gender and strain-specific differences in the development of steatosis in rats

Original Article

Gender and strain-specific differences in the development of

steatosis in rats

S Stoppeler1, D Palmes1, M Fehr2, J P Holzen1, A Zibert3, R Siaj3, H H-J Schmidt3, H-U Spiegel1

and R Bahde1

1Surgical Research, Department of General and Visceral Surgery, Muenster University Hospital, Muenster, Germany; 2University of

Veterinary Medicine Hannover, Foundation, Clinic for Exotic Pets, Reptiles, Pet and Feral Birds, Hannover, Germany; 3Clinic for

Transplantation Medicine, Muenster University Hospital, Muenster, Germany

Corresponding author: H-U Spiegel. Email: [email protected]

AbstractNon-alcoholic fatty liver disease (NAFLD) is a common problem with a wide variety of phenotypes. While its pathogenesis is

still not fully understood, several risk factors for disease progression have been identified. Therefore, defining adequate animal

models may serve to unreveal the pathogenesis in NAFLD. We studied Lewis and Sprague-Dawley rats of both genders (n ¼ 6)

fed standard (Std) or high-fat (HF) diet for three weeks. Disease stage was assessed by haematoxylin–eosin, Azan

Heidenheim and Oil-Red staining, apoptosis by single-stranded DNA (ssDNA) detection and liver regeneration by Ki-67

staining. Serum markers of liver injury and lipid metabolism including adipocytokines were analysed. Livers of both strains and

genders fed with HF diet demonstrated evidence of steatosis. Lewis rats developed microvesicular steatosis whereas

Sprague-Dawley rats presented macrovesicular steatosis accompanied by pronounced fibrosis. Female gender of both strains

was associated with lower steatosis grade and higher proliferation rate (P , 0.05). Gender-specific differences were most

prominent in Lewis rats on a HF diet, where females showed lower alkaline phosphatase, cholesterol, triglyceride and leptin

levels and a more favourable low-density lipoprotein/high-density lipoprotein ratio than males (P , 0.05). Reverse

transcriptase-polymerase chain reaction analysis was performed to demonstrate changes in expression of various genes

important for liver regeneration, fibrosis and steatosis. HF diet induced downregulation of proangiogenic genes such as

vascular endothelial growth factor receptor 1 and 2 (P , 0.05) in males was not present in females. In conclusion, strain and

gender served major roles in disease progression. These differences should be considered when designing studies and may

offer new ways to advance therapeutic strategies.

Keywords: NAFLD, steatosis, rat strain, gender differences, high-fat diet

Laboratory Animals 2013; 47: 43–52. DOI: 10.1177/0023677212473717

The increasing burden of non-alcoholic fatty liver disease(NAFLD) has resulted in greater attention towards its associ-ated rise in morbidity and mortality. Even children can beaffected. Among the various risk factors identified so far, ahigh-fat (HF) diet is one major prerequisite.1 The spectrumof NAFLD ranges from bland fatty infiltration to non-alcoholic steatohepatitis (NASH), fibrosis, cirrhosis and caneventually lead to end-stage liver disease with an increasedrisk of hepatocellular carcinoma.2 Our current understandingof the pathogenesis may be explained by the two-hit hypoth-esis, where steatosis induced by increased fatty acid synthesisand hepatic uptake is followed by oxidative stress and releaseof proinflammatory and profibrogenic mediators.3

NAFLD has been associated with several conditionssuch as ‘metabolic syndrome’ (including obesity, insulin

resistance and dyslipidaemia), metabolic diseases, surgicalinterventions, medications, age, ethnicity and gender.2

Gender-specific differences in prevalence, degree of liverinjury and adipocytokine levels of adolescents with NAFLDhave been reported.4 In general, NAFLD is more commonin men than in women and a reversal in gender distributionfollowing menopause suggests an oestrogen-mediated pro-tective effect on liver fat accumulation.5 The higher preva-lence of NASH in morbidly obese men compared withwomen indicates gender differences even in the spectrumof NAFLD.6 However, animal studies showed conflictingresults regarding oestrogen-mediated protection againstthe development of steatosis.7 – 9 Additionally, strain seemsto be an important factor for the induction of fatty liveralso, but mechanisms causing interstrain differences in the

Laboratory Animals 2013; 47: 43–52

mailto:[email protected]

development of NAFLD are unknown.10,11 In the presentstudy the impact of gender and strain on the degree ofhepatic steatosis, lipid metabolism and gene expressionwas investigated in a model of HF diet induced steatosis.Gender and strain-specific differences may have transla-tional implications for the evaluation of novel therapeuticstrategies for the treatment of liver disease.

Materials and methods

Animals and study design

All experimental procedures were conducted in accordancewith the German Animal Welfare Law and with theapproval of the district administrative authority ofMuenster. Animals were accommodated in air-conditionedrooms with a 12 h light/darkness cycle and received waterand food ad libitum. The study was performed in 24 Lewisand 24 Sprague-Dawley rats (Charles River, Sulzfeld,Germany) at the age of five weeks and weighing90–120 g, one-half each female or male, respectively. Sixanimals per gender and strain were regarded as being suffi-cient for statistical analysis. Animals were fed with eitherstandard nutrition (11% kcal fat, 24% kcal protein and65% kcal lipids; Diet 1320, Altromin GmbH & Co KG,Lage, Germany) or HF diet (71% kcal fat, 18% kcal proteins,11% kcal saccharides; Highfat Lieber-DeCarli Diet, AltrominGmbH & Co KG) containing a high proportion of fat cal-ories for a three-week period.12 Body weight was recordedregularly at three-day intervals. At the end of each exper-iment blood samples and liver biopsies were taken foranalysis.

Serum chemistry

Bilirubin, aspartate aminotransferase (AST), alanine amino-transferase (ALT), alkaline phosphatase (AP), pseudocholineesterase (PCHE), cholesterol, triglycerides, low-density lipo-protein (LDL) and high-density lipoprotein (HDL) weredetermined at 378C photometrically or by enzymaticabsorption photometry in a Vitros 250-Analyzer (OrthoClinical Diagnostics, Neckargemund, Germany). Leptinand adiponectin concentration was assessed by enzyme-linked immunosorbent assay (ELISA) using the follow-ing commercial kits: mouse-leptin ELISA kit (R & D,Minneapolis, MN, USA) and Assay Max Human adipo-nectin kit (Assay Pro, St Charles, MO, USA).

Histological analysis

Sections of 10 mm thickness were prepared from liver speci-mens fixed in 4% formalin and embedded in paraffin fol-lowed by haematoxylin/eosin staining. Oil-Red stainingwas performed in cryostat sections of 6–8 mm thicknessfrom native cryopreserved tissues. Sections were stainedwith fresh filtrated Oil-Red solution for 10 min followedby Mayer’s haematoxylin staining and mounted withKaiser’s glycerine–gelantine at 408C. Furthermore, Azan

Heidenheim staining was performed in liver sections ofall animals to assess the fibrosis stage. Specimens wereevaluated by an experienced pathologist using a modifiedscoring system originally developed by Kleiner andBrunt.13 Size of fat vacuoles (microvesicular, macro-vesicular), percentage of affected cells by fat vacuoles,fibrosis stage, lobar inflammation and cell damage wereassessed as described.14 The pathologist was blinded togender, strain and diet used.

To determine whether apoptosis was related to steatosisgrade sections were stained with primary antibodiesagainst single-stranded DNA (ssDNA) (IBL Co Ltd, Gunma,Japan). Rabbit primary antibodies were detected usingDAKO anti-rabbit EnVision-HRP (DAKO Cytomation) andNovaRed substrate kit (Vector Laboratories, Burlingame,CA, USA). Sections were counterstained with Ehrlichhaematoxylin and mounted with Kaiser’s glycerine-gelantine. ssDNA-positive hepatocytes and non-parenchymal cells were counted in consecutive microscopicareas under �400 magnification. For assessment of liverregeneration an antibody (MIB-5) specific for the rathomologue of the Ki-67 proliferation associated antigen(DAKO Cytomation) was used as described previously.15

For semiquantitative analysis, Ki-67 positive hepatocytesand non-parenchymal cells were counted under �400magnification.

Realtime quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis

Snap-frozen liver tissue was homogenized and applied toRNeasy columns (Qiagen, Hilden, Germany) for totalhepatic RNA extraction. RNAs were reverse transcribedusing SuperScript II (Invitrogen, Karlsruhe, Germany)according to the manufacturer’s instruction. PCR primers(Table 1) were designed using Primer 3 Express Software(Whitehead Institute for Biomedical Research, Cambridge,MD, USA) and purchased from TIB Molbiol, Berlin,Germany. Primers were located such that exon–intronboundaries of the respective genes result in PCR ampliconsof 90–120 bp. Specificity of products was confirmed by ethi-dium bromide-stained agarose gel. For quantitative PCRanalysis, an ABI Prism 7900 HT sequence detection system(PE Applied Biosystems, Foster City, CA, USA) was used.Three-stage program parameters were as follows: 2 min at508C, 10 min at 958C and then 40 cycles of 14 s at 958C,and one minute at 608C. Data were normalized to the house-keeping gene HPRT and fold gene expression differenceswere determined using the DD ct method.

Statistical analysis

Data are expressed as means+SD. Significances wereanalysed by t-test, Mann-Whitney rank sum tests oranalysis of variance (ANOVA), including Holm-Sidakpairwise comparisons with SIGMASTAT 3.1 (Systat Inc,Point Richmond, CA, USA). P , 0.05 was consideredsignificant.

................................................................................................................................................44 Laboratory Animals Volume 47 January 2013

Results

Gender and strain-specific morphometric differences

All animals fed with a standard diet or a HF-diet survivedup to the end of the experiment. In some animals dailyfood intake was monitored for analysing differences indaily caloric intake. Daily caloric intake was significantlyhigher in the HF diet group (46.0+ 7.7 kcal/100 g bodyweight) than in the standard nutrition group (28.7+ 2.5kcal/100 g body weight). In general, Sprague-Dawely rats

became significantly heavier than Lewis rats and malesheavier than females in both strains (P . 0.05; Figure 1).Within six days male Lewis rats fed with a HF dietshowed a significant higher body weight gain than theircontrols fed with standard nutrition. Female Lewis as wellas Sprague-Dawley rats of both genders did not showthose diet-dependent differences during the three-weekfeeding period.

Livers of both strains and genders fed with a HFdiet showed evidence of steatosis. In all specimens of

Table 1 Sequence and GenBank accession numbers of polymerase chain reaction primers

Gene Name Accession number Primer (forward/reverse)

Group 1: referenceHPRT Hypoxanthine guanine phosphoribosyl transferase NM012583 AAAGGACCTCTCGAAGTGTTGG

AAGGGCATATCCAACAACAAAC

Group 2: angiogenesis

Tie2 Endothelial-specific receptor tyrosine kinase 2 XM342863 AGGTCGAGTTCGAGGACAGG

CCTGTCCACGGTCATAGTTAG

VEGFA Vascular endothelial growth factor A NM031836 CAGTTCGAGGAAAGGGAAAGG

CAAATGCTTTCTCCGCTCTG

FLT-1 FMS-like tyrosine kinase 1 NM019306 CAAAGCTCTGATGACCGAACTC

TCCACGATCACCATCAGAGG

FLK-1 Kinase insert domain protein receptor NM013062 GAGCCCTCATGTCCGAACTC

AGTCTTTCCCAGAGCGGAAG

Ang1 Angiopoietin-1 NM053546 GCACAAAGGACGCTGATAACG

TAGATTGGAAGGGCCACAGG

Group 3: cytokines/growth factorsHGF Hepatocyte growth factor NM017017 GTCAGCACCATCAAGGCAAG

TGAGTGGGCCACCATAATCTC

PDGFB Platelet-derived growth factor B Z14117 CTGCTGCAATAACCGCAATG

TGGCTTCTTTCTCACAATTTCG

PDGFBR Platelet-derived growth factor B receptor NM031525 CAAGCCTGATGCTGCTGATG

GTCGCAGGAGATGGTGGAAG

Group 4: extracellular matrixSMA Smooth muscle alpha-actin X06801 CCGTGACATCAAGGAGAAGC

GCCCATCAGGCAGTTCGTAG

TIMP1 Tissue inhibitor of metalloproteinase 1 BC099821 CCTGGTTCCCTGGCATAATC

TTGCAAGGGATGGCTGAAC

ICAM Intercellular adhesion molecule-1 BC081837 TTAGCTCCCGTGGGAGTATCAC

CCGCAATGATCAGTACCAACAC

VCAM1 Vascular cell adhesion molecule 1 NM012889 CCGGCATTTATGTATGTGAAGG

TGACGCTCTTAGATGGGAAGAC

Group 5: steatosis/fibrosisADN-R Adiponectin receptor 2 (Adipor2) NM001037979 ATCCCTGAGCGCTTCTTTCC

TGAACAAAGGCACCAGCAAC

Lepr Leptin receptor NM_012596 TGGATGGACTAGGGTATTGGAG

TCCAGAATTCAGGCCCTCTC

PPARa Peroxisome proliferator activated receptor alpha NM013196 ATGCCCTCGAACTGGATGAC

CCCTCCTGCAACTTCTCAATG

PPARg Peroxisome proliferator activated receptor gamma AF156665 TCAGAAGTGCCTTGCTGTGG

ATCTCCGCCAACAGCTTCTC

HOX-1 Heme oxygenase NM012580 AGAGGCTAAGACCGCCTTCC

AGGCCTCTGGCGAAGAAAC

Group 6: fat metabolism

GK Glucokinase M25807 ATCACTGTGGGCGTGGATG

TGATTTCGCAGTTGGGTGTC

G6P Glucose-6-phosphatase NM013098 GTGGCAGTGGTTGGAGACTG

GTCCAGGACCCACCAATACG

SREBP-1c Sterol regulatory element-binding protein-1c AF286470 AGAAGGCCAGTGGGTACCTG

TGCGGGCCACAAGAAGTAG

Group 7: cell cycle

CycD3 Cyclin D3 NM012766 CCAGCACTCCCACAGATGTC

CCCTCGGGCTTCAGATATGG

P21 Cyclin-dependent kinase inhibitor P21 U24174 CTTGCACTCTGGTGTCTCACG

ATCGGCGCTTGGAGTGATAG

................................................................................................................................................Stoppeler et al. Gender and strain differences in NAFLD 45

control animals fed with standard nutrition no noticeablemorphological abnormalities were observed (Figure 2a). InLewis rats being fed a HF diet caused a microvesicularfatty vacuolation. Male Lewis rats developed a grade 3 stea-tosis with small intracytoplasmic fat vacuoles in .66% of

liver cells whereas in female individuals much less hepato-cytes (33–66%) were affected (Figure 2b). Further histologi-cal analysis revealed no noticeable signs of fibrosis,inflammation or hepatocyte damage. Livers of Sprague-Dawley rats on a HF diet exhibited a macrovesicular steato-sis with widepread deposition of large lipid droplets.Although the gender-specific differences were only minorit was noteworthy that male rats showed a tendencytoward larger vacuole size and higher steatosis grade. Ingeneral, Sprague-Dawley rats showed more architecturaldistortion with scattered fibrosis, neutrophil infiltrationand hepatocyte ballooning than Lewis rats. Signs of fibrosis,lobar inflammation and hepatocyte damage were more pro-nounced in male than in female rats (Figure 2b).

To determine whether differences in the development ofsteatosis were associated with proliferation and apoptosiswe performed Ki-67 and ssDNA immunostains. In maleLewis as well as male Sprague-Dawley rats fed with a HFdiet a two to three-fold higher proliferation rate of hepato-cytes was detected compared with animals on standardnutrition (P , 0.05; Figure 3a). The number of Ki-67 positivenon-parenchymal cells did not differ in those animals. Infemale rats of both strains proliferation was not affectedby diet. However, female Lewis rats showed a 2- to10-fold higher proliferation rate of hepatocytes and non-parenchymal cells than their male counterparts in general(P , 0.05). In Sprague-Dawley rats this was just the casefor non-parenchymal cells (P , 0.05). Apoptotic cells weremainly localized in the centrilobular regions of the liver.Apoptosis rate of hepatocytes and non-parenchymal cellswas not affected by diet, strain or gender (Figure 3b). A ten-dency toward higher apoptosis rates could be observed infemale rats and animals on a HF diet.

Serum markers of liver injury

Bilirubin levels were within normal ranges in all animals.Induction of steatosis by a HF diet did not correlate withserum levels of transaminases as markers of haepatocellularinjury within this short-term exposure to a HF diet(Figure 4). AST levels did not significantly differ. FemaleLewis rats on a HF diet showed higher ALT levels comparedwith their corresponding controls fed with standard

Figure 1 Body weight gain (in % of baseline weight). Lewis (LEW) and Sprague-Dawley (SD) rats of both sexes were randomized to either standard nutrition (Std)

or high-fat diet (HF) at five weeks of age. �P , 0.05 versus C fed with corresponding diet; ��P , 0.05 versus standard nutrition

Figure 2 Assessment of hepatic steatosis. (a) Representative histological

sections of male and female Lewis (LEW) and Sprague-Dawley (SD) rats fed

with either standard (Std) or high-fat (HF) diet for three weeks are shown.

Staining and original magnification: haematoxylin and eosin (H&E) (�100);

Oil-Red (�200); insets show magnified views of hepatic lipid vesicles (LEW:

microvesicular; SD: macrovesicular). Panel b shows evaluation of histological

sections using a modified scoring system originally developed by Kleiner and

Brunt13 (�P , 0.05 versus standard nutrition). Histological changes in the

development of NAFLD were more pronounced in male than in female rats


nutrition (P , 0.05). In male Lewis rats ALT levels tended tobe higher also without reaching statistical significance(87.5+ 17.0 U/L versus 70.7+ 5.2 U/L). By contrast, maleSprague-Dawley rats fed with a HF diet showed evenlower ALT levels than their controls (55.8+ 9.4 U/L versus78.7+ 11.4 U/L, P , 0.05). But in general, absolute differ-ences in transaminase levels were only minor and thereforenegligible. Animals of both strains and genders on a HF diethad a significant increase in AP levels by approximatelytwo-fold compared with controls on standard nutrition(Figure 4, lower left panel, P , 0.05). It was noteworthy,that the female gender in both strains, Lewis and Sprague-Dawley, was associated with significantly lower AP levelsthan the male (P , 0.05). Furthermore, female rats of bothstrains presented with significantly higher serum PCHElevels than their male counterparts irrespective of dietused (Figure 4, lower right panel, P , 0.05). HF diet

induced an increase in PCHE levels in male and a decreasein female Sprague-Dawley rats (P , 0.05). This parameterwas not affected by diet in Lewis rats.

Serum markers of lipid metabolism

To establish whether gender and strain-specific differenceswere reflected by abnormalities of lipids and adipocytokineswe measured cholesterol, triglycerides, LDL, HDL, leptinand adiponectin. In male Lewis rats, a HF diet led to elev-ated triglyceride, LDL and leptin levels as well as decreasedHDL levels compared with controls fed with standard nutri-tion (P , 0.05, Figure 5). This effect was only partiallyobserved in female Lewis rats, where the HF groupshowed higher leptin and lower HDL levels than theircontrol group, also (P , 0.05). Triglycerides were notaffected and significant decreases were recorded for choles-terol, LDL and adiponectin. For Lewis rats consuming theHF diet, male rats had significantly higher cholesterol, tri-glyceride, LDL, leptin and lower HDL levels than females(P , 0.05). In Sprague-Dawley rats no significant differencesregarding gender or diet in serum levels of cholesterol, tri-glycerides, HDL or adiponectin were noted. Triglyceridestended to be higher in the HF group, but this was not sig-nificant. HF diet resulted in increased LDL and leptinlevels in male, but not female, Sprague-Dawley rats (P ,

0.05). Moreover, leptin levels in female Sprague-Dawleyrats on a HF diet were significantly lower than in males.

Gender and strain-specific differences ingene expression

To demonstrate HF diet induced changes in the expressionof various genes important for angiogenesis, cell-to-cell sig-nalling (cytokines and growth factors), extracellular matrixdeposition, steatosis, fibrosis, fat metabolism and cell cyclequantitative RT-PCR analysis was performed (Figure 6).Changes in gene expression of three-fold or greater withP values ,0.05 were considered significant. We examinedliver gene expression profiles of Lewis and Sprague-Dawley rats on a HF diet compared with rats on standardnutrition. In male Lewis rats HF diet induced significantdownregulation of three relevant genes including twoproangiogenic genes, FLT1 and FLK1, also known asvascular endothelial growth factor (VEGF) receptor 1 and2, and platelet-derived growth factor B (PDGFB), an im-portant growth factor for liver regeneration (P , 0.05,Figure 6a). Hepatocyte growth factor (HGF) and cyclin D3(CycD3) showed a trend toward downregulation withoutreaching statistical significance. By contrast, gene expressionprofile of female Lewis rats was different. HF diet inducedsignificant upregulation of angiopoietin 1 (Ang1), a ligandfor TIE2 (endothelial-specific receptor tyrosine kinase 2)promoting vessel maturation and stability (P . 0.05).Furthermore, CycD3 and p21, both involved in cell cycleregulation, were upregulated, although this was not signifi-cant. No other significant changes were noted in expressionof selected genes.

Male Sprague-Dawley rats on a HF diet showed signifi-cant downregulation of six relevant genes, including three

Figure 3 Cell proliferation and apoptosis. Gender-specific comparison of

Lewis (LEW) and Sprague-Dawley (SD) rats fed with standard (Std) or

high-fat (HF) diet for three weeks. Panel a shows quantitative analysis of

Ki-67 positive hepatocytes (Hep) and non-parenchymal cells (NPC) (identified

by histochemistry, �200, red color). (b) Single-stranded DNA immunhistology

of apoptotic cells (�200; brown colour). �P , 0.05 versus F fed with corre-

sponding diet; HPF ¼ high power field (magnification �200), ��P , 0.05

versus standard nutrition


proangiogenic genes, TIE2, FLT1 and FLK1, and three genesinvolved in extracellular matrix deposition, namely smoothmuscle alpha-actin (SMA), tissue inhibitor of metalloprotei-nase 1 (TIMP1) and vascular cell adhesion molecule 1(VCAM1, P , 0.05, Figure 6b). However, in femaleSprague-Dawley rats HF diet induced downregulation ofonly two genes, FLT1 and SREBP-1c (sterol regulatoryelement-binding protein-1c), was observed (P , 0.05).SREBP-1c is associated with fatty acid synthesis and thedevelopment of hepatic steatosis.16 In male as well asfemale Sprague-Dawley rats peroxisome proliferator acti-vated receptor alpha and gamma (PPARa, PPARg), whoseinhibition may contribute to the developement of fattyliver disease, were downregulated more than three-fold,but this was not signficant.17

Discussion

In the present study, strain and gender in rats play a pivotalrole in the development of liver steatosis, using the nutri-tional model developed by Lieber et al.12 Since childhoodobesity along with paediatric NAFLD is becoming agrowing problem, pubertal rats correlating to human child-hood and puberty were used for experiments.18 The modelof HF diet induced steatohepatitis was chosen because itmay probably best resemble the clinical situation whilereproducing the key features of human NASH in rats.12

Clinical relevance of genetic (e.g. leptin-receptor deficiency)and other experimental models such as methionine-choline-deficient (MCD) diet is limited.19,20 The adminis-tered diet relates to our contemporary diet with HF

content. Results must be interpreted with care, because ahuman diet with 71% of energy derived from fat wouldbe considered extreme.

Morphologically, hepatic steatosis can be classified asmacro- or microvesicular, depending on the size of thelipid vacuoles.21 Different hypothesis for developingmicro- or macrovesicular steatosis have been discussed sofar. The microvesicular type may be more likely related tomitochondrial dysfunction, the macrovesicular type maybe originated from disturbed protein synthesis.22 Whenfed with a HF diet for three weeks, Lewis rats revealed asolely microvesicular steatosis whereas Sprague-Dawleyrats presented with a pure macrovesicular steatosis ac-companied by pronounced fibrosis. The impact of thetype of steatosis on liver injury remains controversial andthere is not sufficient evidence to define the significance offat droplet size. Experiments in mice fed with MCDsuggest that microvesicular steatosis is a primary form ofhepatic steatosis.23 The increased surface area of multiplemicrovesicular droplets may be associated with increasedlipid efflux due to the amount of lipid that is accessible toenzymes.24 Small lipid vacuoles may fuse to become alarge droplet with progression of disease.17 In our exper-iments microvesicular steatosis induced by a HF diet wasassociated with less signs of fibrosis, lobar inflammationand hepatocyte damage than the macrovesicular type sup-porting this hypothesis. Our previous studies indicatedthat hepatic stellate cells (HSC), known to be involved inthe fibrogenic response to chronic liver injury, were moreactivated in Sprague-Dawley rats on a HF diet than inLewis rats.14 Interestingly, PCR analysis revealed that inmale Sprague-Dawley rats developing the greatest degree

Figure 4 Serum markers of liver injury. Aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (AP) and pseudocholine

esterase (PCHE) levels measured in serum of Lewis (LEW) and Sprague-Dawley (SD) rats receiving either standard (Std) or high-fat (HF) diet for three weeks.�P , 0.05 versus F fed with corresponding diet; ��P , 0.05 versus standard nutrition


of macrovesicular steatosis and fibrosis on a HF diet,SMA, TIMP1 and VCAM1 were downregulated. We donot have a definitive explanation for these results, transcrip-tional but also post-transcriptional regulation might play arole. Clinically, microvesicular steatosis due to genetic ortoxin-induced abnormalities in mitochondrial and peroxi-somal b-oxidation of fatty acids tends to be rapidly progress-ive and more severe.17 A recently published cross-sectionalstudy demonstrated that microvesicular steatosis correlatedwith more advanced histology of NAFLD.25 These conflict-ing findings could be attributed to differences in fatty liverinduction by inherited/acquired defect in b-oxidation offatty acids or HF diets. However, others showed a trendto a correlation between microvesicular droplets and lessfibrosis in patients with NAFLD.26 Microcirculatory disturb-ances may contribute to liver injury and oxidative stress.The mere presence of lipid droplets in hepatocytes can

impair hepatic microcirculation by sinusoidal compression,which in turn is related to the size of fat vesicles.14

Animal experiments demonstrated that macrovesicular stea-tosis has a decreased tolerance to ischaemic injury correlat-ing with impairment in hepatic blood flow afterreperfusion.22 For patients with macrosteatosis the risk ofpostoperative complications following liver resection orliver transplantation is increased compared with thosewith microsteatosis.27 – 29 However, Oleszczuk et al. raisedconcerns about the regenerative capacity of microvesicularsteatosis.30 In the present study, in male Lewis as well asmale Sprague-Dawley rats fed with a HF diet, a two- tothree-fold higher proliferation rate of hepatocytes wasdetected compared with animals on standard nutrition.Since leptin may promote progression of hepatocytes intothe cell cycle via control of cyclin D1 expression elevatedleptin-levels in male rats fed with a HF diet may account

Figure 5 Serum markers of lipid metabolism. Serum levels of cholesterol, triglycerides, low-density lipoprotein (LDL), high-density lipoprotein (HDL), leptin and

adiponectin (AND) in Lewis (LEW) and Sprague-Dawley (SD) rats receiving either standard (Std) or high-fat (HF) diet for three weeks. �P , 0.05 versus F fed with

corresponding diet; ��P , 0.05 versus standard nutrition


Figure 6 Changes in expression of selected gene groups. Cumulative changes in gene expression of Lewis (a) and Sprague-Dawley (b) rats fed with a high-fat

diet for three weeks compared with corresponding rats fed with standard nutrition. Changes in gene expression of three-fold or greater (dotted line) with P values

,0.05 were considered significant. ��P , 0.05 versus standard nutrition; na ¼ not available (due to widespread of values in the data set)


for increased proliferation rates.31 Interestingly, Sydoret al.32 reported recently that a Western diet induced steato-sis may even enhance liver cell proliferation after partialhepatectomy via increased HGF and leptin signalling aswell as Erk1/2 phosphorylation. On the other hand,higher proliferation rates may represent a need for moreliver regeneration due to more severe injury. We did notfind differences in apoptosis rates between micro- andmacrosteatotic rat livers being in concordance to the studyby Oleszczuk et al.30 In fact, apoptosis rates and hepatocytedamage of animals on a HF diet were comparable to thoseon standard nutrition. According to the second hit theoryan additional source of oxidative stress or a longer feedingperiod might have shown different results.

It was quite remarkable, that the female gender of bothstrains was associated with decreased susceptibility toliver injury. Steatosis and fibrosis were less pronouncedand proliferation rates were higher even on standard nutri-tion. Experimental evidence implies that oestrogen canprotect from adipose tissue oxidative stress and inflam-mation, development of liver steatosis and insulin resist-ance.9,33 Furthermore, the portal/fatty acid flux theory canpartially explain the higher risk of males developingNAFLD through increased accumulation of visceral fat.5 Inthe present study, gender-specific differences in lipid meta-bolism were most prominent in Lewis rats on a HF diet.Female Lewis rats showed lower cholesterol and triglyceridelevels and a more favourable LDL/HDL ratio than males.It has been described, that the severity of liver injury isstrongly associated with a more atherogenic profile inNAFLD.34 Furthermore, the lower leptin levels of femalerats on a HF diet may be related to histological changesalso, since leptin has a proinflammatory role and is con-sidered to be an essential mediator of liver fibrosis.35 Itwas noteworthy, that realtime PCR analysis of liver tissuesamples from female Sprague-Dawley rats showed down-regulation of SREBP-1c, one of three known transcriptionfactors regulating liver de novo fatty acid synthesis thatmay result in steatosis.17 The decreased hepatic expressionof this lipogenic gene could be attributed to an oestrogen-mediated effect, as described before.36

HF diet in male rats of both strains resulted in decreasedexpression of several genes involved in angiogenesis such asVEGF receptor 1 and 2 (FLT1, FLK1) whereas female ratsshowed a more favourable gene expression profile. Thesechanges in gene expression were in agreement with higherproliferation rates of females as shown by Ki-67 immuno-stains. VEGF-mediated signalling can protect hepatocytesand improve the impaired regeneration of steatoticlivers.37 – 39 Therefore, those gender-specific differences inthe expression of proangiogenic genes should be relevantand may offer therapeutic options for preservation oforgan function.

In summary, strain and gender should be consideredwhen exploring the induction of steatosis in models on aHF diet. Among the rats studied, male Sprague-Dawleyrats developed the greatest degree of steatosis on a HFdiet and may represent a useful animal strain for studyingadvanced stages of NAFLD. Female gender was associatedwith an alleviated disease phenotype and less changes in

gene expression, e.g. of VEGF receptor 1 and 2. Therefore,strain and gender in our model of NAFLD is of highrelevance and should be taken into account once patho-genesis or therapeutic targeting is evaluated.

ACKNOWLEDGEMENT

The authors wish to express their thanks to K Cebulla fortechnical assistance in the conduct of this study.

REFERENCES

1 Adams LA, Lindor KD. Nonalcoholic fatty liver disease. Ann Epidemiol2007;17:863–9

2 Kopec KL, Burns D. Nonalcoholic fatty liver disease: a review of thespectrum of disease, diagnosis, and therapy. Nutr Clin Pract2011;26:565–76

3 Day CP, James OF. Steatohepatitis: a tale of two ‘hits’? Gastroenterology1998;114:842–5

4 Ayonrinde OT, Olynyk JK, Beilin LJ, et al. Gender-specific differences inadipose distribution and adipocytokines influence adolescentnonalcoholic fatty liver disease. Hepatology 2011;53:800–9

5 Lavoie JM, Pighon A. NAFLD, estrogens, and physical exercise: theanimal model. J Nutr Metab 2012;2012:914938

6 Arun J, Clements RH, Lazenby AJ, Leeth RR, Abrams GA. Theprevalence of nonalcoholic steatohepatitis is greater in morbidly obesemen compared to women. Obes Surg 2006;16:1351–8

7 Kashireddy PR, Rao MS. Sex differences in choline-deficientdiet-induced steatohepatitis in mice. Exp Biol Med 2004;229:158–62

8 Nemoto Y, Toda K, Ono M, et al. Altered expression of fattyacids-metabolizing enzymes in aromatase-deficient mice. J Clin Invest2000;12:1819–25

9 Stubbins RE, Najjar K, Holcomb VB, Hong J, Nunez NP. Estrogen altersadipocyte biology and protects female mice from adipocyteinflammation and insulin resistance. Diabetes Obes Metab 2012;14:58–66

10 Yamazaki Y, Kakizaki S, Takizawa D, et al. Interstrain differences insusceptibility to non-alcoholic steatohepatitis. J Gastroenterol Hepatol2008;23:276–82

11 Kirsch R, Clarkson V, Shephard EG, et al. Rodent nutritional model ofnon-alcoholic steatohepatitis: species, strain and sex difference studies.J Gastroenterol Hepatol 2003;18:1272–82

12 Lieber CS, Leo MA, Mak KM, et al. Model of non-alcoholicsteatohepatitis. Am J Clin Nutr 2004;79:502–9

13 Kleiner DE, Brunt EM, Van Natta M, et al. Nonalcoholic steatohepatitisclinical research network. Design and validation of a histological scoringsystem for non-alcoholic fatty liver disease. Hepatology 2005;41:1313–21

14 Rosenstengel S, Stoeppeler S, Bahde R, Spiegel HU, Palmes D. Type ofsteatosis influences microcirculation and fibrogenesis in different ratstrains. J Invest Surg 2011;24:273–82

15 Palmes D, Zibert A, Budny T, et al. Impact of rapamycin on liverregeneration. Virchows Arch 2008;452:545–57

16 Endo M, Masaki T, Seike M, Yoshimatsu H. TNF-alpha induced hepaticsteatosis in mice by enhancing gene expression of sterol regulatoryelement binding protein-1c (SREBP-1c). Exp Biol Med 2007;232:614–21

17 Reddy JK, Rao MS. Lipid metabolism and liver inflammation. II. Fattyliver disease and fatty acid oxidation. Am J Gastrointest Liver Physiol2006;290:G852–8

18 Roberts EA. Pediatric non-alcoholic fatty liver disease (NAFLD): a‘growing’ problem? J Hepatol 2007;46:1133–42

19 Leclercq A, Farrell GC, Schriemer R, Robertson GR. Leptin is essential forthe hepatic fibrogenic response to chronic liver injury. J Hepatol2002;37:206–13

20 Vetelainen R, Van Vliet A, Van Gulik TM. Essential pathogenic andmetabolic differences in steatosis induced by choline or methione-cholinedeficient diets in a rat model. J Gastroenterol Hepatol 2007;22:1526–33

21 Gauthier MS, Couturier K, Latour JG, Lavoie JM. Concurrent exerciseprevents high-fat-diet-induced macrovesicular hepatic steatosis. J ApplPhysiol 2003;94:2127–34


22 Selzner N, Selzner M, Jochum W, Amann-Vesti B, Graf R, Clavien PA.Mouse livers with macrosteatosis are more susceptible to normothermicischemic injury than those with microsteatosis. J Hepatol 2006;44:694–701

23 Fu MM, Sun R, Tian ZG, Wei HM. Increased susceptibility toexperimental steatohepatitis induced by methionine-choline deficiencyin HBs-Tg mice. Hepatobiliary Pancreat Dis Int 2010;9:513–19

24 Walther TC, Farese RV Jr. The life of lipid droplets. Biochem Biophys Acta2009;1791:419–40

25 Tandra S, Yeh MM, Brunt EM, et al. Presence and significance ofmicrovesicular steatosis in nonalcoholic fatty liver disease. J Hepatol2011;55:654–9

26 Masterton G, Ngoh LYC, Lockman A, Hayes PC, Plevris J. Thesignificance of fat droplet size and the prognostic value of hyaloronicacid in non-alcoholic fatty liver disease (NAFLD): a biopsy basedanalysis. Gut 2011;60:A239–40

27 Fiorentino M, Vasuri F, Ravaioli M, et al. Predictive value offrozen-section analysis in the histological assessment of steatosis beforeliver transplantation. Liver Transpl 2009;15:1821–25

28 Selzner M, Clavien PA. Fatty liver in liver transplantation and surgery.Semin Liver Dis 2001;12:105–13

29 McCormack L, Petrowsky H, Jochum W, Furrer K, Clavien PA. Hepaticsteatosis is a risk factor for postoperative complications after majorhepatectomy. Ann Surg 2007;245:923–30

30 Oleszczuk A, Spannbauer M, Tannapfel A, et al. Regenerative capacitydiffers between micro- and macrovesicular hepatic steatosis. Exp ToxicolPathol 2007;59:205–13

31 Leclercq IA, Field J, Farrell GC. Leptin-specific mechanisms for impairedliver regeneration in ob/ob mice after toxic injury. Gastroenterology2003;124:1451–64

32 Sydor S, Gu Y, Schlattjan M, et al. Steatosis does notimpair liver regeneration after partial hepatectomy. Lab Invest2013;93:20–30

33 Medrikova D, Jilkova ZM, Bardova K, Janovska P, Rossmeisl M,Kopecky J. Sex differences during the course of diet-induced obesity inmice: adipose tissue expandability and glycemic control. Int J Obes2012;36:262–72

34 Nobili V, Alkhouri N, Bartuli A, et al. Severity of liver injury andatherogenic lipid profile in children with nonalcoholic fatty liver disease.Pediatr Res 2010;67:665–70

35 Tsochatzis EA, Papatheodoridis GV, Archimandritis AJ.Adipokines in nonalcoholic steatohepatitis: from pathogenesis toimplications in diagnosis and therapy. Mediators Inflamm2009;2009:831670

36 D’Eon TM, Souza SC, Aronovitz M, Obin MS, Fried SK, Greenberg AS.Estrogen regulation of adiposity and fuel partitioning. Evidence ofgenomic and non-genomic regulation of lipogenic and oxidativepathways. J Biol Chem 2005;280:35983–91

37 LeCouter J, Moritz DR, Li B, et al. Angiogenesis-independent endothelialprotection of liver: role of VEGFR-1. Science 2003;299:890–3

38 Vetelainen R, Bennink RJ, van Vliet AK, van Gulik TM. Mild steatosisimpairs functional recovery after liver resection in an experimentalmodel. Br J Surg 2007;94:1002–8

39 Redaelli CA, Semela D, Carrick FE, et al. Effect of vascular endothelialgrowth factor on functional recovery after hepatectomy in lean and obesemice. J Hepatol 2004;40:305–12

(Accepted 29 November 2012)


gender and strain-specific differences in the development of steatosis in rats

Documents