Upload File

figure s2.- neighbor-joining tree of obap proteins from different species

  • Home
  • Documents
  • Figure S2.- Neighbor-joining tree of OBAP proteins from different species
1
Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

Upload: wyome

Post on 14-Jan-2016

21 views

Category:

Documents


3 download

Report

Tags:

DESCRIPTION

Figure S2.- Neighbor-joining tree of OBAP proteins from different species. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Figure S2.- Neighbor-joining tree of OBAP proteins from different species

Figure S2.- Neighbor-joining tree of OBAP proteins from different species.

BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA

GENETIC CHARACTERIZATION OF HAEMONCHUS …journal.usm.my/journal/18-02-05Wahab.pdfGenetic Characterization of Haemonchus Contortus The ITS-2 Neighbor-Joining tree clearly separated

Algorithm research project neighbor joining

Squares: Supporting Interactive Performance Analysis for ...€¦ · reduction and neighbor joining trees (similarity trees with branches emanating radially) to arrange instances

Phylogenetic and Chronological Analysis of Proteins ...clbme.bas.bg/bioautomation/2012/vol_16.3/files/16.3_02.pdfPhylogenetic inference The Neighbor-Joining method used for phylogenetic

Phylogeny, Taxonomy, and Biogeography of the Oriental ...Evolution of Trimeresurus 1149 Fig. 1. Neighbor-joining (NJ) tree derived from Kimura’s (1980) two parameter distance matrix

The Only Good Neighbor is a Dead Neighbor

OBAP, a New family of Oil Body-Associated Proteins Author to whom

GASCUEL O., Getting a Tree Fast: Neighbor Joining and ...€¦ · Distance methods and especially Saitou and Nei’s (1987) Neighbor Joining (NJ) are popular methods to reconstruct

The Neighbor Joining Tree-Reconstruction Technique Lecture 13 ©Shlomo Moran & Ilan Gronau

Large-scale neighbor-joining with NINJA - Wheeler Labwheelerlab.org/software/ninja/files/NINJA_preprint.pdf · Large-scale neighbor-joining with NINJA Travis J. Wheeler [email protected]

Figure S1 Evolutionary relationships of RBG subclasses in Arabidopsis (a) and B. rapa (b). Optimal neighbor-joining trees with sum of branch lengths =

NJM (Neighbour-Joining Method) A.METODI FILOGENETICI CON MATRICI DI DISTANZA NEIGHBOR-JOINING clustering method, crea un albero con il minimo valore di

Figure S2 - Neighbor joining phylogenetic analysis of the ......Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA

Interception of ‘Candidatus Phytoplasma solani’ in Brazil ... · reported (DUDUK et al., 2010). ... Phylogenetic tree inferred from 16S rDNA sequences using the neighbor-joining

The Neighbor-Joining Method a New Method For

OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all

Supplementary Figure S1 | Phylogenetic relationship of the ...€¦ · phylogenetic tree was constructed using the neighbor-joining algorithm, with the Jukes-Cantor parameter correction

The C3 initiative: an overviewdodds/for_trustees_C3_May_2016.pdf · insight into the processes that direct and define life. ... In this problem you will implement the neighbor-joining

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Optimality of the Neighbor Joining Algorithm and Faces of the Balanced Minimum Evolution Polytope Ruriko Yoshida

Neighbor 2 Neighbor Lead Flip Book

Susquehanna Universitycomenius.susqu.edu/biol/312/centralia metagenomics case... · Web viewfrom your filtered alignments using FastTree, a modified Neighbor-Joining method (uses

?@AB@A@CCDC EFGHI...2 # o66p #˙, ++ o66p #˙, 9+˜+ + oˇ6p #˙, # ++ oˇ6p #˙, # 9+˜+ + oˇˇp 7 ˙ ˝, o/1p "& % ( 9˙ ˙ oBAp 7 ˙ ˘ o26p

Phylogenetic Trees Tutorial 5. Agenda How to construct a tree using Neighbor Joining algorithm Phylogeny.fr tool Cool story of the day: Horizontal gene

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium

bio.research.ucsc.edubio.research.ucsc.edu/people/bernardi/Bernardi/.../1992sharksMPE.pdf · cording to the manufacturer's instructions. In addition, ... 1985). The neighbor-joining

Large-scale neighbor-joining with NINJA · 2016. 5. 8. · Large-scale neighbor-joining with NINJA Travis J. Wheeler [email protected] Department of Computer Science The University

The Neighbor-joining Method: A New Method for ...matilde/NeighborJoinMethod.pdf · The new, neighbor-joining method and Sattath and Tversky’s method are shown to be generally better

Cloning and characterization of a -amyrin synthase gene ... · Cloning and characterization of a ... formed using the neighbor-joining method with the program and TreeView software

Acinetobacter pakistanensis sp. nov. - PARC · Neighbor-joining phylogenetic tree showing inter-relationship of strain NCCP-644T with the closely related type species of genera Acinetobacter

Author version - microbialbiofilms.files.wordpress.com · with the neighbor-joining algorithm by using the CLC Sequencer Viewer 7.6. The tree was resampled with 1000 bootstrap replications

IP8800/S6700 IP8800/S6600 IP8800/S6300 ソフト …...neighbor ebgp-multihop neighbor maximum-prefix neighbor next-hop-self neighbor password neighbor peer-group (assigning members)

Phylogeny taxa(Acari: Ixodida) 16S rDNA · mum-parsimony, and maximum-likelihood methods were used in phylogeny reconstruction. Fordistance analysis, a neighbor-joining tree (18)