h yue et al. nature 000 , 1-5 (2012) doi:10.1038/nature11492

H Yue et al. Nature 000, 1-5 (2012) doi:10.1038/nature11492 The 11 April 2012 rupture sequence.

Upload: xaviera-mcguire

Post on 03-Jan-2016

26 views

Category:

Documents

0 download

Report

Download

Tags:

rupture sequence

Embed Size (px):

DESCRIPTION

The 11 April 2012 rupture sequence. H Yue et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11492. - PowerPoint PPT Presentation

TRANSCRIPT

H Yue et al. Nature 000, 1-5 (2012) doi:10.1038/nature11492

The 11 April 2012 rupture sequence.

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

GI Motility online (May 2006) | doi:10.1038/gimo6

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05202 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo46

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo12

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Nature , 2008, Doi:10.1038/nature07103

doi:10.1038/nature12886 Neanderthal from the Altai

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/ncomms1280 molecular dynamics of single

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

doi:10.1038/nature06481 LETTERS

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental