i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 0

Avai lab le a t www.sc iencedi rec t .com

j ourna l homepage : www.e lsev ier . com/ loca te /he

Effects of hydraulic retention time on anaerobichydrogenation performance and microbial ecology ofbioreactors fed with glucose–peptone and starch–peptone

Shiue-Lin Li a, Liang-Ming Whang a,b,*, Yu-Chieh Chao a, Yu-Hsuan Wang a,Yung-Fu Wang a,b, Chia-Jung Hsiao a, I.-Cheng Tseng b,c, Ming-Der Bai a,Sheng-Shung Cheng a,b

a Department of Environmental Engineering, National Cheng-Kung University, No. 1, University Road, Tainan 701, Taiwan, ROCb Sustainable Environment Research Center (SERC), National Cheng-Kung University, No. 1, University Road, Tainan 701, Taiwan, ROCc Department of Life Science, National Cheng-Kung University, No. 1, University Road, Tainan 701, Taiwan, ROC

a r t i c l e i n f o

Article history:

Received 7 August 2009

Received in revised form

10 October 2009

Accepted 10 October 2009

Available online 10 November 2009

Keywords:

Biological hydrogen production

Hydraulic retention time

Microbial ecology

Hydrogen consumption

Glucose

Starch

Peptone

* Corresponding author at: Department of En701, Taiwan, ROC. Tel.: þ886 6 2757575x6583

E-mail address: whang@mail.ncku.edu.tw0360-3199/$ – see front matter ª 2009 Profesdoi:10.1016/j.ijhydene.2009.10.033

a b s t r a c t

This study evaluated anaerobic hydrogenation performance and microbial ecology in

bioreactors operated at different hydraulic retention time (HRT) conditions and fed with

glucose–peptone (GP) and starch–peptone (SP). The maximum hydrogen production rates

for GP- and SP-fed bioreactors were found to be 1247 and 412 mmol-H2/L/d at HRT of 2 and

3 h, respectively. At HRT> 8 h, hydrogen consumption due to peptone fermentation could

occur and thus reduced hydrogen yield from carbohydrate fermentation. Results of

cloning/sequencing and denaturant gradient gel electrophoresis (DGGE) indicated that

Clostridium sporogenes and Clostridium celerecrescens were dominant hydrogen-producing

bacteria in the GP-fed bioreactor, presumably due to their capability on protein hydrolysis.

In the SP-fed bioreactor, Lactobacillus plantarum, Propionispira arboris, and Clostridium

butyricum were found to be dominant populations, but the presence of P. arboris at

HRT> 3 h might be responsible for a lower hydrogen yield from starch fermentation. As

a result, optimizing HRT operation for bioreactors was considered an important asset in

order to minimize hydrogen-consuming activities and thus maximize net hydrogen

production. The limitation of simple parameters such as butyrate to acetate ratio (B/A

ratio) in predicting hydrogen production was recognized in this study for bioreactors fed

with multiple substrates. It is suggested that microbial ecology analysis, in addition to

chemical analysis, should be performed when complex substrates and mixed cultures are

used in hydrogen-producing bioreactors.

ª 2009 Professor T. Nejat Veziroglu. Published by Elsevier Ltd. All rights reserved.

1. Introduction environment, there is an urgent need in developing a clean

The importance of renewable energy sources increases as the

issues of fossil fuel exhaustion and global warming become

serious. Considering the energy security and the global

vironmental Engineering7; fax: þ886 6 2752790.(L.-M. Whang).

sor T. Nejat Veziroglu. Pu

and renewable energy source. Hydrogen is a clean energy

carrier, generating only water when it burns. However, for

hydrogen production to meet sustainability requirements, it

must be produced from renewable resources. One way to

, National Cheng-Kung University, No. 1, University Road, Tainan

blished by Elsevier Ltd. All rights reserved.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 062

produce hydrogen renewably is through fermentative bio-

hydrogen production from potential renewable materials

such as carbohydrate-containing biomass and organic wastes

[1–3].

In principle, the theoretical hydrogen yield from glucose

fermentation can be estimated by a known metabolic

pathway [4], giving a maximum yield of 4 mol hydrogen per

mol of glucose when acetic acid is produced as the only

fermentation metabolite. However, in practice, several studies

observed actual hydrogen yields close to or lower than 2 [1],

even with pure culture experiments and defined substrates

such as glucose or sucrose [5–8]. It is assumed that several

factors including thermodynamics [9,10], metabolic regula-

tion [11–17], kinetics [16–19], microbial community structure

[20–22], or a combination can cause the distribution of elec-

tron equivalents into products other than hydrogen and

acetate. Consequently, the relatively unpredictable hydrogen

yield and unstable biohydrogen process can be a drawback of

its application.

Hydrogen production from anaerobic waste treatment

possesses potential benefits in both reducing organic wastes

and generating a sustainable energy source at the same time,

but it also creates challenges because the waste materials

usually are composed of a variety of substrates that can be

used by different species of microorganisms [1]. Unfortu-

nately, some microorganisms present in wastewaters or

fermentation systems can consume hydrogen, leading to

a lower hydrogen production efficiency. Control strategies

such as maintaining a low pH value in the reactor, using

a heat-treated inoculum, and using a short hydraulic reten-

tion time (HRT) can be applied to minimize the growth of

hydrogen-utilizing microorganisms such as methanogens in

continuous reactors [21–24]. Additionally, organic waste

compositions and characteristics are also important to

hydrogen fermentation. Carbohydrates including sugars and

starch have been studied for its potential application for

hydrogen production [1], but such information for organic

nitrogen compounds is relatively limited, except that peptone

has been reported as a nitrogen source for enhancing

hydrogen production of hydrogen-producing bacteria [25,26].

Furthermore, microbial community structures in hydrogen-

producing bioreactors fed with single substrate such as

glucose [27], sucrose [20,28], xylose [28], and starch [29] have

been investigated recently using molecular methods, and the

occurrence and importance of hydrogen-producing bacteria,

mostly clostridial species, are usually reported for their

correlation with hydrogen production. However, hydrogen-

consuming bacteria present in bioreactors and their connec-

tion to the frequently observed low hydrogen yield are rarely

discussed.

In this study, we present experimental results of anaerobic

hydrogenation performance in bioreactors operated at

different HRT conditions, with glucose–peptone and starch–

peptone as carbohydrate and nitrogen sources. Investigation

on microbial ecology in both bioreactors was also performed

using molecular methods including cloning/sequencing and

denaturant gradient gel electrophoresis (DGGE). Finally, the

effects of HRT on hydrogenation performance and microbial

ecology in both bioreactors, and, most importantly, the

connection between them are discussed.

2. Materials and methods

2.1. Operation of continuous stirred tank bioreactors

Two continuous stirred tank reactors (CSTR) were operated in

this study. One bioreactor (GP) was fed with 12,000 mg/L of

glucose and 8000 mg/L of peptone, while the other one (SP) was

fed with 12,000 mg/L of starch and 8000 mg/L of peptone for all

experimental runs. The total volume of the GP-fed bioreactor

was 2.5 L with a working volume of 1.5 L. A complete-mix

condition was achieved with a magnetic mixer at an agitation

speed of 300 rpm. For the SP-fed bioreactor, the total volume

was 25 L with a working volume of 10 L, and the bioreactor was

equipped with a mechanic propeller for mixing. Each liter of

the influent feed was supplemented with 528 mg of

MgCl2$6H2O, 380 mg of KCl, 73.4 mg of CaCl2$6H2O, 5.8 mg

of MnCl2$4H2O, 8.8 mg of CoCl2$6H2O, 1.6 mg of H3BO3, 0.8 mg of

CuCl2$2H2O, 24.8 mg of FeCl2$4H2O, 0.74 mg of Na2MoO4, and

0.62 mg of ZnCl2 [30]. The influent medium solution was stored

at 4 �C in a refrigerator and continuously fed into the bioreac-

tors using a peristaltic pump. In order to avoid fermentation in

the feed tank and to provide sufficient alkalinity required for

neutralizing the acids produced in the bioreactors, 240 mL of

70% liquid sodium hydroxide was added in every 20 L of the

influent feed solution, resulting in a pH of 11 of the feed solu-

tion. Without additional pH control for the CSTRs, the pH

values ranged from 6.1 to 6.5 in the bioreactors in all experi-

mental runs. The seed microorganisms for the bioreactors in

each experimental run were obtained from an upflow anaer-

obic sludge blanket bioprocess treating food processing

wastewater. Before seeding, the anaerobic sludge was pre-

treated by boiling for over 30 min in order to minimize intro-

ducing methanogens into the bioreactors [23]. During this

study, no observable methane gas was detected in the biore-

actors. In each run, the bioreactors were seeded with fresh

pretreated inocula at an initial concentration of 200 mg/L and

the data were collected from the bioreactors after operation of

a period passing through more than 10 reactor volumes. The

amount of gases produced in the bioreactor was measured with

a wet-gas flow meter (Shinagawa W-NK-0.5B, Tokyo, Japan).

The bioreactors and the off-gas flow meter were kept in an air-

bath incubator and the temperature was maintained at 35 �C.

2.2. Analytical methods

Biogas collected from both bioreactors was analyzed using

a gas chromatograph (China GC 8900, Taipei, Taiwan) equipped

with a thermal conductivity detector (TCD). A 2 m stainless

column was packed with Hayesep Q (60/80 mesh) and

installed in a 60 �C oven. The operational temperatures of the

injection port, the oven, and the detector were all set at 60 �C.

Nitrogen was used as the carrier gas at a flow rate of 15 mL/min.

The volatile fatty acids (VFAs) were determined using an ion

chromatography (Dionex DX-120, California, USA) equipped

with an anion IonPac ICE-ASI column, an AMMA-ICE II

suppressor, and a conductivity detector. The carbohydrate was

analyzed using the phenol-sulfuric acid method [31]. The pH,

ORP, NH4þ-N and volatile suspended solids (VSS) were

measured according to standard methods [32].

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 0 63

2.3. Biochemical hydrogen potential (BHP) test

The BHP test employed in this study was a modified version of

biochemical methane potential (BMP) test developed by Owen

et al. [30]. The test was carried out in a series of 120 mL serum

bottles. To each bottle with a liquid working volume of 80 ml,

3000 mg/L of starch and/or 2000 mg/L of peptone were added

as fermentation substrates. In addition, each bottle contained

the following chemicals as growth nutrients (in mg/L):

CaCl2$6H2O, 32.32; MgCl2$6H2O, 232.26; KCl, 167.81;

MnCl2$4H2O, 63.87; CoCl2$6H2O, 3.87; H3BO3, 0.74; CuCl$2H2O,

0.35; Na2MoO4 2H2O, 0.33; ZnCl2, 0.27; FeCl2 4H2O, 10.62;

sodium thioglycolate, 217.35; KH2PO4, 119. Trace amount of

resazurin (0.175 mg/L) was also added as the redox-status

indicator. The medium pH was adjusted to 7.2 using 3 N KOH

and 3 N HCl. The bottles were capped tightly with rubber

septum stoppers, flushed with oxygen free nitrogen gas, and

then sterilized in an autoclave. The culture was then inocu-

lated into the bottles and was incubated in an orbital shaker

with a rotational rate of 120 rpm and a temperature of

35 � 1 �C. Hydrogen gas production was calculated from

headspace measurements of gas composition using gas

chromatography and the total volume of biogas produced at

each time interval as previously described [33]. Samples were

frequently taken throughout the batch experiments for the

determination of carbohydrate and NH4þ-N.

2.4. DNA extractions and polymerase chainreaction (PCR)

A modification of the sodium dodecyl sulfate-based extraction

method [34] was used to obtain genomic DNA in biomass

samples taken from the two bioreactors. After DNA extrac-

tion, two sets of primers for PCR amplification were employed

in this study. For the 16S rRNA clone library analysis, an

universal primer set including forward a primer 11F (50

GTTTGATCCTGGCTCAG 30) and a reverse primer 1512R (50

TACCTTGTTACGACTT 30) was used for amplifying an

approximate 1500-bp fragment of bacterial 16S rRNA gene [35].

The thermal profile used for the amplification was as follows:

a hotstart at 95 �C for 3 min, 30 cycles of denaturation (45 s at

95 �C), annealing (45 s at 52 �C) and extension (2 min at 72 �C),

and a final extension at 72 �C for 3 min. For the DGGE profile

analysis, PCR amplification was performed using the

primer set of EUB968F with GC clamp (50-CGCCCGGG

GCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAAGA

ACCTTAC-30) [36] and UNIV1392R (50-ACGGGCGGTGTGTAC-30)

[37]. The thermal profile used for the amplification was as

follows: a hotstart at 95 �C for 3 min, 30 cycles of denaturation

(45 s at 95 �C), annealing (45 s at 54 �C) and extension (2 min at

72 �C), and a final extension at 72 �C for 3 min.

2.5. Cloning, sequencing, and phylogenic analysis of 16SrRNA gene

PCR products (1500 bp) of 11F-1512R were purified by electro-

phoresis in a 1.5% (wt/vol) agarose gel, and used in the

construction of the 16S rRNA clone libraries. The purified PCR

products were ligated into the pCR2.1-TOPO vector and the

ligation products were used to transform Escherichia coli DH5a

competent cells following the manufacture’s protocol (Invi-

trogen, Groningen, Netherlands). Plasmids of clones were

extracted and purified using Mini-M plasmid DNA extraction

system (Viogene, Sunnyvale, CA, USA). Restriction fragment

length polymorphism (RFLP) pattern analyses for about

80 randomly selected clones, using the primer set M13F

(50-GTAAAACGACGGCCAG-30) and M13R (50-CAGGAAACAGCT

ATGAC-30) and restriction enzymes Hpa II and Hha I, were

performed to determine the operational taxonomic unit (OTU)

numbers. DNA sequencing reactions were performed for

clones in each OTU using ABI 3100 and 3730 capillary

sequencers (Applied Biosystems, Foster City, CA, USA). BioEdit

was used to align cloned and published sequences in GenBank

using the Basic Local Alignment Search Tool program devel-

oped by U.S. National Center for Biotechnology Information

[38]. The sequences determined in this study have been

deposited in the GenBank database under accession numbers

GQ167169–GQ167197.

2.6. Denaturant gradient gel electrophoresis (DGGE)analysis

DGGE profiles of the PCR-amplified fragments were obtained

using a DCode� Universal Mutation Detection System (Bio-

Rad, Hercules, CA, USA) as described previously [39]. By

applying PCR products to a polyacrylamide gel with gradients

ranging from 35% to 60% (70% denaturant gradient was

defined as a 100 mL of mixture containing 28 mL formamide,

29.4 g urea, 2 mL 50� TAE buffer, and 15 mL 40% acrylamide

stock solution (acrylamide:bisacrylamide, 37.5:1)), electro-

phoresis was performed in 1� TAE buffer at a constant voltage

of 200 V and a temperature of 60 �C for 5 h to separate the PCR

products. After electrophoresis, the gel was incubated for

20 min in deionized water containing silver nitrate (1 g/L),

rinsed for 10 min with deionized water, color-developed for

20 min in solution containing sodium hydroxide (15 g/L),

sodium tetrahydroborate (0.1 g/L), and formaldehyde (4 mL/L),

rinsed for 10 min with deionized water, and then photo-

graphed for further analysis.

3. Results and discussion

3.1. Performance of glucose–peptone and starch–peptonefed bioreactors

The experimental results of substrate and biomass concen-

trations in both glucose–peptone (GP) and starch–peptone (SP)

fed bioreactors operated at different HRT conditions are pre-

sented in Fig. 1. For the GP-fed bioreactor operated at

HRT � 2 h, the average effluent glucose concentration was

measured to be less than 600 mg/L with a more than 95% of

glucose consumption efficiency. At HRT of 1.45 h, the average

glucose concentration was as high as 2700 mg/L with a lower

glucose conversion efficiency of 78%, presumably due to

wash-out of microorganisms from the bioreactor as indicated

by the decreased biomass concentration from 3300 to

2500 mg/L when the HRT was reduced from 2 to 1.45 h. For the

operational conditions of HRT increased from 8 to 18 h, the

average biomass concentration drastically decreased from

0

3000

6000

9000

1.2 104

1.5 104

1.8 104

0

1000

2000

3000

4000

5000

6000

0510152025

Eff

luen

t Sub

stra

te C

once

ntra

tion

(mg/

L)

Biom

ass Concentration (m

g/L)

HRT (h)

BiomassGP

BiomassSP

Starch

Glucose

Fig. 1 – Effluent substrate and biomass concentrations in

glucose–peptone (GP) and starch–peptone (SP) fed

bioreactors operated at different HRT conditions.

0

200

400

600

800

1000

1200

1400

0

0.5

1

1.5

2

2.5

3

0510152025

Hyd

roge

n Pr

oduc

tion

Rat

e (m

mol

-H2/L

/d) H

ygrogen Yield (m

mol-H

2 /mm

ol-Hexose)

HRT (h)

YieldSP

YieldGP

HPRGP

HPRSP

Fig. 2 – Hydrogen production rate and hydrogen yield of

GP- and SP-fed bioreactors observed at different HRT

conditions.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 064

3700 to 1100 mg/L although the consumption of glucose was

more than 95%. In the bioreactor operated at a longer HRT,

endogeneous metabolism or cell lysis could become

substantial, leading to a lower biomass concentration [18].

For the SP-fed bioreactor, starch and biomass concentra-

tions measured at different HRT conditions showed similar

trends to those observed in the GP-fed bioreactor. At HRT of 12

and 24 h, the average starch concentrations were measured to

be less than 1200 mg/L with a more than 90% of starch

consumption efficiency, while decreasing HRT from 12 to 3 h,

the average starch concentration gradually increased to

2500 mg/L. Similar to that observed in the GP-fed bioreactor,

wash-out of microorganisms from the SP-fed bioreactor was

noticeable, as indicated by the decreased biomass concen-

tration from 4500 to 2600 mg/L, when the HRT was reduced

from 9 to 3 h. A complete wash-out was observed in the SP-fed

bioreactor when HRT was continuously reduced to 2 h, cor-

responding to an average starch concentration of 11,724 mg/L.

The hydrogen production rate and hydrogen yield of

both bioreactors observed at different HRT conditions are

presented in Fig. 2. In general, for both bioreactors, hydrogen

production rate increased with decreased HRT, but a sudden

decrease in hydrogen production rate was observed when

wash-out of hydrogen-producing bacteria became serious at

a low HRT condition. The maximum hydrogen production

rates for GP- and SP-fed bioreactors were found to be 1247 and

412 mmol-H2/L/d at HRT of 2 and 3 h, respectively. The

hydrogen yield for both bioreactors observed at different HRT

conditions, as indicated in Fig. 2, seemed to share a similar

trend with observed hydrogen production rate. For the GP-fed

bioreactor, the hydrogen yields were less than 1 mmol-H2/

mmol-Hexose consumed at HRTs of 1.5, 8, 12, and 18 h, but the

yield increased to 1.5 mmol-H2/mmol-Hexose consumed

when HRT was controlled between 2 and 6 h. The hydrogen

yield of the SP-fed bioreactor attained a maximum value of

1 mmol-H2/mmol-Hexose consumed at an HRT of 3 h, but

these values were generally lower than those observed in the

GP-fed bioreactor.

The soluble metabolites produced in both bioreactors at

different HRT conditions are summarized in Table 1. Among

these metabolites, formate, acetate, butyrate, and lactate

were dominant products found in the GP-fed bioreactor, while

in the SP-fed bioreactor, acetate, propionate, butyrate, and

lactate were major metabolites. During anaerobic fermenta-

tion of carbohydrates such as glucose and starch, several

volatile fatty acids (VFAs) and alcohols are produced as major

primary metabolites, depending on microorganisms and

environments present in the bioreactor [4,40,41]. In our study,

neglected amount of alcohols were observed in both bioreac-

tors. According to metabolic pathways and stoichiometric

relationships proposed for anaerobic glucose fermentation,

hydrogen production is accompanied with the production of

acetate and butyrate, but not with production of formate,

propionate, and lactate [43]. Based on available information

for hydrogen production and produced soluble metabolites

obtained in both bioreactors, no apparent correlation was

found between hydrogen production and VFAs produced at

different HRT conditions. In several studies, the ratio of

butyrate to acetate (B/A ratio) has been used as an indicator for

evaluating the effectiveness of biohydrogen production

[7,10,14,19,20,44,45]. In Table 1, a higher B/A ratio seemed to

correspond to a higher observed hydrogen yield, but the

correlation between them, with a correlation coefficient of 0.5,

did not seem to be statistically significant. Unlike many other

studies feeding bioreactors with single organic substrate, in

this study, in addition to glucose or starch, peptone was fed as

an organic nitrogen substrate in order to enhance hydrogen

production from carbohydrate fermentation [25,26]. Anaer-

obic fermentation of peptone through the Stickland reaction

[41] may account for the production of VFAs such as butyrate

and acetate in bioreactors but not necessary for the produc-

tion of hydrogen. By examining the species of Clostridium

sporogenes, Stickland [42] defined amino acids as hydrogen-

accepting amino acids (e.g., proline, hydroxyproline, and gly-

sine) or hydrogen-donating amino acids (e.g., alanine, valine,

and leusine) depending on their oxidation or reduction states.

Although previous studies [25,26] reported that addition of

Table 1 – Summary of produced soluble metabolites and hydrogen yields in both bioreactors at different HRT conditions.

HRT(hr)

Formate(mg/L)

Acetate(mg/L)

Propionate(mg/L)

Butyrate(mg/L)

Lactate(mg/L)

Ammonium(mg N/L)

B/A ratio(mol/mol)

Hydrogen yield(mmol/mmol-

hexoseconsumed)

Glucose–peptone fed bioreactor

18 920 � 501 465 � 217 ND 2030 � 1392 6643 � 3911 – 2.98 0.56

12 355 � 104 3130 � 410 515 � 81 2060 � 561 824 � 449 313 � 28 0.45 0.91

8 918 � 260 3049 � 420 473 � 280 3363 � 357 134 � 146 449 � 59 0.75 0.61

6 1220 � 526 2600 � 896 ND 4000 � 806 1178 � 938 200 � 83 1.05 1.55

4 1081 � 180 2519 � 306 ND 3734 � 95 345 � 73 156 � 20 1.01 1.6

2 1222 � 88 2026 � 136 ND 2989 � 323 1059 � 255 26 � 12 1.01 1.48

1.45 1923 � 88 1847 � 136 ND 1901 � 323 755 � 255 6 0.70 0.79

Starch–peptone fed bioreactor

24 ND. 1655 � 122 1139 � 113 788 � 90 ND 205 � 20 0.32 0

12 ND 1503 � 90 1606 � 50 1203 � 126 ND 197 � 5 0.55 0.13

9 18 � 13 781 � 525 1462 � 783 472 � 208 2987 � 1140 106 � 90 0.41 0.22

6 120 � 24 771 � 54 2069 � 69 1905 � 194 108 � 22 45 � 17 1.68 0.47

3 13 � 4 1088 � 138 163 � 115 2072 � 176 2633 � 310 10 � 10 1.30 1.02

2 ND ND ND ND ND ND – 0

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 0 65

peptone as a nitrogen source would enhance growth of

hydrogen-producing bacteria and hydrogen production, it is

like that at a longer HRT hydrogen-accepting amino acids

present in peptone were utilized, resulting in consumption of

produced hydrogen. Furthermore, depending on microorgan-

isms and environmental conditions, anaerobic fermentation

of carbohydrates may lead to production of acetate and

butyrate without hydrogen production accompanied

[4,40,41,45–47]. Consequently, without knowing microbial

ecology, simple parameters such as the B/A ratio may be

insufficient for properly explaining or predicting hydrogena-

tion performance in bioreactors fed with multiple substrates

like the ones investigated in this study.

3.2. Microbial ecology and DGGE analysis of GP- and SP-fed bioreactors

Cloning and sequencing of 16S rRNA gene fragments were

performed for the biomass samples taken from the GP- and

SP-fed bioreactors at the HRT condition of 12 and 3 h,

respectively, in order to investigate microbial ecology of

hydrogen-producing bacteria in both bioreactors. The clone

sequences obtained in this study were aligned with published

sequences available from the GenBank database. A neighbor-

joining phylogenetic tree, which graphically depicts the

homologies of aligned sequences, is presented in Fig. 3.

According to the results obtained for the GP-fed bioreactor,

among the total 62 clones retrieved, 38 clones (representing

62% of relative abundance) were phylogenetically within the

genus Clostridium, 4 clones (6%) within the genus Dendrospor-

obacter quercicolus (formally Clostridium quercicolum), 2 clones

(3%) within the genus Enterobacter, 1 clone (2%) within the

genus Klebsiella, and the remaining 17 clones (27%) were related

to either unidentified or uncultured bacteria. For sequences

within the genus Clostridium, they were phylogenetically

related to clostridial species including Clostridium celerecrescens

(representing 26% of relative abundance), C. sporogenes (21%),

Clostridium butyricum (5%), Clostridium sartagoforme (2%), Clos-

tridium sulfidogenes (2%), and Clostridium mesophilum (2%).

Among the total 46 clones retrieved from the SP-fed bioreactor,

Lactobacillus plantarum was found to be dominant (representing

52% of relative abundance), followed by Clostridium sp. (9%),

Propionispira arboris (5%), C. butyricum (2%), and Megasphaera

paucivorans (2%), and the remaining 6 clones (14%) were related

to either unidentified or uncultured bacteria.

DGGE profiles of 16S rRNA gene fragments were performed

for thebiomasssamples takenfromboth bioreactorsatdifferent

HRT conditions in order to evaluate the effect of HRT on the

microbial community of hydrogen-producing bacteria in both

bioreactors. The results are presented in Fig. 4. According to the

results, C. sporogenes and C. celerecrescens were dominant and

ubiquitous in the GP-fed bioreactor under different HRT condi-

tions. Clostridial species are known as classical acid producers

and usually ferment glucose to butyrate, acetate, carbon dioxide

and molecular hydrogen [4,40]. Both C. sporogenes and C. cele-

recrescens are capable of producing hydrogen from glucose

fermentation [49]. In addition, C. sporogenes is able to metabolize

various amino acids through the Stickland reaction to either

produce or consume hydrogen, depending on the characteris-

tics of amino acids [41], and C. celerecrescens is able to hydrolyze

certain proteins such as gelatin [49], presumably accounting for

their predominance in the GP-fed bioreactor.

In the SP-fed bioreactor, L. plantarum, P. arboris, and C.

butyricum were found to be dominant populations present at

different HRT conditions examined. L. plantarum is a faculta-

tive heterofermentative lactic acid bacteria [48,50,51] and

studies have shown that isolated amylolytic strains of

L. plantarum are capable of utilizing starch for lactate

production [52–54]. Depending on cultivation conditions,

anaerobic conversion of low-molecular-weight sugars by

L. plantarum can lead to mainly lactate production and some

trace amount of volatile acids such as acetate [50,51], but not

to hydrogen production [48]. It is presumed that their amylo-

lytic characteristic on catalyzing starch hydrolysis allowed

L. plantarum strains to be dominant in the SP-fed bioreactor.

P. arboris, originally isolated from wetwood of living trees, is

able to produce a mixture of propionic and acetic acids from

glucose [55]. In a subsequent study, Thompson et al. [46] found

GP clone 66

Clostridium butyricum (RCEB)

Clostridium butyricum (W4)

SP clone 9-0

Clostridium beijerinck ii (NCIMB9362)

Clostridium acetobutylicum (NCIMB8052)

GP clone 5

Clostridium sartagoformum (DSM 129)

GP clone 63

Clostridium mesophilum (SW408)

GP clone 30

Clostridium sulfidogenes (SGB2)

GP clone 40

GP clone 51

Clostridium botulinum (F)

GP clone 1

Clostridium sporogenes (TrE7262)

Clostridium sp. (Z6)

Clostridium sp. (S6)

SP clone 4

GP clone 46

GP clone 45

GP clone 17

Clostridium celerecrescens (DSM 5628)

GP clone 50

GP clone 55

Clostridium quercicolum (DSM 1736)

Propionispira arboris (DSM 2179)

SP clone 2

SP clone 7

SP clone 5

SP clone 8

Megasphaera paucivorans (VTT E-032341)

Megasphaera sueciensis (VTT E-97791)

SP clone 1-2

SP clone 1-1

SP clone 1-3

SP clone 1-4

SP clone 1-5

Lactobacillus pentosus (NRIC 1836)

Lactobacillus plantarum (Ru2-1i)

SP clone 3

Lactobacillus plantarum (NRIC 0383)

Lactobacillus plantarum (L3)

Lactobacillus plantarum (L5)

GP clone 23

Uncultured Firmicutes bacterium (clone A

SP clone 6

Uncultured bacterium (clone SJTU G 0496)

GP clone 22

Klebsiella pneumoniae (HR16)

GP clone 79

Enterobacter cloacae subsp.

Escherichia coli (K12)

0.02

Fig. 3 – The neighbor-joining tree showing the phylogenetic relationship between representative 16S rRNA gene sequences

retrieved in this study and known species available from the GenBank database. Clone sequences retrieved from the

glucose–peptone and starch–peptone fed bioreactors are labeled as GP and SP, respectively. The scale bar represents 0.02

estimated change per nucleotide. Numbers at the nodes are the bootstrap values based on 100 trials.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 066

that the fermentation end products were regulated by the

presence of hydrogen gas, which was consumed via hydroge-

nase, resulting in a dramatic increase in the propionate to

acetate ratio. It is not clear, at this time, the reason for the

dominance ofP.arboris in theSP-fed bioreactor,but it isassumed

that its presence was not related to hydrogen production [55]. As

a result, C. butyricum, also capable of fermenting starch, was

considered to contribute to hydrogen production in the SP-fed

bioreactor, as suggested in previous studies using starch as

hydrogen fermentation substrate [29,56].

3.3. Effects of HRT on hydrogenation performance of GP-and SP-fed bioreactors

In both bioreactors, decreasing HRT, in general, increased

hydrogen production rate and hydrogen yield, until the

minimum HRT was reached, resulting in wash-out of

hydrogen-producing bacteria. At a longer HRT operation,

a lower hydrogen production rate is expected due to a lower

organic loading applied to the bioreactor. Unexpected low

hydrogen yields observed at HRT > 8 h, however, suggest that

other mechanisms, in addition to a lower applied organic

loading, may present in the GP- and SP-fed bioreactors,

leading to a low hydrogen production. In addition to glucose or

starch, peptone was fed as an organic nitrogen substrate in

order to enhance hydrogen production from carbohydrate

fermentation. Ammonium nitrogen, in addition to VFAs and

alcohols, can be produced from anaerobic fermentation of

peptone through the Stickland reaction [41]. This observed

ammonium release might account for consumption of elec-

tron donors such as NADH [4,41] and thus reduced hydrogen

production [18].

Fig. 4 – DGGE profiles of 16S rRNA gene fragments for the biomass samples taken from (A) GP- and (B) SP-fed bioreactors at

different HRT conditions. M: marker.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 0 67

For the operational conditions at HRT < 4 and 9 h for GP-

and SP-fed bioreactors, respectively, peptone was utilized

mainly for biomass synthesis since only less than 3% of total

nitrogen applied was released as ammonium nitrogen from

peptone fermentation. When HRT increased, released

ammonium percentage started to increase to more than 10%

as presented in Table 1, indicating that peptone fermentation

through Stickland reaction may occur [41]. This phenomenon

was even more significant in the GP-fed bioreactor, with

a released ammonium percentage of 35% at an HRT of 12 h,

presumably due to the dominance of protein-hydrolyzing C.

sporogenes and C. celerecrescens. Our observations agreed well

with those reported by Allison and MacFarlane [57], who grew

C. sporogenes in a CSTR fed with glucose and peptone and

0

5

10

15

0

10

20

30

40

50

60

0 20 40 60 80 100 120

Cum

mul

ativ

e H

2 Pro

duct

ion

(mL

)

Am

monium

(mg-N

/L)

Time (hr)

H2 (Starch)

H2 (Starch+Peptone)

Ammonium (Starch+Peptone)

Ammonium (Starch)

Fig. 5 – Cumulative hydrogen production and ammonium

concentration of BHP batch tests using biomass taken from

the SP-fed bioreactor operated at an HRT of 12 h. Symbol:

3000 mg/L of starch and 2000 mg/L of peptone, - (H2

production), , (ammonium); 3000 mg/L of starch, C (H2

production), B (ammonium).

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 068

observed decreased effluent ammonium concentration from

126 to 56 mg N/L due to reduced deamination activity as HRT

decreased from 17 to 1.5 h.

Fig. 5 presents the results of hydrogen production during

BHP batch experiments using biomass taken from the SP-fed

bioreactor operated at an HRT of 12 h. Although limited

hydrogen production was detected in the SP-fed bioreactor at

an HRT of 12 h, considerable amount of hydrogen production

was observed in the batches fed with starch and starch/

peptone, indicating that the biomass acclimated in the SP-fed

bioreactor at an HRT of 12 h was able to produce hydrogen

from starch. In comparison of hydrogen production from the

two substrates examined, it was confirmed that the evolved

hydrogen during carbohydrate fermentation could be

consumed at a longer retention time, with a faster

consumption rate when peptone was present.

For the SP-fed bioreactor operated at HRT > 6 h, unex-

pected low hydrogen yield was even more obvious, presum-

ably due to its massive production of propionate. Low

hydrogen production has been related to high propionate

production in bioreactors fed with glucose [58,59] and starch

[19]. Based on the experimental results published by Zoete-

meyer et al. [58], Vavilin et al. [60] proposed a model assuming

that propionic bacteria present in the bioreactor can compete

with butyric bacteria for glucose and consume hydrogen for

production of propionate, acetate, and lactate. Their results

suggested that propionate production by propionic bacteria

can be significant at a longer HRT operation, which agreed

well with our observations of substantial propionate produc-

tion and P. arboris in the SP-fed bioreactor at HRT > 6 h. In

addition, previous studies [46,61] indicated that P. arboris, with

reversible hydrogenase activity, could consume glucose and

hydrogen for propionate and acetate production, suggesting

that its relative dominance might account for substantial

propionate production and unexpected low hydrogen yield

observed in the SP-fed bioreactor.

3.4. Significance for engineering application

Conventional anaerobic fermentation processes are not able

to accumulate a net production of hydrogen gas because

hydrogen is rapidly consumed by methane-producing micro-

organisms for methane formation in the processes [62].

During this study, methane gas was not detected in both

bioreactors, presumably because the relatively low HRT

conditions operated were able to eliminate the growth of

hydrogen-utilizing methane-producing microorganisms, with

maximum specific growth rates ranged from 0.058 to 0.108 h

[63,64]. For hydrogen-producing clostridial species including

C. sporogenes, C. celerecrescens, and C. butyricum enriched in this

study, specific growth rates between 0.12 and 0.7 h have been

reported [7,8,57,65,66]. These values, however, were compa-

rable to specific growth rates reported for P. arboris (0.18 h, [46])

and L. plantarum (0.43 h, [52]), allowing their coexistence in the

SP-fed bioreactor. Only at HRT < 3 h, the negative impact on

hydrogenation performance caused by to P. arboris in the SP-

fed bioreactor started to decrease, while starch-hydrolyzing

L. plantarum and hydrogen-producing C. butyricum were still

active until wash-out of these microorganisms became

serious at an HRT of 2 h. Furthermore, potential hydrogen

consumption due to peptone fermentation by protein-hydro-

lyzing microorganisms was identified in this study, but this

occurrence could be minimized by reducing HRT. As a result,

optimizing HRT operation for bioreactors was considered an

important asset in order to minimize hydrogen-consuming

activities and thus maximize net hydrogen production. In this

study, the limitation of simple parameters such as the B/A

ratio in predicting hydrogen production was recognized for

bioreactors fed with multiple substrates. Fortunately, under-

standing of microbial ecology can be a beneficial measure in

order to correctly evaluate hydrogenation performance in

bioreactors. Therefore, it is suggested that microbial ecology

analysis, in addition to chemical analysis, should be per-

formed when complex substrates and mixed cultures are used

in hydrogen-producing bioreactors.

4. Conclusions

This study evaluated anaerobic hydrogenation performance

and microbial ecology in bioreactors operated under HRT

between 1.5 and 24 h and fed with glucose–peptone and

starch–peptone. At a relative long HRT operation, hydrogen

consumption due to peptone fermentation could occur and

thus reduced hydrogen yield from carbohydrate fermentation.

C. sporogenes and C. celerecrescens were dominant hydrogen-

producing bacteria in the GP-fed bioreactor, presumably due

to their capability on protein hydrolysis. In the SP-fed biore-

actor, L. plantarum, P. arboris, and C. butyricum were found to be

dominant populations, but the presence of P. arboris at

HRT > 3 h might be responsible for a lower hydrogen yield

from starch fermentation. The limitation of simple parame-

ters such as the B/A ratio in predicting hydrogen production

was recognized in this study for bioreactors fed with multiple

substrates. It is suggested that microbial ecology analysis, in

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 0 69

addition to chemical analysis, should be performed when

complex substrates and mixed cultures are used in hydrogen-

producing bioreactors.

Acknowledgements

The authors would like to acknowledge the financial support

from National Science Council of Taiwan under Grant NSC91-

2211-E-006-060, NSC92-2211-E-006-053, NSC96-2218-E-006-

295, and NSC97-2218-E-006-005.

r e f e r e n c e s

[1] Li CL, Fang HHP. Fermentative hydrogen production fromwastewater and solid wastes by mixed cultures. Crit RevEnviron Sci Technol 2007;37(1):1–39.

[2] Das DT, Veziroglu TN. Hydrogen production by biologicalprocesses: a survey of literature. Int J Hydrogen Energy 2001;26(1):13–28.

[3] Hawkes FR, Dinsdale R, Hawkes DL, Hussy I. Sustainablefermentative hydrogen production: challenges for processoptimization. Int J Hydrogen Energy 2002;27(11–12):1339–47.

[4] Gottschalk G. Bacterial metabolism. 2nd ed. NewYork:Springer-Verlag; 1986.

[5] Kataoka N, Miya A, Kiriyama K. Studies on hydrogenproduction by continuous culture system of hydrogenproducing anaerobic bacteria. Water Sci Technol1997;36(6–7):41–7.

[6] Oh SE, Lyer P, Bruns MA, Logan BE. Biological hydrogenproduction using a membrane bioreactor. Biotechnol Bioeng2004;87(1):119–27.

[7] Chen WM, Tseng ZJ, Lee KS, Chang JS. Fermentativehydrogen production with Clostridium butyricum CGS5isolated from anaerobic sewage sludge. Int J HydrogenEnergy 2005;30(10):1063–70.

[8] Lin PY, Whang LM, Wu YR, Ren WJ, Hsiao CJ, Li SL, et al.Biological hydrogen production of the genus Clostridium:metabolic study and mathematical model simulation. Int JHydrogen Energy 2007;32(12):1728–35.

[9] Lee HS, Salerno MB, Rittmann BE. Thermodynamicevaluation on H2 production in glucose fermentation.Environ Sci Technol 2008;42(7):2401–7.

[10] Lee HS, Rittmann BE. Evaluation of metabolism usingstoichiometry in fermentative biohydrogen. BiotechnolBioeng 2009;102(3):749–58.

[11] Fang HHP, Liu H. Effect of pH on hydrogen production fromglucose by a mixed culture. Bioresour Technol 2002;82(1):87–93.

[12] Khanal SK, Chen WH, Li L, Sung S. Biological hydrogenproduction: effects of pH and intermediate products. Int JHydrogen Energy 2004;29(11):1123–31.

[13] Zhu Y, Yang ST. Effect of pH on metabolic pathway shift infermentation of xylose by Clostridium tyrobutyricum.J Biotechnol 2004;110(2):143–57.

[14] Van Ginkel S, Logan BE. Inhibition of biohydrogen productionby undissociated acetic and butyric acids. Environ SciTechnol 2005;39(23):9351–6.

[15] Kim DH, Han SK, Kim SH, Shin HS. Effect of gas sparging oncontinuous fermentative hydrogen production. Int JHydrogen Energy 2006;31(15):2158–69.

[16] Fang HHP, Yu HQ. Effect of HRT on mesophilic acidogenesisof dairy wastewater. J Environ Eng-ASCE 2000;126(12):1145–8.

[17] Chen CC,LinCY, ChangJS.Kinetics ofhydrogenproductionwithcontinuous anaerobic cultures utilizing sucrose as the limitingsubstrate. Appl Microbiol Biotechnol 2001;57(1–2):56–64.

[18] Whang LM, Hsiao CJ, Cheng SS. A dual-substrate steady-statemodel for biological hydrogen production in an anaerobichydrogen fermentation process. Biotechnol Bioeng 2006;95(3):492–500.

[19] Arooj MF, Han SK, Kim SH, Kim DH. Continuous biohydrogenproduction in a CSTR using starch as a substrate. Int JHydrogen Energy 2008;33(13):3289–94.

[20] Kim SH, Han SK, Shin HS. Effect of substrate concentrationon hydrogen production and 16S-rDNA-based analysis of themicrobial community in a continuous fermenter. ProcessBiochem 2006;41(1):199–207.

[21] Cha GC,NoikeT.Effectof rapid temperaturechangeand HRT onanaerobic acidogenesis. Water Sci Technol 1997;36(6–7):247–53.

[22] Duangmanee T, Padmasiri SI, Simmons JJ, Raskin L, Sung S.Hydrogen production by anaerobic microbial communitiesexposed to repeated heat treatments. Water Environ Res2007;79(9):975–83.

[23] Lay JJ, Lee YJ, Noike T. Feasibility of biological hydrogenproduction from organic fraction of municipal solid waste.Water Res 1999;33(11):2579–86.

[24] Nandi R, Sengupta S. Microbial production of hydrogen: anoverview. Crit Rev Microbiol 1998;24(1):61–84.

[25] Ueno Y, Haruta S, Ishii M, Igarashi Y. Microbial community inanaerobic hydrogen-producing microflora enriched fromsludge compost. Appl Microbiol Biotechnol 2001;57(4):555–62.

[26] Yokoi H, Ohkawara T, Hirose J, Hayashi S, Takasaki Y.Characteristics of hydrogen production by aciduric Enterobacteraerogenes strain HO-39. J Fermen Bioeng 1995;80(6):571–4.

[27] Hung CH, Lee KS, Cheng LH, Huang YH, Lin PJ, Chang JS.Quantitative analysis of a high-rate hydrogen-producingmicrobial community in anaerobic agitated granular sludgebed bioreactors using glucose as substrate. Appl MicrobiolBiotechnol 2007;75(3):693–701.

[28] Lo YC, Chen WM, Hung CH, Chen SD, Chang JS. Dark H2

fermentation from sucrose and xylose using H2-producingindigenous bacteria: feasibility and kinetic studies. WaterRes 2008;42(4–5):827–42.

[29] Lin CY, Chang CC, Hung CH. Fermentative hydrogenproduction from starch using natural mixed cultures. Int JHydrogen Energy 2008;33(10):2445–53.

[30] Owen WF, Stuckey DC, Herly JB, Young LY, McCarty PL.Bioassay for monitoring biochemical methane potential andanaerobic toxicity. Water Res 1979;13(6):485–92.

[31] Herbert D, Philipps PJ, Strange RE. Carbohydrate analysis.Methods Enzymol 1971;5B:265–77.

[32] Apha Awwa Wef. Standard methods for the examination ofwater and wastewater. 19th ed. Washington, DC, USA:American Public Health Association; 1995.

[33] Van Ginkel SW, Oh SE, Logan BE. Biohydrogen gas productionfrom food processing and domestic wastewaters. Int JHydrogen Energy 2005;30(15):1535–42.

[34] Li SL, Kuo SC, Lin JS, Lee ZK, Wang YH, Cheng SS. Processperformance evaluation of intermittent-continuous stirredreactor tank for anaerobic hydrogen fermentation withkitchen waste. Int J Hydrogen Energy 2008;33(5):1522–31.

[35] Kane MD, Poulsen LK, Stahl DA. Monitoring the enrichmentand isolation of sulfate-reducing bacteria by usingoligonucleotide hybridization probes designed fromenvironmentally derived 16S rRNA sequences. Appl EnvironMicrobiol 1993;59(3):682–6.

[36] Heuer H, Krsek M, Baker P, Smalla K, Wellington EMH.Analysis of actinomycete communities by specificamplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. ApplEnviron Microbiol 1997;63(8):3233–41.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 5 ( 2 0 1 0 ) 6 1 – 7 070

[37] Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E,Goodfellow M, editors. Nucleic acid techniques in bacterialsystematic. New York: John Wiley and Sons; 1991. p. 115–75.

[38] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basiclocal alignment search tool. J Mol Biol 1990;215(3):403–10.

[39] Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complexmicrobial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol1993;59(3):695–700.

[40] Andreesen JR, Bahl H, Gottschalk G. Introduction to thephysiology and biochemistry of the genus Clostridium. In:Minton NP, Clarke DJ, editors. Biotechnology handbooks:clostridia. New York: Plenum Press; 1989.

[41] McInerney MJ. Anaerobic hydrolysis and fermentation of fatsand proteins. In: Zehnder AJB, editor. Biology of anaerobicmicroorganisms. New York: John Wiley and Sons; 1988.

[42] Stickland LH. Studies in the metabolism of the strictanaerobes (genus Clostridium). I. The chemical reactions bywhich Cl. sporogenes obtains its energy. Biochem J 1934;28:1746–59.

[43] Ljungdahl LG, Hugenholtz J, Wiegel J. Acetogenic and acid-producing bacteria. In: Minton NP, Clarke DJ, editors.Biotechnology handbooks: clostridia. , New York: PlenumPress; 1989.

[44] Ueno Y, Kawai T, Sato S, Otsuka S, Morimoto M. Biologicalproduction of hydrogen from cellulose by natural anaerobicmicroflora. J Fermen Bioeng 1995;79(4):395–7.

[45] Zhang ZP, Show KY, Tay JH, Liang DT, Lee DJ, Jiang WJ. Effectof hydraulic retention time on biohydrogen production andanaerobic microbial community. Process Biochem 2006;41(10):2118–23.

[46] Thompson TE, Conrad R, Zeikus JG. Regulation of carbon andelectron flow in Propionispira arboris: physiological function ofhydrogenase and its role in homopropionate formation.FEMS Microbiol Lett 1984;22(3):265–71.

[47] Batstone DJ, Keller J, Angelidaki I, Kalyuzhnyi SV,Pavlostathis SG, Rozzi A, et al. Anaerobic digestion model No.1. IWA Scientific and Technical Report, No. 13, London; 2002.

[48] Plumed-Ferrer C, Koistinen KM, Tolonen TL, Lehesranta SJ,Karenlampi SO, Makimattila E, et al. Comparative study ofsugar fermentation and protein expression patterns of twoLactobacillus plantarum strains grown in three differentmedia. Appl Environ Microbiol 2008;74(17):5349–58.

[49] Hippe H, Andreesen JR, Gottschalk G. The genera Clostridium.In: Albert B, Hans GT, Martin D, Wim H, Karl-Heinz K,editors. The prokaryotes, vol. II. New York: Springer-Verlag;1991. p. 1800–978.

[50] Murphy MG, Condon S. Correlation of oxygen utilization andhydrogen peroxide accumulation with oxygen inducedenzymes in Lactobacillus plantarum cultures. Arch Microbiol1984;138(1):44–8.

[51] Tseng CP, Montville TJ. Enzymatic regulation of glucosecatabolism by Lactobacillus plantarum in response to pH shiftsin a chemostat. Appl Microbiol Biotechnol 1992;36(6):777–81.

[52] Giraud E, Brauman A, Keleke S, Lelong B, Raimbault M.Isolation and physiological study of an amylolytic strain ofLactobacillus plantarum. Appl Microbiol Biotechnol 1991;36(3):379–83.

[53] Giraud E, Champailler A, Raimbault M. Degradation of rawstarch by a wild amylolytic strain of Lactobacillus plantarum.Appl Environ Microbiol 1994;60(12):4319–23.

[54] Thomsen MH, Guyot JP, Kiel P. Batch fermentations onsynthetic mixed sugar and starch medium with amylolyticlactic acid bacteria. Appl Microbiol Biotechnol 2007;74(3):540–6.

[55] Schink B, Thompson TE, Zeikus JG. Characterization ofPropionispira arboris gen. nov. sp. nov., a nitrogen-fixinganaerobe common to wetwoods of living trees. J GenMicrobiol 1982;128(11):2771–9.

[56] Chen SD, Lee KS, Lo YC, Chen WM, Wu JF, Lin CY, et al. Batchand continuous biohydrogen production from starchhydrolysate by Clostridium species. Int J Hydrogen Energy2008;33(7):1803–12.

[57] Allison C, Macfarlane GT. Regulation of protease productionin Clostridium sporogenes. Appl Environ Microbiol 1990;56(11):3485–90.

[58] Zoetemeyer RJ, Van Den Heuvel JC, Cohen A. pH influence onacidogenic dissimilation of glucose in an anaerobic digestor.Water Res 1982;16(3):303–11.

[59] Cohen A, Distel B, van Deursen A, Breure AM, van Andel JG.Role of anaerobic spore-forming bacteria in the acidogenesisof glucose: changes induced by discontinuous or low-ratefeed supply. Anton Van Leeuw 1985;51(2):179–92.

[60] Vavilin VA, Rytow SV, Lokshina LY. Modeling hydrogenpartial pressure change as a result of competition betweenthe butyric and propionic groups of acidogenic bacteria.Bioresour Technol 1995;54(2):171–7.

[61] Thompson T, Zeikus JG. Regulation of carbon and electronflow in Propionispira arboris: relationship of catabolic enzymelevels to carbon substrates fermented during propionateformation via the methylmalonyl coenzyme A pathway.J Bacteriol 1988;170(9):3996–4000.

[62] Madigan MT, Martinko JM, Parker J. Biology ofmicroorganisms. 10th ed. Upper Saddle River, NJ, USA:Prentice-Hall, Inc; 2003.

[63] Gujer W, Zehnder AJB. Conversion processes in anaerobic-digestion. Water Sci Technol 1983;15(8–9):127–67.

[64] Romli M, Keller J, Lee PJ, Greenfield PF. Model prediction andverification of a 2-stage high-rate anaerobic waste-watertreatment system subjected to shock loads. Process SafEnviron Protect 1995;73(B2):151–4.

[65] Flythe MD, Russell JB. The effect of pH and a bacteriocin(bovicin HC5) on Clostridium sporogenes MD1, a bacterium thathas the ability to degrade amino acids in ensiled plantmaterials. FEMS Microbiol Ecol 2004;47(2):215–22.

[66] Palop ML, Valles S, Pinaga F, Flors A. Isolation andcharacterization of an anaerobic, cellulolytic bacterium,Clostridium celerecrecens sp. nov. Int J Syst Bacteriol 1989;39(1):68–71.