GENETIC DEMONSTRATION THAT THE PLASMA MEMBRANE MAXI-ANION CHANNEL AND VOLTAGE-DEPENDENT ANION CHANNELS (VDACS) ARE UNRELATED PROTEINS*

Ravshan Z. SABIROV§, Tatiana SHEIKO‡, Hongtao LIU§, Defeng DENG‡, Yasunobu OKADA§, and William J. CRAIGEN‡

From the §Department of Cell Physiology, National Institute for Physiological Sciences and

Department of Physiological Sciences, School of Life Science, The Graduate University for Advanced Studies (SOKENDAI), Okazaki 444-8585, Japan; ‡Department of Molecular and Human

Genetics, Baylor College of Medicine, Houston, Texas 77030, USA Running Title: Maxi-anion channel in VDAC KO cells

Address correspondence to: Ravshan Z. Sabirov, Department of Cell Physiology, National Institute for Physiological Sciences, Okazaki 444-8585, Japan; Tel: +81-564-55-7733; Fax: +81-564-55-7735; E-mail: sabirov@nips.ac.jp

The maxi-anion channel is widely

expressed in many cell types where it fulfils a general physiological function as an ATP-conductive gate for cell-to-cell purinergic signaling. Establishing the molecular identity of this channel is crucial to understanding the mechanisms of regulated ATP release. A mitochondrial porin (voltage-dependent anion channel, VDAC1) located in the plasma membrane has long been considered as the molecule underlying the maxi-anion channel activity, based upon similarities in the biophysical properties of these two channels and the purported presence of VDAC protein in the plasma membrane. We have deleted each of the three genes encoding the VDAC isoforms individually and collectively and demonstrate that maxi-anion channel (~400 pS) activity in VDAC-deficient mouse fibroblasts is unaltered. The channel activity is similar in VDAC1/VDAC3 double-deficient cells and in double-deficient cells with VDAC2 protein depleted by RNA interference. VDAC deletion slightly down-regulated, but never abolished, the swelling-induced ATP release. The lack of correlation between VDAC protein expression and maxi-anion channel activity strongly argues against the long held hypothesis of plasmalemmal VDAC being maxi-anion channel.

Purinergic signaling is a widespread phenomenon of general biological significance, and mechanisms accounting for ATP release from cells remain a contentious issue (1). We have recently identified a maxi-anion channel as a nanoscopic pore (2) well suited to function as the ATP-releasing pathway (3, 4). This pore accounts for the swelling-induced ATP release from mouse mammary C127 cells (5,6) and NaCl-dependent ATP-mediated signaling from macula densa to mesangial cells during tubuloglomerular feedback in the kidney (7). In addition, the same pore is operational in swelling-, ischemia- and hypoxia-induced ATP release from neonatal rat cardiomyocytes (8).

The maxi-anion channel has been observed in a wide variety of cell types and exhibits roughly uniform behavior (9), suggesting it has a general physiological function. Although the molecular identity of the maxi-anion channel is not yet firmly established, it is widely held that a voltage-dependent anion channel (VDAC) located in the plasmalemma that normally functions in the mitochondrial outer membrane (10-12) is the most likely candidate protein. This hypothesis was based on the similarity of shared biophysical properties, such as the large unitary conductance and bell-shaped voltage dependency of the maxi-anion channel and mitochondrial VDAC (13-18). Corroborating this idea, numerous groups have reported the presence of VDAC protein in the

http://www.jbc.org/cgi/doi/10.1074/jbc.M509482200The latest version is at JBC Papers in Press. Published on November 16, 2005 as Manuscript M509482200

Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

plasma membrane of various cell types (13-26). A possible mechanism for targeting of the same protein to different locations has been suggested by Buettner et al. (14). They reported the existence of an alternative first exon in the murine vdac-1 gene that encodes a different leader peptide at the N-terminus, a signal that purportedly targets the protein to the plasma membrane through the Golgi apparatus. Under this scenario, the signal peptide is eventually cleaved away to produce a plasmalemmal VDAC (pl-VDAC) protein identical to the mitochondrial protein. Other mechanisms involving alternative mRNA untranslated regions have also been hypothesized to explain the extramitochondrial localization of porin (27).

The “maxi-anion channel = pl-VDAC” hypothesis is widely accepted (e.g., see 17). We thoroughly tested this hypothesis by gene deletion and gene silencing. In mammals, three isoforms of mitochondrial porin, VDAC1, VDAC2 and VDAC3 have been cloned (13, 28-35). The deletion of vdac genes was shown to result in various physiological dysfunctions (36). These include male infertility (37), disrupted fear conditioning and spatial learning (38), enhanced apoptosis (39), and growth retardation and increased fatigue (36). If the maxi-anion channel is a pl-VDAC, then deletion and/or silencing of the VDAC genes would be expected to eliminate the channel activity and abolish the maxi-anion channel-mediated ATP release. Here we present the results of such a study.

EXPERIMENTAL PROCEDURES

Generation of VDAC-deficient mouse

fibroblasts – The gene targeting strategies for the vdac1, vdac2 and vdac3 genes have been described previously (40). VDAC1-deficient mouse embryonic fibroblasts (MEFs) were isolated from

day 11.5 vdac1-/- embryos, derived from the cross of vdac1-/- mice. Mouse embryos derived from the cross of vdac3-/- females and

vdac3+/- males were harvested at day 11.5 and vdac3-/- MEFs were genotyped by polymerase chain reaction (36). vdac2-/- embryos die in mid-gestation, but MEFs derived from embryos harvested before then are viable. vdac2-/- embryonic stem cell clones were microinjected into blastocysts obtained from C57BL/6 female mice. MEFs derived from 8.5-day chimeric embryos were treated with 0.3 mg/ml G418. Deficiency of VDAC2 following G418 selection was confirmed by both PCR and immunoblotting with anti-VDAC2 antibodies. Double-deficient (dKO) mouse adult fibroblasts (MAFs) were isolated from skin biopsies of adult double-knockout (vdac1-/-/vdac3-/-) mice generated by crossing vdac1-/-/vdac3+/- females to vdac1+/-/vdac3+/- males. Cultured fibroblasts were maintained in Dulbecco's modified

Eagle's high glucose plus pyruvate medium (Invitrogen, Carlsbad, CA) containing

10% fetal bovine serum, and penicillin

(100 U/ml) plus streptomycin (100 U/ml) in a humidified atmosphere

containing 5% CO2. VDAC protein expression was verified by Western blotting using affinity-purified anti-VDAC1 rabbit polyclonal antibodies and anti-VDAC2 and anti-VDAC3 chicken polyclonal antibodies (41).

vdac2 gene silencing was performed by RNA interference in dKO fibroblasts. The following oligonucleotides, targeting three different regions of the mouse vdac2 gene, were used to generate the hairpin-encoding inserts for the three RNAi constructs:

5’TTTTCTCGAGCCGCCTCGGCTGTGATGTTGACTTCAAGAGA3’ and 5’CCTT GGTACCTTCCAAAAACCTCGGCTGTGATGTTGACTCTCTTGAA3’ (RNAi-1 construct);

5’ TTTT CTCGAG CC G CTTTGCAGTCGGCTACAGG TTCAAGAGA 3’ and

5’CCTTGGTACCTTCCAAAAACTTTGCAGTCGGCTACAGGTCTCTTGAA3’ (RNAi-2 construct); 5’ TTTT CTCGAG CC G

2

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

TGGGACAGAATTTGGAGGA TTCAAGAGA 3’ and

5’CCTTGGTACCTTCCAAAAATGGGACAGAATTTGGAGGATCTCTTGAA3’ (RNAi-3 construct). The underlined sequences are 19-nucleotide target sequences corresponding to the regions of murine vdac2. The oligonucleotides were annealed, extended with the Klenow fragment of DNA polymerase and cloned into a pBluescript II KS+ vector (Stratagene, La Jolla, CA) containing the mouse RNAaseP H1 promoter and a puromycin resistance gene. Fugene 6 (Roche Applied Science, Indianapolis, IN)-mediated transfection of fibroblasts was performed with these three RNAi-constructs, as well as with the control construct containing only the RNAaseP H1 promoter and puromycin resistance gene. Clones stably expressing hairpin siRNAs were selected with 5 µg/ml puromycin (Sigma, St. Louis, MO). The effectiveness of VDAC2 down-regulation by each RNAi construct was studied by Western

blotting with specific anti-VDAC2 antibodies. For patch-clamp experiments, the cells were

grown on glass coverslips and were transferred to the chamber immediately before experiments.

Solutions – The normal Ringer solution for patch-clamp contained (mM): 135 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 5 Na-HEPES, 6 HEPES, 5 glucose (pH 7.4, 290 mosmol/kg-H2O). For selectivity measurements, 135 mM NaCl in Ringer solution was replaced with 135 mM of TEA-Cl or Na-glutamate. The pipette solution for inside-out experiments was either normal Ringer solution or solution containing (mM): 100 KCl, 2 MgCl2 and 5 HEPES (pH 7.4 adjusted with KOH). The pipette solution for outside-out experiments contained (mM): 120 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 5 Na-HEPES, 6 HEPES, 10 EGTA (pH 7.4 adjusted with NaOH, pCa 7.7, 280 mosmol kg−1 H2O). For K/Cl permeability measurements, the bath solution contained (mM): 1000 KCl, 2 MgCl2 and 5 HEPES (pH 7.4 adjusted with KOH). The bath solution for bromide and acetate permeability measurements contained (mM): 1000 KBr or K-

acetate, 2 MgCl2 and 5 HEPES (pH 7.4 adjusted with KOH or acetic acid, respectively). For ATP-permeability measurements, 100 mM Na2ATP solution was used after the pH was adjusted to 7.4 with NaOH. The hypotonic solution for ATP release measurements contained (mM): 92 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 5 Na-HEPES, 6 HEPES, 5 glucose (pH 7.4, 210 mosmol/kg-H2O, 72% hypotonicity).

GdCl3 was stored as a 50 mM stock solution in water and added directly to Ringer solution immediately before each experiment. 5-Nitro-2-(phenylpropylamino)-benzoate (NPPB), glibenclamide, 4-acetamino-4’-isothiocyanostilbene (SITS), arachidonic acid, indomethacin, nordihydroguaiaretic acid (NDGA) and clotrimazole were purchased from Sigma-Aldrich (St. Louis, MD) and were added to Ringer solution immediately before use from stock solutions in DMSO. DMSO did not have any effect, when added alone at a concentration of less than 0.1%.

The osmolality of all solutions was measured using a freezing-point depression osmometer (OM802, Vogel, Germany).

Electrophysiology – Patch electrodes were fabricated from borosilicate glass capillaries using a laser micropipette puller (P-2000, Sutter Instrument, Novato, CA) and had a tip resistance of around 1.5 − 2 MΩ when filled with pipette solution. Membrane currents were measured with an EPC-9 patch-clamp system (Heka-Electronics, Lambrecht/Pfalz, Germany). The membrane potential was controlled by shifting the pipette potential (Vp). The membrane potential is reported as −Vp. Currents were filtered at 1 kHz and sampled at 5-10 kHz. Data acquisition and analysis were done using Pulse+PulseFit (Heka-Electronics). Whenever the bath Cl− concentration was altered, a salt bridge containing 3 M KCl in 2% agarose was used to minimize variations of the bath electrode potential. The liquid junction potentials were measured according to (42) and

3

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

were corrected when necessary. All experiments were performed at room temperature (23-25oC).

ATP release and total ATP assay – Bulk extracellular ATP concentration was measured by the luciferin-luciferase assay (ATP Luminescence Kit; AF-2L1, DKK-TOA Co., Tokyo, Japan) with an ATP analyzer (AF-100, DKK-TOA), as described previously (5, 6) with modifications. Briefly, the cells were cultured to confluence in 12-well plates for time-course experiments and in 24-well plates for end-point steady-state ATP release measurements. Culture medium was totally replaced with isotonic Ringer solution (1000 µl for 12-well and 425 µl for 24-well plates, respectively). Cells were incubated for 60 min at 37oC, and 100 µl of the extracellular Ringer solution was removed and used as a control sample for background ATP release. A hypotonic challenge was then applied by gently removing most of the remaining extracellular solution (875 µl for 12-well and 300 µl for 24-well plate, respectively) and adding the hypotonic solution (1000 µl for 12-well and 400 µl for 24-well plate, respectively). The solution was gently mixed by careful rocking and the plate was placed into the incubator at 37oC. At the specified time points, the plate was carefully rocked again to ensure homogeneity of the extracellular solution, and samples (20 µl for 12-well and 50 µl for 24-well plate, respectively) were collected from each well for the luminometric ATP assay. ATP concentration was measured by mixing 20-50 µl of sample solution with 500 µl normal Ringer solution and 50 µl of luciferin-luciferase reagent. At this ratio, ionic salt sensitivity of luciferase reaction (43) was negligible. When required, drugs were added to the hypotonic solution to give the final concentrations as indicated. Since Gd3+ has been reported to interfere with the luciferase reaction (43), we supplemented the luciferin/luciferase assay mixture with 600 µM of EDTA when the samples contained Gd3+. Other drugs employed in the present study had no

significant effect on the luciferin-luciferase reaction.

Total ATP in cell lysates was quantified using a commercially available luciferin-luciferase assay kit (AF-2L1, DKK-TOA, Tokyo, Japan) as previously described (44). Data Analysis – Single-channel amplitudes were measured by manually placing a cursor at the open and closed channel levels. The reversal potentials were calculated by fitting I-V curves to a second-order polynomial (2) or measured directly from ramp-currents. Permeability ratios were calculated using the Goldman-Hodgkin-Katz (GHK) equation as previously described (5). The value of PK/PCl was calculated from the KCl gradient experiments and this was then used for Br– to Cl– and acetate to Cl– permeability ratio calculations. Data were analyzed in Origin 5-7 (OriginLab Corporation, Northampton, MA). Pooled data are given as means ± SEM of n observations. Statistical differences of the data were evaluated by ANOVA and the paired or unpaired Student’s t test where appropriate, and considered significant at P < 0.05. Statistical differences in slopes of linear fits were evaluated by analysis of covariance using StatsDirect software (StatsDirect Ltd, Cheshire, UK) and considered significant at P < 0.05.

RESULTS

Single maxi-anion channels in wild-type mouse fibroblasts – In the cell-attached (on-cell) configuration, no single-channel events were observed from wild-type mouse embryonic fibroblasts (WT-MEFs). However, after excision of the patch membrane, single-channel events with a large amplitude could be readily recorded (Fig. 1A). The channels exhibited voltage-dependent inactivation at both positive and negative potentials greater than ±20 mV. The unitary current-to-voltage (I-V) relationship was linear in the range of ±50 mV with a reversal potential of about 0 mV in symmetrical conditions with Ringer solution in the bath and pipette, and a slope

4

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

conductance of 400.3 ± 3.8 pS (Fig. 1B). The single-channel amplitude was insensitive to the replacement of NaCl with TEA-Cl. However, the inward currents greatly decreased and the reversal potential shifted to a negative value of –33.7 ± 1.6 mV when NaCl in the bath solution was replaced with Na-glutamate (Fig. 1B). This result indicates that the large-conductance channel in WT-MEFs is anion-selective with a permeability ratio of glutamate to Cl− of 0.23 ± 0.02. This value is close to Pglutamate/PCl = 0.22 obtained for the maxi-anion channel in mammary C127 cells (4).

In order to test the ATP-permeability of the maxi-anion channels in WT-MEFs, we recorded the I-V curves in response to ramp-pulse from –50 to +50 mV. The ramp I-V relationship was linear in symmetric ionic conditions with Ringer solution both in the pipette and in the bath, with reversal potential at 0 mV. When all anions in the bath were replaced with 100 mM ATP4−, large outward currents (carried by Cl− from the pipette solution) as well as small inward currents (presumably carried by ATP4− from the bath solution (see (5)) were consistently observed. The average reversal potential shifted to –18.2 ± 1.2 mV (n=15 from 5 different patches) giving PATP/PCl = 0.083 ± 0.005.

The maxi-anion channel in WT-MEFs was insensitive to Gd3+ ions (50 µM) added from the intracellular side of excised patches (n=5, data not shown), but completely blocked (n=6) when the drug was applied from the extracellular side in the outside-out configuration (Fig. 1D). Another well-known modulator of the maxi-anion channel, arachidonic acid (20 µM), potently inhibited the channel activity when added from the cytosolic side (n=7, Fig. 1D).

The biophysical properties of the WT-MEF maxi-anion channel, such as the single-channel conductance, voltage-dependent inactivation, ATP permeability and sensitivity to Gd3+ and arachidonate are very similar to those observed previously in C127 cells (5, 6), kidney macula densa cells (7) and cardiomyocytes (8).

In a separate set of experiments, we

determined the ionic selectivity of WT-MEF maxi-anion channels in conditions close to those commonly used for mitochondrial VDAC proteins reconstituted in lipid bilayers. When 10-fold KCl gradient (100 mM in the pipette vs. 1000 mM in the bath) was applied to the maxi-anion channel-containing patches, the reversal potential was 40.6 ± 1.5 mV (Fig. 1B). This value is much greater than the value of 10.2 mV reported for the mitochondrial porin under the same conditions (45). The calculated permeability ratio PCl/PK = 13.5 ± 2.3 also largely exceeded the PCl/PK of 1.7 – 1.9 for mitochondrial porins from different sources (45, 46). Replacing 1000 mM KCl in the bath with equimolar KBr or K-acetate resulted in the reversal potentials of 41.2 ± 1.5 mV and 28.6 ± 0.5 mV, respectively (Fig. 1B). The calculated permeability ratio PBr/PCl = 1.01 ± 0.06 was close to that for mitochondrial VDAC (1.02) as derived from the partitioned ionic conductances in (47). However, Pacetate/PCl of 0.58 ± 0.01 was greater than Pacetate/PCl = 0.41 for mitochondrial VDAC (47) under similar experimental conditions (both values were calculated after accounting for incomplete dissociation of K-acetate at 1000 mM, see Ref. 47).

Effect of deletion of VDAC genes on the occurrence of maxi-anion channels in mouse fibroblasts – The hypothesis that the maxi-anion channel is a plasmalemmal subtype of VDAC, as suggested by Buettner et al. (14), was based on the proposed existence of an alternative first exon in the murine vdac-1 gene. The hypothetical alternative exon encodes a leader peptide at the N-terminus that targets the protein to the plasma membrane through the Golgi apparatus. Therefore, deleting vdac gene would interrupt this process and consequently abolish plasmalemmal VDAC expression and maxi-anion channel activity. We have generated MEFs lacking the vdac1 gene and assayed the expression of VDAC1 protein using specific antibodies. Western blotting demonstrated complete absence of VDAC1 protein in these cells (Fig. 2Aa). However, when the same cells were

5

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

assayed electrophysiologically, they exhibited maxi-anion channel activity indistinguishable from WT-MEFs, including activation by patch excision, voltage-dependent gating, linear current-voltage relationship and unaltered single-channel conductance and K+ to Cl– selectivity (Fig. 2B). The channel occurrence in vdac1-/- fibroblasts was only slightly less (~60% of channel incidence) than in wild-type cells (~70%).

The very existence of maxi-anion channels in vdac1-/- cells decisively refutes the “maxi-anion channel = pl-VDAC” hypothesis as formulated for the vdac1 gene. However, the hypothesis can still be modified by replacing VDAC1 protein with one of the two other isoforms (VDAC2 and VDAC3) and hypothetically presuming the existence of an alternative leader peptide. To test this possibility, we first generated the cells lacking the vdac3 gene and double-deficient cells lacking both the vdac1 and vdac3 genes. The vdac3-/- cells do not express VDAC3 protein, and VDAC1/VDAC3 double knock-out (dKO) cells lack both VDAC1 and VDAC3 proteins, as demonstrated by Western blots in Fig. 2A (a, b). However, both vdac3-/- and dKO cells displayed maxi-anion channels with normal biophysical properties (Fig. 2C,D) and with maxi-anion channel occurrence (~50% for vdac3-/- and ~70% for dKO cells) similar to WT-MEF and vdac1-/- cells. The only possible remaining candidate for pl-VDAC protein as a maxi-anion channel is the VDAC2 isoform. We therefore tested the vdac2-/- cells (39). These cells lack the VDAC2 protein (see Western blots in Fig. 3A). However, when we tested the maxi-anion channel activity, it was found to be normal (Fig. 3B) with approximately same occurrence in about 70% of membrane patches.

Thus, our results strongly suggest that none of the three individual isoforms of VDAC protein can be responsible for the maxi-anion channel activity in mouse fibroblasts. However, theoretically, it is still possible that the different isoforms replace each other when one (e.g., VDAC1), which normally functions as a wild-type

maxi-anion channel, is deleted. VDAC1/VDAC2/VDAC3 triple knock-out cells would give a definitive answer to this question. However, it was not possible to produce such mutant cells due to embryonic lethality associated with the absence of VDAC2 (39). Therefore we employed a gene silencing strategy using RNA interference to reduce the expression of VDAC2 protein in dKO cells lacking VDAC1 and VDAC3. We generated three different constructs designated RNAi-1, RNAi-2 and RNAi3 (see Methods for details) and obtained three different clones with substantially depleted VDAC2 expression, as determined by Western blotting (Fig. 3A). When these cells were tested by patch-clamp, the maxi-anion channel activity was normal in all three clones of VDAC2 depleted cells, and the number of maxi-anion channels per patch was not statistically different from each other, nor from WT-MEF or wild-type adult fibroblast cells (Fig. 3C). Therefore, we conclude that maxi-anion channel activity is unrelated to the expression of VDAC1, VDAC2 and VDAC3 proteins. It is also highly unlikely that VDAC2 (the only possible candidate for maxi-anion channels in VDAC1/VDAC3 double knock out cells) can replace VDAC1 (maxi-anion channel in the original form of the hypothesis) or VDAC3 (an alternative candidate for maxi-anion channel in vdac1-/- cells) in VDAC-deficient cells.

Effect of deletion of VDAC genes on swelling-induced ATP release – Our previous studies strongly suggest that the maxi-anion channel serves as a pathway for ATP release induced by osmotic cell swelling and other stimuli from several different types of cells (3). Therefore, we assayed the release of ATP induced by 72% hypotonicity from VDAC-deficient cells. WT-MEFs responded to this stimulation with a time-dependent release of ATP into the extracellular milieu (Fig. 4A). This ATP release was inhibited by anion channel blockers SITS and NPPB, by the maxi-anion channel blocker Gd3+, but not by glibenclamide, an inhibitor of cAMP-activated

6

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

CFTR and volume-sensitive outwardly rectifying (VSOR) Cl– channels (Fig. 4B). These latter channels are also considered as candidates for the ATP release pathway (3, 4). Arachidonic acid had a significant inhibitory effect on ATP release. This inhibition was enhanced in the presence of a cocktail of inhibitors, which suppresses the consumption of free arachidonate by cytosolic oxygenases (6). The total ATP content of WT-MEF cells was not significantly altered by arachidonic acid at P < 0.05 (n=12), ruling out the possibility that the observed inhibition of ATP release was due to modulation of the mitochondrial permeability transition (48). The pattern of ATP release from WT-MEFs was very similar to that observed in our earlier studies with mammary C127 cells (5, 6) and neonatal cardiac myocytes (8), where maxi-anion channels play a key role in the release of ATP.

Fibroblasts deleted for vdac1, vdac2 and vdac3 genes displayed slightly reduced mass release of ATP compared to the wild-type cells (Fig. 4C). However, the observed difference did not reach statistical significance when analyzed by the ANOVA test. Thus, none of these genes alone can be entirely responsible for the osmotic ATP release from these cells. When VDAC1/VDAC3 double-deficient cells were tested with and without VDAC2 protein depletion by RNA interference, the swelling-induced ATP release levels were not statistically different within this group (dKO, dKO-RNAi-1, -RNAi-2 and -RNAi-3), suggesting that the decreased VDAC2 protein expression in dKO fibroblasts (Fig. 3A) did not result in the comparable decrease in ATP release.

It should be noted, however, that the ATP release from dKO cells themselves was significantly lower than that from WT-MEFs when compared by unpaired t-test (Fig. 4D). This result is probably due to impaired ATP production by mitochondria lacking an important ATP transport pathway in their mitochondrial outer membrane (36). To verify this possibility, we measured the total ATP content in the cell lysates. The total

ATP content of dKO cells was only 78.5 ± 4.5 % (n=9) of that for wild-type adult fibroblast cells (significant at P < 0.05). Thus, we believe that reduced ATP release from dKO cells and its clones derived by RNAi is mainly due to the decreased ATP gradient caused by reduced mitochondrial ATP production, and not due to reduced activity of an ATP releasing maxi-anion channel, which was normal in these cells (Fig. 3C).

DISCUSSION The Voltage-dependent Anion Channel

(VDAC, or mitochondrial porin) resides in the outer membrane of mitochondria and when reconstituted in lipid bilayers displays large single-channel conductance and bell-shaped voltage-dependent inactivation with maximal open probability at around zero mV (10-12). These biophysical properties are similar to those observed for maxi-anion channels in patch-clamp experiments (3, 4, 9). Probing the mitochondrial porin by the nonelectrolyte partitioning method yielded a value for the pore radius of 1.5 nm for the fully open state of the channel in lipid bilayers (49). This figure is very close to the cut-off size of around 1.3 nm obtained in our experiments with the maxi-anion channel (2). Using the asymmetric PEG application method, Carneiro et al. (50, 51) described an asymmetrical pore for mitochondrial VDAC with radius of ~1 nm and ~2 nm for its cis- and trans-entrances, respectively (cis designates the side of the bilayer into which the protein was added). This asymmetry parallels the asymmetry of the maxi-anion channel demonstrated in experiments using a one-sided application of PEG: 1.16 nm and 1.42 nm for radii of intracellular and extracellular vestibules (2). Electron microscopic images have demonstrated that mitochondrial porin has an inner radius of ~1.4 nm (52), which is very close to the value obtained by polymer size exclusion for VDAC in lipid bilayers (44-46) and for the maxi-anion channel in our patch-clamp study (2). Thus, the structural features of

7

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

mitochondrial porin and the ATP-conductive maxi-anion channel do converge. Maxi-anion channels also resemble (5) mitochondrial porins with respect to their open-channel block by ATP (53) and ATP conductivity (53-55).

The hypothesis that maxi-anion channels observed in patch-clamp experiments in different cells represent a plasmalemmally expressed VDAC (pl-VDAC) protein (13-18) has received a great attention and is currently considered to be an established concept in the field. A large number of research groups have indeed detected the presence of VDAC protein in the plasma membrane of various cells (13-26) and several genetic mechanisms for targeting the same protein to such different locations as mitochondrial outer membrane and plasmalemma have been postulated (14, 27).

From the present study, we conclude that the maxi-anion channel activity in mouse fibroblasts does not correlate with the presence of any one of the three individual isoforms of VDAC, as established in single-gene knock-out experiments. Moreover, simultaneous deletion of vdac1 and vdac3 genes and vdac2 gene silencing in VDAC1/VDAC3 double-deficient cells did not notably affect the maxi-anion channel activity, unequivocally establishing that the maxi-anion channel protein is not encoded by any of the vdac genes. This result contradicts the long held hypothesis that the maxi-anion channel represents a plasmalemma VDAC protein (13-18). Our data, however, do not exclude the possibility that VDAC protein(s) could be, in fact, targeted to the plasma membrane, e.g., by the mechanism proposed by Buettner et al. (14) or via mRNA untranslated regions, as speculated by Bathori et al. (27). If VDAC re-targeting does occur, the plasmalemmal VDAC proteins may perform some other functions, such as being a receptor for plasminogen kringle 5 (56) or a trans-plasma membrane NADH-ferricyanide reductase (57), activities that are unrelated to the maxi-anion channel activity. The mass release of ATP could

be modulated (17) indirectly by VDAC protein expression, possibly due to an altered rate of ATP production by mitochondria, or by affecting other ATP releasing pathways. Another conclusion from these studies is that mitochondrial outer membrane permeability can be effectively ablated and yet the cell remains viable. This may reflect the limited dependence of fibroblasts on oxidative metabolism, as underscored by the ability to create rho 0 cells by mitochondrial DNA depletion (58).

It should be noted that, although both proteins transport ATP, the similarities in single-channel properties between VDAC and the maxi-anion channel are rather superficial, and closer inspection reveals crucial differences. Specifically, the single-channel conductance of the max-anion channel saturates at 617 pS (Kd=77 mM) and 640 pS (Kd=112 mM) with increases in the chloride concentration in skeletal muscle “sarcoballs” (59) and L6 myoblasts (60), respectively. In contrast, the VDAC single-channel conductance may reach levels of over 10 nS at high salt concentrations without any saturation (61), suggesting a principally different mechanism of ionic transport in these two pores. The same inference can be drawn by comparing the K+ to Cl– selectivity of these two channels. Under the same 10-fold KCl gradient, the maxi-anion channel generated a reversal potential of about 40 mV, whereas no more than approximately 10 mV was observed for mitochondrial VDAC (45), indicating that the maxi-anion channel is much more selective for chloride over potassium. Although the overall ranking of anionic permeability was similar for both channels (Br– ≈ Cl– > acetate), the numeric value of the permeability ratio was notably different for acetate. The permeability ratio for glutamate to Cl− of 0.23 for the WT-MEF maxi-anion channels was also different from the value of Pglutamet/PCl = 0.4 reported for mitochondrial porin (62).

Voltage-dependent gating is considered to be a common property for the two channels. Mitochondrial VDAC is known to retain

8

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

approximately 40% of its initial conductance in the so-called “closed” state, which is cation-selective (10, 12, 46). Like many other channels, the maxi-anion channel also displays subconductance states. However, normally it closes completely at high positive and negative voltages (e.g., see Fig. 1C). Voltage-dependent modulation of ionic selectivity has never been reported for maxi-anion channels, supporting our conclusion that the maxi-anion channel and mitochondrial VDAC are unrelated proteins.

The “maxi-anion channel = pl-VDAC” hypothesis has been stimulating. We believe, however, that a fresh start to molecular identification of the maxi-anion channel, an important gateway of purinergic signaling, should be undertaken. Particular attention to other candidates, such as connexin hemichannels or orthologs of the tweety gene found in the flightless locus of Drosophila (63) is warranted.

REFERENCES

1. Bodin, P., and Burnstock, G. (2001) Neurochem. Res. 26, 959-969 2. Sabirov, R. Z., and Okada, Y. (2004) Biophys. J. 87, 1672-1685 3. Sabirov, R. Z., and Okada, Y. (2004) Jpn. J. Physiol. 54, 7-14 4. Sabirov, R. Z., and Okada, Y. (2005) Purinergic Signalling. 1, (In press) 5. Sabirov, R. Z., Dutta, A. K., and Okada, Y. (2001) J. Gen. Physiol. 118, 251-266 6. Dutta, A. K., Okada, Y., and Sabirov, R. Z. (2002) J. Physiol. (London) 542, 803-816 7. Bell, P. D., Lapointe, J. Y., Sabirov, R., Hayashi, S., Peti-Peterdi, J., Manabe, K., Kovacs, G., and Okada,

Y. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 4322-4327 8. Dutta, A. K., Sabirov, R. Z., Uramoto, H., and Okada, Y. (2004) J. Physiol. (London) 559, 799-812 9. Strange, K., Emma, F., and Jackson, P. S. (1996) Am. J. Physiol 270, C711-C730 10. Colombini, M., Blachly-Dyson, E., and Forte, M. (1996) in Ion Channels, ed. Narahashi, T. (Plenum

Press, New York), pp. 169-202

11. Mannella, C. A. (1997) J. Bioenerg. Biomembr. 29, 525-531 12. Colombini, M. (2004) Mol. Cell Biochem. 256-257, 107-115 13. Dermietzel, R., Hwang, T. K., Buettner, R., Hofer, A., Dotzler, E., Kremer, M., Deutzmann, R., Thinnes,

F. P., Fishman, G. I., and Spray, D. C. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 499-503 14. Buettner, R., Papoutsoglou, G., Scemes, E., Spray, D. C., and Dermietzel, R. (2000) Proc. Natl. Acad. Sci.

U.S.A. 97, 3201-3206 15. Bahamonde, M. I., and Valverde, M. A. (2003) Pflugers Arch. 446, 309-313 16. Bahamonde, M. I., Fernandez-Fernandez, J. M., Guix, F. X., Vazquez, E., and Valverde, M. A. (2003) J.

Biol. Chem. 278, 33284-33289 17. Okada, S. F., O'Neal, W. K., Huang, P., Nicholas, R. A., Ostrowski, L. E., Craigen, W. J., Lazarowski, E.

R., and Boucher, R. C. (2004) J. Gen. Physiol. 124, 513-526

9

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18. Elinder, F., Akanda, N., Tofighi, R., Shimizu, S., Tsujimoto, Y., Orrenius, S., and Ceccatelli, S. (2005)

Cell Death. Differ. 12, 1134-1140 19. Thinnes, F. P., Gotz, H., Kayser, H., Benz, R., Schmidt, W. E., Kratzin, H. D., and Hilschmann, N. (1989)

Biol. Chem. Hoppe Seyler 370, 1253-1264 20. Jakob, C., Gotz, H., Hellmann, T., Hellmann, K. P., Reymann, S., Florke, H., Thinnes, F. P., and

Hilschmann, N. (1995) FEBS Lett. 368, 5-9 21. Eben-Brunnen, J., Reymann, S., Awni, L. A., Cole, T., Hellmann, T., Hellmann, K. P., Paetzold, G.,

Kleineke, J., Thinnes, F. P., Gotz, H. et al. (1998) Biol. Chem. 379, 1419-1426 22. Bathori, G., Parolini, I., Tombola, F., Szabo, I., Messina, A., Oliva, M., De, P., V, Lisanti, M.,

Sargiacomo, M., and Zoratti, M. (1999) J. Biol. Chem. 274, 29607-29612 23. Moon, J. I., Jung, Y. W., Ko, B. H., De, P., V, Jin, I., and Moon, I. S. (1999) Neuroreport 10, 443-447 24. Steinacker, P., Awni, L. A., Becker, S., Cole, T., Reymann, S., Hesse, D., Kratzin, H. D., Morris-

Wortmann, C., Schwarzer, C., Thinnes, F. P. et al. (2000) Int. J. Biochem. Cell Biol. 32, 225-234 25. Schwarzer, C., Becker, S., Awni, L. A., Cole, T., Merker, R., Barnikol-Watanabe, S., Thinnes, F. P., and

Hilschmann, N. (2000) Int. J. Biochem. Cell Biol. 32, 1075-1084 26. Shimizu, S., Matsuoka, Y., Shinohara, Y., Yoneda, Y., and Tsujimoto, Y. (2001) J. Cell Biol. 152, 237-

250 27. Bathori, G., Parolini, I., Szabo, I., Tombola, F., Messina, A., Oliva, M., Sargiacomo, M., De Pinto V., and

Zoratti, M. (2000) J. Bioenerg. Biomembr. 32, 79-89 28. Bureau, M. H., Khrestchatisky, M., Heeren, M. A., Zambrowicz, E. B., Kim, H., Grisar, T. M.,

Colombini, M., Tobin, A. J., and Olsen, R. W. (1992) J. Biol. Chem. 267, 8679-8684 29. Blachly-Dyson, E., Zambronicz, E. B., Yu, W. H., Adams, V., McCabe, E. R., Adelman, J., Colombini,

M., and Forte, M. (1993) J. Biol. Chem. 268, 1835-1841 30. Ha, H., Hajek, P., Bedwell, D. M., and Burrows, P. D. (1993) J. Biol. Chem. 268, 12143-12149 31. Sampson, M. J., Lovell, R. S., and Craigen, W. J. (1996) Genomics 33, 283-288 32. Sampson, M. J., Lovell, R. S., Davison, D. B., and Craigen, W. J. (1996) Genomics 36, 192-196 33. Sampson, M. J., Ross, L., Decker, W. K., and Craigen, W. J. (1998) J. Biol. Chem. 273, 30482-30486 34. Anflous, K., Blondel, O., Bernard, A., Khrestchatisky, M., and Ventura-Clapier, R. (1998) Biochim.

Biophys. Acta 1399, 47-50 35. Rahmani, Z., Maunoury, C., and Siddiqui, A. (1998) Eur. J. Hum. Genet. 6, 337-340 36. Graham, B. H., and Craigen, W. J. (2004) Curr. Top. Dev. Biol. 59, 87-118 37. Sampson, M. J., Decker, W. K., Beaudet, A. L., Ruitenbeek, W., Armstrong, D., Hicks, M. J., and

Craigen, W. J. (2001) J. Biol. Chem. 276, 39206-39212

10

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

38. Weeber, E. J., Levy, M., Sampson, M. J., Anflous, K., Armstrong, D. L., Brown, S. E., Sweatt, J. D., and

Craigen, W. J. (2002) J. Biol. Chem. 277, 18891-18897 39. Cheng, E. H., Sheiko, T. V., Fisher, J. K., Craigen, W. J., and Korsmeyer, S. J. (2003) Science 301, 513-

517

40. Wu, S., Sampson, M. J., Decker, W. K., and Craigen, W. J. (1999) Biochim. Biophys. Acta 1452, 68-78 41. Decker, W. K., and Craigen, W. J. (2000) Mol. Genet. Metab. 70, 69-74 42. Neher, E. (1992) Methods Enzymol. 207, 123-131 43. Boudreault, F., and Grygorczyk, R. (2002) Am. J. Physiol Cell Physiol. 282, C219-C226 44. Zamaraeva, M. V., Sabirov, R. Z., Maeno, E., Ando-Akatsuka, Y., Bessonova, S. V., and Okada, Y.

(2005) Cell Death. Differ. 12, 1390-1397 45. Blachly-Dyson, E., Peng, S., Colombini, M., and Forte, M. (1990) Science 247, 1233-1236 46. Colombini, M. (1989) J. Membrane Biol. 111, 103-111 47. Zizi, M., Byrd, C., Boxus, R., and Colombini, M. (1997) Biophys. J. 75, 704-713 48. Scorrano, L., Penzo, D., Petronilli, V., Pagano, F., and Bernardi, P. (2001) J. Biol. Chem. 276, 12035-

12040 49. Krasilnikov, O. V., Carneiro, C. M., Yuldasheva, L. N., Campos-de-Carvalho, A. C., and Nogueira, R. A.

(1996) Braz.J.Med.Biol.Res. 29, 1691-1697 50. Carneiro, C. M., Krasilnikov, O. V., Yuldasheva, L. N., Campos de Carvalho, A. C., and Nogueira, R. A.

(1997) FEBS Lett. 416, 187-189 51. Carneiro, C. M., Merzlyak, P. G., Yuldasheva, L. N., Silva, L. G., Thinnes, F. P., and Krasilnikov, O. V.

(2003) Biochim.Biophys.Acta 1612, 144-153 52. Mannella, C. A. (1998) J.Struct.Biol. 121, 207-218 53. Rostovtseva, T. K. and Bezrukov, S. M. (1998) Biophys.J. 74, 2365-2373 54. Rostovtseva, T. and Colombini, M. (1997) Biophys.J. 72, 1954-1962 55. Rostovtseva, T. K., Komarov, A., Bezrukov, S. M., and Colombini, M. (2002) J.Membr.Biol. 187, 147-

156

56. Gonzalez-Gronow, M., Kalfa, T., Johnson, C. E., Gawdi, G., and Pizzo, S. V. (2003) J. Biol. Chem. 278, 27312-27318

57. Baker, M. A., Lane, D. J., Ly, J. D., De Pinto V., and Lawen, A. (2004) J. Biol. Chem. 279, 4811-4819 58. King, M. P., and Attardi, G. (1989) Science 246, 500-503 59. Hals, G. D., Stein, P. G., and Palade, P. T. (1989) J. Gen. Physiol. 93, 385-410 60. Hurnak, O., and Zachar, J. (1994) Gen. Physiol. Biophys. 13, 171-192 61. Colombini, M. (1986) in Ion Channel Reconstitution, ed. Miller, C. (Plenum Press, New York), pp. 533-

550

11

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

62. Gincel, D., Silberberg, S.D., and Shoshan-Barmatz, V. (2000) J. Bioenerg. Biomembr. 32, 571-583 63. Suzuki, M., and Mizuno, A. (2004) J. Biol. Chem. 279, 22461-22468

FOOTNOTES

* This work was supported by Grants-in-Aid for Scientific Research (A) and (C) to Y.O. and R.Z.S. from the MEXT of Japan, by MOD grant 323 and R01 NS42319 to W.J.C. and the Child Health Research Center and Mental Retardation and Developmental Disabilities Research Center at Baylor College of Medicine. The authors would like to thank K. Shigemoto and M. Ohara for technical support as well as T. Okayasu for secretarial help.

1The abbreviations used are: VDAC, voltage-dependent anion channel; pl-VDAC,

plasmalemmal VDAC; MEF, mouse embryonic fibroblasts; MAF, mouse adult fibroblasts; dKO, double knock-out.

FIGURE LEGENDS Fig. 1. Single maxi-anion channel currents in inside-out patches excised from wild-type mouse

fibroblasts. (A) Representative current traces recorded at different voltages as indicated on the left of each trace. The pipette was filled with normal Ringer solution and the maxi-anion channels were activated by excising the patch into the normal Ringer solution. Arrowheads on the right indicate the zero current level. (B) Unitary current-to-voltage (I-V) relationship for maxi-anion channel events recorded in the inside-out mode with Ringer solution in the bath (open circles) or when 135 mM NaCl in Ringer solution was replaced with 135 mM of TEA-Cl (filled triangles) or Na-glutamate (filled circles). Open squares, filled squares and filled diamonds correspond to I-V relationships obtained with 100 mM KCl in the pipette and 1000 mM KCl, 1000 mM KBr and 1000 mM K-acetate in the bath solution, respectively (these solutions additionally contained 2 mM MgCl2 and 5 mM HEPES, pH 7.4). Each data point represents the mean ± SEM of 5 to 22 measurements from 5 different patches. The solid line for symmetrical conditions is a linear fit with a slope conductance of 400.3 ± 3.8 pS. The solid lines for asymmetrical conditions are polynomial fits with the reversal potentials indicated in the text. (C) Representative ramp I-V records from a patch exposed to standard Ringer solution and after replacing the Ringer solution in the bath with 100 mM Na4ATP solution. The pipette solution was standard Ringer. The current recorded with ATP in the bath reversed at –17 mV. (D) Effect of Gd3+ (50 µM) on the maxi-anion channel activity in the outside-out mode and of arachidonic acid (20 µM) in the inside-out mode. The applied pulse protocol is shown on the top.

Fig. 2. Maxi-anion channel activity in VDAC1- and VDAC3-deficient fibroblasts and in

VDAC1/VDAC3 double-deficient cells. (A) Effect of gene deletion on VDAC protein expression probed by Western blotting. Protein extracts (30 µg) from wild-type (WT-MEF), VDAC1-deficient (vdac1-/-), VDAC3-deficient (vdac3-/-), and VDAC1/VDAC3 double-deficient (dKO) cells were separated using

12

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12% Tris-HCL/SDS PAGE, transferred to a PVDF membrane and probed with anti-VDAC1 rabbit polyclonal antibodies (panel Aa) or anti-VDAC3 chicken polyclonal antibodies (panel Ab). The same blots were then probed with anti-beta-actin as a control for protein loading. (B, C and D) Representative current traces recorded at ± 25 mV from vdac1-/-, vdac3-/- and dKO cells, respectively. The respective single-channel current-to-voltage (I-V) relationships are shown on the right. Filled symbols represent the data obtained in symmetrical conditions with Ringer solution in the pipette and in the bath solution. Open symbols correspond to I-V relationships obtained with 100 mM KCl in the pipette and 1000 mM KCl in the bath solution (these solutions additionally contained 2 mM MgCl2 and 5 mM HEPES, pH 7.4). Each data point represents the mean ± SEM of 5 to 17 measurements from 5-6 different patches. The solid lines for symmetrical conditions are linear fits with slope conductances of 400.8 ± 5.0 pS, 391.1 ± 4.7 pS and 394.3 ± 2.3 pS for vdac1-/-, vdac3-/- and dKO cells, respectively. The slopes were not significantly different from the control slope (Fig. 1B, open circles) at P < 0.05. The solid lines for asymmetrical conditions are polynomial fits with the reversal potential of 36.9 ± 1.6 mV, 39.3 ± 1.5 mV and 39.7 ± 1.3 mV for vdac1-/-, vdac3-/- and dKO cells, respectively.

Fig. 3. Maxi-anion channel activity in VDAC2-deficient cells and in dKO cells with the vdac2

gene silenced by RNA interference. (A) Protein extracts (30 µg), from wild-type (WT-MEF or WT-MAF), VDAC2-deficient (vdac2-/-), VDAC1/VDAC3-deficient (dKO) fibroblasts, as well as three dKO RNAi clones (designated as dKO/RNAi-1, dKO/RNAi-2, dKO/RNAi-3, see Methods for details) were separated using 12% Tris-HCL/SDS PAGE, transferred to a PVDF membrane, and probed with anti-VDAC2 chicken polyclonal antibodies. The same blot was then probed with anti-beta-actin as a control for protein loading. (B) Representative current traces recorded at ± 25 mV from vdac2-/- cells (left) and the corresponding single-channel current-to-voltage relationship (right). Open symbols correspond to I-V relationships obtained with 100 mM KCl in the pipette and 1000 mM KCl in the bath solution (these solutions additionally contained 2 mM MgCl2 and 5 mM HEPES, pH 7.4). Each data point represents the mean ± SEM of 6 to 15 measurements from 5-6 different patches. The solid line fro symmetrical conditions is a linear fit with a slope conductance of 402.5 ± 3.4 pS (not significantly different from the slope for WT-MEF cells at P < 0.05). The solid line for asymmetrical conditions is a polynomial fit with the reversal potential of 38.3 ± 1.1 mV. (C) Maxi-anion channel activity in macropatches excised from wild-type fibroblasts (WT-MEF and WT-MAF), from VDAC1/VDAC3 double-deficient cells (dKO) and from dKO cells with vdac2 gene silenced by RNAi-1, RNAi-2 and RNAi-3. The mean numbers of channels per patch are not significantly different at P < 0.05.

Fig. 4. Swelling-induced ATP release from wild-type and VDAC-deficient fibroblasts. (A) Time-

course of ATP release from wild-type (WT-MEF) cells stimulated with control Ringer solution (filled circles) and hypotonic solution (open circles). (B) Effect of Gd3+, anion channel blockers and arachidonic acid (alone and in the presence of oxygenase inhibitors cocktail of indomethacin, NDGA and clotrimazole, 20 µM each) on swelling-induced ATP release from WT-MEF cells upon 15-min hypotonic stimulation. (C) The ATP release from wild-type fibroblasts (WT-MEF), VDAC1-deficient (vdac1-/-), VDAC2-deficient (vdac2-/-) and VDAC3-deficient (vdac3-/-) cells measured after 15-min stimulation with control Ringer solution (filled bars) and hypotonic solution (open bars). (D) The ATP release from wild type fibroblasts (WT-MAF), from VDAC1/VDAC3 double-deficient cells (dKO) and from dKO cells with vdac2 gene silenced by RNAi-1, RNAi-2 and RNAi-3 after 15-min stimulation with control Ringer solution (filled bars) and hypotonic solution (open bars). Each column represents the mean ±

13

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

SEM. * Significantly different from the control at P < 0.05 by ANOVA test. # Significantly different from WT-MAF at P < 0.05 by t-test.

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

-60 -40 -20 20 40 60 80

-30

-20

-10

10

20

-50 -25 25 50

-20

-10

10

20

20 pA-50

-40

-30

-20-101020

30

40

50mV

mV

pA

mV

pA

DC

Control TEA Glutamate 100 KCl / 1000 KCl 100 KCl / 1000 KBr 100 KCl / 1000 KAc

100 mM ATP4-

Ringer

B

Gd3+ (50 µM)

ControlOutside-out

A

50 ms

10 pA100 ms

Arachidonic acid (20 µM)

ControlInside-out

Figure 1

0 mV+25 mV

-25 mV

by guest on August 17, 2018 http://www.jbc.org/ Downloaded from

-50 -25 25 50 75

-20

-10

10

20

-50 -25 25 50 75

-20

-10

10

20

WT-MAFWT-MEF

dKOWT-MAFvdac1-/-WT-MEF

Actin

Actin

VDAC3

-25 mV -25 mV

+25 mV +25 mV

-25 mV

+25 mV

50 ms

vdac1-/-

10 pA

VDAC1

dKOvdac3-/-

50 ms10 pA

vdac3-/-

b

a

50 ms10 pA

DC

B

dKO

A

-50 -25 25 50 75

-20

-10

10

20

pA

pA

pA

mV

mV

Figure 2

mV

by guest on August 17, 2018 http://www.jbc.org/ Downloaded from

-50 -25 25 50 75

-20

-10

10

20

Figure 3

dKO/RNAi-3

dKO/RNAi-2

CB

A dKO/RNAi-1dKOWT-MAFvdac2-/-WT-MEF

-25 mV

+25 mV

VDAC2

Actin

mV

pA

50 ms10 pA

vdac2-/-

0

1

2

3

4n=9

n=9

n=8

n=11n=9

dKO-R

NAi-3

dKO-R

NAi-2

dKO-R

NAi-1dKO

WT-MAF

Num

ber o

f cha

nnel

s pe

r pat

ch

WT-MEF

n=11

by guest on August 17, 2018 http://www.jbc.org/ Downloaded from

0 10 20 30 40

0,0

0,5

1,0

1,5

2,0n=10 for each group

n=8

n=7

ATP

(nM

)

ATP

(nM

)

ATP

(nM

)

DC

B

Figure 4

A

Time (min)

Isotonic Hypotonic

ATP

(nM

)

0,0

0,5

1,0

1,5

2,0

dKO-R

NAi-3

dKO-R

NAi-2

dKO-R

NAi-1dKO

WT-M

AF

vdac

3 -/-

vdac

2 -/-

vdac

1 -/-

WT-M

EF

Arachid

onic

acid

+co

cktai

l

Arachid

onic

acid

Gliben

clamideGd3

+

NPPB

SITS

***

*

*

Contro

l

0,0

0,5

1,0

1,5

2,0

n=12n=12

n=12

n=12

n=12

n=12

n=10

Isotonic Hypotonic

0,0

0,5

1,0

1,5

2,0 n=11

n=12

n=12

n=11

n=12

n=12

n=12

n=12

n=12n=10

#

Isotonic Hypotonicn=11

by guest on August 17, 2018 http://www.jbc.org/ Downloaded from

William J. CraigenRavshan Z. Sabirov, Tatiana Sheiko, Hongtao Liu, Defeng Deng, Yasunobu Okada and

voltage-dependent anion channels (VDACs) are unrelated proteinsGenetic demonstration that the plasma membrane maxi-anion channel and

published online November 16, 2005J. Biol. Chem.

10.1074/jbc.M509482200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

by guest on August 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from