h uoyama et al. nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

H Uoyama et al. Nature 492, 234-238 (2012) doi:10.1038/nature11687 Photoluminescence of the CDCB series.

Upload: elgin

Post on 20-Jan-2016

54 views

Category:

Documents

0 download

Report

Download

Tags:

Embed Size (px):

DESCRIPTION

Photoluminescence of the CDCB series. H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687. - PowerPoint PPT Presentation

TRANSCRIPT

H Uoyama et al. Nature 492, 234-238 (2012) doi:10.1038/nature11687

Photoluminescence of the CDCB series.

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Published in Nature Materials (2016) doi:10.1038/nmat4569

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature , 2008, Doi:10.1038/nature07103

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

h uoyama et al. nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

Documents

h uoyama

cdcb series