genetic characterization of omani cattle using ... two/session 2/kareema... · genetic...
TRANSCRIPT
24/02/2016
Genetic Characterization of Omani
Cattle Using Microsatellite DNA Markers
Kareema R. Al-SinaniAnimal Production Researcher
Livestock Research Center
Ministry of Agriculture and Fisheries
Introduction
Cattle are one of the most important domestic animal species
In various parts of the world, cattle provide traction, meat,
milk and other products include leather and manure or fuel
Cattle are classified as : Bos taurus and Bos indicus, the zebu
Origin and Domestication of Cattle
• Cattle are thought to have beendomesticated from the aurochs
• Evidence from mitochondrialDNA indicates divergence of thetwo cattle groups, Bos indicusand Bos taurus, more than100,000 years ago.
• These two groups were likelydomesticated independently(Grigson 1980) some 10,000years before present
Cattle in Oman
Livestock sector in Oman, including cattle, plays an important role in Omani economy
This sector provides the country with food items (meat and milk products)
It also provides job opportunities for Omanis in the animal husbandry sector and developing the Omani rural areas
Cattle in Oman
The total number of cattle population grew from 301,000 heads in 2005 to 359,507 heads in 2013 (MAF, 2013).
Percentage of Cattle to livestock in Oman (MAF, 2013).
Distribution of Cattle in Oman
(MAF, 2013).
Cattle in Oman
Omani cattle are characterized by hump and horns , and are classified as Zebu cattle
Omani cattle show a very heterogenic population with a markedly Bos Indicus ancestry and with some degree of admixture with Bos taurus of African and Near East origin (Mahgoub et al., 2012)
Local Omani cattle is divided into two groups; Al-Batinah cattle (North of Oman) and Dhofari cattle (South of Oman) (MAF, 2012)
Cattle Breeds in Oman
Al-Batinah Cattle
Light brown with medium size
Color
250 kg – 200 kgAverage adult Body weight (kg)
3.1 kg/dAverage Daily Milk Yield (kg/d)
-Northern and Interior part of country- Raised under traditional system
Location
Meat & milkUse
Cattle Breeds in Oman
Dhofari Cattle
Dark brown to blackColor
325 kg – 270 kgAverage adult body weight (kg)
6 kg/dAverage daily milk yield (kg/d)
-Southern part of country- Raised under stationary grazing system
Location
Meat & milkUse
Cattle in Oman
Genetic characterization of local Omani cattle breeds is the first step towards their sustainable use in genetic improvement programs
Accurate and reliable information on genetic distances within and among Omani cattle breeds is required in order to make the most optimal use of breeding program
The development of molecular techniques has led to an increase in the studies on the genetic characterization of domestic breeds using genetic markers (Giovambattistaet al.,2001)
Microsatellite
Short sequences of nucleotide ( typically 1 to 6 bp) which represent tandem repeats of genomic DNA in length
One of the most powerful techniques for evaluating genetic variation and diversity (MacHugh et al., 1994)
Relatively easy to use and have high levels of accuracy (Goldstein and Shlötterer, 2000)
They are used to determine the genetic characterization of many living organisms(Beaumont and Bruford, 1999).
Major Objective
• To study genetic diversity of Omani cattle using microsatellite
DNA markers
Specific Objectives
To provide preliminary molecular data on the genetic diversity of Omani
cattle breeds
To estimate the allelic frequency, percent heterozygosity for 6
microsatellite markers in Omani cattle population
To assess the genetic distance among Al-Batina and Dhofari Cattle
To assess the genetic distance between the local Omani Cattle and the
Pakistani , Ethiopian , Friesian, Jersey and Charolais Cattle.
Materials & Methods
1. Blood Samples Collection: Al-Batinah(15 samples)
Dhofar (14 samples)
Pakistani Cattle(5 samples)
Ethiopian Cattle(7 samples)
Charolais (33)
Friesian (35)
Jersey (32)
Materials & Methods
Genomic DNA extracted from whole
blood samples using Qiagen kit
(QIAamp Blood Midi Kit)
Quantification of quality andpurity of DNA using nano
drop machine
Materials & Methods
UV spectrophotometer and separation of the
PCR products
The amplification products of each PCR
reaction were studied by agarose gel
electrophoresis Polymerase Chain Reaction (PCR)
Thermal cycler used for PCR
Materials & MethodsMicrosatellite markers used
DyeReverse Primer SequenceForward Primer SequenceMicrosatellites
Fam
ACACGGAAGCGATCTAAACGTGTCTGTATTTCTGCTGTGGILSTS006
Vic
AGATTTCTGAAGTAGGGACCTCTAGAAGGCTGGGACTTGGILSTS023
Ned
GTCATGTCATACCTTTGAGCTCCAGATTTTGTACCAGACCILSTS028
Ned
GTTTTTCTACACGAGTTGGCAAATCAGACACCCAGTTTCCILSTS050
FamAATCACATGGCAAATAAGTACATAC
CCCTCCTCCAGGTAAATCAGCTGLA122
Vic
GCTCTTGGAAGCTTATTGTATAAAG
GAGCAGCTTCTTTCTTTCTCATCTTMGTG4B
Materials & Methods
Statistical analyses for microsatellites
• Allele frequency
• Heterozygosity (He) extent of diversity of each MS
•Genetic distances measured by FST
•The polymorphism information content (PIC) of microsatellite loci estimated
•Statistic programs: Pop gene, Gene Alex and Microsatellite toolkit.
Results and Discussion• Estimate of MS sizes using capillary electrophoresis
Figure represented electropherogram for fragment analysis. Peak profile and
size determination of ILSTS023 locus for S11 sample (South Oman cattle).
ILSTS023 locus labeled with green (VIC). S11 sample has two different
alleles size (heterozygous). The size of amplitude is shown at the top of each
peak. The peak sizes are measured in base pairs (bp). This electropherogram
for S11 sample shows size of 169.8 bp for allele (a) and 234.7 bp for allele
(b).
234.7 bp
169.9 bp
Results and Discussion (Cont.)• Total number of alleles observed and allele size range for each
locus in the study
ReferencesAllele Size
(bp)
Number of
alleles
Locus Name
279 – 301
(Chaudhari et al,2009)
283-30511ILSTS006
-163-23512ILSTS023
119-151
(Freeman et al,2006)118-16111ILSTS028
130-166
(Freeman et al,2006)140-16110ILSTS050
139 – 185
(Zhou et al,2005)135-18418TGLA122
-131-15312MGTG4B
74Total
Results and Discussion (Cont.)• Total number of alleles observed for different Loci in each breed
TNA: Total number of different alleles in each population
MNA/locus: Mean number of alleles observed for each locus for each breed
MNA/pop.: Mean number of alleles observed for each breed/sample
The populations are: Oman north (ON); Oman South; Ethiopian (ET); Pakistani (PK);
Charolais (CH); Friesian (FR); Jersey (JR).
Locus /
Pop. ON OS ET PK CH FR JRMNA/LOCUS
ILSTS006 7 6 1 4 8 6 7 5.57
ILSTS023 4 6 4 3 5 6 3 4.43
ILSTS028 5 5 5 5 4 7 4 5.00
ILSTS50 8 6 4 4 4 7 6 5.57
TGLA122 10 6 5 5 8 14 7 7.86
MGTG4B 8 8 6 4 6 10 4 6.57
TNA/POP 42 37 25 25 35 50 31 245
MNA/POP 7.00 6.17 4.17 4.17 5.83 8.33 5.17 6.05
Results and Discussion (Cont.)
ReferencesRange Number of
Alleles Observed
Breed
Present study4 - 10Omani Cattle
Present study6 – 14Friesian Cattle
Present study1 - 6Ethiopian Cattle
Present study3 - 5Pakistani Cattle
Present study4 – 8Charolais Cattle
Present study3 – 7Jersey Cattle
Allelic Diversity
Results and Discussion (Cont.)
• The average
number of alleles
observed in the
present study
compared to other
cattle breeds
• Omani cattle in the
present study had
high mean number
of alleles (6.58)
with a range
between 7.00
Omani North and
6.17 Omani South.
ReferenceMean no. of
alleles
Name of the
species
Present study5.83Charolais Cattle
(Rehman and
Khan,2009)
4.37Hissar Cattle
Present study
(Wiener et al,2004)
8.33 /
6.30
Friesian Cattle
( Karthickeyan et
al,2007)
3.88Ongole Cattle
Present study4.17Ethiopian Cattle
Present study4.17Pakistani Cattle
Present study
(Wiener et al,2004)
5.17
4.77
Jersey Cattle
Present study6.58
(7.00-6.17)
Omani Cattle
Allelic Diversity
Results and Discussion (Cont.)
• The number of alleles unique to a particular population ranges
from 2 to 9
Private alleles
Locus / Pop ON OS ET PK CH FR JR Total
ILSTS006 1 - - 1 1 - 3 6
ILSTS023 - - - 2 - 3 - 5
ILSTS028 1 - - - - 3 - 4
ILSTS50 - - - - - - - 0
TGLA122 - - - - 1 1 - 2
MGTG4B - - - - - 2 - 2
Total 2 0 0 3 2 9 3 19
Results and Discussion (Cont.)Effective number of alleles (Ne)
Locus / Pop. ON OS ET PK CH FR JR MNA/LOCUS
ILSTS006 3.33 3.56 1.00 2.29 5.63 3.33 4.53 3.38
ILSTS023 1.53 2.29 2.58 1.68 2.44 3.73 1.15 2.20
ILSTS028 4.21 3.38 3.63 3.85 2.07 2.92 2.10 3.16
ILSTS50 5.29 3.76 3.16 2.78 2.47 3.08 3.22 3.39
TGLA122 5.70 2.88 3.00 2.50 3.76 6.88 3.03 3.97
MGTG4B 3.57 4.96 5.14 3.60 2.72 4.26 3.57 3.97
Mean 3.94 3.47 3.09 2.78 3.18 4.03 2.93 3.35
Results and Discussion (Cont.)Heterozygosity (H) measurements
• Observed (Ho) and expected (He) Heterozygosity for each population.
Population HO ± SD He ± SD
ON 0.5333±0.113 0.694 ±0.113
OS 0.5440±0.0553 0.7222 ±0.0340
ET 0.5040±0.0822 0.6303 ±0.1295
PK 0.7083±0.0891 0.6956 ±0.0585
CH 0.6327±0.0349 0.6590 ±0.0458
FR 0.7019±0.0319 0.7415 ±0.0300
JR 0.5372±0.0372 0.5955 ±0.0989
Mean 0.589 ±0.053 0.719 ±0.048
Ho = Observed Heterozygosity = No. of Hets / total no. of alleles
He = Expected Heterozygosity = 1 - Sum pi^2
Where pi is the frequency of the allele for the population & sum pi^2 is the
sum of the squared population allele frequencies
Results and Discussion (Cont.)
• The average expected Heterozygosity (He) should be in the range of 0.3 to 0.8 (Takezaki and Nei, 1996) for markers to be useful in measuring genetic variation in a population .
Heterozygosity (H) measurements
• Observed (Ho) and expected (He) Heterozygosity for each population.
Population Ho He Referance
Omani Cattle0.53 0.71 / 0.77
Present study
(Mahgoub et all,2012)
Taleshie Cattle 0.57 0.68 (Mirhoseinie et al,2005)
Ethiopian Cattle0.50 0.63 Present study
Pakistani Cattle0.70 0.69 Present study
Hariana Cattle 0.51 0.67 (Rehman and Khan,2009)
Charolais Cattle0.63 0.65 Present study
Friesian Cattle0.70/ 0.66 0.74 (Wiener et al,2004)
Jersey Cattle 0.54 0.59/0.53 (Moazami et al,1997)
Results and Discussion (Cont.)
• A microsatellite locus is highly polymorphic if PIC ≥ 0.5
• A microsatellite locus is medium polymorphic if PIC between 0.25 and 0.5
• A microsatellite locus is low polymorphic if it was lower than 0.25
• All marker values were highly polymorphic in the studied breeds (PIC > 0.50)
The polymorphic information content (PIC)
LOCI PIC Referance
ILSTS006 0.827
ILSTS023 0.759
ILSTS028 0.793
ILSTS50 0.769
TGLA122 / 0.8650.882 (Almeida et al,2004)
MGTG4B 0.859
Results and Discussion (Cont.)
• Fis = (Mean He - Mean Ho) / Mean He
• Fit = (Ht - Mean Ho) / Ht
• Fst = (Ht - Mean He) / Ht
• Nm= [(1 / Fst) - 1] /4 (Nei, 1987).
F-Statistics
Locus Fis Fit Fst Nm
ILSTS006 0.0088 0.2491 0.2424 0.7813
ILSTS023 0.4217 0.578 0.2703 0.6750
ILSTS028 -0.1253 0.1121 0.211 0.9349
ILSTS50 0.0734 0.1588 0.0922 2.4628
TGLA122 0.1493 0.304 0.1818 1.1248
MGTG4B 0.0648 0.221 0.1671 1.2464
Mean 0.098783 0.2705 0.194133 1.2042
Results and Discussion (Cont.)Genetic distances
• Pairwise Fst as a measure of genetic differentiation among
eight cattle breeds (n=141). The populations are: Oman north
(ON); Oman South; Ethiopian (ET); Pakistani (PK); Charolais
(CH); Friesian (FR); Jersey (JR).
ON OS ET PK CH FR
OS 0.066
ET 0.129 0.084
PK 0.024 0.077 0.171
CH 0.177 0.176 0.229 0.217
FR 0.133 0.133 0.196 0.148 0.065
JR 0.281 0.259 0.335 0.305 0.150 0.120
Results and Discussion (Cont.)Principal Coordinate Analysis (PCoA)
Principal coordinates analysis built using pairwise FST genetic
distances for eight cattle breeds (n=141).
Results and Discussion (Cont.)Neighbor-joining tree
Neighbor-joining tree for seven cattle breeds (n=141) based
on Nei’s standard genetic distance. Numbers in nodes are
percentage bootstrap values obtained from 10,000
replicates.
ON
PK
OS
ET
CH
FR
JR
0.00.10.20.30.4
Conclusions• The study showed a significant genetic diversity in two
Omani cattle breeds
• All six loci were highly polymorphic and are useful and
successful to be used in characterization of the Omani
cattle breeds
• There was a close distance between the North and South
Omani Cattle
• There was a large distance between Omani cattle and
European breeds (Jersey, Friesian and Charolais)
Recommendations
• The study proved that Omani cattle population should be regarded as two true breeds ; North and South cattle
• Crossbreeding should not be practiced between the local cattle breeds and selection within breed should be carried out
• Farmers should be educated and trained on selection and cross breeding programs to avoid inbreeding
The information generated in this study may further be utilized for studying differentiation and relationships among two Omani cattle breeds
• Further studies are needed to identify molecular markers related to productive, reproductive and adaptive traits
Acknowledgements
Prof. Osman Mahgoub
Prof. Isam Kadim
Dr. Waleed Al-Marzouqi
Dr. Badar Al-Qamashoui
Acknowledgements
Dr. Albano Beja Pereira
Dr. Hamza Babiker
Mr. Nasser Al-Araimi
All faculty in Department of Animal and Veterinary Sciences
All engineers and technical staff in Directorate of Agriculture and Livestock
Research, especially LRC.
Technical staff in the
Department of Animal and Veterinary Sciences College of Agricultural and
Marine Sciences
Department of Biochemistry, College of Medicine and Health Sciences
Thank You