expression and distribution of s100 protein in the nervous system of the adult zebrafish (danio...

Expression and Distribution of S100 Protein in the NervousSystem of the Adult Zebrafish (Danio rerio)A. GERMANA,1,2* F. MARINO,2 M.C. GUERRERA,1 S. CAMPO,3 P. DE GIROLAMO,4 G. MONTALBANO,1

G.P. GERMANA,1 F.J. OCHOA-ERENA,5 E. CIRIACO,1 AND J.A. VEGA5,6

1Dipartmento di Morfologia, Biochimica, Fisiologia e Produzione Animale, Sezione di Morfologia, Universita di Messina, Italy2CISS (Centro di Ittiopatologia Sperimentale Sicilia), Dipartimento di Sanita pubblica Veterinaria Universita di Messina, Italy3Dipartimento di Scienze Biochimiche, Fisiologiche e della Nutrizione, Policlinico Universitario ‘‘G. Martino’’, Messina, Italy4Dipartimento di Strutture, Funzioni e Tecnologie Biologiche, Universita di Napoli Federico II, Italy5Departamento de Morfologıa y Biologıa Celular, Universidad de Oviedo, Spain6Instituto Asturiano de Oncologıa, Universidad de Oviedo, Spain

KEY WORDS optics; S100 protein; nervous system; adult zebrafish

ABSTRACT S100 proteins are EF-hand calcium-binding protein highly preserved during evo-lution present in both neuronal and non-neuronal tissues of the higher vertebrates. Data about theexpression of S100 protein in fishes are scarce, and no data are available on zebrafish, a commonmodel used in biology to study development but also human diseases. In this study, we have inves-tigated the expression of S100 protein in the central nervous system of adult zebrafish using PCR,Western blot, and immunohistochemistry. The central nervous system of the adult zebrafishexpress S100 protein mRNA, and contain a protein of �10 kDa identified as S100 protein. S100protein immunoreactivity was detected widespread distributed in the central nervous system,labeling the cytoplasm of both neuronal and non-neuronal cells. In fact, S100 protein immunoreac-tivity was primarily found in glial and ependymal cells, whereas the only neurons displaying S100immunoreactivity were the Purkinje’s neurons of the cerebellar cortex and those forming the deepcerebellar nuclei. Outside the central nervous system, S100 protein immunoreactivity wasobserved in a subpopulation of sensory and sympathetic neurons, and it was absent from the en-teric nervous system. The functional role of S100 protein in both neurons and non-neuronal cells ofthe zebrafish central nervous system remains to be elucidated, but present results might serve asbaseline for future experimental studies using this teleost as a model. Microsc. Res. Tech. 71:248–255, 2008. VVC 2007 Wiley-Liss, Inc.

INTRODUCTION

S100 proteins represent the largest subgroup of theEF-hand calcium(Ca21)-binding proteins (Ca21BP)with at least 21 members identified, localized in boththe cytoplasm, and nucleus of different cells, that actas trigger or activator, rather than Ca21 buffer pro-teins (for a review see Donato, 2003; Santamaria-Kisielet al., 2006). The nomenclature of these proteins isvery complex, and has recently been simplified andupdated (Marenholz et al., 2006). First identified in thebovine brain (Moore, 1965), in the high vertebratenervous system S100 protein is a mixture of S100A1(S100a) and S100B (S100b) combined as homo or het-erodimers to form S100a0 (aa), S100a (ab), and S100b(bb), but also higher-order aggregates. S100 proteinsare involved in the control of cell growth and prolifera-tion, cell cycle progression, and modulation of specificsignal transduction pathways, but also have extracel-lular functions, including neurotrophic and antimicro-bial activity (Donato, 2003; Marenholz et al., 2004).

The occurrence and distribution of S100 proteins inthe mammalian central and peripheral nervous systemis now well documented (Gonzalez-Martinez et al., 2003;Goto et al., 1988; Schafer et al., 2000; Yamashita et al.,1999). Conversely, only sparse informations are so faravailable about the expression and distribution of S100in the central nervous system of nonmammalian verte-

brates, i.e., birds (Castagna et al., 2003) and fishes(Chiba, 2000; Manso et al., 1997). As far as we knownthe presence of S100 protein in the central nervous sys-tem of the zebrafish (Danio rerio) has been neverreported. Nevertheless, its presence has been confirmedin different sensory organs of the teleosts including theretina (Vecino et al., 1997; Velasco et al., 1997), neuro-masts of the lateral line system (Abbate et al., 2002; Ger-mana et al., 2002), inner ear and olfactory epithelium(Catania et al., 2007; Germana et al., 2004a,b, 2007).

Zebrafish have been used extensively in a variety ofmedical and scientific disciplines including cardiology,neurology, ophatalmology, and environmental toxicol-ogy (Hsu et al., 2007; Kari et al., 2007; Lieschke andCurrie, 2007). However, the majority of these studieshave explored developmental aspects (Langenau andZon, 2005). Interestingly, the zebrafish are now emerg-ing also as an important vertebrate model system that

*Correspondence to: Prof. Antonino Germana, Department of Morphology, Bio-chemistry, Physiology and Animal Production, Section of Morphology, Faculty ofVeterinary Medicine, University of Messina, Polo Universitario Annunziata,98168 Messina, Italy. E-mail: [email protected]

Received 30 July 2007; accepted in revised form 3 October 2007

Contract grant sponsor: University of Messina (PRA 2004).

DOI 10.1002/jemt.20544

Published online 27 November 2007 in Wiley InterScience (www.interscience.wiley.com).

VVC 2007 WILEY-LISS, INC.

MICROSCOPY RESEARCH AND TECHNIQUE 71:248–255 (2008)

can be studied across the various neuroscience disci-plines, and researchers have developed zebrafish mod-els for the study of human degenerative brain diseasessuch as Parkinson’s disease (Bretaud et al., 2007) andAlzheimer’s disease (Newman et al., 2007). Since S100protein is implicated in a broad diversity of neuropa-thologies from traumatic to degenerative conditions(Rothermundt et al., 2003; Sen and Belli, 2007; Stroicket al., 2006), we decided to investigate the expressionat the mRNA and protein level, as well as the ana-tomical distribution of S100 protein throughout cen-tral nervous system of the adult zebrafish. Thisstudy might serve as a baseline for future experimentalstudies.

MATERIALS AND METHODSAnimals and Treatment of the Tissues

Ten adult zebrafish (Danio rerio), 6–8-months old,were obtained from CISS (Center of Experimental Ich-thyiopathology of Sicily), University of Messina, Italy.The fishes were anesthetized with MS222 (ethyl-m-amino benzoate; 0.4 g/L), and sacrificed by decapita-tion. The heads were removed and fixed in Bouin’s fixa-tive for 24 h, then being routinely processed for paraf-fin embedding. Furthermore, three freshly isolatedbrains were used to isolate RNA and three whole fro-zen zebrafish were processed for Western-blot.

Isolation of RNA and Reverse Transcription PCR

Total RNAs were extracted from fresh samples usingTrizol reagent (Sigma; St. Louis, MO). The integrity ofRNA was checked using agarose gel electrophoresis.RNA extracted was reverse-transcribed in a final vol-ume of 20 lL using 20 U of Superscript RNA-ase H2

Reverse Transcriptase (Gibco BRL, Gaithersburg, MD)in the manufacturer’s buffer containing 2 lg RNA,5 lM oligo (dT), 12–18 mM dNTPS, 40 U RNA-aseinhibitor (Amersham Pharmacia Biotech, Little Chal-font, Buckinghamshire, UK), 0.1 lg/lL BSA and10 mM DTT. The reaction took place at 428C for 90min. The sequences of the oligonucleotide primerswere based upon the published sequences for Daniorerio S100 protein (GenBank accesion number XM682144) and Danio rerio b-actin (GenBank accesionnumber NM 131031), and were for S100 protein for-ward: 50TTGCTTCAAGGGGAACTCAG30, reverse:50CATTGCATGCCACAGTGAGA30. The conditions ofamplification were as follows: 2 U Taq DNA Polymer-ase (Promega, Madison, WI), 1 lM primers, 10 ngzebrafish brain cDNA, 0,2 mM each dNTP in 15 lL TaqDNA Polymerase buffer. The reaction was performedin a thermal cycler (Hyband Th. Cycler) with the fol-lowing program: 1 min 948C initial denaturation, then10 cycles of 948C 1 min, 658C 30 s and 728C 45 s, fol-lowed by 20 cycles of 948C 1 min, 618C 30 s, 728C 45 sand a 5-min final extension at 728C. The PCR productswere visualized by ethidium bromide staining underUV light following electrophoresis on a 2% agarose gel.

Western Blot

For Western blot the procedure was as follows: thesamples were homogenized (1:2, w/v) with a Potter ho-mogenizer in Tris–HCl buffered saline (TBS; 0.1M, pH7.5) containing 1 lM leupeptin, 10 lM pepstatin, and2 mM phenylmethylsulfonyl fluoride. The homogenates

were then centrifuged at 25,000 r.p.m. for 15 m at 48C,and the resulting pellet dissolved in 10 mM Tris–HCl,pH 6.8, 2% SDS, 100 mM dithiothreitol, and 10% glyc-erol at 48C. The pellets were thawed and analyzed byelectrophoresis in 15% discontinuous polyacrylamideSDS gels. After electrophoresis, proteins were trans-ferred onto a nitrocellulose membrane and blocked byimmersion for 3 h in PBS containing 5% dry milk and0.1% Tween-20. The membranes were then incubatedat 48C for 2 h with the primary antibodies against S100protein. The antibody anti-S100 protein was raised inrabbit directed against bovine S100 protein (Dako,Glostrup, Denmark; code No. Z0311; diluted 1:1000)and it detects both S100A and S100B proteins (manu-facturer’s notice). After incubation, the membraneswere washed with Tris buffered saline (pH 7.6) contain-ing 20% Tween-20, and incubated again for 1 h withthe goat anti-rabbit IgG (Amersham Pharmacia Bio-tech) diluted 1:100 at room temperature. Membraneswere washed again and incubated with the PAP com-plex diluted 1:100 for 1 h at room temperature. Finally,the reaction was developed using a chemiluminescentreagent (ECL, Amersham Pharmacia Biotech, Buck-inghamshire, UK) and exposed to Hyperfilm. Markerproteins were visualized by staining with BrilliantBlue.

Immunohistochemistry

The pieces were cut 10 lm thick in serial frontal, hor-izontal, or sagittal sections, and collected on gelatine-coated microscope slides. The sections were processedfor indirect peroxidase immunohistochemistry asdescribed elsewhere (Abbate et al., 2002; Germanaet al., 2004b). Briefly, deparaffinized and rehydratedsections were rinsed in Tris–HCl buffer (0.05M, pH7.5) containing 0.1% bovine serum albumin and 0.2%Triton-X 100. The endogenous peroxidase activity andnon-specific binding were blocked (3% H2O2 and 25%foetal calf serum, respectively) and sections were incu-bated overnight with the same primary antibodiesdescribed above (Dako), used diluted 1:1000. Afterincubation, sections were washed and incubated for 1 hat room temperature with peroxidase-labeled sheepanti-rabbit IgG (Amersham Pharmacia Biotech)diluted 1:100. Sections were rinsed, and the immunore-action was visualized using 3-30DAB as a chromogen.Furthermore, some sections were processed for S100detection using the highly sensible immunohistochemi-cal EnVision antibody complex kit (Dako) following themanufacturer’s recommendations. The specificity ofthe immunoreactivity developed was tested substitut-ing the primary antibody by a specifically preabsorbedserum (DPC, Los Angeles, USA; purchased prediluted).

RESULTSPCR

Total RNA obtained by the TRI method was retro-transcribed and, in order to assess its integrity b-actinwas amplified by PCR in the resulting cDNA. Allexperiments were performed in triplicate. Figure 1ashows the analysis of zebrafish S100 protein mRNA,being the size of the amplified fragment of 150 b.p.; theanalysis of zebrafish b-actin mRNA showed that thesize of the amplified fragments of 210 b.p. (data notshown).

Microscopy Research and Technique DOI 10.1002/jemt

249EXPRESSION OF S100 PROTEIN OF ADULT ZEBRAFISH

Western Blot

A specific protein band for S100 protein was detectedin homogenates of whole adult zebrafish using Westernblot. The band labeled with the antibody against S100protein showed an estimated molecular weight of 10 kDa(Fig. 1b). The molecular weight of the protein detectedwas the expected one (see Germana et al., 2007).

Distribution of S100 Protein Immunoreactivity

The cells immunoreactive for S100 protein have beenidentified on the basis of their morphology and localiza-tion within the different segments of the encephalonand spinal cord. On the other hand, the anatomical no-menclature used throughout this article follows the‘‘Neuroanatomy of the zebrafish brain’’ atlas by Wulli-mann (1996).

Telencephalon

The telenchephalon displayed a faint but specific S100protein immunoreactivity in disperse cells, apparentlyneurons, localized primarily in the dorsal telencephalicarea (data not show). Another telencephalic segmentcontaining S100 immunoreactive cells was the olfactorybulb (Fig. 2a). In this structure, scattered S100 proteinpositive cells and nerve fibre profiles were found in thecentral segments, as well as in outermost layers.

Diencephalon

In the diencephalic area, positive immunostainingfor S100 protein was found restricted to the cells lyingon the walls of the diencephalic ventricle and identifiedas ependymal cells (Fig. 2b), which have large pro-cesses that enter deeply the diencephalon. In the dor-sal zone of the diencephalon, cells displaying S100 pro-tein immunostaining showed morphological features ofboth tanycytes and of subependymal cells whose pro-cesses form a radiate subventricular zone (Fig. 2c).Regarding the diencephalic ventral zone, the S100 pro-tein positive cells were arranged in a single and super-ficial cellular layer, and presumably correspond withtanycytes (Fig. 2d).

Moreover, the commissura habenularum that runsbetween the two dorsal habenular nuclei showed astrong S100 IR in the epithelium (Fig. 2e). S100 proteinpositive cells were also present among the fibres form-ing the optic chiasm (Fig. 2f).

Mesencephalon

S100 protein immunoreactivity was mainly detectedin the mesecaphalic optic tectum, labeling nerve fiberprofiles rather than cells. In fact, the immunoreactivitywas concentred in fiber profiles that cross ventrodor-

Fig. 2. Immunohistochemical detection of S100 protein in theexpression in the telencephalon and diencephalon of the adult zebra-fish. Immunoreactive cells were found in the superficial cells of theolfactory bulb (a), the cells lying on the walls of the diencephalic ven-tricle, identified as subependymal glial cells and tanycytes (b–d).

S100 positive cells were also found in the commissura habenularum(e), and cells of the optic chiasm (f). Arrows indicate the immunoreac-tive cells. Chab, commissura habenularum; CO, chiasma opticum;DiV, diencephalic ventricle; ob, olfactory bulb. Scale bar 5 30 lm fora; 50 lm for b, e, and f; and 70 lm for c, d.

Fig. 1. (a) The brain (B) of the adult zebrafish constitutivelyexpresses mRNA for S100 protein (predicted size 150 pb). All experi-ments were performed in triplicate. M: Log DNA Ladder. (b) Western-blot analysis of brain homogenates detected at �10kDa protein bandthat correspond to the S-100 protein.


250 A. GERMANA ET AL.

sally the entire optic tectum perpendicular to the exter-nal surface (Fig. 3a). Moreover S100 protein immuno-reactive cells were also localized in the medial and lat-eral zone of the valvula cerebelli (Fig. 3a). The innersurface of the optic tectum that lie in the tectal ventri-cle was also covered by S100 protein positive cells dis-playing morphological features of ependymal cells andsubependymal cells. The ependymal cells were large insize and round in shape (Fig. 3b) whereas the subepen-dymal glial cells show long-radial processes thatthrough the tectum opticum reach the pial surface(Fig. 3d).

The dorsal and the lateral parts of the torus longitu-dinalis was covered by ependymal cells displayingS100 protein IR, and the nerve fibres forming the com-missura in the ventral part of the torus longitudinaliswere also S100 protein positive (Fig. 3c).

Cerebellum

The pattern of distribution of S100 protein in the cere-bellum clearly differed from the other segments of thecentral nervous since it was primarily localized in neu-rons rather than in glial cells (Figs. 4a and 4b). Thecorpus cerebellum showed S100 protein IR in smallneurons localized mainly in the superficial layer(Fig. 4b). Furthermore, the neurons forming the cere-bellar deep nuclei also were immunoreactive for S100protein (Figs. 4c and 4d). The Purkinje’s neurons local-ized in the basal zone showed a strong IR for S100 pro-tein in both the soma and the dendritic tree (Fig. 4e).

Rhombencephalon

As a rule S100 protein IR was absent from the nucleilocalized in the rombencephalon, the immunoreactivitybeing localized exclusively in the cells that covered therhomboencephalic ventricle; occasional S100 proteinpositive cells were present in the surface of theseregions of the brain stem (data not shown).

Spinal Cord

The cells displaying S100 protein IR in the spinalcord have their somata lying on the walls of the epen-dymal canal or covering the external surface of theorgan, and the positive reaction was detected in boththe nucleus and cytoplasm. On the basis of their local-ization and morphology they were identified as ependy-mal cells and outer radial glial cells, respectively. Bothouter and inner cells typically showed long processesthan enter deeply in the spine (Figs. 5a–5c). The pro-files of the large motoneurons as well as of the neuronsof the dorsal horn were always devoid of S100 proteinIR. This pattern of distribution was identical along theentire spine and no differences were noted between thedifferent regions.

Peripheral Nervous System

Outside the central nervous system, S100 proteinimmunoreactivity was detected in neurons of the cra-nial nerve ganglia, dorsal root ganglia, and paraverte-bral ganglia. Interestingly no immunoreactivity wasdetected in the satellite glial cells of these ganglia as itoccurs typically in higher vertebrates. In the facialganglia, a large subpopulation of neurons, rangingaround 35%, were S100 protein positive, the immuno-reactivity, being stronger in the large sized ones(Fig. 6a). Conversely in the trigeminal ganglion S100protein IR was restricted to the smaller neurons,whereas the larger ones were devoid of immunoreactiv-ity (Fig. 6b). Regarding the sympathetic ganglia S100protein IR labeled both the somata and the neuronalprocesses (Fig. 6c), and no positive immunoreactivityfor S100 protein was detected in the enteric nervoussystem (data not shown). Furthermore, in the dorsalroot ganglia the immunoreactive neurons covered theentire size range, and the percentage of S100 positivecells was of about 40% (Fig. 6d).

Fig. 3. Immunohistochemical detectionof S100 protein in the expression in themesencephalon of the adult zebrafish. Theimmunoreactivity for S100 protein was infibres of optic tectum (a,d), in subependy-mal cells of the tectal ventricle (b) and inthe subependymal glial cells (d). Ependy-mal S100 positive immunoreactive cellswere also observed in the torus longitudina-lis (c). Arrows indicate the immunoreactivecells. TL, torus longitudinalis; TeO, tectumopticum; TeV, tectal ventricle; Val, valvulacerebelli. Scale bar 5 30 lm for a,c; 50 lmfor d; and 70 lm for b.



As a summary, the nervous system of the adultzebrafish express mRNA for S100 protein, and a pro-tein with an estimated molecular weight of �10 kDaconsistent with that of S100 protein. The immunoreac-tivity for S100 protein was preferentially localized innon-neuronal cells of the central nervous system, i.e.,glial cells and tanycytes, but also in some neurons andtheir processes, as it occurs in the cerebellum and pe-ripheral nervous system.

DISCUSSION

The present study was designed to systematicallyanalyze the expression at the mRNA and protein level,as well as the anatomical distribution of S100 protein

in the nervous system of the adult zebrafish. This smallteleost is currently used as a model for developmentalstudies but also to investigate the molecular basis ofsome human diseases (Hsu et al., 2007; Kari et al.,2007; Lieschke and Currie, 2007). The distribution of alarge number of proteins in the nervous system of thezebrafish is rather well known (www.zfin.org), but sur-prisingly there is no information about the expressionand localization of S100 protein, one protein wellknown in the nervous system of the higher vertebrates(Gonzalez-Martinez et al., 2003; Heizmann, 1999) andwhich is philogenetically well preserved (Donato, 2003;Marenholz et al., 2004). Conversely, there exists somedata on the expression and distribution in the zebrafishnervous system of some other Ca21BP such as calreti-

Fig. 4. Immunohistochemical localiza-tion of S100 protein in the cerebellum ofthe adult zebrafish. Diffuse S100 proteinimmunostaining was detected in the cere-bellar cortex (a,b), in the bodies and den-dritic tree of the neurons forming the cere-bellar nuclei (c,d) and in the Purkinje’scells (e). Arrows indicate S100 protein im-munoreactive neurons. Scale bar 5 30 lmfor a,b and 70 lm for c–e.

Fig. 5. Immunohistochemical localization of S100 protein in the spinal cord of the adult zebrafish.The cells displaying S100 protein immunoreactivity were identified as ependymal cells and outer radialglial cells (a–c). ED, ependymal duct (arrow). Scale bar5 50 lm for a and 70 lm for b and c.



nin (Castro et al., 2006a,b) or parvalbumin (Hsiaoet al., 2002).

This article demonstrates for the first time theexpression at the mRNA and protein level of S100 pro-tein in the nervous system of the adult zebrafish, aswell as the distribution of S100 protein immunoreactiv-ity in different cell types throughout the whole ence-phalon and the peripheral nervous system. We havedemonstrated the expression of specific mRNA forzebrafish S100 protein, and by means of Western blot,associated to a polyclonal antibody against bovine S100protein, we have detected a protein with an estimatedmolecular weight of �10 kDa which roughly corre-sponds with that of S100 protein in other vertebrates(see Donato, 2003), including teleosts (Germana et al.,2007; Manso et al., 1997). On the other hand, the im-munohistochemical study we have conducted the com-plete map of the distribution of S100 protein in thezebrafish, since this protein has been localized previ-ously only in some mechanosensory (Abbate et al.,2002; Germana et al., 2004a, 2007) and chemosensory(Germana et al., 2004b) cells. The information so faravailable about the occurrence and distribution of S100protein in teleosts other than zebrafish is also primar-ily focused on some sensory organs (Vecino et al., 1997;Velasco et al., 1997), the mechanosensory cells (Fosteret al., 1993; Germana et al., 2002; Saidel et al., 1990),or the kidney (de Girolamo et al., 2000, 2003). OnlyManso et al. (1997) have reported the distribution ofS100 protein-like in the trout brain.

The antibody we used in this study was raised in rab-bit against bovine brain S100. Since this antibody rec-ognizes by Western blot a single protein band, it is ofcapital importance to know the S100 protein identified.On the basis of its molecular weight (Manso et al.,

1997) and the cells displaying S100 protein immuno-reactivity, it seems that the main, if not the unique,S100 protein we identified is S100B protein. Neverthe-less, this remains to be definitively clarified in futurestudies, and the immunolabeling of other S100 proteinscannot be ruled out. Moreover, the commercially avail-able antibodies against S100 proteins, like the used inthe present study, predominantly detects S100B pro-tein (Jensen et al., 1985).

Our results demonstrated the immunoreactivity forS100 protein in the central nervous system of thezebrafish was mainly localized in non-neuronal cells.These cells were found in the diencephalon, the optictectum, the mesencaphalon and were distributedmainly in the epithelium that lie the brain ventriclesand the external surface of the encephalon, althoughdepending on their localization were different in sizeand shape. According to their morphological character-istics and topographic distribution, S100-immunoreac-tive glial elements of zebrafish brain belong to tany-cytes, ependymal cells and subependymal radial glialcells. This heterogeneity roughly matches previousdata in fishes and those in other vertebrates. A similardistribution has been reported for calbindin-28k and aS100 protein-like in the trout brain (Manso et al.,1997). Furthermore, in elasmobranchs S-100 proteinimmunoreactive cells were identified as astrocytes andtanycytes, including the superficial glial membraneand radial fibers, and it was absent from neurons(Chiba, 2000). This is in good agreement with data inhigher vertebrates in which S100 protein immunoreac-tivity is primarily present in astroglial cells of the cen-tral nervous system (Goto et al., 1988). Nevertheless, ithas been demonstrated that S100B was also found inependymal cells, the choroid plexus epithelium, vascu-

Fig. 6. Immunohistochemical local-ization of S100 protein in the peripheralnervous system of the adult zebrafish.Different neuronal populations showedS100 protein immunoreactivity in thefacial ganglion (a, FG), trigeminal gan-glion (b, TG), the sympathetic ganglia(c, SG), and dorsal root ganglia (DRG).Scale bar 5 50 lm for b, c and 70 lmfor a.



lar endothelial cells, lymphocytes, and several neurons(Steiner et al., 2007), and it is also present in the ma-jority of the ventricular ependymal cells and tanycytes,in agreement with previous studies carried out also inmammals (Didier et al., 1986; Stagaard Janas et al.,1991) and birds (Castagna et al., 2003).

A surprising result from our study was the presenceof S100 protein immunoreactivity in cortical and deepcerebellar neurons. All the first data in vertebratesargues that the localization of S100 protein immuno-reactivity is restricted to the glial cells (Legrand et al.,1981), following studies demonstrated the presence ofS100 immunoreactivity in central neurons of differentvertebrates (turtle, frog, fish, rabbit, cat, rat, human:Goto et al., 1988; Haglid et al., 1976; Isobe et al., 1984;Tabuchi et al., 1976). Most of these studies describedthe distribution of S100-immunopositive neuronal pop-ulation only in limited regions, but some authors havedetailed the distribution of S100-positive neurons inthe whole mammalian brain with immunocytochemis-try and nonradioactive in situ hybridization (Rickmannand Wolff, 1995; Yang et al., 1995a). So, this particular-ity of the cerebellum of the adult zebrafish must beinvestigated in other fishes and its significance if anyremains to be demonstrated.

Regarding the peripheral nervous system, results inadult zebrafish clearly differed from those reported forhigher vertebrates, especially mammals, in whichS100 protein has been primarily in the satellite glialcells of both sensory and sympathetic ganglia (see forreferences Gonzalez-Martinez et al., 2003). Neverthe-less, as for the zebrafish, neuronal S100 protein inmu-noreactivity has been reported in the rat dorsal rootganglia (Sugimura et al., 1989; Vega et al., 1989, 1991),trigeminal ganglia (Ichikawa et al., 1997; Yang et al.,1995b), vagal, and glossopharingeal ganglia (Ichikawaand Helke, 1998). S100 protein immunoreactivity isalso present in sensory neurons of other higher mam-mals, but species specific differences exist in theexpression of this protein by sensory neurons (Albu-erne et al., 1998). On the other hand, present results insympathetic ganglia differ from those known for highervertebrates because in fishes S100 protein immuno-reactivity label neurons instead of satellite glial cells(Gonzalez-Martinez et al., 2003). These discrepanciesare also true for the enteric nervous system in whichS100 protein was absent whereas in other vertebratespecies is present in the enteric glial cells (see Albu-erne et al., 1998).

The role of S100 proteins in the nervous system ofadult zebrafish is not known. They participate in theregulation of intracellular Ca21 homeostasis acting astrigger or activation proteins (Heizmann et al., 2002).They also have a neurotrophic activity (Huttunenet al., 2000), inhibit phosphorylation and induce apo-ptosis (Donato, 1999, 2001), and regulate the cytoskele-ton stability (Sorci et al., 2000). Nevertheless, the func-tions of S100 proteins in vivo are largely uncertain,since no main changes have been observed in trans-genic animal models for S100 proteins (Gerlai andRoder, 1995; Roder et al., 1996). Moreover, S100B pro-tein is produced, stored, and released from astrocytes,tanicytes, oligodendrocytes, and radial cells, and exertparacrine and autocrine effects on neurons and glia. Itcan be assumed that S100 protein participates in the

biology of the cells expressing it. In this way, it hasbeen demonstrated that S100B expression defines alate developmental stage after which GFAP-expressingcells lose their neural stem cell potential (Raponi et al.,2007). Because S100 protein continues to be expressedin these regions of adult zebrafish, and the glial cells ofthe subventricular zone play an important role in theadult zebrafish neurogenesis S100 protein could be inthis function, which is maintained in zebrafish duringall lifespan (Grandel et al., 2006; Ninkovic and Gotz,2007). Studies are in progress in our laboratory to clar-ify this hypothesis.

ACKNOWLEDGMENT

Technical assistance of Mr. Vincenzo Sidoti wasgratefully acknowledged.

REFERENCES

Abbate F, Catania S, Germana A, Gonzalez T, Diaz-Esnal B, GermanaG, Vega JA. 2002. S-100 protein is a selective marker for sensoryhair cells of the lateral line system in teleosts. Neurosci Lett329:133–136.

Albuerne M, Mammola CL, Naves FJ, Levanti B, Germana G, VegaJA. 1998. Immunohistochemical localization of S100 proteins indorsal root, sympathetic and enteric ganglia of several mammalianspecies, including man. J Peripher Nerv Syst 3:243–253.

Bretaud S, Allen C, Ingham PW, Bandmann O. 2007. p53-dependentneuronal cell death in a DJ-1-deficient zebrafish model of Parkin-son’s disease. J Neurochem 100:1626–1635.

Castagna C, Viglietti-Panzica C, Panzica GC. 2003. Protein S100immunoreactivity in glial cells and neurons of the Japanese quailbrain. J Chem Neuroanat 25:195–212.

Castro A, Becerra M, Manso MJ, Anadon R. 2006a. Calretinin immu-noreactivity in the brain of the zebrafish, Danio rerio: Distributionand comparison with some neuropeptides and neurotransmitter-synthesizing enzymes. I. Olfactory organ and forebrain. J CompNeurol 494:435–459.

Castro A, Becerra M, Manso MJ, Anadon R. 2006b. Calretinin immu-noreactivity in the brain of the zebrafish, Danio rerio: Distributionand comparison with some neuropeptides and neurotransmitter-synthesizing enzymes. II. Midbrain, hindbrain, and rostral spinalcord. J Comp Neurol 494:792–814.

Catania S, Germana A, Cabo R, Ochoa-Erena FJ, Guerrera MC, Han-nestad J, Represa J, Vega JA. 2007. Neurotrophin and Trk neuro-trophin receptors in the inner ear of Salmo salar and Salmo trutta.J Anat 210:78–88.

Chiba A. 2000. S-100 protein-immunoreactive structures in the brainsof the elasmobranches Scyliorhinus torazame and Mustelus man-azo. Neurosci Lett 279:65–68.

de Girolamo P, Arcamone N, Gargiulo G. 2000. S100-like protein inthe goldfish (Carassius auratus) kidney. An immunohistochemicalstudy. Cell Tissue Res 302:135–138.

de Girolamo P, Arcamone N, Pelagalli GV, Gargiulo G. 2003. Immuno-histochemical localization of S100-like protein in non-mammaliankidney. Microsc Res Tech 60:652–657.

Didier M, Harandi M, Aguera M, Bancel B, Tardy M, Fages C, CalasA, Stagaard M, Mollgard K, Belin MF. 1986. Differential mmunocy-tochemical staining for glial fibrillary acidic (GFA) protein, S-100protein and glutamine synthetase in the rat subcommissural organ,nonspecialized ventricular ependyma and adjacent neuropil. CellTissue Res 245:343–351.

Donato R. 1999. Functional roles of S100 proteins, calcium-bindingproteins of the EF-hand type. Biochim Biophys Acta 1450:191–231.

Donato R. 2001. S100: A multigenic family of calcium-modulated pro-teins of the EF-hand type with intracellular and extracellular func-tional roles. Int J Biochem Cell Biol 33:637–668.

Donato R. 2003. Intracellular and extracellular roles of S100 proteins.Microsc Res Tech 60:540–551.

Foster JD, Drescher MJ, Khan KM, Drescher DG. 1993. Immunohis-tochemical localization of S-100 protein in the saccule of the rain-bow trout (Salmo gairdnerii R.). Hear Res 68:180–188.

Gerlai R, Roder J. 1995. Abnormal exploratory behavior in transgenicmice carrying multiple copies of the human gene for S100 beta.J Psychiatry Neurosi 20:105–112.



Germana A, Catania S, Cavallaro M, Gonzalez-Martinez T, Ciriaco E,Hannestad J, Vega JA. 2002. Immunohistochemical localization ofBDNF-, TrkB- and TrkA-like proteins in the teleost lateral line sys-tem. J Anat 200:477–485.

Germana A, Gonzalez-Martinez T, Catania S, Laura R, Cobo J, Cir-iaco E, Vega JA. 2004a. Neurotrophin receptors in taste buds ofadult zebrafish (Danio rerio). Neurosci Lett 354:189–192.

Germana A, Montalbano G, Laura R, Ciriaco E, del Valle ME, VegaJA. 2004b. S100 protein-like immunoreactivity in the crypt olfac-tory neurons of the adult zebrafish. Neurosci Lett 371:196–198.

Germana A, Paruta S, Germana GP, Ochoa-Erena FJ, Montalbano G,Cobo J, Vega JA. 2007. Differential distribution of s100 protein andcalretinin in mechanosensory and chemosensory cells of adultzebrafish (Danio rerio). Brain Res 1162:48–55; doi:10.1016/j.brainres.2007.05.070.

Gonzalez-Martinez T, Perez-Pinera P, Diaz-Esnal B, Vega JA. 2003. S-100 proteins in the human peripheral nervous system. Microsc ResTech 60:633–638.

Goto K, Endo H, Fujiyoshi T. 1988. Cloning of the sequencesexpressed abundantly in established cell lines: Identification of acDNA clone highly homologous to S-100, a calcium binding protein.J Biochem 103:48–53.

Grandel H, Kaslin J, Ganz J, Wenzel I, Brand M. 2006. Neural stemcells and neurogenesis in the adult zebrafish brain: Origin, prolifer-ation dynamics, migration and cell fate. Dev Biol 295:263–277.

Haglid KG, Hamberger A, Hansson HA, Hyden H, Persson L, Ronn-back L. 1976. Cellular and subcellular distribution of the S-100 pro-tein in rabbit and rat central nervous system. J Neurosci Res2:175–191.

Heizmann CW. 1999. Ca21-binding S100 proteins in the central nerv-ous system. Neurochem Res 24:1097–1100.

Heizmann CW, Fritz G, Schafer BW. 2002. S100 proteins: Structure,functions and pathology. Front Biosci 7:d1356–d1368.

Hsiao CD, Tsai WY, Tsai HJ. 2002. Isolation and expression of twozebrafish homologues of parvalbumin genes related to chickenCPV3 and mammalian oncomodulin. Gene Expr Patterns 2:163–168.

Hsu CH, Wen ZH, Lin CS, Chakraborty C. 2007. The zebrafish model:Use in studying cellular mechanisms for a spectrum of clinical dis-ease entities. Curr Neurovasc Res 4:111–120.

Huttunen HJ, Kuja-Panula J, Sorci G, Agneletti AL, Donato R, Rau-vala H. 2000. Coregulation of neurite outgrowth and cell survivalby amphoterin and S100 proteins through receptor for advancedglycation end products (RAGE) activation. J Biol Chem 275:40096–40105.

Ichikawa H, Helke CJ. 1998. Coexistence of s100beta and putativetransmitter agents in vagal and glossopharyngeal sensory neuronsof the rat. Brain Res 800:312–318.

Ichikawa H, Jacobowitz DM, Sugimoto T. 1997. S100 protein-immu-noreactive primary sensory neurons in the trigeminal and dorsalroot ganglia of the rat. Brain Res 748:253–257.

Isobe T, Takahashi K, Okuyama T. 1984. S100a0 (alpha alpha) proteinis present in neurons of the central and peripheral nervous system.J Neurochem 43:1494–1496.

Jensen R, Marshak DR, Anderson C, Lukas TJ, Watterson DM. 1985.Characterization of human brain S100 protein fraction: amino acidsequence of S100 beta. Neurochem 45:700–705.

Kari G, Rodeck U, Dicker AP. 2007. Zebrafish: An Emerging modelsystem for human disease and drug discovery. Clin Pharmacol Ther82:70–80.

Langenau DM, Zon LI. 2005. The zebrafish: A new model of T-cell andthymic development. Nat Rev Immunol 307:317.

Legrand C, Clos J, Legrand J, Langley OK, Ghandour MS, Labour-dette G, Gombos G, Vincendon G. 1981. Localization of S100 proteinin the rat cerebellum: An immunoelectron microscope study. Neuro-pathol Appl Neurobiol 7:299–306.

Lieschke GJ, Currie PD. 2007. Animal models of human disease:Zebrafish swim into view. Nat Rev Genet 8:353–367.

Manso MJ, Becerra M, Anadon R. 1997. Expression of a low-molecu-lar-weight (10 kDa) calcium binding protein in glial cells of thebrain of the trout (Teleostei). Anat Embryol 196:403–416.

Marenholz I, Heizmann CW, Fritz G. 2004. S100 proteins in mouseand man: From evolution to function and pathology (including anupdate of the nomenclature). Biochem Biophys Res Commun322:1111–1122.

Marenholz I, Lovering RC, Heizmann CW. 2006. An update of theS100 nomenclature. Biochem Biophys Acta 1763:1282–1283.

Moore BW. 1965. A soluble protein characteristics of the nervous sys-tem. Biochem Biophys Res Commun 19:739–744.

Newman M, Musgrave FI, Lardelli M. 2007. Alzheimer disease: Amy-loidogenesis, the presenilins and animal models. Biochim BiophysActa 1772:285–297.

Ninkovic J, Gotz M. 2007. Signaling in adult neurogenesis: Fromstem cell niche to neuronal networks. Curr Opin Neurobiol 17:338–344.

Raponi E, Agenes F, Delphin C, Assard N, Baudier J, Legraverend C,Deloulme JC. 2007. S100B expression defines a state in whichGFAP-expressing cells lose their neural stem cell potential and ac-quire a more mature developmental stage. Glia 55:165–177.

Rickmann M, Wolff JR. 1995. S100 protein expression in subpopula-tions of neurons of rat brain. Neuroscience 67:977–991.

Roder JK, Roder JC, Gerlai R. 1996. Conspecific exploration in the T-maze: Abnormalities in S100 beta transgenic mice. Physiol Behav60:31–36.

Rothermundt M, Peters M, Prehn JH, Arolt V. 2003. S100B in braindamage and neurodegeneration. Microsc Res Tech 60:614–632.

Saidel WM, Presson JC, Chang JS. 1990. S-100 immunoreactivityidentifies a subset of hair cells in the utricle and saccule of a fish.Hear Res 47:139–146.

Santamaria-Kisiel L, Rintala-Dempsey AC, Shaw GS. 2006. Calcium-dependent and -independent interactions of the S100 protein fam-ily. Biochem J 396:201–214.

Schafer BW, Fritschy JM, Murmann P, Troxler H, Durussel I, Heiz-mann CW, Cox JA. 2000. Brain S100A5 is a novel calcium-, zinc-,and copper ion-binding protein of the EF-hand superfamily. J BiolChem 275:30623–30630.

Sen J, Belli A. 2007. S100B in neuropathologic states: The CRP of thebrain? J Neurosci Res 85:1373–1380.

Sorci G, Agneletti AL, Donato R. 2000. Effects of S100A1 and S100Bon microtubule stability. An in vitro study using triton-cytoskele-tons from astrocyte and myoblast cell lines. Neuroscience 99:773–783.

Stagaard Janas M, Nowakowski RS, Terkelsen OB, Mollgard K. 1991.Glial cell differentiation in neuron-free and neuron-rich regions. I.Selective appearance of S-100 protein in radial glial cells of the hip-pocampal fimbria in human fetuses. Anat Embryol 184:549–558.

Steiner J, Bernstein HG, Bielau H, Berndt A, Brisch R, Mawrin C,Keilhoff G, Bogerts B. 2007. Evidence for a wide extra-astrocyticdistribution of S100B in human brain. BMC Neurosci 2:8–12.

Stroick M, Fatar M, Ragoschke-Schumm A, Fassbender K, Bertsch T,Hennerici MG. 2006. Protein S-100B—A prognostic marker for cere-bral damage. Curr Med Chem 13:3053–3060.

Sugimura K, Haimoto H, Nagura H, Kato K, Takahashi A, 1989. Im-munohistochemical differential distribution of S-100alpha andS100beta in the peripheral nervous system of the rat. Muscle Nerve12:929–935.

Tabuchi K, KirschWM, Nakane PK. 1976. The fine structural localiza-tion of S-100 protein in rodent cerebellum. J Neurol Sci 28:65–76.

Vecino E, Velasco A, Caminos E, Aijon J. 1997. Distribution of S100immunoreactivity in the retina and optic nerve head of the teleostTinca tinca L. Microsc Res Tech 36:17–25.

Velasco A, Brinon JG, Caminos E, Lara JM, Aijon J. 1997. S-100-posi-tive glial cells are involved in the regeneration of the visual path-way of teleosts. Brain Res Bull 43:327–336.

Vega JA, Dubovy P, del Valle-Soto ME, Hernandez LC, Perez-Casas A,Malinovsky L. 1989. Immunohistochemical study of Pacinian cor-puscles using monoclonal antibodies for neurofilament protein, glialfibrillary acidic protein and S-100 protein. Cell Mol Biol 35:627–633.

Vega JA, del Valle-Soto ME, Calzada B, Alvarez-Mendez JC. 1991. Im-munohistochemical localization of S-100 protein subunits (alphaand beta) in dorsal root ganglia of the rat. Cell Mol Biol 37:173–181.

Yamashita N, Ilg EC, Schafer BW, Heizmann CW, Kosaka T. 1999.Distribution of a specific calcium-binding protein of the S100 pro-tein family, S100A6 (calcyclin), in subpopulations of neurons andglial cells of the adult rat nervous system. J Comp Neurol 404:235–257.

Yang QE, Hamberger A, Hyden H, Wang S, Stigbrand T, Haglid KG.1995a. S100beta has a neuronal localisation in the rat hindbrainrevealed by an antigen retrieval method. Brain Res 696:49–60.

Yang Q, Hou X, Hamberger A, Wang S, Dahlstrom A, Haglid KG.1995b. S-100 beta immunoreactivity in neurones of the rat periph-eral sensory ganglia. Neuroreport 23:2005–2009.

Wulliman MF. 1996. Neuroanatomy of the zebrafish brain. Basel, Bos-ton, Berlin: Birkhauser Verlag. p 144.



expression and distribution of s100 protein in the nervous system of the adult zebrafish (danio...

Documents