National Academy of Sciences of the United States of America 2013, 110:1387-1392.
Beck FX, Grünbein R, Lugmayr K, Neuhofer W: Heat shock proteins and the cellular response to osmotic stress. Cellular Physiology and Biochemistry 2000, 10: 303-306.
Boone AN, Vijayan MM: Constitutive heat shock protein 70 (HSC70) expression in rainbow trout hepatocytes: Effect of heat shock and heavy metal exposure. Comparative Biochemistry and Physiology - C Toxicology and Pharmacology 2002, 132:223-233.
Booth NJ, Bilodeau-Bourgeois AL: Proteomic analysis of head kidney tissue from high and low susceptibility families of channel catfish following challenge with Edwardsiella ictaluri. Fish and Shellfish Immunology 2009, 26:193–96.
Brierley AS, Kingsford MJ: Impacts of Climate Change on Marine Organisms and Ecosystems. Current Biology 2009,19:602-612.
104 Error! No text of specified style in document.
Burrows MT, Schoeman DS, Buckley LB, Moore P, Poloczanska ES, Brander KM, Brown C, Bruno JF, Duarte CM, Halpern BS, Holding J, Kappel CV, Kiessling W, O'Connor MI, Pandolfi JM, Parmesan C, Schwing FB, Sydeman WJ, Richardson AJ: The pace of shifting climate in marine and terrestrial ecosystems. Science 2011, 334:652–655.
Byrne M, Lamare M, Winter D, Dworjanyn S, Uthicke S: The stunting effect of a high CO2 ocean on calcification and development in sea urchin larvae, a synthesis from the tropics to the poles. Philosophical Transactions of the Royal Society B: Biological Sciences 2013, 368:Article number 20120439
Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL: BLAST+: Architecture and applications. BMC Bioinformatics 2009, 10: Article number 421.
Casellato S, Masiero L, Ballarin L: Toxicity of fluoride to the freshwater mollusc Dreissena polymorpha: Effects on survival, histology, and antioxidant enzyme activity. Fluoride 2012, 45:35-46.
Castro P, Huber ME: Marine Biology Boston: McGraw-Hill 2003.
Chapperon C, Seuront L: Space-time variability in environmental thermal properties and snail thermoregulatory behaviour. Functional Ecology 2011, 25:1040-1050.
Chapperon C, Seuront L: Temporal shifts in motion behaviour and habitat use in an intertidal gastropod. Journal of the Marine Biological Association of the United Kingdom 2013, 93:1025-1034.
Chapperon C, Seuront L: Variability in the motion behaviour of intertidal gastropods: ecological and evolutionary perspectives. Journal of the Marine Biological Association of the United Kingdom 2011, 91:1717.
Chappuis E, Terradas M, Cefalì ME, Mariani S, Ballesteros E: Vertical zonation is the main distribution pattern of littoral assemblages on rocky shores at a regional scale. Estuarine, Coastal and Shelf Science 2014, 147:113-122.
Chiara M, Horner DS, Spada A: De novo assembly of the transcriptome of the non-model plant Streptocarpus rexii employing a novel heuristic to recover locus-specific transcript clusters. PLoS One 2013, 8:e80961.
Conesa A, Götz S, García-Gómez JM, Terol J, Talón M, Robles M, Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21:3674–3676.
Cong M, Ni D, Song L, Wang L, Zhao J, Qiu L, Li L: Molecular cloning, characterization and mRNA expression of peroxiredoxin in Zhikong scallop Chlamys farreri. Molecular Biology Reports 2009, 36:1451-1459.
105
Coppe A, Bortoluzzi S, Murari G, Marino IAM, Zane L, Papetti C: Sequencing and Characterization of Striped Venus Transcriptome Expand Resources for Clam Fishery Genetics. PLoS ONE 2012, 7:44185.
Crandall ED, Frey MA, Grosberg RK, Barber PH: Contrasting demographic history and phylogeographical patterns in two Indo-Pacific gastropods. Molecular Ecology 2008, 17:611-626.
Davenport J, Macalister H: Environmental conditions and physiological tolerances of intertidal fauna in relation to shore zonation at Husvik, South Georgia. Journal of the Marine Biological Association of the United Kingdom 1996, 76:985-1002.
De Oliveira AL, Wollesen T, Kristof A, Scherholz M, Redl E, Todt C, Bleidorn C, Wanninger A: Comparative transcriptomics enlarges the toolkit of known developmental genes in mollusks. BMC Genomics 2016, 17:905.
De Wit P, Palumbi SR: Transcriptome-wide polymorphisms of red abalone (Haliotis rufescens) reveal patterns of gene flow and local adaptation. Molecular Ecology 2013, 22:2884-2897.
Derbali A, Jarboui O, Ghorbel M: Distribution, abundance and population structure of Pinctada radiata (Mollusca: Bivalvia) in southern Tunisian waters (Central Mediterranean). Cahiers de Biologie Marine 2011, 52:23-31.
Dhanasekaran DN, Reddy EP: JNK signaling in apoptosis. Oncogene 2008, 27:6245-6251.
Dong Y, Miller LP, Sanders JG, Somero GN: Heat-shock protein 70 (Hsp70) expression in four limpets of the genus Lottia: Interspecific variation in constitutive and inducible synthesis correlates with in situ exposure to heat stress. Biological Bulletin 2008, 215:173-181.
Dong Y, Somero GN: Temperature adaptation of cytosolic malate dehydrogenases of limpets (genus Lottia): Differences in stability and function due to minor changes in sequence correlate with biogeographic and vertical distributions. Journal of Experimental Biology 2009, 212:169-177.
Drummond AJ, Ashton B, Buxton S, et al: 2010. Geneious v5.6, Available from http://www.geneious.com.
Fabry VJ, Siebel BA, Feely RA, Orr JC: Impacts of ocean acidification on marine fauna and ecosystem processes. ICES Journal of Marine Science 2008, 65:414–432.
Fagerberg L, Hallstrom BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, Habuka M, Tahmasebpoor S, Danielsson A, Edlund K, Asplund A, Sjostedt E, Lundberg E, Szigyarto CA-K, Skogs M, Ottosson Takanen J, Berling H, Tegel H, Mulder J, Nilsson P, Schwenk JM, Lindskog C, Danielsson F, Mardinoglu A, Sivertsson A, Von Feilitzen
106 Error! No text of specified style in document.
K, Forsberg M, Zwahlen M, Olsson I, Navani S, Huss M, Nielsen J, Ponten F, Uhlen M: Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Molecular and Cellular Proteomics 2014, 13:397-406.
Faulkner P: Late Holocene mollusc exploitation and changing near-shore environments: A case study from the coastal margin of Blue Mud Bay, northern Australia. Environmental Archaeology 2011, 16:137-150.
Feldmeyer B, Wheat CW, Krezdorn N, Rotter B, Pfenninger M: Short read illumina data for the de novo assembly of a non-model snail species transcriptome (Radix balthica, basommatophora, pulmonata), and a comparison of assembler performance. BMC Genomics 2011, 12:317.
Feng Z-P, Zhang Z, van Kesteren RE, Straub VA, van Nierop P, Jin K, Nejatbakhsh N, Goldberg JI, Spencer GE, Yeoman MS, Wildering W, Coorssen JR, Croll RP, Buck LT, Syed NI, Smit AB: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis. BMC Genomics 2009, 10:1471.
Feng ZP, Zhang Z, van Kesteren RE, Straub VA, van Nierop P, Jin K, Nejatbakhsh N, Goldberg JI, Spencer GE, Yeoman MS, Wildering W, Coorssen JR, Croll RP, Buck LT, Syed NI, Smit AB: Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis. BMC Genomics 2009, 10:451.
Fiedler TJ, Hudder A, McKay SJ, Shivkumar S, Capo TR, Schmale MC, Walsh PJ: The transcriptome of the early life history stages of the California Sea Hare Aplysia californica. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 2010, 5: 165-170.
Finn RD, Clements J, Arndt W, Miller BL, Wheeler TJ, Schreiber F, Bateman A, Eddy SR: HMMER web server: 2015 Update. Nucleic Acids Research 2015, 43:W30-W38.
Firth LB, Knights AM, Bell SS: Air temperature and winter mortality: Implications for the persistence of the invasive mussel, Perna viridis in the intertidal zone of the south-eastern United States. Journal of Experimental Marine Biology and Ecology 2011, 400:250-256.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R: DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology 1994, 5:294-299.
Frey MA, Vermeij GJ: Molecular phylogenies and historical biogeography of a circumtropical group of gastropods (Genus: Nerita): Implications for regional diversity patterns in the marine tropics. Molecular Phylogenetics and Evolution 2008. 48:1067-1086.
107
Frey MA: The relative importance of geography and ecology in species diversification: evidence from a tropical marine intertidal snail (Nerita). Journal of Biogeography 2010, 37:1515–1528.
Fulda S, Gorman AM, Hori O, Samali A: Cellular stress responses: Cell survival and cell death. International Journal of Cell Biology 2010, Article number 214074.
Gagnaire B, Geffard O, Noury P, Garric J: In vivo indirect measurement of cytochrome P450-associated activities in freshwater gastropod molluscs. Environmental Toxicology 2010, 25:545-553.
Gibbons JG, Janson EM, Hittinger CT, Johnston M, Abbot P, Rokas A: Benchmarking next-generation transcriptome sequencing for functional and evolutionary genomics. Mol Biol Evol 2009, 26:2731–2744.
Giribet G, Okusu A, Lindgren AR, Huff SW, Schrödl M, Nishiguchi MK: Evidence for a clade composed of molluscs with serially repeated structures: Monoplacophorans are related to chitons. Proceedings of the National Academy of Sciences of the United States of America 2006, 103:7723-7728.
Gleason LU, Burton RS: Regional patterns of thermal stress and constitutive gene expression in the marine snail Chlorostoma funebralis in northern and southern California. Marine Ecology Progress Series 2016, 24:143-159.
Gleason LU, Burton RS: RNA-seq reveals regional differences in transcriptome response to heat stress in the marine snail Chlorostoma funebralis. Molecular Ecology 2015, 24:610-627.
Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen N, Gnirke A, Rhind N, Di Palma F, Birren BW, Nusbaum C, Lindblad-Toh K, Friedman N, Regev A: Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 2011, 29:644–652.
Gracey AY, Chaney ML, Boomhower JP, Tyburczy WR, Connor K, Somero GN: Rhythms of Gene Expression in a Fluctuating Intertidal Environment. Current Biology 2008, 18:1501-1507.
Gupta K, Jha B, Agarwal PK: A Dehydration-Responsive Element Binding (DREB) Transcription Factor from the Succulent Halophyte Salicornia brachiata Enhances Abiotic Stress Tolerance in Transgenic Tobacco. Marine Biotechnology 2014, 16:657-673.
Gutierrez-Gonzalez JJ, Tu ZJ, Garvin DF: Analysis and annotation of the hexaploid oat seed transcriptome. BMC Genomics 2013, 14:471.
Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden Jf, Couger MB, Eccles D, Li B, Lieber M, Macmanes MD, Ott M, Orvis J, Pochet N, Strozzi F,
108 Error! No text of specified style in document.
Weeks N, Westerman R, William T, Dewey CN, Henschel R, Leduc RD, Friedman N, Regev A: De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols 2013, 8:1494-1512.
Harley CDG, Helmuth BST: Local- and regional-scale effects of wave exposure, thermal stress, and absolute versus effective shore level on patterns of intertidal zonation. Limnology and Oceanography 2003, 48:1498-1508.
Harley CDG, Hughes AR, Hultgren KM, Miner BG, Sorte CJB: The impacts of climate change in coastal marine systems. Ecological Letters 2006, 9:228–241.
Haven SB: Niche differences in the intertidal limpets Acmaea scabra and A. digitalis (Gastropoda) in central California. Veliger 1970, 13:231-248.
Helmuth B, Mieszkowska N, Moore P, Hawkins SJ: Living on the edge of two changing worlds: Forecasting the responses of rocky intertidal ecosystems to climate change. Annual Review of Ecology, Evolution, and Systematics 2006, 37:373-404.
Herpin A, Badariotti F, Rodet F, Favrel P: Molecular characterization of a new leucine-rich repeat-containing G protein-coupled receptor from a bivalve mollusc: evolutionary implications. Biochim Biophys Acta Gene Struct Expr 2004, 1680:137–144.
Heyland A, Vue Z, Voolstra CR, Medina M, Moroz LL: Developmental transcriptome of Aplysia californica. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 2011, 316B:113-134.
Hinrichsen H-H, Huwer B, Makarchouk A, Petereit C, Schaber M, Voss R: Climate-driven long-term trends in Baltic Sea oxygen concentrations and the potential consequences for eastern Baltic cod (Gadus morhua). ICES Journal of Marine Science 2011, 68:2019-2028.
Hold N, Murray LG, Hinz H, Neill SP, Lass S, Lo M, Kaiser MJ: Environmental drivers of small scale spatial variation in the reproductive schedule of a commercially important bivalve mollusk. Marine Environmental Research 2013, 92:144-153.
Hook SE, Twine NA, Simpson SL, Spadaro DA, Moncuquet P, Wilkins MR: 454 pyrosequencing-based analysis of gene expression profiles in the amphipod Melita plumulosa: transcriptome assembly and toxicant induced changes. Aquat Toxicol 2014, article in press.
Hopwood DA, Sherman DH: Molecular genetics of polyketides and its comparison to fatty acid biosynthesis. Annual Review of Genetics 1990, 24:37-66.
Hou R, Bao Z, Wang S, Su H, Li Y, Du H, Hu J, Wang S, Hu X: Transcriptome sequencing and De novo analysis for yesso scallop (Patinopecten yessoensis) using 454 GS FLX. PLoS One 2011, 6:21560.
109
Huang Y, Niu B, Gao Y, Fu L, Li W: CD-HIT Suite: a web server for clustering and comparing biological sequences. Bioinformatics 2010, 26:680–682.
Hungate BA, Dukes JS, Shaw MR, Luo Y, Field CB: Nitrogen and Climate Change. Science 2003, 302:1512-1513.
Ip JCH, Leung PTY, Ho KKY, Qiu JW, Leung KMY: De novo transcriptome assembly of the marine gastropod Reishia clavigera for supporting toxic mechanism studies. Aquatic Toxicology 2016, 178:39-48.
Jakubowska M, Normant M: Metabolic rate and activity of blue mussel Mytilus edulis trossulus under short-term exposure to carbon dioxide-induced water acidification and oxygen deficiency. Marine and Freshwater Behaviour and Physiology 2015, 48:25-39.
Jurgen F, Valerio M, Roberto R, Paolo SG, Marta M: 2-DE proteomic analysis of HSP70 in mollusc Chamelea gallina. Fish and Shellfish Immunology 2011, 30-739-743.
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A: Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28:1647–1649.
Kefaloyianni E, Gourgou E, Ferle V, Kotsakis E, Gaitanaki C, Beis I: Acute thermal stress and various heavy metals induce tissue-specific pro- or anti-apoptotic events via the p38-MAPK signal transduction pathway in Mytilus galloprovincialis (Lam.). Journal of Experimental Biology 2005, 208:4427-4436.
Khondee P, Srisomsap C, Chokchaichamnankit D, Svasti J, Simpson RJ, Kingtong S: Histopathological effect and stress response of mantle proteome following TBT exposure in the Hooded oyster Saccostrea cucullata. Enviornmental Pollution 2016, 218:855-862.
Khripounoff A, Caprais JC, Decker C, Le Bruchec J, Noel P, Husson B: Respiration of bivalves from three different deep-sea areas: Cold seeps, hydrothermal vents and organic carbon-rich sediments. Deep-Sea Research Part II: Topical Studies in Oceanography 2017, 142:233-243.
Kosová K, Vítámvás P, Prášil IT: Proteomics of stress responses in wheat and barley-search for potential protein markers of stress tolerance. Frontiers in Plant Science 2014, 11:711.
Kültz D: Evolution of the cellular stress proteome: From monophyletic origin to ubiquitous function. Journal of Experimental Biology 2003, 206:3119-3124.
110 Error! No text of specified style in document.
Kültz D: Molecular and evolutionary basis of the cellular stress response. Annual Review of Physiology 2005, 67:225–57.
Kyriakis JM, Banerjee P, Nikolakaki E, Dai T, Rubie EA, Ahmad MF, Avruch J, Woodgett JR: The stress-activated protein kinase subfamily of c-Jun kinases. Nature 1994, 369:156-160.
Lathlean JA, Minchinton TE: Manipulating thermal stress on rocky shores to predict patterns of recruitment of marine invertebrates under a changing climate. Marine Ecology Progress Series 2012, 467:121-136.
Lemos MF, Soares AM, Correia AC, Esteves AC: Proteins in ecotoxicology—How, why and why not? Proteomics 2010, 10:873–87.
Lespinet O, Wolf YI, Koonin EV, Aravind L: The Role of Lineage-Specific Gene Family Expansion in the Evolution of Eukaryotes. Genome Resources 2002, 12:1048–1059
Li P, Deng W-Q, Li T-H, Song B, Shen Y-H: Illumina-based de novo transcriptome sequencing and analysis of Amanita exitialis basidiocarps. Gene 2013, 532:63–71.
Li R, Fan W, Tian G, Zhu H, He L, Cai J, Huang Q, Cai Q, Li B, Bai Y, Zhang Z, Zhang Y, Wang W, Li J, Wei F, Li H, Jian M, Li J, Zhang Z, Nielsen R, Li D, Gu W, Yang Z, Xuan Z, Ryder OA, Leung FC-C, Zhou Y, Cao J, Sun X, Fu Y, et al: The sequence and de novo assembly of the giant panda genome. Nature 2010, 463:311–317.
Lima FP, Wethey DS: Three decades of high-resolution coastal sea surface temperatures reveal more than warming. Nature Communications 2012, 3:704.
Liu D, Chen Z: The expression and induction of heat shock proteins in molluscs. Protein and Peptide Letters 2013, 20:602-606.
Liu Z, Wang L, Zhou Z, Liu Y, Dong M, Wang W, Song X, Wang M, Gao Q, Song L: Transcriptomic analysis of oyster Crassostrea gigas larvae illustrates the response patterns regulated by catecholaminergic system upon acute heat and bacterial stress. Developmental and Comparative Immunology 2017, 73:52-60.
Lu P, Vogel C, Wang R, Yao X, Marcotte EM: Absolute protein expression profiling estimates the relative contributions of transcriptional and translational regulation. Nature Biotechnology 2007, 25:117-124.
Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G, Chen Y, Pan Q, Liu Y, Tang J, Wu G, Zhang H, Shi Y, Liu Y, Yu C, Wang B, Lu Y, Han C, Cheung DW, Yiu S-M, Peng S, Xiaoqian Z, Liu G, Liao X, Li Y, Yang H, Wang J, Lam T-W, Wang J: SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience 2012, 1:18.
111
Madeira D, Narciso L, Cabral HN, Diniz MS, Vinagre C: Role of thermal niche in the cellular response to thermal stress: Lipid peroxidation and HSP70 expression in coastal crabs. Ecological Indicators 2014, 36:601-606.
Marçais G, Kingsford C: A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics 2011, 27:764–770.
Markov GV, Baskaran P, Sommer RJ: The Same or Not the Same: Lineage-Specific Gene Expansions and Homology Relationships in Multigene Families in Nematodes. Journal of Molecular Evolution 2015, 80:18–36.
Martin JA, Wang Z: Next-generation transcriptome assembly. Nat Rev Genet 2011, 12:671–682.
Mason JM, Arndt KM: Coiled coil domains: Stability, specificity, and biological implications. ChemBioChem 2004, 5:170-176.
Mayfield AB, Wang Y-B, Chen C-S, Chen S-H, Lin C-Y: Dual-compartmental transcriptomic + proteomic analysis of a marine endosymbiosis exposed to environmental change. Molecular Ecology 2016, 25:5944-5958.
Menge BA, Branch, GM: Rocky intertidal communities. Marine community ecology 2001, 1:221–251.
Miloslavich P, Cruz-Motta JJ, Klein E, Iken K, Weinberger V, Konar B, Trott T, Pohle G, Bigatti G, Benedetti-Cecchi L, Shirayama Y, Mead A, Palomo G, Ortiz M, Gobin J, Sardi A, Díaz JM, Knowlton A, Wong M, Peralta AC: Large-Scale Spatial Distribution Patterns of Gastropod Assemblages in Rocky Shores. PLoS ONE 2013, 8:e71396.
Miura O, Keawtawee T, Sato N, Onodera K-I.: Vertical zonation of endosymbiotic zooxanthellae within a population of the intertidal sea anemone, Anthopleura uchidai. Marine Biology 2014, 161:1745-1754.
Mochida K, Shinozaki K: Genomics and bioinformatics resources for crop improvement. Plant and Cell Physiology 2010, 51:497-523.
Mohamed B, Hajer A, Susanna S, Caterina O, Flavio M, Hamadi B, Aldo V: Transcriptomic responses to heat stress and nickel in the mussel Mytilus galloprovincialis. Aquatic toxicology 2014, 13:104-112.
Morimoto RI, Kroeger PE, Cotto JJ: The transcriptional regulation of heat shock genes: a plethora of heat shock factors and regulatory conditions. EXS 1996, 77:139-163.
Morozova O, Marra MA: Applications of next-generation sequencing technologies in functional genomics. Genomics 2008, 92:255-264.
112 Error! No text of specified style in document.
Nachin L, Nannmark U, Nyström T: Differential roles of the universal stress proteins of Escherichia coli in oxidative stress resistance, adhesion, and motility. Journal of Bacteriology 2005, 187:6265-6272.
Narum SR, Campbell NR, Meyer KA, Miller MR, Hardy RW: Thermal adaptation and acclimation of ectotherms from differing aquatic climates. Molecular Ecology 2013, 22:3090-3097.
Nock CJ, Baten A, Barkla BJ, Furtado A, Henry RJ, King GJ: Genome and transcriptome sequencing characterises the gene space of Macadamia integrifolia (Proteaceae). BMC Genomics 2016, 13:937.
O'Connor MI, Bruno JF, Gaines SD, Halpern BS, Lester SE, Kinlan BP, Weiss JM: Temperature control of larval dispersal and the implications for marine ecology, evolution, and conservation. Proceedings of the National Academy of Sciences of the United States of America 2007, 104:1266-1271.
Pante E, Rohfritsch A, Becquet V, Belkhir K, Bierne N, Garcia P: SNP detection from de novo transcriptome sequencing in the bivalve Macoma balthica: marker development for evolutionary studies. PLoS One 2012, 7:e52302.
Pantzartzi CN, Drosopoulou E, Scouras ZG: Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages. PLoS ONE 2013, 8:e73217.
Parra G, Bradnam K, Korf I: CEGMA: a pipeline to accurately annotate core genes in eukaryotic genomes. Bioinformatics 2007, 23:1061–1067.
Parsell DA, Lindquist S: The function of heat-shock proteins in stress tolerance: Degradation and reactivation of damaged proteins. Annual Review of Genetics 1993, 27:437-496.
Passamaneck YJ, Schander C, Halanych KM: Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences. Molecular Phylogenetics and Evolution 2004, 32:25-38.
Pespeni MH, Sanford E, Gaylord B, Hill TM, Hosfelt JD, Jaris HK, LaVigne M, Lenz, EA, Russell AD, Young MK, Palumbi SR: Evolutionary change during experimental ocean acidification. Proceedings of the National Academy of Sciences of the United States of America 2013, 110:6937-6942.
Petersen TN, Brunak S, Von Heijne G, Nielsen H: SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nature Methods 2011, 8:785-786.
Peterson CH: Recruitment overfishing in a bivalve mollusc fishery: hard clams (Mercenaria mercenaria) in North Carolina. Can J Fish Aquat Sci 2002, 59:96–104.
113
Place SP, Menge BA, Hofmann GE: Transcriptome profiles link environmental variation and physiological response of Mytilus californianus between Pacific tides. Functional Ecology 2012, 26:144-155.
Poirier I, Kuhn L, Caplat C, Hammann P, Bertrand M: The effect of cold stress on the proteome of the marine bacterium Pseudomonas fluorescens BA3SM1 and its ability to cope with metal excess. Aquatic Toxicology 2014, 157:120-133.
Ponder WF, Lindberg DR: Towards a phylogeny of gastropod molluscs: an analysis using morphological characters. Zool J Linnean Soc 1997, 119:83–265.
Pörtner HO, Peck MA: Climate change effects on fishes and fisheries: towards a cause-and-effect understanding. Journal of Fish Biology 2010, 77:1745–1779.
Postaire B, Bruggemann JH, Magalon H, Faure B: Evolutionary dynamics in the southwest indian ocean marine biodiversity hotspot: A perspective from the rocky shore gastropod genus Nerita. PLoS ONE 2014, 9:Article number e95040.
Prentis PJ, Pavasovic A: The Anadara trapezia transcriptome: A resource for molluscan physiological genomics. Marine Genomics 2014, 18:113-115.
Przeslawski R, Byrne M, Mellin C: A review and meta-analysis of the effects of multiple abiotic stressors on marine embryos and larvae. Global Change Biology 2015, 21:2122-2140.
Ramos AA, Weydmann A, Cox CJ, Canário AVM, Serrão EA, Pearson GA: A transcriptome resource for the copepod Calanus glacialis across a range of culture temperatures. Marine Genomics 2015, 23:27-29.
Rappsilber J, Mann M, Ishihama, Y: Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nature Protocols 2007, 2:1896-1906.
Reece JB, Neil AC: Campbell Biology. Boston: Benjamin Cummings / Pearson, 2011.
Reusch TBH: Climate change in the oceans: evolutionary versus phenotypically plastic responses of marine animals and plants. Evolutionary Applications 2014, 7:104-122.
Ribeiro DA, Ferraz LFC, Vicentini R, Ottoboni LMM: Gene expression modulation by heat stress in Acidithiobacillus ferrooxidans LR. Antonie van Leeuwenhoek, International Journal of General and Molecular Microbiology 2012, 101:583-593.
Roessig JM, Woodley CM, Cech Jr JJ, Hansen LJ: Effects of global climate change on marine and estuarine fishes and fisheries. Reviews in Fish Biology and Fisheries 2004, 14:251-275.
114 Error! No text of specified style in document.
Rossbach M: Small non-coding rnas as novel therapeutics. Current Molecular Medicine 2010, 10:361-368.
Rupik W, Jasik K, Bembenek J, Widłak W: The expression patterns of heat shock genes and proteins and their role during vertebrate's development. Comparative Biochemistry and Physiology - A Molecular and Integrative Physiology 2011, 159:349-366.
Sadamoto H, Takahashi H, Okada T, Kenmoku H, Toyota M, Asakawa Y: De novo sequencing and transcriptome analysis of the central nervous system of mollusc Lymnaea stagnalis by deep RNA sequencing. PLoS One 2012, 7:42546.
Scavia D, Field JC, Boesch DF, Buddemeier RW, Burkett V, Cayan DR, Fogarty M, Harwell MA, Howarth RW, Mason C, Reed DJ, Royer TC, Sallenger AH, Titus JG: Climate change impacts on U.S. coastal and marine ecosystems. Estuaries 2002, 25:149-164.
Schadt EE, Linderman MD, Sorenson J, Lee L, Nolan GP: Computational solutions to large-scale data management and analysis. Nature Reviews Genetics 2010, 11:647-657.
Schaeffer HJ, Weber MJ: Mitogen-activated protein kinases: Specific messages from ubiquitous messengers. Molecular and Cellular Biology 1999, 19:2435-2444.
Schlesinger MJ: Heat shock proteins. Journal of Biological Chemistry 1990, 265:12111-12114.
Schulz MH, Zerbino DR, Vingron M, Birney E: Oases: robust de novo RNA-seq assembly across the dynamic range of expression levels. Bioinformatics 2012, 28:1086–1092.
Schunter C, Vollmer SV, Macpherson E, Pascual M: Transcriptome analyses and differential gene expression in a non-model fish species with alternative mating tactics. Acta Vet Scand 2014, 15:167.
Sexton GJ, Frere CH, Dieters MJ, Godwin ID, Prentis PJ: Development and characterization of microsatellite loci for Khaya senegalensis (Meliaceae). Am J Bot 2010, 97:e111–e113.
Shivhare R, Lata C: Exploration of genetic and genomic resources for abiotic and biotic stress tolerance in pearl millet. Frontiers in Plant Science 2017, 7:2069.
Shotwell J: Distribution of Volume and Relative Linear Measurement Changes in Acmaea, the Limpet. Ecology 1950, 31:51-61.
Sigwart JD, Chen C, Marsh L: Is mining the seabed bad for mollusks? Nautilus 2017, 131-43-49.
115
Simakov O, Marletaz F, Cho S-J, Edsinger-Gonzales E, Havlak P, Hellsten U, Kuo D-H, Larsson T, Lv J, Arendt D, Savage R, Osoegawa K, De Jong P, Grimwood J, Chapman JA, Shapiro H, Aerts A, Otillar RP, Terry AY, Boore JL, Grigoriev IV, Lindberg DR, Seaver EC, Weisblat DA, Putnam NH, Rokhsar DS: Insights into bilaterian evolution from three spiralian genomes. Nature 2013, 493:526-531.
Snyder MJ, Girvetz E, Mulder EP: Induction of marine mollusc stress proteins by chemical or physical stress. Archives of Environmental Contamination and Toxicology 2001, 41:22-29.
Somero GN: Thermal physiology and vertical zonation of intertidal animals: Optima, limits, and costs of living. Integrative and Comparative Biology 2002, 42:780-789.
Southward AJ, Hawkins SJ, Burrows MT: Seventy years′ observations of changes in distribution and abundance of Zooplankton and intertidal organisms in the western English Channel in relation to rising sea temperature. Journal of Thermal Biology 1995, 20:127-155.
Spencer HG, Waters JM, Eichhorst TE: Taxonomy and nomenclature of black nerites (Gastropoda, Neritimorpha: Nerita) from the South Pacific. Invertebrate Systematics 2007, 21:229-237.
Stillman JH, Somero GN: Adaptation to temperature stress and aerial exposure in congeneric species of intertidal porcelain crabs (genus Petrolisthes): Correlation of physiology, biochemistry and morphology with vertical distribution. Journal of Experimental Biology 1996, 199:1845-1855.
Stillman JH: Causes and consequences of thermal tolerance limits in rocky intertidal porcelain crabs, genus Petrolisthes. Integrative and Comparative Biology 2002, 42:790-796.
Sumizawa T, Igisu H: Release of heat shock proteins from human neuroblastoma cells exposed to acrylamide. Journal of Toxicological Sciences 2008, 33:117-122.
Sun J, Wang M, Wang H, Zhang H, Zhang X, Thiyagarajan V, Qian PY, Qiu JW: De novo assembly of the transcriptome of an invasive snail and its multiple ecological applications. Molecular Ecology Resources 2012, 12:1133-1144.
Takeuchi T, Koyanagi R, Gyoja F, Kanda M, Hisata K, Fujie M, Goto H, Yamasaki S, Nagai K, Morino Y, Miyamoto H, Endo K, Endo H, Nagasawa H, Kinoshita S, Asakawa S, Watabe S, Satoh N, Kawashima T: Bivalve-specific gene expansion in the pearl oyster genome: implications of adaptation to a sessile lifestyle. Zoological Letters 2016, 2:3.
116 Error! No text of specified style in document.
Tassone EE, Geib SM, Hall B, Fabrick JA, Brent CS, Hull JJ: De novo construction of an expanded transcriptome assembly for the western tarnished plant bug, Lygus hesperus. GigaScience 2016, 5:6.
Thunders M, Cavanagh J, Li Y: De novo transcriptome assembly, functional annotation and differential gene expression analysis of juvenile and adult E. fetida, a model oligochaete used in ecotoxicological studies. Biological Research 2017, 50:7.
Timmins-Schiffman E, Coffey WD, Hua W, Nunn BL, Dickinson GH, Roberts SB: Shotgun proteomics reveals physiological response to ocean acidification in Crassostrea gigas. BMC Genomics 2014, 15:951.
Tkaczuk KL, Shumilin AI, Chruszcz M, Evdokimova E, Savchenko A, Minor W: Structural and functional insight into the universal stress protein family. Evolutionary Applications 2013, 6:434-449.
Tomanek L, Somero GN: Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: Implications for limits of thermotolerance and biogeography. Journal of Experimental Biology 1999, 202:2925-2936.
Tomanek L, Zuzow MJ: The proteomic response of the mussel congeners Mytilus galloprovincialis and M. trossulus to acute heat stress: Implications for thermal tolerance limits and metabolic costs of thermal stress. Journal of Experimental Biology 2010, 213:3559-3574.
Tomanek, L: The heat-shock response: Its variation, regulation and ecological importance in intertidal gastropods (genus Tegula). Integrative and Comparative Biology 2002, 42:797-807.
Underwood AJ, Jernakoff P: Effects of interactions between algae and grazing gastropods on the structure of a low-shore intertidal algal community. Oecologia 1981, 48:221-233.
Van Dyck H, Bonte D, Puls R, Gotthard K, Maes D: The lost generation hypothesis: Could climate change drive ectotherms into a developmental trap?. Oikos 2015, 124:54-61.
Walsh CT, Jefferis R: Post-translational modifications in the context of therapeutic proteins. Nature Biotechnology 2006, 24:1241-1252.
Wang J, Zhang G, Fang X, Guo X, Li L, Luo R, Xu F, Yang P, Zhang L, Wang X, Qi H, Xiong Z, Que H, Xie Y, Holland PWH, Paps J, Zhu Y, Wu F, Chen Y, Wang J, Peng C, Meng J, Yang L, Liu J, Wen B, Zhang N, Huang Z, Zhu Q, Feng Y, Mount A, Hedgecock D, Xu Z, Liu Y, Domazet-Lošo T, Du Y, Sun X, Zhang S, Liu B, Cheng P, Jiang X, Li J, Fan D, Wang W, Fu W, Wang T, Wang B, Zhang J, Peng Z, Li Y, Li N, Wang J, Chen M, He Y, Tan F, Song X, Zheng Q, Huang R, Yang H, Du X, Chen L, Yang M, Gaffney PM, Wang S, Luo L, She Z, Ming Y, Huang W, Zhang S, Huang B, Zhang Y, Qu T, Ni P, Miao G, Wang J, Wang Q, Steinberg CEW, Wang H, Li N,
117
Qian L, Zhang G, Li Y, Yang H, Liu X, Wang J, Yin Y, Wang J: The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012, 490:49-54.
Wang Y-J, Zheng H-P, Zhang B, Liu H-L, Deng H-J, Deng L-H: Cloning and respond of a cold shock domain protein (CnCSDP) gene to cold stress in noble scallop Chlamys nobilis (Bivalve: Pectinidae). Molecular Biology Reports 2014, 41:7985-7994.
Wang Y, Coleman-Derr D, Chen G, Gu YQ: OrthoVenn: A web server for genome wide comparison and annotation of orthologous clusters across multiple species. Nucleic Acids Research 2015, 43:W78-W84.
Waters JM, King TM, O'Loughlin PM, Spencer HG: Phylogeographical disjunction in abundant high-dispersal littoral gastropods. Molecular Ecology 2005, 14:2789-2802.
Webster N, Pantile R, Botté E, Abdo D, Andreakis N, Whalan S: A complex life cycle in a warming planet: Gene expression in thermally stressed sponges. Molecular Ecology 2013, 22:1854-1868.
Wheat CW, Vogel H: Transcriptome sequencing goals, assembly, and assessment. Methods Mol Biol 2011, 772:129–144.
Wijgerde T, Silva CIF, Scherders V, Van Bleijswijk J, Osinga R: Coral calcification under daily oxygen saturation and pH dynamics reveals the important role of oxygen. Biology Open 2014, 3:489-493.
Wiśniewski JR, Zougman A, Nagaraj N, Mann M: Universal sample preparation method for proteome analysis. Nature Methods 2009, 6:359-362.
Wu G, Nie L, Zhang W: Integrative analyses of posttranscriptional regulation in the yeast Saccharomyces cerevisiae using transcriptomic and proteomic data. Current Microbiology 2008, 57:18-22.
Wu H-C, Jinn T-L: Oscillation regulation of Ca2+/calmodulin and heat-stress related genes in response to heat stress in rice (Oryza sativa L.). Plant Signaling and Behavior 2007, 12:1056-1057.
Xie J, Bai X, Lavoie M, Lu H, Fan X, Pan X, Fu Z, Qian H: Analysis of the Proteome of the Marine Diatom Phaeodactylum tricornutum Exposed to Aluminum Providing Insights into Aluminum Toxicity Mechanisms. Environmental Science and Technology 2015, 49:11182-11190.
Xu Q, Qin Y: Molecular cloning of heat shock protein 60 (PtHSP60) from Portunus trituberculatus and its expression response to salinity stress. Cell Stress and Chaperones 2012, 17:589-601.
118 Error! No text of specified style in document.
Yates JR, Ruse CI, Nakorchevsky A: Proteomics by mass spectrometry: Approaches, advances, and applications. Annual Review of Biomedical Engineering 2009, 11:49-79.
Ye J, Fang L, Zheng H, Zhang Y, Chen J, Zhang Z, Wang J, Li S, Li R, Bolund L, Wang J: WEGO: a web tool for plotting GO annotations. Nucleic Acids Research 2006, 34(Web Server):W293–W297.
Zeh JA, Bonilla MM, Su EJ, Padua MV, Anderson RV, Kaur D, Yang D-S, Zeh DW: Degrees of disruption: Projected temperature increase has catastrophic consequences for reproduction in a tropical ectotherm. Global Change Biology 2012, 18:1833-1842.
Zerbino DR, Birney E: Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Research 2008, 18: 821-829.
Zhang Q, Pell J, Canino-Koning R, Howe AC, Brown CT: These are not the K-mers you are looking for: Efficient online K-mer counting using a probabilistic data structure. PLoS ONE 2014, 7:e101271.
Zhang Z, Li J, Zhao X-Q, Wang J, Wong GK-S, Yu J: KaKs_Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging. Genomics, Proteomics and Bioinformatics 2006, 4:259-263.
Zhao X, Yu H, Kong L, Li Q: Transcriptomic responses to salinity stress in the pacific oyster Crassostrea gigas. PLoS One 2012, 7:e46244.
Appendix A – Poster Presentations
Poster Presentations
119
International Marine Biotechnology Conference – Convention Centre, Brisbane
(2013)
121
Big Biology and Bioinformatics Symposium – QUT, Brisbane (2014)
122 Error! No text of specified style in document.
Appendix B – Outcomes from associated works
OUTCOMES FROM ASSOCIATED WORKS
Pavasovic, A., Hair, C., Amin, S., Hurwood, D, and P. Prentis. Characterisation of
candidate nuclear genes for species delineation in the genus Cherax.
Conservation Genetic Resources 2:331-333.
Ali MY, Pavasovic A, Amin S, Mather PB, and Prentis PJ. 2015. Comparative analysis
of gill transcriptomes of two freshwater crayfish, Cherax cainii and C.
destructor. Marine Genomics 22:11-13.
Rahi ML, Amin S, Mather PB, Hurwood DA: Candidate genes that have facilitated
freshwater adaptation by palaemonid prawns in the genus Macrobrachium:
Identification and expression validation in a model species (M.
koombooloomba). PeerJ 2017, 2:e2977.