genetic substructure of the pacific harbor seal (phoca vitulina richardsi) off washington, oregon,...

MARINE MAMMAL SCIENCE, 12(3):402-413 (July 1996) 0 1996 by the Society for Marine Mammalogy

GENETIC SUBSTRUCTURE OF THE PACIFIC HARBOR SEAL

(PHOCA VITULINA RICHARDSI) OFF WASHINGTON, OREGON, AND CALIFORNIA

MARGARET M. LAMONT~ J. T. VIDA~

JAMES T. HARVEY~ STEVEN JEFFRIES~ ROBIN BROWN

HARRIET H. HUBER ROBERT DELONG~

W. KELLEY THOMAS~ ‘Moss Landing Marine Laboratories, P.O. Box 450, Moss Landing, CA 950.~9

*Department of Biological Sciences, University of Missouri-Kansas City, 5100 Rockhill Road, Kansas City, MO 64110

washington Department of Wildlife, Marine Mammal Investigations, 7801 Phillips Road, SW., Tacoma, WA 98498

*Oregon Department of Fish and Wildlife, 2040 SE. Marine Science Dr.:, Newport, OR 97365

5National Marine Mammal Laboratory, National Marine Fisheries Service, Bldg. 4, 7600 Sand Point Way, Seattle, WA 98115

ABSTRACT

Genetic substructure among groups of Pacific harbor seals, Phoca vitulina richardsi, along the western coast of the United States was investigated using mitochondrial DNA sequences. Blood and tissue samples were removed from 86 seals inhabiting Puget Sound and the Pacific coasts of Washington, Ore- gon, and California. A 320 base-pair segment of the control region was am- plified using the polymerase chain reaction and directly sequenced. These data indicated a high level of diversity. Thirty variable sites were found that define 47 mitochondrial haplotypes. Among groups of P. v. richardsi sampled, 5 haplotypes were shared, but most (42) were unique to a locality. Haplotypic frequency and an Analysis of Molecular Variance (AMOVA) revealed significant differences (P = 0.001) among regions. Phylogenetic analysis indicated Puget Sound seals possess unique divergent lineages not found in seals from the coasts of Washington, Oregon, and California. These lineages may represent haplotypes from north of Washington, which is consistent with late reproductive timing of harbor seals from Puget Sound.

Key words: harbor seal, Phoca vitulina richardsi, polymerase chain reaction, mitochondrial DNA haplotypes, Puget Sound, genetic structure.

402

LAMONT ETAL.: HARBORSEALGENETICS 403

The Pacific harbor seal (Phoca vitulina richardsi) inhabits much of the western coast of North America from Baja California, Mexico, to Alaska (King 1983). There are an estimated 300,000 Pacific harbor seals, with most (approximately 85%) residing in Alaskan waters. Of the remaining 15%, approximately 42,000 are found off Washington, Oregon, and California (Bon- nell et al, 1983). Although these groups are considered one subspecies (P. v. richardsi, Shaughnessy and Fay (1977) reported a cline in harbor seal pelage, with a larger portion of harbor seals in the south of their range being darker than those in the north.

In addition to variation in pelage color, Pacific harbor seals exhibit extensive variation in reproductive timing. Throughout most of their range, timing of harbor seal pupping varies according to latitude (King 1983). Harbor seals in Mexico are born in early February, whereas pupping off Oregon occurs April through June. Off British Columbia and Alaska, pupping occurs from May through September (King 1983). Therefore, birth date in harbor seals may be regulated by photoperiod (Newby 1972, Temte 1991).

Exceptions to the correlation between photoperiod and breeding date, are the harbor seals in Puget Sound, Washington. In Puget Sound pupping begins in July and continues through September, yet pupping along the outer coast of Washington occurs approximately two months earlier, beginning in April and peaking in June (Jeffries and Johnson 1990). Harbor seals along the inner and outer coasts of Washington occur at about the same latitude (47”N), therefore, they are exposed to equal day lengths. This indicates photoperiod alone does not determine reproductive timing of harbor seals in Washington. Reproductive timing of deer mice (Peromyscus maniculatus) and birds may be genetically regulated (Desjardins et al. 1986, Price et al. 1988), and Temte (1991) proposed a genetic influence on pupping dates of captive harbor seals. Also, cranial morphometric analysis indicated significant differences between harbor seal skulls from Puget Sound and the Pacific coast of Washington (Temte 1993). Genetic regulation of reproductive timing would require genetic isolation among harbor seal groups, particularly those along the inner and outer coasts of Washington, which are geographically close but display different pupping dates.

Our objectives were to test for genetic substructuring among Pacific harbor seal groups that exhibit different pupping seasons. For this analysis we compared four groups. Three that represent typical clines of reproductive timing include: (1) the outer coast of Washington (Grays Harbor), (2) the outer coast of Oregon (the Umpqua River), and (3) the outer coast of California (Monterey Bay). A fourth population, that does not adhere to the typical clinal birth timing, was sampled from the inner coast of Washington (Gertrude Island in southern Puget Sound). To test for genetic structure we sequenced a portion of the control region of the mitochondrial genome from 86 seals and compared genetic differences among groups.

MATERIAI~ AND METHODS

Sampling-Harbor seals were caught in southern Puget Sound (Gertrude Island) during November 1992 and June 1993; Grays Harbor, Washington,

404 MARINE MAMMAL SCIENCE, VOL. 12, NO. 3, 1996

and the Umpqua River, Oregon, during June 1993; and Monterey Bay, Cal- ifornia, during October 1993 (Fig. 1). Blood was removed from 82 seals (Ger- trude n = 32, Grays Harbor n = 19, Umpqua River n = 20, California n = 15), and approximately one ml from each individual was placed in 0.01. mil- limole of ethylenediaminetetraacetic acid (EDTA) or sodium heparin to pre- vent clotting. DNA was extracted from 5 p,l of blood using Chelex 100 (Walsh et al. 1991). Approximately 10 ~1 was removed from the final 2 ml of Chelex solution, and used as the template for PCR reactions. Samples of liver were removed from four seals that stranded along the coast of Monterey Bay. Sam- ples were transported on dry ice and stored at -2O’C.

Amplification and sequencing-Polymerase chain reactions were performed in 25+1 reactions containing 67 mM Tris-HCl (pH.8.8), 6.7 mM MgCI,., 16.6 mM (NH;,),S04, 10 mM B-mercaptoethanol, one mM each dNTP, one FM of each primer, and 10 ~1 of Chelex-extracted DNA. The initial double- stranded amplifications employed primers Ll6274 (TACACTGGTCTTGT- AAACC) and HI 67.52 ATGACCCTGAAGAAGIAGAACCAG), which cor- responded to the published sequence of Arnason and Johnsson (1992). Am- plifications occurred by 30 cycles of denaturation at 94°C for 40 set, annealing at 52 “C for one minute, and extension at 72°C for two minutes, Five ~1 of product was resolved by electrophoresis in 2% NuSieve agarose gel and vi- sualized with ethidium bromide staining. Approximately 5 p,l of the resulting band was diluted in 100 ~1 of water. We then subjected 1 ~1 of this sample to asymmetric amplification to generate templates for sequencing by the un- balanced primer method of Gyllensten and Erlich (1988). Single stranded DNA suitable for sequencing was generated using the original primers and two internal primers, L163 71 (TCTAATTAAACTATTCCCTG) and HI 6571 (GGTGTTACAACCGTATGCCA). Templates were concentrated and desalted on Ultrafree-mc filters (Millipore). All sequencing reactions were performed using Sequenase (United States Biochemical).

Data analysis-An Analysis of Molecular Variance (AMOVA; Excoffier et al. 1992) was conducted on pairwise differences and haplotypic frequency to determine within- and among-group genetic diversity. Phylogenetic relation- ships were assessed using neighbor-joining (Saitou and Nei 1987) and Phy- logenetic Analysis Using Parsimony (PAUP; Swofford 1990). The neighbor- joining tree was developed using all haplotypes on Kimura corrected sequences as implemented in Molecular Evolutionary Genetic Analysis (MEGA) (KLumar et al. 1993) and was midpoint rooted. The parsimony tree was constructed using only those haplotypes that differed by more than one site. The tree was rooted at its midpoint by the published P. v. vitulina sequence (Arnason and Johnsson 1992).

RESULTS AND DISCUSSION

MtDNA sequence variation-Among 86 harbor seals, 30 variable sites were observed that define 47 unique haplotypes (Table 1). Twenty-nine variable sites were transition substitutions, and one was a length change. There were

LAMONT ETAL.: HARBOR SEAL GENETICS 405

GRAYS

HARBOR

n = 19

UMPQUA

MONTEREY BAY

n = I.5

Figure 1. Areas where samples were removed from harbor seals for mtDNA sequencing. Numbers represent sample sizes for each location.


Table 1. Haplotypic frequency among 86 P. v. richardsi, and variable sites in the control region of the 47 mtDNA types. Numbers across the top refer to 37 variable sites numbered according to Arnason and Johnsson (1992). The sequence for type 1 is shown at all 37 sites; bases present in the other types are shown only when different from type 1. Identical bases are indicated by a dot. Dashes denote deletions relative to type 1. Numbers below region abbreviations indicate numbers of each haplotype per region. Within the published sequence, bold letters indicate variable sites found only between P. v. richardsi and P. v. vitulina. Publ. = the published P u. vitulina sequence of Arnason and Johnsson (1992). WS = Washington-Puget Sound, WC = Washington-Pacific coast, OR = Oregon, CA = California. Haps. = haplotypes.

Haps. Variable sites

8125247934012679314902989890847359244 8111444456777777899455566778890111389 3444444444444444444555555555556666666

1 TAATAGATCGTGCTCCTGCAGGAATCGGATTGTATAA C ; C::-G.~..::....:C..:~-~~......~~..~ ..

4 C...G:-::..:i::.C::....G:::i::..::C:: C

2 c:: .G.-........TC......G.....C....C .. .G.-.....T...C.................C ..

7 C...G.-C...............G.........GC .. 8 C...G.-.........C......G...A......C .. 9 C...G.-.........C......G.....C....C ..

10 CG .... -C.A..T.TTC.......C.A.GC.AC.C .. 11 ... ..A..........C .................... 12 ......... ..A....C .................... 13 ......... ..A....C....A ............... 14 - .A 15 C:::G:-::::A::::C::::::G:.........C ............ 16 C...G.-.........C.................C .. 17 C...G.-.....T...C......G.........GC .. 18 C...G.-.........C..........A......C .. 19 C...G.-.........C .................... 20 C......................G..........C .. 21 C...G.-.....T...C....A............C .. 22 C...G.-.....T...C......G...A ......... 23 C...G.-.....T...C......G...A......CG. 24 c...............c .................... 25 C.....-........TC.......C.A.G.C.C .... 26 C..........A....C .................... 27 CG....-..A....TTC.......C.A..C..C ....

C zi c::::

.-.........C....A....A.....CG ... ..TC.T.........G.C.CG

30 C...G:I::::i,...C ...... .C.A.GC.AC.C ..... 31 CG....-..A....TTC.......C.A.G..AC.C ..

C ;; c::

.G.-.....T...C ....................

... T.TT .. ..C.A.GC.AC.C

34 . . . . . . ::i....C.::::.G ..

35 ..................... ..

..G..:i::::::h:: 36 ..................... ..G.........GC .. 37 ... ..A.....A....C .................... 38 ........ ..c.....c ....................

. .CA ... .G G 2 ::::::::::::::.........:c:&&:c:.

- WS WC OR CA - -

2

:

3 2

2

2 2

1

1

1 1 1

1

1

1 1

1

5 i 1 1

1 2

3 3

2

1 1

1 1 1

1

1 1

1 1

1

1

1

1

1

1 1

1 1

1


Table 1. Continued.

Haps. Variable sites WS WC OR CA

41 .. ..G..........TC......G..........C .. 1 42 .. ..G...........C.........A .......... 1

t: :: ..G.-.....T...C .................... 1 ..G.-.........C.................C .. 1

45 .. ..G.-.........C .................... 1 ... .G.- _. ... :T. . .C......G..........C . . 1

Publ c:cc::.:T::..c:.c::oA:: G .......... C ....

1 ..TAA .........

no transversions. Within the 320 base pairs examined, the observed number of pairwise differences among haplotypes ranged from 1 to 16. This high level of genetic divergence is in contrast to observations that pinnipeds have low genetic variability (Simonsen et al. 1982, Testa 1986). Hoelzel et ul. (1993) found only two haplotypes in 300 base pairs of the mtDNA control region of 40 northern elephant seals, Mirounga angustirostris, and Maldonado et al. (1995) found no variation in 368 base pairs of the cytochrome b region of 40 Cali- fornia sea lions (Zalophus californianus). Harbor seal genetic diversity, however, is comparable to that found among house mouse populations in Europe, where Prager et ul. (1993) found 56 haplotypes within the entire control region of 104 mice, with pairwise divergence levels similar to levels we found among harbor seals.

Most pinniped species studied previously, such as elephant seals, have been severely exploited, which would result in low genetic variability. Bonnell and Selander (1974) found no polymorphisms among 159 northern elephant seals from Mexico and California. They suggested this was due to severe hunting of the seals in the mid-1800s, that resulted in near extinction of the species. Therefore, the present population’s genetic resources may have been derived from a few isolated individuals. Throughout their history Pacific harbor seals, however, have increased or remained stable in numbers throughout most of their range. Harbor seal numbers have increased by 7%-31% in Washington from 1977 to 1984, 6%-8% in Oregon from 1977 to 1984 (Harvey et al. 1990), and 14% from 1965 to 1986 in California (Boveng 1988). Although harbor seals are often killed by fishermen, who consider them a nuisance, a severe decline such as occurred with northern elephant seals has not been reported. Therefore, the great levels of variation we found among Pacific harbor seals may be because throughout Washington, Oregon, and California they have not experienced a significant reduction in numbers.

Also, previous studies on pinniped genetics have reported low genetic diversity of blood proteins (Bonnell and Selander 1974, Simonsen et al. 1982, Testa 1986), and minisatellite loci (Lehman et al. 1993). Mitochondrial DNA may be a greater source of variation in pinnipeds than previously studied


Table 2. Analysis of Molecular Variance on (a) distance matrix and (b) frequency matrix, among harbor seal haplotypes from Washington, Oregon, and California. The Phi- statistic is an F-statistic analog that reflects the tendency of an animal to be more similar to an animal in its group than an animal in another group. P = probability of having a more extreme variance component and Phi-statistic than the observed values by chance.

Variance component Variance % total P Phi-statistics

a. Haplotypic distances Among regions Within populations

b. Multiallelic distances Among regions Within populations

0.378 12.38 0.001 0.124 2.678 87.62 0.876

0.025 5.14 0.001 0.05 1 0.464 94.86 0.949

protein molecules, although mtDNA sequence analysis of elephant seals also indicated only two haplotypes (Hoelzel et al. 1991).

Population subdivision-Five of the 47 haplotypes were shared among regions, but most were unique to a locality (Table 1). Haplotypic frequencies were different among harbor seal groups in Washington, Oregon, and Cali- fornia. An AMOVA (P = 0.001, Table 2) also indicated limited gene flow among harbor seal groups along the coasts of Washington, Oregon, and. Cal- ifornia. Other data support these conclusions. Local movements of individuals may occur in association with food resources and breeding activities, but movements greater than approximately 480 km have not been observed (Brown and Mate 1983, Allen et al. 1987, Harvey 1987). Among Pacific coast harbor seals, we found that seals separated by the greatest geographic distance (Cal- ifornia to Washington) also had the greatest genetic distance (Table 3a). This

Table 3. (a) Genetic distance among groups of harbor seals from Washington (WPS = Puget Sound, WPC = Pacific coast), Oregon (ORE), and California (CAL). The largest genetic distance occurs between the greatest geographic distance. (b) Genetic distance within groups of harbor seals, which indicated harbor seals in Puget Sound have the greatest amount of diversity.

Region WPS

Genetic distance

WPC ORE CAL

a. WPS WPC ORE CAL

b. WPS WIT ORE CAL

0.00 - - - 0.18 0.00 - - 0.05 0.12 0.00 - 0.06 0.31 0.08 0.00

116.23 27.72 44.95 25.33


supports Lehman et &.‘s (1993) hypothesis of a “stepping-stone” pattern of gene flow in P. v. richardsi, with harbor seals from geographically closer sites being more genetically similar than those farther apart.

Diversity within each locality also differed (Table 3b). Puget Sound seals were the most diverse with 20 haplotypes, whereas, harbor seals from the Pacific coast of Washington exhibited the fewest haplotypes (9). This indicates harbor seals in Puget Sound have received haplotypes from locations that have had no gene flow with harbor seals off Washington, Oregon, and California.

Phylogenetic analysis--In the neighbor-joining and PAUP trees there was no obvious phylogeographic structure (Fig. 2), which is consistent with Lehman et al’s (1993) conclusions. Haplotypes from all regions were found throughout the tree, except for one clade (A) that consisted entirely of haplotypes from WPS. Clade A also had a sister clade (B) that contained one haplotype from WPS and one from WPC. Clade A was the most divergent, which was evident in the greater levels of intrapopulation diversity within WPS, as indicated by the AMOVA.

Unique haplotypes in harbor seals from WPS may represent an influence of haplotypes from harbor seals north of Puget Sound. This hypothesis assumes gene flow at some time in the past among harbor seals in Puget Sound and those north of Washington, and limited gene flow among coastal groups. Haplotypes from north of Washington may have been introduced to Puget Sound during the Pleistocene, approximately 15,000 yr ago, when the Cor- dilleran ice sheet moved south, blocking the Straits of Juan de Fuca (Booth 1987). The Cordilleran ice sheet covered the northern and central Puget low- land, thereby isolating glacial lakes along its southern margin (Fig. 3). Harbor seals from the north may have moved into these lakes via the Straits of Geor- gia, and used them as a refuge until the ice receded (Booth 1987). Once the Straits of Juan de Fuca were opened, harbor seals in Puget Sound had the opportunity to move to the Pacific coast. Radio-tagging studies throughout Washington, however, indicated seals rarely move between Puget Sound and the Pacific coast of Washington (S. Jeffries, Washington Department of Wild- life, personal communication). Once northern harbor seals were introduced into southern Puget Sound, they may have remained isolated from seals along the Pacific coast by differences in reproductive timing and limited movements.

Harbor seal reproductive timing off southeast Vancouver Island and within the Straits of Georgia, Canada, are in accord with this hypothesis. Bigg (1973) and Temte (1993) reported that harbor seals off Vancouver Island and within the Straits of Georgia pup at the same time as those in southern Puget Sound (July through September). This indicates possible gene flow among harbor seals in southern Puget Sound, off southeast Vancouver Island, and within the Straits of Georgia, at some time in the past.

Results of this study indicate: (1) large amounts of genetic variation in Pacific harbor seals, possibly due to lack of a severe population bottleneck at some time in the past; (2) limited gene flow among Pacific harbor seals along the coasts of Washington, Oregon, and California; (3) limited, if any, gene flow between Puget Sound and the Pacific coast of Washington; and (4) pos-


rCAL 6

Irl LWPS 27 I WPS 42

10

I Clade B

I

Clade A

- = 0.003264 substitutions per site

Figure 2. Neighbor-joining tree of mtDNA for 86 P. v. richardsi off Washington, Oregon, and California, based on sequencing of a 320 base pair segment of the control region. Region abbreviations are: WPS = Washington-Puget Sound, WPC = Wash- ington-pacific coast, ORE = Oregon, and CAL = California. Haplotypes (indicated by numbers) from all regions are found throughout the tree, except clades A and B.

sible influence of haplotypes from the Straits of Georgia, Canada, in harbor seals from Puget Sound, which may explain differences in timing of pupping among harbor seals in Puget Sound and those off the Pacific coast of Wash- ington. A comparison of genetic material among harbor seals in Puget Sound and those off Canada and Alaska is needed. Timing of harbor seal births in Puget Sound is most likely genetically regulated, and possibly follows the schedule of harbor seals off British Columbia, Canada.


Figwe 3. The Puget Lobe region of the Cordilleran ice sheet covering Puget Sound (inset) during the Pleistocene. Harbor seals from north of Washington may have entered the Puget Sound region via the Straits of Georgia or Grays Harbor and used glacial lakes in the southern Puget Sound as refuges throughout the glaciation.

ACKNOWLEDGMENTS

This project was funded by The Packard Foundation, The Dr. Earl H. Myers and Ethel M. Myers Oceanographic and Marine Biology Trust, The American Museum of Natural History Lerner-Grey Fund, and The Bay Foundation. The AMOVA program was made available by Dr. Andrew Dizon at the Southwest Fisheries Science Center. This research was conducted under NMFS Marine Mammal Research Permit #737 and the oversight of the San Jose State University Animal Care Code.

LITERATURE CITED

ALLEN, S. G., D. G. AINLEY, L. FANCHER AND D. SHUFORD. 1987. Movement and activity patterns of harbor seals (Phoca vitulina) from Drakes Ester0 population, California, 1985-86. NOAA Technical Memorandum 6. Washington, DC. 36 PP.

ARNASON, U., AND E. JOHNSSON. 1992. The complete mitochondrial DNA sequence of the harbor seal, Phoca vitulina. Journal of Molecular Evolution 34:493-505.

BIGG, M. A. 1973. Adaptations in the breeding of the harbor seal, Phoca vitulina. Journal of Reproduction and Fertility (Suppl.) 19:131-142.

BONNELL, M. L., AND R. K. SELANDER. 1974. Elephant seals: genetic variation and near extinction. Science 184:908-909.

BONNELL, M. L., M. 0. PIERSON AND G. D. FARRENS. 1983. Pinnipeds and sea otters of Central and Northern California, 1980-1983: status, abundance, and distribution. Part of investigator’s final report. Marine mammal and seabird study, Central and Northern California. Principal investigator: T. P. Dohl. Center for Marine Studies. University of California, Santa Cruz, CA. 244 pp.

BOOTH, D. B. 1987. Timing and processes of deglaciation along the southern margin of the Cordilleran ice sheet. Pages 71-90 in W. F. Ruddiman and H. E. Wright,


Jr., eds. North America and adjacent oceans during the last deglaciation. The Geology of North America Vol. K-3. The Geological Society of America,, Inc., Boulder, CO.

BOVENG, P. 1988. Status of the Pacific harbor seal population on the U. S. west coast. National Marine Fisheries Service Administrative Report LJ-88-07. 43 pp.

BROWN, R. F., AND B. R. MATE. 1983. Abundance, movements, and feeding habits of harbor seals, Phoca vitulina, at Netarts and Tillamook Bays, Oregon. Fishery Bulletin 81:291-301.

DESJARDINS, C., F. H. BRONSON AND J. L. BLANK. 1986. Genetic selection for pho- toresponsiveness in deer mice. Nature 332:172-173.

EXCOFFIER, I,., P. E. SMOUSE AND J. M. QUATTRO. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 181:479-491.

GYLLENSTEIN, U. B., AND H. A. ERLICH. 1988 Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA- DQA locus. Proceedings of the National Academy of Sciences, United Sta.tes of America 85:7652-7656.

HARVEY, J. ‘I‘. 1987. Population dynamics, annual food consumption, movements, and dive behaviors of harbor seals, Phoca vitulina richardsi, in Oregon. Ph.D. disser- tation, Oregon State University, Corvallis, OR. 177 pp.

HARVEY, J. T., R. F. BROWN AND B. R. MATE. 1990. Abundance and distribution for harbor seals (Phoca vitulina) in Oregon, 1975-1983. Northwestern Naturalist 71: 65-71.

HOELZEL, A. R., J. HALLEY, S. J. O’BRIEN, C. CAMPAGNA, T. ARNBOM, B. LE BOEUF, K. RALLS AND G. A. DOVER. 1993. Elephant seal genetic variation and the use of simulation models to investigate historical population bottlenecks. Heredity 84: 443-449.

JEFFRIES, S. J., AND M. L. JOHNSON. 1990. Population status and condition of the harbor seal, Phoca vitulina richardsi, in the waters of the state of Washington: 1975-1980. Final report to the Marine Mammal Commission. University of Pu- get Sound, Tacoma, WA. 77 pp.

KING, J. E. 1983. Seals of the world, Second ed. Cornell University Press, Ithaca, NY. KUMAR, S., K. TAMURA AND M. NEI. 1993. MEGA: Molecular evolutionary genetics

analysis, version 1.0. 1.0 ed. The Pennsylvania State University, University Park, PA. 130 pp.

LEHMAN, N., R. K. WAYNE AND B. S. STEWART. 1993. Comparative levels of genetic variability in harbour seals and northern elephant seals as determined by genetic fingerprinting. Symposium of the Zoological Society of London 66:49-60.

MALDONADO, J. E., F. 0. DAVILA, B. S. STEWART, E. GEFFEN AND R. K. WAYNE. 1995. Intraspecific genetic differentiation in California sea lions (Zalophus californianus) from Southern California and the Gulf of California. Marine Mammal Science 11: 46-58.

NEWBY, T. C. 1972. Observations on the breeding behavior of the harbor seal in the state of Washington. Journal of Mammology 54:540-543.

PRAGER, E. M., R. D. SAGE, U. GYUllENSTEN, W. K. THOMAS, R. HUBNER, C. S. JONES, L. NOBLE, J. B. SEARLE AND A. C. WILSON. 1993. Mitochondrial DNA sequence diversity and the colonization of Scandinavia by house mice from East Holstein. Biological Journal of the Linnean Society 50:85-122.

PRICE, T., M. KIRKPATRICK AND S. J. ARNOLD. 1988. Directional selection and the evolution of breeding date in birds. Science 240:798-799.

SAITOU, N., AND M. NEI. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-,425.

SHAUGHNESSY, P. D., AND F. FAY. 1977. A review of the taxonomy and nomenclature of North Pacific harbour seals. Journal of Zoology, London. 182:385-419.

SIMONSEN, V., F. KAPEL AND G. LARSEN. 1982. Electrophoretic variation in the minke


whale, Balaenoptera acutorostrata Lacepede. Report of the International Whaling Commission 32:275-278.

SWOFFORD, D. L. 1990. PAUP:Phylogenetic Analysis Using Parsimony, Version 3.Og. Champaign: Illinois Natural History Survey.

TEMTE, J. L. 1991. Precise birth timing in captive harbor seals (Phoca vitulina) and California sea lions (Zalophus californianus). Marine Mammal Science 7:145-156.

TEIMTE, J. L. 1993. Population differentiation of the Pacific harbor seal: cranial mor- phometry parallels birth timing. Ph.D. disseration, University of Wisconsin, Madison, WI. 209 pp.

TESTA, J. W. 1986. Electromorph variation in Weddell seals (Leptonychotes weddelli). Journal of Mammology 67:606-610.

WALSH, P. S., D. A. METZGER AND R. HIGUCHI. 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Bio- Techniques 10:506-513.

Received: 4 April 1995 Accepted: 13 December 1995

genetic substructure of the pacific harbor seal (phoca vitulina richardsi) off washington, oregon,...

Documents