Research ArticleIntermittent Hypoxia Composite Abnormal GlucoseMetabolism-Mediated Atherosclerosis In Vitro and In Vivo: TheRole of SREBP-1

Linqin Ma,1,2 Jingchun Zhang ,1 Yu Qiao,1 Xinli Sun,1 Ting Mao,1 Shuyan Lei,3

Qiaoxian Zheng,4 and Yue Liu 1

1Cardiovascular Diseases Center, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing 100091, China2Department of Emergency, Dongzhimen Hospital, Beijing University of Chinese Medicine, Beijing 100700, China3Cardiopulmonary Division, TCM Hospital of Beijing Mentougou District, Beijing 102300, China4Graduate School, Beijing University of Chinese Medicine, Beijing 100029, China

Correspondence should be addressed to Jingchun Zhang; zhangjingchun276@vip.sohu.comand Yue Liu; liuyueheart@hotmail.com

Received 25 July 2018; Accepted 31 October 2018; Published 4 February 2019

Academic Editor: Vladimir Jakovljevic

Copyright © 2019 Linqin Ma et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Objective. The aim of this study was to establish a 3T3-L1 adipocyte model and ApoE−/−mouse model of intermittent hypoxia (IH)composite abnormal glucose metabolism (AGM) in vitro and in vivo and explore their synergistic damage effect leading toatherosclerosis (AS) and the influence of SREBP-1 signaling molecule-related mechanisms. Methods. Mature 3T3-L1 adipocyteswere cultured with complete culture medium containing DEX 1 × 106 mol/L for 96 h to establish an AGM-3T3-L1 adipocytemodel. Then, AGM-3T3-L1 adipocytes were treated with IH for 0 cycles, 2 cycles, 4 cycles, 8 cycles, 16 cycles, and 32 cycles andsustained hypoxia (SH). ApoE−/− mice were treated with high-fat diet and injection of STZ solution to establish anAGM-ApoE−/− mouse model. A total of 16 AGM-ApoE−/− mice were randomly and averagely divided into the normoxiccontrol group (NC) and model group (CIH). AGM-ApoE−/− mice of the CIH group were treated with IH, which meant that theoxygen concentration fell to 10 ± 0 5% in the first 90 seconds of one cycle and then increased to 21 ± 0 5% in the later 90seconds, continuous for eight hours per day (09 : 00-17 : 00) with a total of eight weeks. Eight C57BL/6J mice were used as theblank control group (Con) which was fed with conventional diet. qPCR and Western blotting were used to detect the expressionlevel of SREBP-1c, FAS, and IRS-1. Oil Red O staining was used to compare the plaque of the aorta among each mouse group.Results. As a result, within 32 cycles of IH, mRNA and protein expression levels of SREBP-1c and FAS in AGM-3T3-L1adipocytes were elevated with the increase in IH cycles; the mRNA expression of IRS-1 was decreased after IH 32 cycles andlower than that of the SH group. For the study in vivo, Oil Red O staining showed a more obvious AS aortic plaque in the CIHgroup. After CIH treatment of 4w and 8w, fasting blood glucose (FBG) of the NC group and CIH group was higher than thatof the Con group, and the insulin level of the CIH group was higher than that of the Con group after IH treatment of 8 w. Theexpressions of the IRS-1 mRNA level in the aorta, skeletal muscle, and liver of the CIH group were lower than those in theCon group. The mRNA and protein expression of SREBP-1c and its downstream molecule FAS in the aorta, skeletal muscle,and liver significantly enhanced in the CIH group in contrast with those in the Con group. Conclusion. The CIH compositeAGM could promote the progress of AS, which might be related to the modulation of the expression of SREBP-1-relatedmolecular pathways.

1. Introduction

Obstructive sleep apnea-hypopnea syndrome (OSAHS),which has high morbidity, is an independent risk factor for

cardiovascular diseases and that predisposes to hyperten-sion, myocardial infarction, heart failure, and even suddencardiac death during the nighttime. Chronic intermittenthypoxia (CIH), which is a pivotal physiopathological

HindawiOxidative Medicine and Cellular LongevityVolume 2019, Article ID 4862760, 11 pageshttps://doi.org/10.1155/2019/4862760

character of OSAHS, could lead to the deterioration of theinsulin resistance and the formation of glucose and lipidmetabolic disorder. The synergy of CIH and abnormal glu-cose metabolism (AGM) can promote vascular endothelialinjury and cause OSAHS-related atherosclerosis (AS) andother vascular lesions. By reviewing and summarizing cur-rent researches, we found that some experimental researcheshave preliminarily studied the possible mechanisms relatedto intermittent hypoxia (IH), insulin resistance, or AGMand AS. For example, literature had suggested the followingpossible signaling molecules or pathways: hypoxia exposureregulated the expression of lysyl oxidase and other targetgenes via promotion of HIF-1; the HIF-1/Angptl4 pathwaymay play a vital role in CIH-mediated abnormal lipidmetabolism and even atherosclerosis formation; andSREBPs, which are closely related to glycolipid metabolism,might be related to CIH-mediated insulin resistance. It couldalso be seen that there are more concerns about the relation-ship between IH and AGM or IH and AS, while it was rare toconsider IH and AGM as costimulatory factors in mediatingAS. In clinical practice, as we know, AGM, dyslipidemia,obesity, and other insulin resistance-based metabolic disor-ders often occur with OSAHS simultaneously, and the syner-gistic effect of IH and AGM on AS might be greater than thesimple sum of the effect of each one. This was the reasonwhy it was necessary to observe the synergistic effect ofCIH and AGM-mediated AS under experimental conditionsto initially answer the above questions provided by insuffi-cient information. This study built a model system of CIHcomposite AGM, both in vitro and in vivo, to observeSREBP-1 signaling molecule-related mechanisms.

2. Materials and Methods

2.1. Materials. The embryo fibroblasts of 3T3-L1 wereobtained from the American Type Culture Collection(ATCC). High-glucose Dulbecco’s modified eagle medium(H-DMEM, HyClone, SH30022), fetal bovine serum (FBS,Gibco, 10099141), phosphate-buffered saline (PBS,HyClone, SH30256), NuPAGE MOPS SDS Running Buffer(NP0001), iBlot Transfer Stack (IB301001), PageRuler Pre-stained Protein Ladder (26617), SuperSignal West FemtoMaximum Sensitivity Substrate (34905), and TRIzolReagent (Invitrogen, 15596-026) were purchased fromThermo Fisher Scientific. 3-Isobutyl-1-methylxanthine(IBMX, I5879), insulin (I5500), dexamethasone (DEX,D1756), glucose assay kit (GAGO20), and diethylpyrocarbonate-treated water (DEPC, 95284) were pur-chased from Sigma-Aldrich. PrimeScript RT Master Mix(RR036A) and SYBR Premix Ex Taq II (RR420A) werepurchased from TaKaRa. SREBP-1 antibody (ab28481),anti-fatty acid synthase (FAS) antibody (ab22759), andp-IRS-1 antibody (ab5599) were purchased from Abcam.β-Actin antibody (TA-09), GAPDH (TA-08), and othersecondary antibodies were purchased from ZSGB-BIO.The Modular Incubator Chamber (MIC-101) was pur-chased from Billups-Rothenberg Inc. The hypoxic animalincubator (YCP-160D) was purchased from ChangshaHuaxiao Electronic Technology Co. Ltd. Other laboratory

equipment included Real-Time Quantitative PCR detect-ing system (ABI 7500, Life Tech) and Western blot electro-phoresis (Thermo Fisher Scientific). Primer sequences areas follows: β-actin mouse F-CCATGTACGTAGCCATCCAG, β-actin mouse R-GAGTCCATCACAATGCCTGT, SREBP-1c mouse F-TTGTGGAGCTCAAAGACCTG,SREBP-1c mouse R–TGCAAGAAGCGGATGTAGTC,IRS-1 mouse F–ATTAAACACTGGGCCTCTGG, andIRS-1 mouse R–GCTGTGCCATACTCTCTCCA (synthe-sized by Sangon Biotech, Shanghai).

2.2. Animals.Male 8-week-old ApoE−/−mice and 8-week-oldC57BL/6J mice were purchased from Beijing Vital RiverLaboratory Animal Technology Co. Ltd. The weight of micewas 23 ± 1 g. All animals were fed in the Animal Experimen-tal Center of Xiyuan Hospital of China Academy of ChineseMedical Sciences with room temperature of 22 ± 2°C, rela-tive humidity of 55 ± 5%, and light time 07:00-19:00. Afteradaptive feeding for a week, the experimental phase began.During the experimental period, all ApoE−/− mice were fedwith high-fat feed. The composition of a high-fat diet [1,2] consisting of 21% fat, 0.15% cholesterol, and 78.85% con-ventional basic feed, was purchased from Beijing HuaFukang Biotechnology Co. Ltd. C57BL/6J mice were givenconventional basic feed. Every 4 weeks, the weight of themice and fasting blood glucose would be detected.

2.3. Cell Culture and Differentiation. Conventional culture,inheritance, cryopreservation, and anabiosis of the embryofibroblasts of 3T3-L1 had been done routinely. Two daysafter contact inhibition of the embryo fibroblasts, for differ-entiation, the cell culture medium would be replaced by celldifferentiation solution I, of which the composition con-tained 0.5mmol/L IBMX, 5 μg/mL insulin, 1 μmol/L DEX,and complete cell culture medium. After 2 days, the mediumwould be changed into cell differentiation solution II, ofwhich the composition contained 5 μg/mL insulin andcomplete cell culture medium, after culture with a celldifferentiation solution II for 8-11 days. For verification bythe method of Oil Red O staining, the rate of celldifferentiation could reach more than 80% and 3T3-L1preadipocytes were successfully differentiated into mature3T3-L1 adipocytes (Figure 1).

2.4. Establishment of Cell Model of IH Composite AGM.Mature 3T3-L1 adipocytes were treated with a completemedium containing DEX 1μmol/L for 96h to establish a cellmodel of AGM. The method of glucose oxidase-peroxidase(GOD-POD) was used to detect the glucose concentrationin the cell culture medium. The result showed that the glu-cose concentration in the group pretreated with the cell cul-ture medium with DEX after 96 h was higher than that of thecontrol group (n = 12, P < 0 05). These AGM-3T3-L1 adipo-cytes would be treated with IH to establish the cell model ofIH composite AGMT3-L1 adipocytes.

The specific procedure was as follows: (1) AGM-3T3-L1adipocytes were replaced with H-DMEM without FBS andcultured for 0.5 h in a cell incubator at 37°C. (2) Hypoxiadevice MIC-101 was UV-disinfected. (3) Cell culture dishes

2 Oxidative Medicine and Cellular Longevity

were placed in MIC-101, while the oxygen electrode wasused to monitor the oxygen concentration at the gas outlet.During the hypoxia phase, the air in the chamber ofMIC-101 was eluted with low oxygen air containing 1%O2, 5% CO2, and 94% N2. When the oxygen concentrationreaches 5%, the intake of low oxygen air would be stoppedand the inlet and outlet would be closed. This hypoxia con-dition would be maintained for 1 minute. Then, the reoxy-gen phase was started, and oxygen was passed into thechamber. When the oxygen concentration at the outletreaches 21%, the intake of oxygen would be stopped andthe inlet and outlet would be closed. This normal oxygencondition would be maintained for 5 minutes. The hypoxiaand reoxygen cycle would be repeated for 2, 4, 8, 16, and32 cycles for different groups of IH (IH2, IH4, IH8, IH16,and IH32) (Figure 2). (4) Another cell culture dish ofAGM-3T3-L1 adipocytes would be treated by sustained hyp-oxia (SH) at the same time, which meant the cells were cul-tured in an oxygen incubator at an oxygen concentration ofabout 5% for about 4 hours, which is the same as in the IH32group.

2.5. Establishment of Animal Model of CIH Composite AGM.The AGM-ApoE−/− mouse model was established byhigh-fat feed and streptozocin (STZ) injection. 16 ApoE−/−

mice, as the AGB group, were given a high-fat diet for 4weeks, and then intraperitoneally injected with STZ solutionat a dose of 50mg/kg for 5 consecutive days [3]. AGM-A-poE−/− mice were randomly divided into 2 groups. EightC57BL/6J mice, as the control group, were injected withthe same volume of sterilized injection water at the sametime. After 72 h, fasting blood glucose (FBG) of each groupwas detected. The blood glucose in the AGB group(9 31 ± 1 32mmol/L) was significantly higher than that inthe control group (6 05 ± 0 43mmol/L) (P < 0 05), whichmeant mice in the AGB group could be used for the nextexperiment.

These AGB-ApoE−/− mice were randomly divided intonormoxia control group (NC) and chronic intermittent hyp-oxia group (CIH) and were fed with high-fat diet. At thesame time, eight C57BL/6J mice of the same week of age,as a blank control group (Con), were fed with conventionalbasic feed. Mice of the CIH group had been treated in a

sealed incubator of hypoxia animal feeding deviceYCP-160D. Specific operational procedures are as follows:(1) put the mice of the CIH group into the incubator andconfirm that the incubator door is closed tightly. (2) Switchon the power of YCP-160D and enter “intermittent hypoxiacontrol” mode. (3) Switch on the gas pressure reducer of theN2 and O2 bottle to start ventilation. (4) In the “N2 intake”mode, adjust the gas pressure reducer of N2 so that the N2outlet pressure is about 0.08 kPa, while in “O2 intake” modeadjust the gas pressure reducer of O2 so that the O2 outletpressure is about 0.015 kPa. (5) Observe several CIH cyclesto ensure that FIO2 of the incubator decreases to 10 ± 0 5%within the former 90 seconds of one cycle and increases to21 ± 0 5% within the later 90 seconds of one cycle; the intakepressure was fine-tuned so that the highest and lowest FIO2is relatively stable in each cycle. (6) CIH treatment lasts for 8hours daily (09:00-17:00) with a total of 8 weeks (Figure 2).

2.6. Methods of Experimental Indicator Test. In the part ofcell experiment, qPCR was used to detect the mRNA expres-sion level of SREBP-1c, FAS, and IRS-1. Western blottingwas used to detect the protein expression level of SREBP-1and FAS. In the part of animal experiment, the serum insu-lin level was measured by ELISA assay at the end of theexperiment. Oil Red O staining was used to compare the pla-que of the aorta among each group. qPCR was used to detectthe mRNA expression levels of SREBP-1c, FAS, and IRS-1 ofthe aorta, skeletal muscle, and liver, while Western blottingwas used to detect SREBP-1c and FAS protein p-IRS-1expression levels of the aorta, skeletal muscle, and liver.

2.7. Statistical Analysis. All measurement data wereexpressed as mean ± standard error (x ± s). Differencesbetween different groups were analyzed by Statistical Pack-age for the Social Sciences version 20.0 (SPSS 20.0). The T-test was used to compare the two groups, while one-wayANOVA was used to compare the multiple groups. For datathat did not meet the normal distribution, the nonparamet-ric Kruskal-Wallis H test was used to compare the groups’differences between levels. A value of P < 0 05 was consid-ered as statistically significant.

3. Results

3.1. Effect of Different IH Cycles on AGM-3T3-L1 Adipocytes.The expression level of SREBP-1c was focused on our exper-iment. The results of qPCR is shown in Figure 3. The expres-sion level of SREBP-1c mRNA was elevated with the increasein the number of IH cycles within 32 cycles of IH treatment.Among these groups, the IH8, IH16, and IH32 groups andthe SH group were statistically different with the IH0 group(P < 0 05); moreover, the IH32 group and SH group werestatistically different with the IH8 group (P < 0 05). Resultsof Western blotting are shown in Figures 4(a) and 4(b). After8 cycles of IH treatment, the expression level of the SREBP-1protein was elevated with the increase in the number of IHcycles. Among them, the IH16 group, IH32 group, and SHgroup were statistically different from the IH0 group, IH2

100 �휇m

Figure 1: Differentiated and mature 3T3-L1 adipocytes (Oil RedO staining).

3Oxidative Medicine and Cellular Longevity

group, and IH4 group (P < 0 05), and the IH32 group wassignificantly different from the IH8 group (P < 0 05).

Furthermore, we detected the protein expression level ofFAS which is a downstream target molecule of SREBP-1c.Results are shown in Figures 4(a) and 4(c). Within 32 cyclesof IH treatment, the expression level of the FAS proteinincreased with the number of IH, and the levels of the IH8group, IH16 group, IH32 group, and SH group were statisti-cally different from that of the IH0 group (P < 0 05).

In order to observe the effect of IH on insulin resistanceof AGM-3T3-L1 adipocytes, qPCR was used to detect theexpression level of IRS-1 mRNA. The results are shown inFigure 5. When AGM-3T3-L1 adipocytes were treated forIH32 cycles, the expression level of IRS-1 mRNA wasdecreased. Compared with the IH0 group and IH2 group,the difference was statistically significant (P < 0 05), andthere was a significant difference compared with the SHgroup (P < 0 05). There was no significant difference amongother groups (P > 0 05).

3.2. Effect of CIH on AGM-ApoE−/− Mice. For the general sit-uation of experimental mice, the weight of mice was mea-sured every 4 weeks. The start of feeding on high-fat dietswas marked as D1. There was no statistical differencebetween the Con group, NC group, and CIH group on D1,

(a)

21%

FiO2%

t

5%

(b)

(c)

21%

10%

t

FiO2%

(d)

Figure 2: Schematic diagram of IH treatment (in vitro) and CIH treatment (in vivo). (a) Schematic diagram of IH treatment (in vitro); (b) IHtreatment cycle pattern (in vitro); (c) schematic diagram of CIH treatment (in vivo); (d) CIH treatment hypoxia cycle pattern (in vivo).

6

4

2

0IH0 IH2 IH4 IH8

#

IH16 IH32 SH

IH0IH2IH4IH8

IH16IH32SH

⁎

#Δ⁎

#Δ�㴚⁎

#Δ�㴚⁎

Figure 3: Effect of different numbers of IH cycles on SREBP-1cmRNA expression (n = 9) (compared with IH0 ∗P < 0 05,compared with IH2 #P < 0 05, compared with IH4 △P < 0 05, andcompared with IH8 □P < 0 05.)

4 Oxidative Medicine and Cellular Longevity

high-fat diet induction at 4w, CIH treatment at 4w, andCIH treatment at 8w. Secondly, we found that mice in theCIH group were observed to have a darker coat and lessactivity than were the other two groups during the experi-ment. Thirdly, the effect of CIH on blood glucosemetabolism-related indicators, including FBG and seruminsulin, was observed. FBG in the NC group and CIH groupwas significantly higher than that in the Con group at CIHtreatment at 4w and CIH treatment at 8w (P < 0 05)(Figures 6(a) and 6(b)). The serum insulin levels in the NCgroup and CIH group were significantly higher than thosein the Con group at CIH treatment at 8w (P < 0 05), andthat of the CIH group was higher than that of the NC group(P < 0 05) (Figure 6(c)).

In order to provide direct evidence for atherosclerosis,the Oil Red O staining method was used to contrast aortic

atherosclerotic plaques in the ascending aorta of mice amongeach group. The following figures show the results of Oil RedO staining from the perspective of the blood vessel cross sec-tion; obvious AS plaques can be seen in the ascending aortaof the mice of the NC group and CIH group (Figures 7(a)–7(c)). We also compared Oil Red O staining in the longitudi-nal sections of the aorta in the NC and CIH groups to give amore intuitive version (Figures 7(d) and 7(e)). It can be seenthat after CIH treatment, the number and area of aortic pla-ques in ApoE−/− mice were significantly increased.

To compare aortic SREBP-1c expression levels in differ-ent groups, qPCR and Western blotting were used to detectand compare mRNA and protein expression levels in theaorta, skeletal muscle, and liver in each group. The resultsof qPCR are shown in Figure 8(a). For the aorta, mRNAexpression levels of SREBP-1c in NC and CIH groups were

SREBP-1

FAS

�훽-Actin

(a)

0

1

2

3

SREB

P-1

#Δ⁎

#Δ�㴚⁎

#Δ⁎

IH0 IH2 IH4 IH8 IH16 IH32 SH

IH0IH2IH4IH8

IH16IH32SH

(b)

0.0

0.5

1.0

1.5

2.0

2.5

※⬦Φ

※

※⬦ΦΨ※⬦Φ

FAS

IH0 IH2 IH4 IH8 IH16 IH32 SH

IH0IH2IH4IH8

IH16IH32SH

(c)

Figure 4: Effect of different numbers of IH cycles on SREBP-1 and FAS expression (n = 9) (a) Representative Western blotting result. (b)Compared with IH0 ∗P < 0 05, compared with IH2 #P < 0 05, compared with IH4 △P < 0 05, compared with IH8 □P < 0 05. (c) Comparedwith IH0 ※P < 0 05, compared with IH2 ◇P < 0 05, compared with IH4 ΦP < 0 05, and compared with IH8 ΨP < 0 05.

5Oxidative Medicine and Cellular Longevity

statistically higher than those in the Con group (P < 0 05).For the skeletal muscle and liver, the mRNA expression levelof SREBP-1c in the CIH group was significantly higher thanthat in the Con group (P < 0 05). The results of Western blot-ting are shown in Figures 8(a) and 8(b). For the aorta, theprotein expression levels of SREBP-1 in NC and CIH groupswere statistically higher than those in the Con group(P < 0 05), and the CIH group was statistically higher thanthe NC group as well (P < 0 05). However, there was no sta-tistically significant difference between the CIH group andthe NC group in the protein expression levels of SREBP-1of the skeletal muscle and liver (P > 0 05).

Then, the protein expression level of FAS which is adownstream molecule of SREBP-1c was detected as well.The results are shown in Figures 8(a) and 8(c). For the aortaand skeletal muscle, the protein expression levels of FAS inthe NC and CIH groups were statistically higher than thosein the Con group (P < 0 05). And the CIH group was statisti-cally higher than the NC group in skeletal muscle (P < 0 05).In the liver, there was no statistical difference in FAS proteinexpression between these groups (P > 0 05).

The effects of CIH on IRS-1 mRNA and p-IRS-1 proteinexpression levels in the aorta, liver, and skeletal muscles inAGM-ApoE−/− mice are shown in Figure 9(a). The mRNAexpression levels of IRS-1 in the aorta, skeletal muscle, andliver were significantly lower in the NC and CIH groups thanthose in the Con group (P < 0 05), while there was no statis-tically significant difference between the CIH and NC groups(P > 0 05). The results of Western blotting are shown inFigures 9(a) and 9(b). For the aorta, the protein expressionlevels of p-IRS-1 in the NC and CIH groups were statisticallyhigher than those in the Con group (P < 0 05), and the CIHgroup was statistically higher than the NC group as well(P < 0 05). However, there was no statistically significant dif-ference between the CIH group and the NC group in the pro-tein levels of p-IRS-1 of the skeletal muscle and liver.

4. Discussion and Conclusion

OSAHS can cause comprehensive damage to various sys-tems of the body, among which secondary cardiovasculardisease is the most common and severe. OSAHS is an inde-pendent risk factor for cardiovascular disease and could leadto increased occurrence of hypertension, stroke, myocardialinfarction, heart failure, arrhythmias, and sudden death inthe night, and these diseases are the main reason thatOSAHS eventually causes disability or death [4–6]. CIH isthe core pathological basis of OSAHS, while CIH and insulinresistance-based disorders of glucose and lipid metabolismdisorder often occur in patients of OSAHS at the same time.CIH and abnormal glucose metabolism (AGM) cooperate topromote the injury of the vascular endothelium and second-ary atherosclerosis (AS) in OSAHS and then promote thedevelopment of OSAHS-related cardiovascular and cerebro-vascular diseases [7–10]. Based on the situation that CIHand AGM often coexist in patients with OSAHS and jointlylead to AS, we intend to establish a composite model of CIHand AGM in this study to help explain the effect of CIH onAGM and their synergistic effect on AS injury.

In the animal research part of this study, the hypoxicanimal incubator (YCP-160D) was used to treat AGM-A-poE−/− mice with a regular pattern of gas circulation to sim-ulate CIH, of which the experimental operation wasrelatively simple and controllable. The CIH stimulation took180 s as one cycle, which means about 20 hypoxic episodesper hour, which is roughly equivalent to human moderateOSAHS [11]. We observed that CIH composite AGB has asignificant effect on promoting AS progression and is signif-icantly stronger than that caused by simple AGB factors.Thus, we established a relatively reliable CIH+AGB-A-poE−/− mouse model. On the other hand, we also observedthat CIH could upregulate the serum insulin level inAGM-ApoE−/− mice and inhibit the expression and phos-phorylation of IRS-1, showing the effect of promoting insu-lin resistance, which may also be an important factor leadingto the progression of AS.

In recent years, the role of sterol regulatoryelement-binding proteins (SREBPs) in the development ofAS has been gaining attention [12, 13]. SREBPs play animportant role in cholesterol anabolism and regulation ofcholesterol balance, being considered as key molecules inrelation to abnormal glucose and lipid metabolism [14].SREBPs are a type of “basic helix-loop-helix-leucine zip-per” (bHLH-ZIP) protein that specifically binds to sterolregulatory element (SRE-1). SREBPs include SREBP-1 andSREBP-2, while the former includes SREBP-1a andSREBP-1c isoforms, which are mainly expressed in the liverand adipocytes, mainly involved in the regulation of choles-terol and fatty acid biosynthesis. Among them, SREBP-1c iswidely expressed in the liver, adipose tissue, skeletal mus-cle, adrenal glands, etc., playing a more important roleand having more abundant research evidence in currentstudies [15]. The SREBPs are anchored on the endoplasmicreticulum membrane and combined with the SREBPcleavage-activating protein (SCAP) to form the SCAP/S-REBP complex. Intracellular hypocholesterol, insulin,

1.5

1.0

0.5

0.0IH0 IH2 IH4 IH8 IH16 IH32 SH

IH0IH2IH4IH8

IH16IH32SH

#

#

⁎

⁎⁎

Figure 5: Effect of different numbers of IH cycles on IRS-1mRNA expression (n = 9) (IH32 vs IH0 or IH2 ∗P < 0 05, IH32vs SH #P < 0 05).

6 Oxidative Medicine and Cellular Longevity

insulin-like growth factor I, etc., can promote the transferof SCAP/SREBP complexes to the Golgi apparatus tobecome nuclear SREBP (nSREBP). The latter rapidlymigrates into the nucleus and binds to SRE-1, activatingits target genes such as the low-density lipoprotein receptor(LDLR) gene, the acetyl-CoA carboxylase (ACC) gene, thefatty acid synthase (FAS) gene, and transcription andexpression of glucokinase (GK) genes. In our study, weobserved the effects of different degrees of IH stimulation

on SREBP-1-related signaling molecules mainly throughthe cell experiments in vitro.

There, what role does SREBP-1 play in IH impactingon AGM and even AS? In the first place, there is a correla-tion between IH and SREBPs. Current studies suggest thatIH can activate SREBPs through complex molecular path-ways. Oxidative stress and inflammatory response areoften observed as prominent effects caused by IH. On theone hand, the levels of ROS and HIF-1α increased

0

5

10

15FB

G (m

mol

/L)

6.68 ± 0.91

Con NA CIH

9.64 ± 1.16 9.90 ± 1.31

(a)

FBG

(mm

ol/L

)

6.33 ± 0.88

10.20 ± 1.4410.99 ± 1.34

0

5

10

15

Con NA CIH

(b)

0

50

100

150

200

250

Seru

m in

sulin

(�휇m

ol/L

)

106.55 ± 14.53

147.86 ± 20.77188.61 ± 15.21

Con NA CIH

(c)

Figure 6: The level of FBG and serum insulin in the Con group, NC group, and CIH group. (a) FBG at CIH treatment at 4w, (b) FBG at CIHtreatment at 8w, and (c) serum insulin at CIH treatment at 8 w.

(a) (b) (c)

(d) (e)

Figure 7: Aortic atherosclerotic plaques (Oil Red O staining). (a–c) Aortic atherosclerotic plaques in the ascending aorta: (a) Con group, (b)NC group, and (c) CIH group. (d, e) The longitudinal sections of the aorta in the NC and CIH group: (d) NC group and (e) CIH group.

7Oxidative Medicine and Cellular Longevity

significantly under IH conditions [16, 17]. IH may upreg-ulate the HIF-1α/SREBP-1c/FAS pathway through theROS pathway, leading to abnormal lipid metabolism, whileSCAP has a linker site for HIF-1, and HIF-1 may also reg-ulate SREBP expression through this pathway. On theother hand, IH-mediated low-level inflammation in vari-ous tissues of the body is also associated with SREBPs.IH can cause an upregulation of NF-κB signaling pathways[18], while other studies suggest that NF-κB expressionlevels and SREBP expression have a positive correlation[19]. In our study, IH enhanced the expression level ofSREBP-1c and its downstream FAS mRNA and proteinin AGM-3T3-L1 adipocytes, especially in the IH cyclemore than 8 times. There was a positive correlationbetween the upregulation of SREBP-1c levels and the

increase in the number of IH cycles, and the effect wasgreater than that of SH at the same stimulation time. Inthe second place, SREBPs play a pivotal role in insulinresistance and abnormal glucose and lipid metabolism.Studies have shown that upregulation of SREBP-1c mayrestrain the expression of IRS and its downstream signal-ing molecule Akt and suppress insulin sensitivity, whiledrugs that exert anti-inflammatory effects through theSREBP-1c pathway can significantly improve pancreaticβ-cell function and produce antidiabetic effects [20]. Inumbilical vein endothelial cells (HUVEC), inhibiting theexpression of SREBP-1c and its downstream pathwaysincluding the FAS gene can reduce the vascular proinflam-matory responses associated with metabolic abnormalities,thereby inhibiting the occurrence of atherosclerosis [12].

0.0

0.5

1.0

1.5

Live

r FA

S

0.0

0.5

1.0

1.5

#

#�㵻

Skel

etal

mus

cle F

AS

0.0

0.5

1.0

1.5 ⁎ ⁎

Aort

a FA

S

0.0

0.5

1.0

1.5

2.0

Φ

Φ

Live

r SRE

BP-1

0

2

4

6

⁎

ConNCCIH

Con NC CIH Con NC CIH Con NC CIH

Con NC CIH Con NC CIH Con NC CIH

Con NC CIH Con NC CIH Con NC CIH

⁎

Aort

a SRE

BP-1

c

0

2

4

6 #

Skel

etal

mus

cle S

REBP

-1c

0

1

2

3

4�㵻

Live

r SRE

BP-1

c

0.0

0.5

1.0

1.5

2.0

⁎

⁎#

Aort

a SRE

BP-1

FAS

prot

ein

SREB

P-1c

mRN

ASR

EBP-

1 pr

otei

n

Aorta LiverSkeletal muscle

0.00.51.01.52.02.5

�㵻

�㵻

Skel

etal

mus

cle S

REBP

-1

(a)

Con NC CIH

Aorta

Skeletal muscle

Liver

(b)

Con NC CIH

Aorta

Skeletal muscle

Liver

(c)

Figure 8: Effect of CIH treatment on SREBP-1c and FAS expression in different tissues (n = 6). (a) The first line showed SREBP-1c mRNAexpression: aorta, compared with Con ∗P < 0 05; skeletal muscle, compared with Con #P < 0 05; and liver, compared with Con ΔP < 0 05. Thesecond line showed SREBP-1 protein expression: aorta, compared with Con ∗P < 0 05, compared with NC #P < 0 05; skeletal muscle,compared with Con ΔP < 0 05; and liver, compared with Con φP < 0 05. The third line showed FAS protein expression: aorta, comparedwith Con ∗P < 0 05; skeletal muscle, compared with Con #P < 0 05, compared with NC ΔP < 0 05; and liver, P > 0 05. (b) RepresentativeWestern blotting result of SREBP-1. (c) Representative Western blotting result of FAS.

8 Oxidative Medicine and Cellular Longevity

In addition, the main function of SREBP-1c is to modulatefatty acid metabolism, which is mainly achieved throughthe regulation of fat metabolism-related genes such asFAS. In summary, the current study can prove thatSREBP-1c is closely related to insulin resistance andabnormal metabolism of glucose and lipids, while this cor-relation has not been discussed under the condition of IH.Our research is based on this and found that IH promotesthe expression of SREBP-1c in adipocytes while inhibitingthe expression of IRS-1 and inhibiting the uptake and uti-lization of glucose. At the level of animals in vivo, as well,CIH stimulation can upregulate the expression ofSREBP-1c and FAS in the aorta, skeletal muscle, and liver.

As we described above for the role SREBP-1 moleculesplay in this process, our study examined the effect of CIHon the expression of SREBP-1 signaling molecules in theaorta, skeletal muscle, and liver. This is the first time thatthis effect of CIH has been observed at the level of animalexperiments and has not been reported in the current study.In our study, the aorta was used as the main observationobject. It was observed that CIH composite AGM promotedthe expression of SREBP-1c and FAS in the aorta, inhibitedthe expression and phosphorylation of IRS-1, and had anobvious AS-promoting effect. Therefore, the effect of ASpromotion might be related to the promotion of the

expression of SREBP-1c-related signaling molecules in arte-rial vessels. In addition, we also observed that CIH compos-ite AGM significantly promoted the expression of theSREBP-1c/FAS signaling pathway in the skeletal muscleand observed its inhibition of IRS-1 expression and phos-phorylation at the same time. Previous studies have investi-gated the upregulation of SREBP-1c/FAS expression anddownregulation of p-IRS-1 expression in cultured insulinresistance muscle cells in vitro, and drugs such as metfor-min, which inhibit the expression of SREBP-1c and FAS,can improve insulin resistance [21]. Then, CIH-mediatedstudies of the relationship between IR and SREBP-1c/FASsignaling pathways are also of further concern. Therefore,studies on the relationship between CIH andSREBP-1-related signaling pathways are also worth moreattention in improving skeletal muscle insulin resistance.Finally, the effect of CIH composite AGM on the expressionof the hepatic SREBP-1-related signaling pathway and theeffect of inhibiting hepatic IRS-1 expression and phosphory-lation levels were also observed. Thus, it was speculated thatCIH composite AGM may promote insulin resistance andlipid deposition of the liver through the SREBP-1-relatedsignaling pathway. This may provide some new ideas forthe current study of SREBP-1c and nonalcoholic fatty liverdisease (NAFLD), obesity, and OSAHS [22, 23].

0.0

0.5

1.0

1.5

Live

r pIR

S-1

0.0

0.5

1.0

1.5

Aort

a IRS

-1

0.0

0.5

1.0

1.5

##

Skel

etal

mus

cle IR

S-1

0.0

0.5

1.0

1.5

Live

r IRS

-1

0.0

0.5

1.0

1.5

2.0

#

Aort

a pIR

S-1

0

1

2

3

Skel

etal

mus

cle p

IRS-

1

p-IR

S-1

prot

ein

IRS-

1 m

RNA

�㴚�㴚

�㵻�㵻

�㵻�㵻

Con NC CIH Con NC CIH Con NC CIH

Con NC CIH Con NC CIH Con NC CIH

⁎

⁎

⁎

⁎

Aorta LiverSkeletal muscle

ConNCCIH

(a)

Con NC CIH

Aorta

Skeletal muscle

Liver

(b)

Figure 9: Effect of CIH treatment on IRS-1 mRNA expression and pIRS-1 expression in different tissues (n = 6). (a) The first line showedIRS-1 mRNA expression: aorta, compared with Con ∗P < 0 05; skeletal muscle, compared with Con #P < 0 05; and liver, compared withCon ΔP < 0 05. The second line showed pIRS-1 protein: aorta, compared with Con ∗P < 0 05, compared with NC #P < 0 05; skeletalmuscle, compared with Con ΔP < 0 05; and liver, compared with Con □P < 0 05. (b) Representative Western blotting result.

9Oxidative Medicine and Cellular Longevity

In summary, an animal model of a CIH compositeAGM-mediated AS animal model was established in ourstudy. And we found that CIH composite AGM couldpromote the progress of AS, which might be related tothe modulation of the expression of SREBP-1-relatedmolecular pathways.

Data Availability

The data used to support the findings of this study areincluded within the article.

Conflicts of Interest

The authors have no conflicts of interests to declare.

Authors’ Contributions

Yue Liu and Jingchun Zhang conceived and designed theexperimental protocol. Ma L, Qiao Y, Sun X, Lei S, and ZhengQ performed the experiments. Ma L, Qiao Y, andMao T ana-lyzed the data. Ma L wrote the paper. All the authorsreviewed and approved the submitted version of the paper.

Acknowledgments

This work was supported by grants from NationalNatural Science Foundation of China (No. 81573817)of Jingchun Zhang and Beijing NOVA Program (No.Z171100001117027) to Yue Liu.

References

[1] L. Sleiman, R. Beanlands, M. Hasu et al., “Loss of cellularinhibitor of apoptosis protein 2 reduces atherosclerosis in ath-erogenic apoE−/− C57BL/6 mice on high-fat diet,” Journal ofthe American Heart Association, vol. 2, no. 5, article e000259,2013.

[2] A. L. Almalki, A. A. R. Sayed, and H. A. E. Rabey,“Proanthocyanidin attenuation of oxidative stress andNF-κB protects apolipoprotein E-deficient mice against dia-betic nephropathy,” Evidence-based Complementary andAlternative Medicine, vol. 2013, Article ID 769409, 8 pages,2013.

[3] N. M. Hanssen, O. Brouwers, M. J. Gijbels et al., “Glyoxalase 1overexpression does not affect atherosclerotic lesion size andseverity in ApoE−/−mice with or without diabetes,” Cardiovas-cular Research, vol. 104, no. 1, pp. 160–170, 2014.

[4] T. D. Bradley and J. S. Floras, “Obstructive sleep apnoea and itscardiovascular consequences,” The Lancet, vol. 373, no. 9657,pp. 82–93, 2009.

[5] V. Bazan, N. Grau, E. Valles et al., “Obstructive sleep apnea inpatients with typical atrial flutter: prevalence and impact onarrhythmia control outcome,” Chest, vol. 143, no. 5,pp. 1277–1283, 2013.

[6] A. S. Gami, E. J. Olson, W. K. Shen et al., “Obstructive sleepapnea and the risk of sudden cardiac death: a longitudinalstudy of 10,701 adults,” Journal of the American College of Car-diology, vol. 62, no. 7, pp. 610–616, 2013.

[7] Z. J.-c. MaLinqin and L. Yue, “Roles and mechanisms ofobstructive sleep apnea-hypopnea syndrome and chronic

intermittent hypoxia in atherosclerosis: evidence and prospec-tive,” Oxidative Medicine and Cellular Longevity, vol. 2016,Article ID 8215082, 10 pages, 2016.

[8] L. F. Drager, V. Y. Polotsky, and G. Lorenzi-Filho, “Obstruc-tive sleep apnea: an emerging risk factor for atherosclerosis,”Chest, vol. 140, no. 2, pp. 534–542, 2011.

[9] S. M. Grundy, “Metabolic syndrome update,” Trends inCardiovascular Medicine, vol. 26, no. 4, pp. 364–373,2015.

[10] V. A. Raghavan, “Insulin resistance and atherosclerosis,”HeartFailure Clinics, vol. 8, no. 4, pp. 575–587, 2012.

[11] A. Qaseem, J. E. Holty, D. K. Owens et al., “Management ofobstructive sleep apnea in adults: a clinical practice guidelinefrom the American College of Physicians,” Annals of InternalMedicine, vol. 159, no. 7, pp. 471–483, 2013.

[12] L. Zhang, D. Huang, Q. Wang et al., “MiR-132 inhibits expres-sion of SIRT1 and induces pro-inflammatory processes of vas-cular endothelial inflammation through blockade of theSREBP-1c metabolic pathway,” Cardiovascular Drugs andTherapy, vol. 28, no. 4, pp. 303–311, 2014.

[13] K. L. Ma, J. Liu, C. X. Wang et al., “Activation of mTOR mod-ulates SREBP-2 to induce foam cell formation throughincreased retinoblastoma protein phosphorylation,” Cardio-vascular Research, vol. 100, no. 3, pp. 450–460, 2013.

[14] J. Kotzka and D. Müllerwieland, “Sterol regulatoryelement-binding protein (SREBP)-1: gene regulatory targetfor insulin resistance?,” Expert Opinion on Therapeutic Tar-gets, vol. 8, no. 2, pp. 141–149, 2004.

[15] W. Li, Y. Li, Q. Wang, and Y. Yang, “Crude extracts fromLyciumbarbarum suppress SREBP-1c expression and preventdiet-induced fatty liver through AMPK activation,” BioMedResearch International, vol. 2014, Article ID 196198, 10 pages,2014.

[16] G. Yuan, J. Nanduri, S. Khan, G. L. Semenza, and N. R. Prab-hakar, “Induction of HIF-1α expression by intermittent hyp-oxia: involvement of NADPH oxidase, Ca2+ signaling, prolylhydroxylases, and mTOR,” Journal of Cellular Physiology,vol. 217, no. 3, pp. 674–685, 2008.

[17] L. J. Teppema and A. Dahan, “The ventilatory response to hyp-oxia in mammals: mechanisms, measurement, and analysis,”Physiological Reviews, vol. 90, no. 2, pp. 675–754, 2010.

[18] Q. Han, S. C. Yeung, M. S. Ip, and J. C. Mak, “Intermittenthypoxia-induced NF-κB and HO-1 regulation in human endo-thelial EA.hy926 cells,” Cell Biochemistry and Biophysics,vol. 66, no. 3, pp. 431–441, 2013.

[19] Y. Li, S. Xu, B. Jiang, R. A. Cohen, and M. Zang, “Activa-tion of sterol regulatory element binding protein andNLRP3 inflammasome in atherosclerotic lesion developmentin diabetic pigs,” PLoS One, vol. 8, no. 6, article e67532,2013.

[20] S. S. Sole, B. P. Srinivasan, and A. S. Akarte, “Anti-inflamma-tory action of tamarind seeds reduces hyperglycemic excursionby repressing pancreatic β-cell damage and normalizingSREBP-1c concentration,” Pharmaceutical Biology, vol. 51,no. 3, pp. 350–360, 2013.

[21] X. Tang, J. Li, W. Xiang et al., “Metformin increases hepaticleptin receptor and decreases steatosis in mice,” Journal ofEndocrinology, vol. 230, no. 2, pp. 227–237, 2016.

[22] Y. S. Lai, W. C. Lee, Y. E. Lin et al., “Ginger essential oil ame-liorates hepatic injury and lipid accumulation in high fatdiet-induced nonalcoholic fatty liver disease,” Journal of

10 Oxidative Medicine and Cellular Longevity

Agricultural and Food Chemistry, vol. 64, no. 10, pp. 2062–2071, 2016.

[23] M. T. Arias-Loste, E. Fábrega, M. López-Hoyos, and J. Crespo,“The crosstalk between hypoxia and innate immunity in thedevelopment of obesity-related nonalcoholic fatty liver dis-ease,” BioMed Research International, vol. 2015, Article ID319745, 8 pages, 2015.

11Oxidative Medicine and Cellular Longevity

Stem Cells International

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

MEDIATORSINFLAMMATION

of

EndocrinologyInternational Journal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Disease Markers

Hindawiwww.hindawi.com Volume 2018

BioMed Research International

OncologyJournal of

Hindawiwww.hindawi.com Volume 2013

Hindawiwww.hindawi.com Volume 2018

Oxidative Medicine and Cellular Longevity

Hindawiwww.hindawi.com Volume 2018

PPAR Research

Hindawi Publishing Corporation http://www.hindawi.com Volume 2013Hindawiwww.hindawi.com

The Scientific World Journal

Volume 2018

Immunology ResearchHindawiwww.hindawi.com Volume 2018

Journal of

ObesityJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Computational and Mathematical Methods in Medicine

Hindawiwww.hindawi.com Volume 2018

Behavioural Neurology

OphthalmologyJournal of

Hindawiwww.hindawi.com Volume 2018

Diabetes ResearchJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Research and TreatmentAIDS

Hindawiwww.hindawi.com Volume 2018

Gastroenterology Research and Practice

Hindawiwww.hindawi.com Volume 2018

Parkinson’s Disease

Evidence-Based Complementary andAlternative Medicine

Volume 2018Hindawiwww.hindawi.com

Submit your manuscripts atwww.hindawi.com