24/02/2016

Genetic Characterization of Omani

Cattle Using Microsatellite DNA Markers

Kareema R. Al-SinaniAnimal Production Researcher

Livestock Research Center

Ministry of Agriculture and Fisheries

Introduction

Cattle are one of the most important domestic animal species

In various parts of the world, cattle provide traction, meat,

milk and other products include leather and manure or fuel

Cattle are classified as : Bos taurus and Bos indicus, the zebu

Origin and Domestication of Cattle

• Cattle are thought to have beendomesticated from the aurochs

• Evidence from mitochondrialDNA indicates divergence of thetwo cattle groups, Bos indicusand Bos taurus, more than100,000 years ago.

• These two groups were likelydomesticated independently(Grigson 1980) some 10,000years before present

Cattle in Oman

Livestock sector in Oman, including cattle, plays an important role in Omani economy

This sector provides the country with food items (meat and milk products)

It also provides job opportunities for Omanis in the animal husbandry sector and developing the Omani rural areas

Cattle in Oman

The total number of cattle population grew from 301,000 heads in 2005 to 359,507 heads in 2013 (MAF, 2013).

Percentage of Cattle to livestock in Oman (MAF, 2013).

Distribution of Cattle in Oman

(MAF, 2013).

Cattle in Oman

Omani cattle are characterized by hump and horns , and are classified as Zebu cattle

Omani cattle show a very heterogenic population with a markedly Bos Indicus ancestry and with some degree of admixture with Bos taurus of African and Near East origin (Mahgoub et al., 2012)

Local Omani cattle is divided into two groups; Al-Batinah cattle (North of Oman) and Dhofari cattle (South of Oman) (MAF, 2012)

Cattle Breeds in Oman

Al-Batinah Cattle

Light brown with medium size

Color

250 kg – 200 kgAverage adult Body weight (kg)

3.1 kg/dAverage Daily Milk Yield (kg/d)

-Northern and Interior part of country- Raised under traditional system

Location

Meat & milkUse

Cattle Breeds in Oman

Dhofari Cattle

Dark brown to blackColor

325 kg – 270 kgAverage adult body weight (kg)

6 kg/dAverage daily milk yield (kg/d)

-Southern part of country- Raised under stationary grazing system

Location

Meat & milkUse

Cattle in Oman

Genetic characterization of local Omani cattle breeds is the first step towards their sustainable use in genetic improvement programs

Accurate and reliable information on genetic distances within and among Omani cattle breeds is required in order to make the most optimal use of breeding program

The development of molecular techniques has led to an increase in the studies on the genetic characterization of domestic breeds using genetic markers (Giovambattistaet al.,2001)

Microsatellite

Short sequences of nucleotide ( typically 1 to 6 bp) which represent tandem repeats of genomic DNA in length

One of the most powerful techniques for evaluating genetic variation and diversity (MacHugh et al., 1994)

Relatively easy to use and have high levels of accuracy (Goldstein and Shlötterer, 2000)

They are used to determine the genetic characterization of many living organisms(Beaumont and Bruford, 1999).

Major Objective

• To study genetic diversity of Omani cattle using microsatellite

DNA markers

Specific Objectives

To provide preliminary molecular data on the genetic diversity of Omani

cattle breeds

To estimate the allelic frequency, percent heterozygosity for 6

microsatellite markers in Omani cattle population

To assess the genetic distance among Al-Batina and Dhofari Cattle

To assess the genetic distance between the local Omani Cattle and the

Pakistani , Ethiopian , Friesian, Jersey and Charolais Cattle.

Materials & Methods

1. Blood Samples Collection: Al-Batinah(15 samples)

Dhofar (14 samples)

Pakistani Cattle(5 samples)

Ethiopian Cattle(7 samples)

Charolais (33)

Friesian (35)

Jersey (32)

Materials & Methods

Genomic DNA extracted from whole

blood samples using Qiagen kit

(QIAamp Blood Midi Kit)

Quantification of quality andpurity of DNA using nano

drop machine

Materials & Methods

UV spectrophotometer and separation of the

PCR products

The amplification products of each PCR

reaction were studied by agarose gel

electrophoresis Polymerase Chain Reaction (PCR)

Thermal cycler used for PCR

Materials & MethodsMicrosatellite markers used

DyeReverse Primer SequenceForward Primer SequenceMicrosatellites

Fam

ACACGGAAGCGATCTAAACGTGTCTGTATTTCTGCTGTGGILSTS006

Vic

AGATTTCTGAAGTAGGGACCTCTAGAAGGCTGGGACTTGGILSTS023

Ned

GTCATGTCATACCTTTGAGCTCCAGATTTTGTACCAGACCILSTS028

Ned

GTTTTTCTACACGAGTTGGCAAATCAGACACCCAGTTTCCILSTS050

FamAATCACATGGCAAATAAGTACATAC

CCCTCCTCCAGGTAAATCAGCTGLA122

Vic

GCTCTTGGAAGCTTATTGTATAAAG

GAGCAGCTTCTTTCTTTCTCATCTTMGTG4B

Materials & Methods

Statistical analyses for microsatellites

• Allele frequency

• Heterozygosity (He) extent of diversity of each MS

•Genetic distances measured by FST

•The polymorphism information content (PIC) of microsatellite loci estimated

•Statistic programs: Pop gene, Gene Alex and Microsatellite toolkit.

Results and Discussion• Estimate of MS sizes using capillary electrophoresis

Figure represented electropherogram for fragment analysis. Peak profile and

size determination of ILSTS023 locus for S11 sample (South Oman cattle).

ILSTS023 locus labeled with green (VIC). S11 sample has two different

alleles size (heterozygous). The size of amplitude is shown at the top of each

peak. The peak sizes are measured in base pairs (bp). This electropherogram

for S11 sample shows size of 169.8 bp for allele (a) and 234.7 bp for allele

(b).

234.7 bp

169.9 bp

Results and Discussion (Cont.)• Total number of alleles observed and allele size range for each

locus in the study

ReferencesAllele Size

(bp)

Number of

alleles

Locus Name

279 – 301

(Chaudhari et al,2009)

283-30511ILSTS006

-163-23512ILSTS023

119-151

(Freeman et al,2006)118-16111ILSTS028

130-166

(Freeman et al,2006)140-16110ILSTS050

139 – 185

(Zhou et al,2005)135-18418TGLA122

-131-15312MGTG4B

74Total

Results and Discussion (Cont.)• Total number of alleles observed for different Loci in each breed

TNA: Total number of different alleles in each population

MNA/locus: Mean number of alleles observed for each locus for each breed

MNA/pop.: Mean number of alleles observed for each breed/sample

The populations are: Oman north (ON); Oman South; Ethiopian (ET); Pakistani (PK);

Charolais (CH); Friesian (FR); Jersey (JR).

Locus /

Pop. ON OS ET PK CH FR JRMNA/LOCUS

ILSTS006 7 6 1 4 8 6 7 5.57

ILSTS023 4 6 4 3 5 6 3 4.43

ILSTS028 5 5 5 5 4 7 4 5.00

ILSTS50 8 6 4 4 4 7 6 5.57

TGLA122 10 6 5 5 8 14 7 7.86

MGTG4B 8 8 6 4 6 10 4 6.57

TNA/POP 42 37 25 25 35 50 31 245

MNA/POP 7.00 6.17 4.17 4.17 5.83 8.33 5.17 6.05

Results and Discussion (Cont.)

ReferencesRange Number of

Alleles Observed

Breed

Present study4 - 10Omani Cattle

Present study6 – 14Friesian Cattle

Present study1 - 6Ethiopian Cattle

Present study3 - 5Pakistani Cattle

Present study4 – 8Charolais Cattle

Present study3 – 7Jersey Cattle

Allelic Diversity

Results and Discussion (Cont.)

• The average

number of alleles

observed in the

present study

compared to other

cattle breeds

• Omani cattle in the

present study had

high mean number

of alleles (6.58)

with a range

between 7.00

Omani North and

6.17 Omani South.

ReferenceMean no. of

alleles

Name of the

species

Present study5.83Charolais Cattle

(Rehman and

Khan,2009)

4.37Hissar Cattle

Present study

(Wiener et al,2004)

8.33 /

6.30

Friesian Cattle

( Karthickeyan et

al,2007)

3.88Ongole Cattle

Present study4.17Ethiopian Cattle

Present study4.17Pakistani Cattle

Present study

(Wiener et al,2004)

5.17

4.77

Jersey Cattle

Present study6.58

(7.00-6.17)

Omani Cattle

Allelic Diversity

Results and Discussion (Cont.)

• The number of alleles unique to a particular population ranges

from 2 to 9

Private alleles

Locus / Pop ON OS ET PK CH FR JR Total

ILSTS006 1 - - 1 1 - 3 6

ILSTS023 - - - 2 - 3 - 5

ILSTS028 1 - - - - 3 - 4

ILSTS50 - - - - - - - 0

TGLA122 - - - - 1 1 - 2

MGTG4B - - - - - 2 - 2

Total 2 0 0 3 2 9 3 19

Results and Discussion (Cont.)Effective number of alleles (Ne)

Locus / Pop. ON OS ET PK CH FR JR MNA/LOCUS

ILSTS006 3.33 3.56 1.00 2.29 5.63 3.33 4.53 3.38

ILSTS023 1.53 2.29 2.58 1.68 2.44 3.73 1.15 2.20

ILSTS028 4.21 3.38 3.63 3.85 2.07 2.92 2.10 3.16

ILSTS50 5.29 3.76 3.16 2.78 2.47 3.08 3.22 3.39

TGLA122 5.70 2.88 3.00 2.50 3.76 6.88 3.03 3.97

MGTG4B 3.57 4.96 5.14 3.60 2.72 4.26 3.57 3.97

Mean 3.94 3.47 3.09 2.78 3.18 4.03 2.93 3.35

Results and Discussion (Cont.)Heterozygosity (H) measurements

• Observed (Ho) and expected (He) Heterozygosity for each population.

Population HO ± SD He ± SD

ON 0.5333±0.113 0.694 ±0.113

OS 0.5440±0.0553 0.7222 ±0.0340

ET 0.5040±0.0822 0.6303 ±0.1295

PK 0.7083±0.0891 0.6956 ±0.0585

CH 0.6327±0.0349 0.6590 ±0.0458

FR 0.7019±0.0319 0.7415 ±0.0300

JR 0.5372±0.0372 0.5955 ±0.0989

Mean 0.589 ±0.053 0.719 ±0.048

Ho = Observed Heterozygosity = No. of Hets / total no. of alleles

He = Expected Heterozygosity = 1 - Sum pi^2

Where pi is the frequency of the allele for the population & sum pi^2 is the

sum of the squared population allele frequencies

Results and Discussion (Cont.)

• The average expected Heterozygosity (He) should be in the range of 0.3 to 0.8 (Takezaki and Nei, 1996) for markers to be useful in measuring genetic variation in a population .

Heterozygosity (H) measurements

• Observed (Ho) and expected (He) Heterozygosity for each population.

Population Ho He Referance

Omani Cattle0.53 0.71 / 0.77

Present study

(Mahgoub et all,2012)

Taleshie Cattle 0.57 0.68 (Mirhoseinie et al,2005)

Ethiopian Cattle0.50 0.63 Present study

Pakistani Cattle0.70 0.69 Present study

Hariana Cattle 0.51 0.67 (Rehman and Khan,2009)

Charolais Cattle0.63 0.65 Present study

Friesian Cattle0.70/ 0.66 0.74 (Wiener et al,2004)

Jersey Cattle 0.54 0.59/0.53 (Moazami et al,1997)

Results and Discussion (Cont.)

• A microsatellite locus is highly polymorphic if PIC ≥ 0.5

• A microsatellite locus is medium polymorphic if PIC between 0.25 and 0.5

• A microsatellite locus is low polymorphic if it was lower than 0.25

• All marker values were highly polymorphic in the studied breeds (PIC > 0.50)

The polymorphic information content (PIC)

LOCI PIC Referance

ILSTS006 0.827

ILSTS023 0.759

ILSTS028 0.793

ILSTS50 0.769

TGLA122 / 0.8650.882 (Almeida et al,2004)

MGTG4B 0.859

Results and Discussion (Cont.)

• Fis = (Mean He - Mean Ho) / Mean He

• Fit = (Ht - Mean Ho) / Ht

• Fst = (Ht - Mean He) / Ht

• Nm= [(1 / Fst) - 1] /4 (Nei, 1987).

F-Statistics

Locus Fis Fit Fst Nm

ILSTS006 0.0088 0.2491 0.2424 0.7813

ILSTS023 0.4217 0.578 0.2703 0.6750

ILSTS028 -0.1253 0.1121 0.211 0.9349

ILSTS50 0.0734 0.1588 0.0922 2.4628

TGLA122 0.1493 0.304 0.1818 1.1248

MGTG4B 0.0648 0.221 0.1671 1.2464

Mean 0.098783 0.2705 0.194133 1.2042

Results and Discussion (Cont.)Genetic distances

• Pairwise Fst as a measure of genetic differentiation among

eight cattle breeds (n=141). The populations are: Oman north

(ON); Oman South; Ethiopian (ET); Pakistani (PK); Charolais

(CH); Friesian (FR); Jersey (JR).

ON OS ET PK CH FR

OS 0.066

ET 0.129 0.084

PK 0.024 0.077 0.171

CH 0.177 0.176 0.229 0.217

FR 0.133 0.133 0.196 0.148 0.065

JR 0.281 0.259 0.335 0.305 0.150 0.120

Results and Discussion (Cont.)Principal Coordinate Analysis (PCoA)

Principal coordinates analysis built using pairwise FST genetic

distances for eight cattle breeds (n=141).

Results and Discussion (Cont.)Neighbor-joining tree

Neighbor-joining tree for seven cattle breeds (n=141) based

on Nei’s standard genetic distance. Numbers in nodes are

percentage bootstrap values obtained from 10,000

replicates.

ON

PK

OS

ET

CH

FR

JR

0.00.10.20.30.4

Conclusions• The study showed a significant genetic diversity in two

Omani cattle breeds

• All six loci were highly polymorphic and are useful and

successful to be used in characterization of the Omani

cattle breeds

• There was a close distance between the North and South

Omani Cattle

• There was a large distance between Omani cattle and

European breeds (Jersey, Friesian and Charolais)

Recommendations

• The study proved that Omani cattle population should be regarded as two true breeds ; North and South cattle

• Crossbreeding should not be practiced between the local cattle breeds and selection within breed should be carried out

• Farmers should be educated and trained on selection and cross breeding programs to avoid inbreeding

The information generated in this study may further be utilized for studying differentiation and relationships among two Omani cattle breeds

• Further studies are needed to identify molecular markers related to productive, reproductive and adaptive traits

Acknowledgements

Prof. Osman Mahgoub

Prof. Isam Kadim

Dr. Waleed Al-Marzouqi

Dr. Badar Al-Qamashoui

Acknowledgements

Dr. Albano Beja Pereira

Dr. Hamza Babiker

Mr. Nasser Al-Araimi

All faculty in Department of Animal and Veterinary Sciences

All engineers and technical staff in Directorate of Agriculture and Livestock

Research, especially LRC.

Technical staff in the

Department of Animal and Veterinary Sciences College of Agricultural and

Marine Sciences

Department of Biochemistry, College of Medicine and Health Sciences

Thank You