Download - GGG G GGG A GGG A GG G T G GGG TT A Program and GGG G G ...g4meeting2013.com/G4_Conference_Program.pdf · GGG A GGG A GGG TT TT A GGG A GGG A GGG A GGG TT TT A GGG A GGG A GGG A GG

G G T TA

G G T TA G G G T TA G

G G G T TA G G G T TA G G G T TA G G G

G G G T TA G G G T TA G G G T TA G G G T TA G G G T

A G G G T TA G G G T TA G G G T TA G G G T TA G G G T TA G

A G G G T TA G G G T TA G G G T TA G G G T TA G G G T TA



TA G G G T TA G G G T TA G G G T TA G G G T TA G G G T TA

TA G G G T TA G G G T TA G G G T TA G G G T T

TA G G G T TA G G G T TA G G G T TA G G G T T

T TA G G G T TA G G G T TA G G G T TA G G G T T

T TA G G G T TA G G G T TA G G G T TA G G G T T

T TA G G G T TA G G G T TA G G G T TA G G G T

A G G G T TA G G G T TA G G G T TA G G G

A G G G T TA G G G T TA G G G

A G G G T TA G G G

G G T T

Program andBook of Abstracts

July 1 - 4, 2013 Singapore

4th International Meeting on G-quadruplex Nucleic Acids

Nanyang Executive Center

Nanyang Technological University, Singapore

July 1 - 4, 2013

The organizers of the meeting gratefully acknowledge the support

of the following organizations and companies


Organizers

Anh Tuân Phan Nanyang Technological University, Singapore

Marie-Paule Teulade-FichouInstitut Curie, France

Conference Support Team

Anjali SengarBrahim Heddi

Christopher LechKah Wai Lim

Michael AdrianNguyen Thuan DaoRanjani NarayananThanh Dung DangVee Vee Cheong

Vineeth MukundanWan Jun ChungXiangjun Zeng

Zhe Li


Program at a Glance1 July 2013, Monday

11.30-13.45 Registration and Welcome13.45-16.00 Keynote lecture 1: N.Maizels (University of Washington)

Z.Tan (Chinese Academy of Sciences); S.Chowdhury (Institute of Genomics and Integrative Biology, India); S.Richter (University of Padua); V.Kuznetsov (Bioinformatics Institute, Singapore)

16.00-16.30 Coffee/Tea break16.30-18.30 J.Plavec (National Institute of Chemistry, Slovenia); H.Sugiyama (Kyoto University);

A.Randazzo (University of Naples Federico II); K.W.Lim (Nanyang Technological University); G.Parkinson (University College London)

19.00-21.00 Dinner + Poster Session 12 July 2013, Tuesday

8.45-11.00 J.L.Mergny (Institut Européen de Chimie et Biologie); H.Mao (Kent State University); I.Prislan (University of Ljubljana); D.Porath (Hebrew University of Jerusalem); M.Uttamchandani (National University of Singapore)

11.00-12.30 Coffee/Tea break + Poster Session 212.30-14.00 Lunch + Poster Session 314.00-16.00 K.Nagasawa (Tokyo University of Agriculture & Technology); D.L.Ma (Hong Kong

Baptist University); X.Qu (Chinese Academy of Sciences); H.Zeng (National University of Singapore); M.Freccero (Università di Pavia)

16.00-16.30 Coffee/Tea break16.30-18.15 A.Nicolas (Institut Curie); T.Bryan (University of Sydney); H.O.Sintim (University of

Maryland); J.P.Perreault (Universite de Sherbrooke); W.Koole (Leiden University Medical Center)

18.30-20.00 Light Dinner + Poster Session 43 July 2013, Wednesday

8.45-10.30 Keynote lecture 2: S.Balasubramanian (University of Cambridge)J.Hartig (University of Konstanz); L.B.McGown (Rensselaer Polytechnic Institute); L.E.Xodo (University of Udine)

10.30-11.00 Coffee/Tea break11.00-12:30 D.Sen (Simon Fraser University); V.Gabelica (Institut Européen de Chimie et Biologie);

P.Mojzeš (Charles University in Prague); D.Verga (University of Konstanz)12.30-14.00 Lunch + Poster Session 514.00-18.30 Free Afternoon – Guided Tour19.00-22.00 Banquet

4 July 2013, Thursday8.45-10.30 Keynote lecture 3: Laurence H. Hurley (University of Arizona)

D.Yang (University of Arizona); V.Kuryavyi (Sloan-Kettering Institute for Cancer Research); B.Heddi (Nanyang Technological University)

10.30-11.00 Coffee/Tea break11.00-12.30 J.F.Riou (Muséum National d’Histoire Naturelle); H.J.Lipps (University of Witten/

Herdecke); D.Rhodes (Nanyang Technological University)12.30-14.00 Lunch14.00-15.30 T.C.Chang (Academia Sinica); D.Miyoshi (Konan University)

Keynote lecture 4: S.Neidle (University College London)15.30-15.45 Closing


Program Schedule


1 July 2013, Monday

11.30-13.30 Registration

13.30-13.45 Welcome

Session Chair: Alain Nicolas

13.45-14.30 Keynote lecture 1 - Nancy Maizels (University of Washington, USA)The G4 genome

14.30-15.00 Zheng Tan (Chinese Academy of Sciences, China)Co-transcriptional formation of DNA:RNA hybrid G-quadruplex: Evolutional selection, mechanism of formation, and regulation on transcription

15.00-15.30 Shantanu Chowdhury (Institute of Genomics and Integrative Biology, India)Guanine-quadruplex-mediated gene regulation controls metastases in lung cancer cells

15.30-15.45 Sara N. Richter (University of Padua, Italy)A dynamic G-quadruplex region regulates the HIV-1 long terminal repeat promoter

15.45-16.00 Vladimir Kuznetsov (Bioinformatics Institute, Singapore)The genome wide cartography of the evolutionarily conserved R-loop formation sequences (RLFS) reveals thousands prevalence sites of G-quadruplexes (G4s), and G4-Rloop structures involving in transcriptional regulation

16.00-16.30 Coffee break

Session Chair: Vitaly V Kuryavyi

16.30-17.00 Janez Plavec (National Institute of Chemistry, Slovenia)NMR structures of G-quadruplexes with unique features

17.00-17.30 Hiroshi Sugiyama (Kyoto University, Japan)Direct observation of the G-hairpin and G-triplex intermediates

17.30-18.00 Antonio Randazzo (University of Naples Federico II, Italy)Targeting G-quadruplexes, knowing G-triplex

18.00-18.15 Kah Wai Lim (Nanyang Technological University, Singapore)Structural basis of DNA quadruplex-duplex junction formation

18.15-18.30 Gary Parkinson (University College London, UK)Structural investigation into human telomeric quadruplex/duplex interfaces

19.00-21.00 Dinner and Poster Session 1

2 July 2013, Tuesday

Session Chair: Laurent Lacroix

8.45-9.15 Jean-Louis Mergny (Institut Européen de Chimie et Biologie, France)Quadruplexes are everywhere!

9.15-9.45 Hanbin Mao (Kent State University, USA)Population dynamics in human telomeric RNA sequence is modulated by G-quadruplex binding


9.45-10.00 Iztok Prislan (University of Ljubljana, Slovenia)Kinetics of G-quadruplexes in all its terrible beauty

10.00-10.15 Danny Porath (Hebrew University of Jerusalem, Israel)Charge transport in single DNA-based molecules

10.15-10.30 Mahesh Uttamchandani (National University of Singapore)Visual DNA detection using asymmetric PCR and G-Quadruplexes: An integrated workfl ow

10.30-12.30 Coffee Break and Poster Session 2

12.30-14.00 Lunch and Poster Session 3

Session Chair: Marie-Paule Teulade-Fichou

14.00-14.30 Kazuo Nagasawa (Tokyo University of Agriculture & Technology, Japan)G-quadruplex ligands with macrocyclic

14.30-15.00 Dik-Lung Ma (Hong Kong Baptist University)Luminescent G-quadruplex-based probes

15.00-15.30 Xiaogang Qu (Chinese Academy of Sciences, China)New insights into ligand-telomeric DNA interactions and their applications

15.30-15.45 Huaqiang Zeng (National University of Singapore)Cationic macrocyclic aromatic pentamers as a new class of highly specifi c telomere RNA G-quadruplex-binding ligands

15.45-16.00 Mauro Freccero (Università di Pavia, Italy)Covalent targeting of G-quadruplex structures by naphthalene diimide conjugated electrophiles


Session Chair: Nancy Maizels

16.30-17.00 Alain Nicolas (Institut Curie, France)Biological role of G-quadruplexes in replication and genome instability

17.00-17.30 Tracy Bryan (University of Sydney, Australia)Functions of telomeric G-quadruplexes in ciliates and humans

17.30-17.45 Herman O. Sintim (University of Maryland, USA)The biological implications of G-quadruplex formation by cyclic dinucleotide, c-di-GMP, at low micromolar concentrations

17.45-18.00 Jean-Pierre Perreault (Universite de Sherbrooke, Canada)Sequence specifi c modulation of G-quadruplex folding

18.00-18.15 Wouter Koole (Leiden University Medical Center, The Netherlands)An alternative end-joining pathway prevents genomic instability at G4 DNA sites

18.30-20.00 Light Dinner and Poster Session 4


3 July 2013, Wednesday

Session Chair: Daniela Rhodes

8.45-9.30 Keynote lecture 2 - Shankar Balasubramanian (University of Cambridge, UK)Studying G-quadruplex formation in the genome

9.30-10.00 Jörg Hartig (University of Konstanz, Germany)Properties and potential functions of bacterial quadruplex sequences

10.00-10.15 Linda B. McGown (Rensselaer Polytechnic Institute, USA)Capture and identifi cation of genomic G4 DNA binding proteins

10.15-10.30 Luigi E. Xodo (University of Udine, Italy)Design of new strategies involving nucleic acid quadruplexes to inhibit the KRAS oncogene in cancer cells


Session Chair: Antonio Randazzo

11.00-11.30 Dipankar Sen (Simon Fraser University, Canada)Catalytic and switching properties of DNA G-quadruplexes

11.30-12.00 Valérie Gabelica (Institut Européen de Chimie et Biologie, France)Interplay between cation and ligand binding to G-Quadruplexes: Insight from mass spectrometry

12.00-12.15 Peter Mojzeš (Charles University, Czech Republic)Raman spectroscopic studies of G-quadruplexes at high DNA concentration

12.15-12.30 Daniela Verga (University of Konstanz, Germany)Photocrosslinking quadruplex DNA

12.30-14.00 Lunch and Poster Session 5

14.00-18.30 Free Afternoon – Guided Tour

19.00-22.00 Banquet

4 July 2013, Thursday

Session Chair: Gary Parkinson

8.45-9.30 Keynote lecture 3 - Laurence H. Hurley (University of Arizona, USA)The BCL-2 promoter DNA i-motif exists in a dynamic state that allows for transcriptional regulation and drug targeting to produce chemosensitization

9.30-10.00 Danzhou Yang (University of Arizona, USA)Promoter DNA G-quadruplexes and their interactions with small molecules

10.00-10.15 Vitaly V Kuryavyi (Sloan-Kettering Institute for Cancer Research, USA)Parallel-stranded quadruplex structures of recombination hotspots from human and prokaryotic genomes

10.15-10.30 Brahim Heddi (Nanyang Technological University, Singapore)Insights into molecular recognition of G-quadruplexes



Session Chair: Jean-Louis Mergny

11.00-11.30 Jean-François Riou (Muséum National d’Histoire Naturelle, France)Replication: RPA to unfold G4 and G4 to direct origins

11.30-12.00 Hans J. Lipps (University Witten/Herdecke, Germany)The use of ciliated protozoa to study the regulation of G-quadruplex structures in vivo

12.00-12.30 Daniela Rhodes (Nanyang Technological University, Singapore)Structure of active dimeric human telomerase

12.30-14.00 Lunch

Session Chair: Anh Tuan Phan

14.00-14.30 Ta-Chau Chang (Academia Sinica, Taiwan)Structural conversion of G-quadruplex, in solution and in cell

14.30-14.45 Daisuke Miyoshi (Konan University, Japan)Molecular crowding effects on functions of G-quadruplex ligands

14.45-15.30 Keynote lecture 4 - Stephen Neidle (University College London, UK)Quadruplex nucleic acids as targets for anticancer drug design

15.30-15.45 Closing


Oral Presentations


The G4 Genome

Nancy MaizelsUniversity of Washington, Seattle, USA

[email protected]

Some G4 motifs and their corresponding quadruplexes function in essential processes, including initiation of DNA replication, telomere maintenance, regulated recombination, control of gene expression, and genetic and epigenetic instability. We have proposed that those G4 motifs comprise the G4 genome, analogous to the transcriptome, proteome or metabolome. In this view, genomic DNA is not only a simple alphabet but also a more complex geography. We are working to defi ne the G4 genome, by determining which of the many G4 motifs are active participants in genomic biology, and by identifying the features that enable specifi c quadruplexes to be recognized by specifi c factors.

Nancy Maizels is a Professor of Immunology and Biochemistry at the University of Washington. She became fascinated by genomic structure as an undergraduate at the University of California at Berkeley. She received her Ph.D. in Biophysics from Harvard University, where she was a Junior Fellow of the Society of Fellows. She taught at Yale University, where she was a Professor of Molecular Biophysics & Biochemistry and of Genetics, and in 2000 she moved to the University of Washington in Seattle, her home town. Her laboratory studies genomic structure and dynamic structures in the genome.

Oral Presentation 1


Co-transcriptional Formation of DNA:RNA Hybrid G-Quadruplex: EvolutionalSelection, Mechanism of Formation, and Regulation on Transcription

Ke-wei Zheng, Jia-yu Zhang, Shan Xiao, Yu-hua Hao, Zheng TanInstitute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China

[email protected]

Putative G-quadruplex-forming sequences (PQS) are abundant in the genomes of a variety of organisms. Previous studies almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more tandem G-tracts and structure formation has rarely been studied in physiologically relevant processes. In order to understand the biogenesis of G-quadruplex structures, we studied G-quadruplex formation in transcription using a T7 transcription model.Here we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ), that may form in genome in transcription. We demonstrate that stable HQ readily forms in transcriptions in double stranded DNA that carries two or more tandem G-tracts of three or more consecutive guanines on the nontemplate strand. Putative HQ-forming sequences (PHQS) are concentrated in the immediate 1000 nt region downstream of transcription start sites with a signifi cant preference on the nontemplate over the template DNA strand. PHQS motifs are evolutionally selected based on their ability to form HQ. They began to enrich in amphibians and became constitutional in genes in warm-blooded animals. HQ formation involves a RNA transcript that goes through a structural cascade of R-loop ssRNA HQ. HQ modulates transcription under both in vitro and in vivo conditions, and the number of PHQS in genes correlates with the transcriptomal profiles in human tissues. Besides the stable three-G-quartet HQ, we were also able to detect HQ of two-G-quartet layers in transcription. Although being unstable and short-lived, they may play role in physiological processes because of their huge abundance in genomes. Lastly, we show that intramolecular G-quadruplex can be induced by remote downstream transcription activity. This G-quadruplex induction in response to a distal DNA tracking events suggests that G-quadruplex can participate in long-range communication between distal genomic locations and function to coordinate regulatory transactions in genome.More details of our above studies can be found in the abstracts under the following titles:(1) Cotranscriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.(2) Evolutional selection of DNA:RNA hybrid G-quadruplex sequences as transcriptionregulatory elements in worm-blooded animals.(3) Consecutive transcription of G-rich DNA generates DNA:RNA hybrid G-quadruplexby displacing RNA in R-loop.(4) DNA:RNA hybrid G-quadruplexes of two-G-quartet layers formed in transcription.Short-lived but the most prevalent and abundant G-quadruplex structures in genomes.(5) DNA G-quadruplex formation in response to remote downstream transcription activity.

Zheng Tan is a principle investigator in the Institute of Zoology, Chinese Academy of Sciences, Beijing, China, since 2005. He received his Bachelor in Biochemistry, Master in Biophysics from Wuhan University, China, and Ph.D. in Cell Biology from the Institute of Zoology, Chinese Academy of Sciences, Beijing, China. Dr. Tan obtained postdoctoral training at the North Carolina State University and NIEHS, NIH, USA, working on signal transduction involving inositol phospholipids and inositol phosphates. Afterwards, he worked as a faculty member in the College of Life Science, Wuhan University, until 2005. His current research interests are on G-quadruplexes and their biological function.

Oral Presentation 2


Guanine-Quadruplex-Mediated Gene Regulation Controls Metastases in Lung Cancer Cells

Shantanu ChowdhuryProteomics and Structural Biology and G.N.R. Knowledge Centre for Genome Informatics, CSIR-Institute

of Genomics and Integrative Biology, Delhi 110 007 India [email protected]

The mechanism of action of NME2, a widely accepted metastasis-suppressor gene, is poorly understood. Our fi nding that NME2 directly regulates transcription of the c-MYC proto-oncogene (Thakur et al., Nucleic Acids Research, 2009) prompted a genome-wide study to ascertain whether NME2 exerts its anti-metastatic action through transcriptional regulation. Chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq) along with transcriptome profi ling uncovered a network of genes involved in intercellular contact, focal adhesion and actin assembly could be under transcriptional control of NME2. In line with this, NME2-depleted cells displayed increased focal adhesion points and altered actin stress fi ber organization. Our fi ndings demonstrate NME2 regulates transcription of a key focal adhesion factor where the mode of regulatory control is G-quadruplex-dependent: regulatory control was lost when the promoter G-quadruplex was either genetically altered, or in presence of molecules that bind G-quadruplex inside cells.

Shantanu Chowdhury is a faculty at the CSIR - Institute of Genomics and Integrative Biology in Delhi. Following his PhD from Indian Institute of Chemical Technology in India, Dr. Chowdhury did his postdoctoral work at the Biochemistry Department, University of Lincoln, USA and the Max Planck Institute in Marburg, Germany. His group in Delhi explores mechanisms of how alternative forms of DNA structure may infl uence cellular physiology.

Oral Presentation 3


A Dynamic G-Quadruplex Region Regulates the HIV-1 Long Terminal Repeat Promoter

Rosalba Perronea, Matteo Nadaia, Ilaria Frassona, Elena Butovskayaa, Barbara Mantellia, Manlio Palumbob, Giorgio Palùa, Sara N. Richtera

aDepartment of Molecular Medicine, via Gabelli 63, 35121 Padua; bDepartment ofPharmaceutical and Pharmacological Sciences, via Marzolo 5, 35131 Padua.

[email protected]

G-quadruplexes have been shown to act as silencer elements in the promoter regions of human oncogenes and genes; putative G-quadruplex forming sequences are also present in the promoter regions of other mammals, yeasts and prokaryotic cells.

Here we show that the HIV-1 LTR promoter exploits G-quadruplex-mediated transcription regulation like eukaryotic and prokaryotic promoters. Computational analysis on 953 HIV-1 strains substantiated a much conserved G-rich sequence corresponding to Sp1 and NF-κB binding sites. Biophysical and biomolecular experiments proved that two mutually exclusive parallel intramolecular G-quadruplexes, eventually stabilized by ligands, like TMPyP4 and BRACO-19, primarily fold in this region. Mutations abrogating G-quadruplex formation incremented promoter activity in cells, whereas treatment with G-quadruplex ligands impaired promoter activity. Striking parallelism between HIV-1 LTR and eukaryotic regulatory oncogene promoter G-quadruplexes encompasses parallel-like topology, one-nucleotide loop, Sp1 binding sites and promoter activity shaping.

These findings open up the possibility of inhibiting the HIV-1 LTR promoter by G-quadruplex-interacting small molecules, therefore envisaging development of anti-HIV-1 drugs with unprecedented mechanism of action

Oral Presentation 4, Poster 1


The Genome Wide Cartography of the Evolutionarily Conserved R-Loop Formation Sequences (Rlfs) Reveals Thousands Prevalence Sites of G-Quadruplexes (G4s), and G4-Rloop Structures

Involving in Transcriptional Regulation.

Piroon Jenjaroenpun1, Thidathip Wongsurawat1,2, Vladimir Kuznetsov1,2

¬1Department of Genome and Gene Expression Data Analysis, Bioinformatics Institute, 30 Biopolis street, #07-01, Singapore,138671

2School of Computer Engineering, Nanyang Technological University, Nanyang Avenue, Singapore, 639798

Email: [email protected]

Background: R-loop is a RNA-DNA hybrid, comprising a nascent RNA transcript hybridized to template DNA, leaving non-template DNA unpaired. R-loop forming sequence (RLFS) comprises three parts, including R-loop initiation zone structure (RIZ), linker and R-loop elongation zone (REZ). The RIZ-structure could contain three or more, short guanine (G) clusters and separated by non-G nucleotides (e.g., GGGNGGGNGGG)1,2. Similar G repeats can be identified in the G-quadruplex (G4)-forming DNA structures3. G4 adopts a defi ned secondary structure, comprising multiple stacked G-tetrads held together through hydrogen bonding. Recent studies show that RLFSs and G4s distribute throughout the human genome2,3. However, there is no report of co-localization, structural and functional association of both of the sequences within genes at genome scale.

Observation: In our study, we developed in silico R-loop model and mapped the RLFSs on the mouse and human genomes. In both species, 11,773 evolutionarily conserved RLFSs were mapped to 7,747 genes. To study the association of RLFSs and G4, we performed a G4 sequence prediction using Quadparser2 and mapped G4 onto RIZ, linker and REZ of evolutionarily conserved RLFSs. We found that 74% (5,714/7,747 genes) of the RLFS-positive genes include RLFS with at least one G4 sequence. A total number of G4s found in RLFSs is 19,346, 15,806 and 3,604 locate in sense and antisense strand, respectively. Strikingly, in sense strands, G4s highly enriched in RIZ (11,849 of 19,346 G4s, 75%) compared to REZ (3,953 of 19,346 G4s, 25%) and RLFS linker (4 of 19,346, 0%). While in antisense strands, G4s highly enriched in REZ (3,143 of 3,604, 87%) compare to RIZ (68 of 3,604, 2%) and RLFS linker (393 of 3,604, 11%). RLFSs and G4s present in the 5'-UTR, the fi rst intron of regulatory genes and are often included in CpG islands, DNA cytosine methylation regions with key epigenetic markers in mammalians that facilitate the heritable transmission of epigenetic information through cell division. The genes containing both structures show strong associated with the positive regulation of transcription from the Pol II promoter (P=2.9x10-25), positive regulation of gene expression (P=5.8x10-23) and chromatin modifi cation (P=2.4x10-16). The molecular functions of this gene set were associated with transcription regulator activity (P=9.9x10-25), transcription factor activity (P=2.3x10-19) sequence-specifi c DNA binding (P=4.8x10-16).

Conclusion: We firstly report the prevalence of G4 in the evolutionarily conserved RLFSs in the genome scale. G4s prone in sense (non-template) strand and highly enriched in RIZ. These fi ndings suggest that R-loop and G4 structures could be physically and biologically related. Co-localization of these non-canonical structures in 25% of the human and mouse genes suggests essential role in the transcriptional events and many diseases.

References1.Roy, D. & Lieber, M. R. G clustering is important for the initiation of transcription-induced R-loops in vitro, whereas high G density without clustering is suffi cient thereafter. Mol Cell Biol 29, 3124-3133, doi:MCB.00139-09 [pii] 10.1128/MCB.00139-09 (2009).2.Wongsurawat, T., Jenjaroenpun, P., Kwoh, C. K. & Kuznetsov, V. Quantitative model of R-loop forming structures reveals a novel level of RNA-DNA interactome complexity. Nucleic Acids Res 40, e16, doi:gkr1075 [pii] 10.1093/nar/gkr1075 (2012).3.Huppert, J. L. & Balasubramanian, S. Prevalence of quadruplexes in the human genome. Nucleic Acids Res 33, 2908-2916, doi:33/9/2908 [pii] 10.1093/nar/gki609 (2005).



NMR Structures of G-Quadruplexes with Unique Features

Janez PlavecSlovenian NMR Center, National Institute of Chemistry, Ljubljana, Slovenia

EN-FIST Center of Excellence, Ljubljana, SloveniaFaculty of Chemistry and Chemical Technology, University of Ljubljana, Ljubljana, Slovenia

[email protected]

A remarkable number of G-rich nucleic acid sequences exhibit potential to fold into G-quadruplexes. These structures are comprised of G-quartets, the basic structural motifs held together by eight Hoogsteen hydrogen bonds. G-rich tracts within a G-quadruplex are linked by residues that adopt loops of various lengths and topologies. Stability of G-quadruplexes depends on a number of stacked G-quartets as well as sequence details of loops that connect guanines involved in G-quartets. In addition to being constitutive elements of G-quartets, guanine residues can be involved in loops thus contributing to the variety of their lengths and orientations. NMR has been successful in determining 3D structures of several unique architectures of G-quadruplexes. NMR studies have not only helped to determine high-resolution structures of several G-quadruplex structures of various origins including telomeric and promoter regions, but have also contributed insights into structural polymorphism and its thermodynamic and kinetic implications. Our recent NMR study on d[TAG3CG3AG3AG3A2] originating from the fi rst intron of the N-myc gene demonstrated formation of G-quadruplex in K+ ion containing aqueous solution. The monomeric form comprises three G-quartets that are bridged with three single nucleotide propeller-type loops. The dimeric G-quadruplex is characterized by consecutive stacking of six G-quartets.

G-quadruplexes are stabilized by coordinated metal ions in the central cavity of their structures. In general, cations can be found between two G-quartets or in the plane of a G-quartet along the central cavity of a G-quadruplex. However, different stacking properties of G-quartets and other structural features make cation-binding sites unequal. As a consequence, cation-binding sites can be occupied by cations or, alternatively, they can be temporarily vacant or occupied by water molecules. Solution-state NMR studies have demonstrated that cations undergo dynamic exchange between coordination sites in the interior of a G-quadruplex and bulk solution. Dynamics of 15NH4

+ ion movement occurs on a range of timescales and has been shown to correlate with structural features of G-quadruplexes. Structures formed by d(TG3T) and its analogs containing a 5’-5’ or 3’-3’ inversion of polarity sites revealed that the inter-quartet cavities at the inversion of polarity sites bind ammonium ions less tightly.References J. Am. Chem. Soc. 2012, 134, 4132. Nucleic Acids Res. 2012, 40, 6946. J. Phys. Chem. C 2012, 116, 23821. Nucleic Acids Res. 2012, 40, 11047.

Janez Plavec received his B.Sc. and M.Sc. degrees in Chemistry at University of Ljubljana in 1987 and 1990, respectively. His Ph. D. degree was conferred by Uppsala University, Sweden in 1995. In 2002 he was visiting researcher at Georgia Institute of Technology, Atlanta, U.S.A. He is head of Slovenian NMR centre since 1995. His research interests include NMR studies of nucleic acid structure and dynamics including cation interactions.

Oral Presentation 6


Direct Observation of the G-Hairpin and G-Triplex Intermediates

Arivazhagan Rajendran,1 Masayuki Endo,2,3 Kumi Hidaka,1 Phong Lan Thao Tran,4 Marie-Paule Teulade-Fichou,5 Jean-Louis Mergny,4 Robert J. Gorelick,6 and Hiroshi Sugiyama1,2,3

1Dept. Chemistry, Kyoto Univ., 2WPI-iCeMS, Kyoto Univ., 3JST-CREST, 4Univ. Bordeaux, 5Institut Curie, 6Frederick National Lab. for Cancer Research

[email protected]

Among the noncanonical secondary structures of nucleic acids,1,2 the G-quadruplex is an attractive conformation, and structural studies of quadruplex motifs are ongoing tasks in the fi eld of chemical biology of nucleic acids.1,3-5 G-quadruplex is a supramolecular architecture, which represents an unusual DNA secondary structure that can be formed by certain G-rich sequences. A well-known example of the G-rich human sequence is chromosomal telomeres comprising the tandem repeat sequence TTAGGG with a single-stranded 3'-overhang of up to 200 nucleotides. Although concrete evidence on the formation of G-quadruplexes inside a cell is still a matter of debate, these structures have been assumed to be involved in various cellular processes including chromosomal alignment, replication, transcription, genome recombination, and control over cancer cell proliferation. Moreover, very less is known on the folding pathway and intermediates involved in the G-quadruplex structures that are directly related to the dynamics of enzyme-catalyzed unwinding. Such an understanding on the folding pathway is also important to elucidate the functions of G-rich sequences, particularly the telomeres. To date, most of the studies on the folding pathway have been carried out by computational analysis that hypothesized the theoretical models. There has been few experimental studies reported on the intermediates, however, the direct evidence on the existence of such intermediates is still not derived. Here, we describe the direct visualization and single-molecule analysis6 on the G-haripin and G-triplex intermediates by the combined use of DNA origami frame and high-speed atomic force microscopy.7 Two types of G-quadruplex folding, a tetramolecular8 and a (3+1) type,5 were used in this study. In both types, the G-rich strands were controlled in such a way that they can form exclusively a hairpin or triplex structure. Formation of the intermediates was visualized by the topographical change of the G-rich strands from parallel to X-shape within the origami frame. Apart from the intermediates, we also investigated the salt,8 ligand9 and protein-induced10 conformational switching of the G-quadruplex structure in real-time.References1. Mashimo, T.; Yagi, H.; Sannohe, Y.; Rajendran, A.; Sugiyama, H. J. Am. Chem. Soc., 2010, 132, 14910.2. Rajendran, A.; Nakano, S.-I.; Sugimoto, N. Chem. Commun., 2010, 46, 1299.3. Dhakal, S.; Mao, H.; Rajendran, A.; Endo, M.; Sugiyama, H. In Guanine Quartets: Structure and Application; The Royal Society of Chemistry, 2013, 73.4. Koirala, D.; Dhakal, S.; Ashbridge, B.; Sannohe, Y.; Rodriguez, R.; Sugiyama, H.; Balasubramanian, S.; Mao, H. Nat. Chem., 2011, 3, 782.5. Sannohe, Y.; Endo, M.; Katsuda, Y.; Hidaka, K.; Sugiyama, H. J. Am. Chem. Soc., 2010, 132, 16311.6. Rajendran, A.; Endo, M.; Sugiyama, H. Angew. Chem. Int. Ed., 2012, 51, 874.7. Rajendran, A.; Endo, M.; Hidaka, K.; Sugiyama, H. 2013, Manuscript under preparation.8. Rajendran, A.; Endo, M.; Hidaka, K.; Tran, P. L. T.; Mergny, J.-L.; Sugiyama, H. 2013, Submitted.9. Rajendran, A.; Endo, M.; Hidaka, K.; Tran, P. L. T.; Teulade-Fichou, M.-P.; Mergny, J.-L.; Sugiyama, H. 2013, Submitted.10. Rajendran, A.; Endo, M.; Hidaka, K.; Tran, P. L. T.; Mergny, J.-L.; Gorelick, R. J.; Sugiyama, H. 2013, Submitted.

Oral Presentation 7


Targeting G-Quadruplexes, Knowing G-Triplex

Antonio RandazzoDepartment of Pharmacy, University of Naples “Federico II”, via D. Montesano 49, 80131, Naples (Italy)

[email protected]

Targeting of secondary DNA structures such as G-quadruplexes is now considered an established opportunity for drug intervention in anticancer therapy. So far, efforts made in the discovery of chemotypes able to target G-quadruplexes mainly succeeded in the identification of a number of polyaromatic compounds featuring end-stacking binding properties. Against this general trend, we are persuaded that the G-quadruplex grooves can recognize molecular entities with better drug-like and selectivity properties. In the fi rst part of this communication, a rational compound selection in tandem with NMR and ITC experiments allowed the identification of a small focused library of molecules having G-quadruplex binding properties [1-2]. The biological characterization of the new ligands demonstrates their ability to induce selective DNA damage at telomeric level and antiproliferative activity. Compared to other G-quadruplex binders, the enhanced drug-like properties of the discovered structures increases the interest in these compounds.

In the second part, the characterization of a G-triplex structure is reported [3]. In particular, during the study of the folding process of the G-quadruplex aptamer TBA by means of well-tempered metadynamic calculations, we have observed the formation of the G-triplex structural motif. The existence of this structure has been proven in an 11-mer oligonucleotide, whose structural and thermodynamic properties have been characterized. At variance with the already known triplex structures, the G-triplex presents G:G:G triad planes stabilized by an array of Hoogsteen-like hydrogen bonds. Although this kind of structure was already hypothesized as an intermediate in the folding process of other quadruplex forming sequences, this is the fi rst time that DNA has been unambiguously isolated and structurally characterized in this conformation. G-rich regions, potentially able to form G-triplex structures, are very abundant in the genome and our study paves the way for further investigations into the presence of these structures in vivo, their biological role, and ways of interacting with them.References1. S. Cosconati, L. Marinelli, R. Trotta, A. Virno, L. Mayol, E. Novellino, A. J. Olson, A. Randazzo. J. Am. Chem. Soc., 2009, 131(45), 16336-16337.2. S. Cosconati, A. Rizzo, R. Trotta, B. Pagano, S. Iachettini, S. De Tito, I. Lauri, I. Fotticchia, M. Giustiniano, L. Marinelli, C. Giancola, E. Novellino, A. Biroccio, A. Randazzo. J. Med. Chem., 2012, 55(22) 9785-9792.3. V. Limongelli, S. De Tito, L. Cerofolini, M. Fragai, B. Pagano, R. Trotta, S. Cosconati, L. Marinelli, E. Novellino, I. Bertini, A. Randazzo, C. Luchinat, M. Parrinello. Angewandte Chemie Int Ed Engl. 2013, 52(8), 2269-2273.

Oral Presentation 8


Structural Basis of DNA Quadruplex–Duplex Junction Formation

Kah Wai Lim and Anh Tuân PhanSchool of Physical and Mathematical Sciences, Nanyang Technological University,

21 Nanyang Link, Singapore [email protected]

DNA has the capacity to adopt several distinct structural forms such as duplex and quadruplex helices. Here we perform a systematic analysis on the juxtaposition of a duplex hairpin and a G-quadruplex, and present the solution structures of DNA quadruplex–duplex hybrids that cover the fundamental aspects of their compatibility. We further show that multiple duplexes can be connected in conjunction to a G-quadruplex, giving rise to a G-junction. Thermodynamic investigation on assorted quadruplex–duplex hybrids showed that stability of the quadruplex component generally increases with the length of the duplex hairpin, up to a point. The infl uences of sequence variations and bulges at the quadruplex–duplex junctions on the stability of these complexes were also explored. An understanding on the compatibility between duplex and quadruplex DNA and the stability of quadruplex–duplex hybrids would open new avenues for drug design efforts targeting genomic G-rich sequences, and could facilitate the integration of such motifs in DNA structural engineering and nanotechnology.

Oral Presentation 9


Structural Investigation into Human Telomeric Quadruplex/Duplex Interfaces

G.N. Parkinson, I.R. Krauss, S. Ramaswamy, S. Haider Department of Pharmaceutical and Biological Chemistry, The School of Pharmacy, University of London,

London, WC1N 1AX, UK. [email protected]

Crystallographic methods have been successfully employed to structurally describe many of the folded topologies observed for G-rich telomeric sequences. Typically our structural investigations of telomeric DNA have focused on a single G-quadruplex motif removed from the context of any adjoining duplex structures, on either the 3’ or 5’ ends. We have now embarked on a series of crystallographic structural investigations of hybrid (tandem) quadruplex/duplex motifs to understand the relationship between these individually folded structural units, as it is expected that they coexist in the cellulr environment. Our initial studies have focused on the human telomeric repeat sequence d(GGGTTA)n, with a linking TTA nucleotide sequence at either the 3’ end or 5’ end to an extended duplex forming sequences, up to one helical turn. Ultimately we aim to understand structural and physicochemical properties of the quadruplex/duplex interfaces and to target them with new ligands that would be designed to selectively bind to these unique interfaces thereby disrupting their normal biological functions.

We will report on our current knowledge of the nature of the human telomeric quadruplex/duplex interface based on our new structural models derived exclusively from crystallographic data. The formation and potential stability of the telomeric duplex DNA will also be discussed along with the likely opportunities for ligand binding at the quadruplex/duplex interface.



Quadruplexes Are Everywhere!

Jean-Louis MergnyINSERM U869 / IECB / Univ. Bordeaux, Pessac, France

[email protected]

Quadruplexes may fi nd applications in a number of fi elds related to Biotech, Nanotech and Biology. I will present recent results obtained in the group, concerning:

- the controlled assembly of G-rich sequences or of complex motifs involving other pairing schemes 1,2;

- the "hidden links" between aptamers and G-quadruplexes;

- the sequence requirements for G4 formation.

Thanks to all lab members, past and present! Our group acknowledges supports from the Conseil Régional d'Aquitaine, the Agence Nationale de La Recherche (ANR), the Fondation ARC, INSERM, AFAF, and Massive Dynamics.

References :1. Zhou, J et al. Angewandte Chem. 2013, in press2. Zhou, J et al. Angewandte Chem. 2012, 51: 11002

Jean-Louis Mergny got his PhD in 1991 (University Paris VI). He went for a postdoctoral position in Basel, Switzerland with W. Gehring (Biozentrum). Afterwards he was hired by INSERM in 1993 in the Muséum National d'Histoire Naturelle, where he worked mainly on nucleic acids structures from a biophysical point of view. He was promoted Research Director in 2002, and he joined the European Institute of Chemistry & Biology (IECB, Pessac, France) in September 2009. Jean-Louis Mergny acts as an Associate Editor for the Elsevier journals Biochimie and Methods.

Oral Presentation 11


Population Dynamics in Human Telomeric RNA Sequence Is Modulated by G-Quadruplex Binding Ligands

Philip M. Yangyuoru, Hanbin MaoKent State University, Kent, OH, 44242, USA

[email protected]

Recently, it was discovered that human telomeres are transcribed into telomeric repeat-containing RNA (or TERRA) that can form G-quadruplex structures, by which telomere functions might be regulated. Herein, we describe studies on single-molecules in laser tweezers, which interrogate the structural, kinetic, and mechanical properties of TERRA G-quadruplexes. We confirmed the formation of unimolecular, parallel TERRA G-quadruplexes. With force jump approaches, we also discovered partially folded structures that serve as intermediates to the TERRA G-quadruplexes. The population dynamics varies significantly in the presence of a RNA G-quadruplex specific ligand, carboxypyridostatin, which was discovered in the lab of Dr. Balasubramanian. The unfolding forces of TERRA G-quadruplexes and the corresponding intermediates along the 5′-3′ trajectory are larger than the stall force of the polymerases that process nucleic acid templates in the same direction. This suggests a requirement for helicases to resolve structures formed in the TERRA during telomere related processes.

Dr. Hanbin Mao graduated with a BS degree from West China University of Medical Sciences in 1995. In 2003, he obtained a PhD in analytical chemistry from Texas A&M University, focusing on lab-on-a-chip development. He spent the following two years as a postdoctoral associate in the University of California at Berkeley and Laurence Berkeley National Lab, focusing on bimolecular structures at the single molecular level. In 2005, he started his independent academic career at Department of Chemistry and Biochemistry, Kent State University. His main research interest is in the structure and transition kinetics of G-tetraplexes, as well as in the development of highly sensitive biosensors.



Kinetics of G-Quadruplexes in All Its Terrible Beauty

Iztok Prislan, Jurij Lah, Gorazd VesnaverFaculty of Chemistry and Chemical Technology, University of Ljubljana, Aškerčeva 5, 1000, Ljubljana,

Slovenia [email protected]

Guanine-rich sequences found in telomeric DNA can self-associate to form variety of quadruplex structures. Their formation has been found to inhibit the activity of the enzyme telomerase required for the proliferation of about 80% of cancer cells so they constitute a promising target for drug design.1 Since ligand binding to various DNA sequences depends strongly on the structure of DNA it is important to know whether a given G-quadruplex occurs in various structural forms that may exhibit different binding properties.G-quadruplexes routinely adopt multiple conformations in solution that may undergo kinetically governed interconversions and folding/unfolding transitions.2 To better understand thermodynamics and kinetics of G-quadruplex formation, we followed thermally induced folding/unfolding transitions of d(G4T4G3) quadruplexes in Na+ and K+ solutions and tried to interpret them in terms of a kinetically governed coexistence of several quadruplex structures and their unfolded forms. We used the experimental data obtained from DSC, UV, CD and Gel electrophoresis to develop a model which allowed us to describe folding and unfolding processes followed by DSC with a single set of parameters. Fitting of the model function to experimental data resulted in positive activation energy for all steps predicted by the model.3,4

References1. Huppert,J.L. Chem. Soc. Rev., 2008, 37, 1375-13842. Lane,A.N., Chaires,J.B., Gray,R.D. and Trent,J.O. Nucleic Acids Res., 2008, 36, 5482-515.3. Prislan, I., Lah, J. and Vesnaver, G., J. Am. Chem. Soc., 2008, 130, 14161–169.4. Prislan, I., Lah, J., Milanic, M. and Vesnaver, G., Nucleic Acids Res., 2011, 39, 1933–1942.



Charge Transport in Single DNA-Based Molecules

Danny PorathInstitute of Chemistry and Center for Nanoscience and Nanotechnology, The Hebrew University of

Jerusalem, 91904 Israel [email protected]

DNA has been in the center of the scientifi c research for decades. In particular, DNA was considered as one of the attractive candidates for molecular electronics and an excellent system to study charge transport in 1-D polymers. spite of intensive efforts the results varied between experiments due to changes in the measured molecules, measurement methods and environment. Recently we were able to measure length dependent electrical transport in G4-DNA attached to a hard surface in a controlled way and get an insight to mechanism governing the charge transport in these molecules. I will report on these results and on our measurement efforts with additional methods.



Visual DNA Detection Using Asymmetric PCR and G-Quadruplexes: An Integrated Workfl ow

Mahesh UttamchandaniDSO National Laboratories, National University of Singapore

[email protected]

We describe a novel method to detect DNA sequences visually through a color change reaction using split G-quadruplexes. 1-2 We have successfully applied this assay for the detection of Salmonella and Mycobacterium DNA, as well as in genotyping a single base difference from within human genomic DNA samples. This is the first time the approach was demonstrated starting from live genomic DNA samples, through an integrated workflow. 3 Our approach adopts a binary split probe system, designed with G-rich sequences and probes that hybridize with target DNA under ambient conditions, facilitating G-quadruplex assembly. In order to integrate the assay with PCR, an asymmetric PCR was fi rst performed to amplify the target region, with primer ratios tailored for optimum amplifi cation of single stranded DNA. This was followed by direct addition of the visual probes, substrates and reagents to produce a colour change within 15 min, when the desired target sequences were amplified1-2. This approach hence offers a rapid readout, ease-of-use and handling convenience, especially at the point-of-care.

References1. Aw, K. L. D., Neo, J. L., Uttamchandani, M. “Visual Detection of DNA from Salmonella and Mycobacterium using Split DNAzymes” Mol. BioSyst. 2010, 6, 792-794.2. Neo, J. L., Aw, K. L. D., Uttamchandani, M. “Visual SNP Genotyping using Asymmetric PCR and Split DNA Enzymes” Analyst. 2011, 136, 1569-1572.3. Neo, J. L., Kalidasan, K., Uttamchandani, M. “G-Quadruplex-based Probes for Visual DNA Detection”, Curr. Pharm Des. 2012, 18, 2048-2057.



G-Quadruplex Ligands with Macrocyclic Polyoxazoles

Kazuo NagasawaTokyo University of Agriculture & Technology, Department of Biotech. & Life Science

[email protected]

G-Quadruplexes (G4s) is a secondary DNA structures consisting of G-quartet planers in G-rich regions. G4s were originally found in telomeric DNA at the ends of chromosomes, and formation of telomeric G4 induces dysfunction of telomeres in cancer cells. Some G4 structures have recently been found not only telomeres, but also in promoter regions of certain oncogenes such as c-kit, c-myc, and bcl-2. Thus, these G4s are also recognized as important drug targets, and stabilization of the G4s by small molecules is one of a promising strategy for cancer chemotherapy.1 Recently, various natural and synthetic compounds have been developed mainly for targeting telomeric G4. We have reported a series of macrocyclic polyoxazoles, 6OTDs and 7OTD as novel G4 ligands inspired by the highly potent natural G4 ligand of telomestatin (1).2 This paper introduces our G4 ligands from points of G4-stabilizing ability and selectivity.3

References1. S. Balasubramanian, L. H. Hurley and S. Neidle, Nat. Rev. Drug Discov. 2011, 10, 261.2. (a) K. Shin-ya and H. Seto et al. J. Am. Chem. Soc. 2001, 123, 1262. (b) L. H. Hurley et al. J. Am. Chem. Soc. 2002, 124, 2098.3. (a) K. Nagasawa et al. Angew. Chem. Int. Ed. 2008, 47, 5557. (b) K. Nagasawa et al. ChemBioChem 2009, 10, 431. (c) K. Nagasawa et al. ChemBioChem. 2012, 13, 774.

Kazuo Nagasawa is a Professor in the Department of Biotechnology and Life Sciences, Tokyo University of Agriculture and Technology (TUAT), Japan. He received his PhD from Waseda University. In 1993, he joined RIKEN as a researcher. From 1997 to 1999, he worked in Kishi group at Harvard University. He moved to the University of Tokyo (IMCB) in 2001, and to the TUAT in 2004as an Associate Professor. In 2009, he was appointed to his current position. His current research interests are natural product synthesis, organocatalysis chemistry, and chemical biology targeting to G-quadruplexes and nuclear receptor of VDR.



Luminescent G-Quadruplex-Based Probes

Dik-Lung MaDepartment of Chemistry, Hong Kong Baptist University, Kowloon Tong, Hong Kong

[email protected]

DNA oligonucleotides are versatile components for the construction of sensing platforms owing to their low cost, ease of synthesis, high solubility, biocompatibility and stability in aqueous solution and biological media.1,2 Early studies in the field of DNA-based sensing typically used labelled oligonucleotides that are covalently conjugated with donor/acceptor or fl uorophore/quencher pairs.3 However, fluorescent labelling can be relatively expensive and time-consuming, and the covalent attachment of the fluorophore may influence the binding affinity or selectivity of the functional oligonucleotide, thus potentially interfering with the operation of the assay.

Indeed, G-quadruplexes show a rich diversity in structural topologies that can be sensitive to the number and length of the guanine tracts, the lengths of the intervening loop regions and the character of the metal ion in solution. The extensive structural polymorphism of G-quadruplexes has rendered them as attractive signal-transducing elements for the development of DNA-based probes. In this talk, I will report continuing progress in the development of “label-free” luminescent based detection platforms based on G-quadruplex. In particular, the use of luminescent complex for construction of detection platforms for a variety of analytes, which have been a focus of our research group, will be discussed.

References1. Y. Du, B. Li, E. Wang, Acc. Chem. Res., 2013, 46, 203–2132. D.-L. Ma, H.-Z. He, K.-H. Leung, H.-J. Zhong, D. S.-H. Chan, C.-H. Leung, Chem. Soc. Rev., DOI: 10.1039/C2CS35472A.3. S. Tyagi, F. R., Kramer, Nat. Biotechnol., 1996, 14, 303–308.

Dr. Dik-Lung Ma received his Ph.D. in 2004 at the University of Hong Kong. He spent the years 2005–09 as Postdoctoral Fellow and Research Assistant Professor at the University of Hong Kong, the Hong Kong Polytechnic University, and the Scripps Research Institute. Since 2010, he has been appointed as Assistant Professor of Chemistry at Hong Kong Baptist University. Dr. Ma research interests lie in bioorganometallic chemistry, computer-assisted drug discovery and development of luminescent DNA based platform for sensing applications.



New Insights into Ligand-Telomeric DNA Interactions and Their Applications

Chuanqi Zhao, Can Xu, Bailu Xu, and Xiaogang Qu*Laboratory of Chemical Biology, Division of Biological Inorganic Chemistry, State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Graduate School of the

Chinese Academy of Sciences, Chinese Academy of Sciences, Changchun, Jilin 130022, ChinaE-mail: [email protected]

Some G4 motifs and their corresponding quadruplexes function in essential processes, including initiation of DNA replication, telomere maintenance, regulated recombination, control of gene expression, and genetic and epigenetic instability. We have proposed that those G4 motifs comprise the G4 genome, analogous to the transcriptome, proteome or metabolome. In this view, genomic DNA is not only a simple alphabet but also a more complex geography. We are working to defi ne the G4 genome, by determining which of the many G4 motifs are active participants in genomic biology, and by identifying the features that enable specifi c quadruplexes to be recognized by specifi c factors.

It is important to understand how biologically active agents, such as chiral metal complexes and nanomaterials, recognize their biological targets and influence disease-related processes. In this report, we summarize our recent advances 1-10 on chiral recognition of G-quadruplex, ligand-induced structural transitions, and their potential applications. This work was supported by 973 Project, NSFC, Funds from the Chinese Academy of Sciences and Jilin Province.

References1. H. Yu, X. Wang, M. Fu, J. Ren, X. Qu, Nucleic Acids Res., 2008, 36, 5695.2. Y. Peng, X. Wang, Y. Xiao, L. Feng, C. Zhao, J. Ren, X. Qu, JACS, 2009, 131, 1381.3. C. Chen, J. Geng, F. Pu, X. Yang, J. Ren, X. Qu, Angew. Chem. Intl. Ed., 2011, 50, 882.4. J. Geng, M. Li, E. J. Ren, Wang, X. Qu, Angew. Chem. Intl. Ed., 2011, 50, 4184.5. C. Zhao, K. Qu, C. Xu, J. Ren, X. Qu, Nucleic Acids Res., 2011, 39, 3939.6. Y. Song, L. Feng, J. Ren, X. Qu, Nucleic Acids Res., 2011, 39, 6835.7. Y. Chen, K. Qu, C. Zhao, L. Wu, J. Ren, J. Wang, X. Qu, Nature Commun., 2012, 3, 1074.8. Y. Lin, C. Xu, J. Ren, X. Qu, Angew. Chem. Intl. Ed., 2012, 51, 12579.9. L. Feng, Z. Huang, J. Ren, X. Qu, Nucleic Acids Res., 2012, 40, e122.10.C. Zhao, J. Ren, J. Gregolinski, J. Lisowski, X. Qu, Nucleic Acids Res., 2012, 40, 8186.

Xiaogang Qu received his PhD from the Chinese Academy of Sciences (CAS) in 1995 with CAS President’s Award. He moved to the USA afterwards and worked with Professor J. B. Chaires at the Mississippi Medical Center and Nobel Laureate Professor Ahmed. H. Zewail at the California Institute of Technology. Since late 2002, he is a professor at Changchun Institute of Applied Chemistry, CAS. From 12/2006 to 05/2007, he visited the group of Nobel Laureate Professor Alan J. Heeger at the UCSB. His current research is focused on ligand-nucleic acids or related protein interactions, and bio-functional materials for advanced medical technology.



Cationic Macrocyclic Aromatic Pentamers as a New Class of Highly Specifi c TelomereRNA G-quadruplex-Binding Ligands

Ying Liu and Huaqiang Zeng National University of Singapore

[email protected]

New regulatory roles on the biology of telomere and telomerase by telomeric repeat-containing RNAs (TERRAs) have been recently demonstrated by Lingner and Blasco.1 The in vivo occurrence of TERRAs may reveal a new level of regulation and protection of chromosome ends that could facilitate valuable insights into fundamental biological processes such as cancer and aging,2 and has garnered recently intensifi ed interests in searching synthetic compounds able to selectively recognize RNA G-quadruplexes (G4) rather than DNA counterparts. Various known or new ligands have been analyzed that until now has not culminated in the identification of such desired ligands with suffi ciently high fi delity. We report here a novel class of positively charged macrocyclic aromatic pentamers that display a high structural selectivity in binding to telomere RNA and successfully discriminate G4 RNA from both G4 DNA and double-stranded RNA (Figure 1a). Specifi cally, while ligands 1 and 2 effect very signifi cant stabilizations of two G4-forming telomeric RNA sequences by 8.0 - 24.1 °C in ΔTm in both Na+ and K+ solutions, they both show negligible effects on either a RNA duplex or a DNA G4 structure. All the ITC binding isotherms show an exothermic behavior. And the best fitting is achieved by using three sequential binding sites with the 1st and 3rd binding sites enthalpy-driven and the 2nd binding site driven by entropy. A ligand:tetraplex stoichiometry of 1:2 is also observed. On the basis of this and as illustrated in Figure 1c, a hypothetic complex formed between the ligand and RNA molecules can be proposed that is mediated by the 1st and 3rd binding sites respectively involving two and three ammonium cations from the pentamer ligand via ionic interactions, and by the 2nd binding site presumably made up of the roughly planar macrocyclic pentameric backbone.These RNA-specifi c macrocyclic pentamers shall provide the basis for designing other closely related macrocycles that may offer good opportunities in finding innovative anticancer medicines, and for deciphering the in vivo functions of TERRAs and other types of G4 RNAs

References1. (a) Azzalin, C. M.; Reichenbach, P.; Khoriauli, L.; Giulotto, E.; Lingner, J., Science 2007, 318, 798; (b) Schoeftner, S.; Blasco, M. A., Nat. Cell Biol. 2008, 10, 228.2. (a) Hurley, L. H., Nat. Rev. Cancer 2002, 2, 188; (b) Gilson, E.; Géli, V., Nat. Rev. Mol. Cell Biol. 2007, 8, 825; (c) Horard, B.; Gilson, E., Nat Cell Biol 2008, 10, 113; (d) Luke, B.; Lingner, J., EMBO J. 2009, 28, 2503; (e) Flynn, R. L.; Centore, R. C.; O' Sullivan, R. J.; Rai, R.; Tse, A.; Songyang, Z.; Chang, S.; Karlseder, J.; Zou, L., Nature 2011, 471, 532.



Covalent Targeting of G-Quadruplex Structures by Naphthalene Diimide Conjugated Electrophiles

Filippo Doria,1 Michele Petenzi,1 Sara N. Richter,2 Mauro Freccero1

1 Dipartimento di Chimica, Università di Pavia, V.le Taramelli 10, 27100 Pavia, Italy.2Dip. di Medicina Molecolare, Università di Padova, via Gabelli 63, 35121 Padua, Italy.

[email protected]

Recognition and stabilization of G-quadruplex structures (G4) have been achieved by a broad range of small molecules acting as reversible ligands. On the contrary, covalent G4 targeting, by metal complexes1 or organic electrophiles, has seldom been explicitly addressed, despite the great potential applications, such as: (i) covalent G4 stabilization and damage, which in turns activates DNA scissoring or DNA damage response, (ii) selective tagging and (iii) G4 pull-down for extraction and purification. Recently, our group has engineered a new class of ligand/alkylating hybrid structures, tethering a naphthalene diimide (NDI) core to electrophilic quinone methides2 (QMs) and oxiranes.3 QMs, unlike oxiranes, are masked electrophiles, which require activation by an external stimulus (irradiation, reduction and 40°C incubation), to unleash the alkylating properties. The NDI moiety act as recognizing unit due to its binding properties toward G4 structures. Furthermore, the NDI synthetic chemistry being extremely flexible allowed us to explore different tethering positions for the alkylating moieties. Efficiency, quadruplex vs duplex selectivity and G4 base specificity of the alkylation by QMs and oxiranes conjugated to NDIs are described and compared, underlining the opportunities (in terms of selectivity and delivery) and drawbacks (in term of product characterization of the covalent damage) offered by QM-like alkylating agents in the G4 covalent targeting.

References1. H. Bertrand, S. Bombard, D. Monchaud, E. Talbot, A. Guedin, J. L. Mergny, R. Grunert, P. J. Bednarski, M. P. Teulade-Fichou. Org. Biomol. Chem. 2009, 7, 28642. a) Di Antonio, M.; Doria, F.; Richter, S. N.; Bertipaglia, C.; Mella, M.; Sissi, C.; Palumbo, M.; Freccero, M. J. Am. Chem. Soc. 2009, 131, 13132. b) Nadai, M.; et al. Biochimie 2011, 93, 1328. c) Doria, F.; et al. Org. Biomol. Chem. 2012, 10, 2798. d) Doria, F.; Nadai, M.; Sattin, G.; Pasotti, L.; Richter, S. N.; Freccero, M. Org. Biomol. Chem. 2012, 10, 3830. (e) Weinert, E. E.; Dondi, R.; Colloredo-Melz, S.; Frankenfi eld, K. N.; Mitchell, C. H.; Freccero, M.; Rokita, S. E. J. Am. Chem. Soc. 2006, 128, 11940. (f) Verga, D.; Nadai, M.; Doria, F.; Percivalle, C.; Di Antonio, M.; Palumbo, M.; Richter, S. N.; Freccero, M. J. Am. Chem. Soc. 2010, 132, 14625. (g) Percivalle, C.; La Rosa, A.; Verga, D.; Doria, F.; Mella, M.; Palumbo, M.; Di Antonio, M.; Freccero, M. J. Org. Chem. 2011, 76, 3096.3. Doria F., Nadai, M.; Folini, M.; Scalabrin, M.; Germani, L.; Sattin, G.; Mella, M.; Palumbo, M.; Zaffaroni, N.; Fabris, D.; Freccero, M.; Richter S. N. Chem. Eur. J. 2013, 19, 78.



Biological Role of G-Quadruplexesin Replication and Genome Instability

A. Piazza1, A. Serero1, J. Lopes1, F. Samazan1, F. Hamon 2 M-P. Teulade-Fichou2, M. Adrian3, B. Heddi3, A.T. Phan3 and A. Nicolas1

1Institut Curie Centre de Recherche, CNRS UMR3244, Université Pierre et Marie Curie, 26 rue d’Ulm, 75248 Paris (France);

2Institut Curie Centre de Recherche, CNRS UMR176, Université Paris XI, 91405 Orsay (France); 3School of Physical and mathematical Sciences, Nanyang Technological University, 637371 Singapore

[email protected]

Over the recent years, we examined the behaviour of the human G4-prone minisatellite CEB1 sequence in the yeast S. cerevisiae. Its instability is specifi cally stimulated in the absence of the Pif1 5’-3’ helicase1 and in wild-type cells treated with the Phen-DC G4 ligands2 during leading strand replication3. The formation of the rearrangements expansion and contraction of the total number of repeats depends on homologous recombination. Also, CEB1 stimulates G4-dependent Gross Chromosomal Rearrangements leading to chromosome breakage and healing of the extremities by telomere addition or complex fusions to other chromosome fragments4. The frequency of events and the choice of outcome depend on the orientation of the G-rich strand with respect to the telomere.

In contrast, the CEB25 G4-forming human minisatellite5, inserted in the same chromosomal locations as CEB1 is not destabilized in pif1Δ nor in wild type+PhenDC3 treated cells.

I will described our experimental evidence arguing for the in vivo formation of G-quadruplex structures, their role in replication and genome instability and address the differences between the CEB1 and CEB25 G4 structures5 that explain their distinct behaviour.

References1. Ribeyre et al., 2009 PLoS Genetics, 5, e1000475. 2. Piazza et al., 2010, Nucleic Acids Research, 38, 4337-4348. 3. Lopes et al., 2011. The EMBO J. 30, 4033-4046. 4. Piazza et al., (2012) PLoS Genetics, 8, e10030338. 5. Amrane S. et al., (2012) Journal of the American Chemical Society (JACS), 134, 5807-5816.



Functions of Telomeric G-Quadruplexes in Ciliates and Humans

Tracy M. BryanChildren’s Medical Research Institute, Sydney, New South Wales, Australia

[email protected]

Although in vivo evidence for G-quadruplex structures is increasing, the structure-specifi c locations and functions of telomeric G-quadruplexes remain speculative. It is widely accepted in telomere biology that G-quadruplexes sequester the 3’ end of the telomere and prevent it from being extended by telomerase. We have identifi ed, purifi ed and characterized stable human telomeric G-quadruplexes and demonstrated that human telomerase is able to extend parallel intermolecular conformations in vitro. Together with our previous work using telomerase from ciliated protozoa, these data confi rm that the ability to extend parallel G-quadruplexes is conserved among species. These parallel G-quadruplexes were shown to align correctly with the RNA template of telomerase indicating that at least partial G-quadruplex resolution is required. A highly purifi ed preparation of human telomerase retains this extension ability, suggesting that telomerase itself may have parallel G-quadruplex resolvase activity. The ability of telomerase to recognize, unwind and extend these structures, and the evolutionary conservation of this property in distantly-related organisms, implies that this conformation of DNA plays an important biological role. We are exploring the function of telomerase extension of parallel G-quadruplexes in the ciliate Tetrahymena, by creating a strain bearing a mutation in telomerase that drastically impairs its ability to extend G-quadruplex, but not linear, DNA. This strain has dramatically shortened telomeres, suggesting that extension of G-quadruplexes by telomerase is necessary for telomere maintenance in vivo. The mutant Tetrahymena also have defects in progressing through mitosis, suggesting that the extension of telomeric G-quadruplexes is important for mitotic chromosome dynamics. In a separate study, we have asked whether G-quadruplexes can play a capping role at deprotected human telomeres, as has been observed in Saccharomyces cerevisiae1. Depletion of the telomeric protein Pot1 in human cells caused damage foci at telomeres, specifically in G1 phase. Treatment of these cells with the G-quadruplex-stabilizing bisquinolium compound PhenDC32 signifi cantly reduced the number of telomere damage foci. Together our studies indicate that G-quadruplexes play positive roles at telomeres in different organisms.

References :1. Smith JS, Chen Q, Yatsunyk LA, Nicoludis JM, Garcia MS, Kranaster R, Balasubramanian S, Monchaud D, Teulade-Fichou MP, Abramowitz L, Schultz DC, Johnson FB, Nat. Struct. Mol. Biol. 18, 478 (2011).2. De Cian A, Delemos E, Mergny JL, Teulade-Fichou MP, Monchaud D, J. Am. Chem. Soc. 129, 1856 (2007).

Tracy Bryan has been head of the Cell Biology Unit at the Children’s Medical Research Institute in Sydney, Australia since 2001. She also has a conjoint appointment as Associate Professor at the University of Sydney. She obtained a Bachelor of Science from Macquarie University, Sydney, and a PhD in cell biology from the University of Sydney in 1997, during which she identifi ed an alternative mechanism for telomere elongation in human cancer cells. Dr. Bryan’s postdoctoral training, in biochemistry and enzymology, was carried out at the University of Colorado, Boulder, USA. Her research interests include the biochemistry and cellular mechanism of the enzyme telomerase.



The Biological Implications of G-Quadruplex Formation by Cyclic Dinucleotide, c-di-GMP, at Low Micromolar Concentrations

Herman O. Sintim, Jie Zhou and Shizuka NakayamaDepartment of Chemistry and Biochemistry, University of Maryland, College Park, MD 20742, USA

[email protected]

Guanine rich DNA/RNA sequences that form tertiary structures, known as G-quadruplexes, play important roles in both biology and nanotechnology. Guanine-containing nucleotides, such as GMP, are also known to form G-quadruplexes but unlike G-rich DNA or RNA that can form structures containing G-tetrad units at low micromolar concentrations, guanine-containing nucleotides are known to form G-quadruplexes at high concentrations (usually millimolar concentrations). Cyclic diguanylic monophosphate, c-di-GMP, is a cyclic dinucleotide that contains two guanine nucleobases and was discovered in the late 80s, as an allosteric modulator of cellulose synthase in bacteria by Benziman. C-di-GMP is unique from other nucleotides and displays interesting polymorphism, including G-quadruplex formation at low micromolar concentrations in the presence of monovalent cations and/or aromatic intercalators. Herein, we characterize c-di-GMP G-quadruplex formation using a panel of biophysical methods including DOSY NMR, CD, UV and fl uorescence titrations. We also use native gel shifts to demonstrate that c-di-GMP can form G-wires. C-di-GMP regulates bacterial physiology and hence the polymorphism of c-di-GMP, especially G-quadruplex formation at physiologically relevant concentrations, could have important biological implications. We discuss possibility of controlling bacterial biofi lm formation and virulence factors production via the modulation of c-di-GMP polymorphism.



Sequence Specifi c Modulation of G-Quadruplex Folding

Samuel Rouleau, Jean-Denis Beaudoin, Rachel Jodoin and Jean-Pierre PerreaultUniversite de Sherbrooke, Department of biochemistry Pavillon de Recherche Appliquée au Cancer, 3201

Jean-Mignault Street, Sherbrooke (Québec) Canada, J1E [email protected]

G-quadruplexes (G4) are highly stable non canonical structures that can be adopted by guanine rich nucleic acids. Over the past years, many important biological roles have been attributed to DNA as well as RNA G4. Hence, many research studies have focused on targeting G4 with chemical compounds that specifi cally bind these structures and either prevent or enhance their folding. Although these compounds are able to discriminate between G4 and other nucleic acid structures, they are not able to recognize one particular G4 sequence. Since there are more than 370 000 potential G4 sequences in the human genome, off-target effects remain a major issue. The aim of this project was to target specific G4 sequences with chemically modified RNA oligonucleotides. The specificity is obtained using Watson-Crick base pairing between the oligonucleotide and the targeted G4. To ensure that there would not be any off-target effects, we focused on G4 harboring a particular topology, namely a long loop 2. Oligonucleotides with specific chemical modifications (i.e. 2’O-methylated and LNA) were used for their high affi nity and their great stability in human cells. By using in line probing, we showed that the oligonucleotides could modulate the folding of G4 either positively or negatively, depending on where the oligonucleotide is bound. This modulation was obtained on artifi cial G4 sequences as well as on sequences present in the 5’ UTR of human genes. By inserting them in the 5’UTR of a luciferase reporter gene, we also demonstrated that long loop 2 G4 motif can decrease translation in human cells. We showed that this translation inhibition can be either increased or decreased by co-transfecting oligonucleotides with the luciferase gene. To our knowledge this is the fi rst report of targeting a specifi c G4, and it also paves the way for a new kind of therapeutic tool that could modulate the expression of specifi c genes.



An Alternative End-joining Pathway Prevents Genomic Instability at G4 DNA Sites

W. Koole, R. v. Schendel, A. E. Karambelas, J. v. Heteren, K. L. Okihara and M. TijstermanDepartment of Toxicogenetics, Leiden University Medical Center, Leiden, The Netherlands

[email protected]

Previously, we have shown that G4 DNA can be mutagenic in vivo: in the absence of the DNA helicase DOG-1 (the ortholog of human FancJ) G4 DNA motifs including 5’ upstream neighbouring DNA were deleted from the C. elegans genome (Kruisselbrink et al., 2008). The underlying mechanism, however, remained unknown. To get more insight in this process, we developed an in vivo selectable G4-instability assay to characterize mutagenesis of endogenous G4 motifs. The system relies on the insertion of single G4 sequences at the unc-22 gene without disrupting its frame or function. We found that the mutagenic potential of G4 DNA is infl uenced by the sequence context of the motif and also by its orientation (top versus bottom strand). More importantly, we show that G4-induced deletions have characteristics that point towards a non-canonical error-prone repair mechanism: a narrow deletion size distribution, a predominance of minimal homology of exactly one nucleotide, and the occasional presence of templated insertions indicative of repair false starts. We subsequently identifi ed a novel DNA double-strand break mechanism acting on these natural replication fork barriers. This mechanism will be discussed.

ReferencesKruisselbrink, E., Guryev, V., Brouwer, K., Pontier, D. B., Cuppen, E., & Tijsterman, M. (2008). Mutagenic capacity of endogenous G4 DNA underlies genome instability in FANCJ-defective C. elegans. Current biology : CB, 18(12), 900–905. doi:10.1016/j.cub.2008.05.013



Studying G-Quadruplex Formation in the Genome

Shankar BalasubramanianUniversity of Cambridge

[email protected]

In this lecture I will present our recent exploration of G-quadruplex structures in genomic DNA. We have employed a range of techniques, using both small molecule probes and engineered antibodies to examine the existence of G-quadruplexes and to also map where in the genome such structures may form.

We have also sought evidence that such DNA structures are indeed the actual targets for small molecule stabilizers that have shown promising anti-proliferation with various human cancer cell lines. I will also give perspectives on how such studies align with predictions based on biophysics and computational searching of the genome sequence data.



Properties and Potential Functions of Bacterial Quadruplex Sequences

Jörg S. HartigDepartment of Chemistry and Graduate School Chemical Biology,

University of Konstanz, [email protected]

Although in recent years DNA and RNA quadruplexes have received much attention, relatively few studies have focused on the properties and specifi c functions of four-stranded nucleic acid sequences in bacteria. Starting with the characterization of artifi cial sequences we have demonstrated signifi cant effects of quadruplexes on gene expression in bacterial mRNAs. More recently we have focused on the study of naturally occurring and often highly repeated quadruplex sequences in proteobacteria. Importantly, in some cases the genetic context points at specific functions of quadruplexes in regulating bacterial life style adaptations. An overview about current projects of our group related to functional characterization of quadruplex sequences in bacterial genomes will be presented. In addition, the application of electron paramagnetic resonance (EPR) spectroscopy for characterizing quadruplex conformations will be introduced. Although it is necessary to covalently attach spin labels to the sequence of interest, EPR spectroscopy has the advantage of a low background and increased sensitivity compared to NMR technologies, making it suited for the characterization of individual species in complex mixtures and biological samples.

Jörg Hartig studied chemistry, followed by a PhD (from 2000 to 2003) at the University of Bonn, Germany, concerning the construction and utilization of ligand-responsive ribozymes for assaying biomolecular interactions. He then spent two years as a postdoc with Eric Kool at Stanford University. End of 2005 he moved to the University of Konstanz in order to start his own research group. Interests include the generation of artificial riboswitches based on self-cleaving ribozymes and the study of structures and functions of non-canonical nucleic acid motifs such as quadruplexes. Jörg Hartig wastenured to full professor in 2011.



Capture and Identifi cation of Genomic G4 DNA Binding Proteins

Linda B. McGown, Tian Zhang, Huiping ZhangRensselaer Polytechnic Institute

[email protected]

The role of three-dimensional genomic architecture in gene regulation has become a topic of intensive investigation in recent years. In particular, there has been extensive speculation about possible roles of in vivo G-quadruplex (G4) formation in nuclear processes. Interest has been fueled by discovery of ever-increasing numbers of G4-forming genomic sequences with putative links to genomic function and of proteins that exhibit some function or activity related to G4 structures. We have been using a combination of in vitro affi nity protein capture strategies followed by studies to determine if the same capture occurs in the nuclei of live, cultured cells in order to identify proteins that are candidates for in vivo G4 binding. In particular, we are studying protein capture by G4-forming sequences from human oncogene promoter regions. This talk will describe our approach and its application to the breast cancer oncogene ERBB2 (HER2/neu). The goal is to obtain new insight into breast cancer gene regulation that will lead to earlier diagnosis and identifi cation of new therapeutic targets. In a broader context, the research may establish new approaches to in vivo interrogation of molecular architecture in gene regulation.



Design of New Strategies Involving Nucleic Acid Quadruplexes to Inhibit the KrasOncogene in Cancer Cells

Luigi E. XodoDepartment of Medical and Biological Sciences, University of Udine, 33100 Udine, Italy

[email protected]

To design new molecular approaches to pancreatic cancer, we focused on two structural elements of the KRAS gene, which is mutated in > 90% of pancreatic tumors and plays a key role in the pathogenesis of the disease.

First, the promoter of KRAS, upstream of TSS, contains a 32-mer G-element showing a high structural polymorphism. Within this sequence we identifi ed 3 motifs, each forming a stable G-quadruplex. We found that the KRAS quadruplexes interact with several proteins including MAZ: a nuclear factor that activates the transcription of the gene. As the dysregulated proliferation of pancreatic cancer cells depends on the expression of this oncogene, we have hypothesized that this gene can be repressed by a decoy strategy, by using oligonucleotides mimicking the KRAS G-quadruplex with the highest affi nity for MAZ (G4 decoys). To increase their stability and nuclease resistance, the G4-decoys were synthesized with LNA modifi cations at the 3’-end and with two para-TINA insertions [TINA=(R)-3-((4- (pyren-1-ylethynyl)benzyl)oxy) propane-1,2-diol], stacking externally to the G-tetrads. The activity of the designed G4-decoys in pancreatic Panc-1 cells and their capacity to inhibit the growth of Panc-1 tumor xenograft in SCID mice will be presented.

Second, the KRAS oncogene is transcribed into a mRNA containing a 192-nt untranslated region (5’-UTR) at the 5’-end, which is conserved in mammals. This untranslated exon, being characterized by repetitive blocks of two-guanines (45% guanines), can potentially form a cluster of G4-RNA structures. These folded structures have a high affinity for tri-meso(N-methyl-4-pyridyl), meso(N-tetradecyl-4-pyridyl) porphine (TMPyP4-C14): a cationic porphyrin that effi ciently penetrates the cell membranes and accumulates in the cytoplasm. Upon photoactivation, TMPyP4-C14 generates reactive oxygen species that degrades RNA, thus causing a dramatic reduction of the KRAS protein. This results in a signifi cant arrest of pancreatic cancer cell proliferation and the retardation of Panc-1 tumor growth in SCID mice.



Catalytic and Switching Properties of DNA G-Quadruplexes

Dipankar SenSimon Fraser University, British Columbia, Canada

[email protected]

I will describe catalytic DNAs and RNAs that exploit the unique physical and chemical properties of G-quadruplexes for their activity, as well as mechano-electronic DNA switches, that take advantage of the unique charge conduction properties of G-quadruplexes. The catalysts include a photolyase DNAzyme, that catalyzes the repair of a thymine dimer photo-lesion in a DNA substrate using UV and violet light; and, DNA and RNA G-quadruplexes complexed with Fe(III)-heme, that show a range of 1-electron and 2-electron oxidation catalytic activities (comparable to the peroxidase and Cytochrome P450 protein enzymes). I will also describe a variety of electronic and mechatronic switches that can be constructed using DNA G-quadruplexes, which should find application in DNA-based nanotechnologies.

Dipankar Sen is Professor in the departments of Molecular Biology &Biochemistry (MBB) and Chemistry, at Simon Fraser University, Canada.He received his Bachelor’s degree in Natural Sciences at the University of Cambridge, a Ph.D. in Chemistry from Yale University, and received postdoctoral training with Nobel laureate Walter Gilbert at Harvard University. His research interests include the fundamental physical and chemical properties of the Nucleic Acids, as well as creation of novel catalysts and devices out of DNA and RNA.



Interplay between Cation and Ligand Binding to G-Quadruplexes: Insight from Mass Spectrometry

Adrien Marchand,1,2 Frédéric Rosu,1 Valérie Gabelica1,2

1 Univ. Bordeaux, Institut Européen de Chimie et Biologie (IECB), F-33600 Pessac, France2 Inserm, U869, ARNA Laboratory, F-33000 Bordeaux, France

[email protected]

Mass spectrometry has the capability to separate complexes according to their mass with high resolution. Hence, complexes with zero, one, two or more ligands and complexes with zero, one, two or more cations can be distinguished and quantifi ed. Usually mass spectrometry studies focus on the detection of total amounts of complexes with ligands, independently of the number of bound cations, to determine equilibrium binding constants. Here, after an introduction on the principles underlying ammonium ion preservation in G-quadruplexes in mass spectrometry,1,2 we will focus on the number of ammonium cations detected in the free and ligand-bound forms of G-quadruplexes.

Ammonium ion preservation depends on instrumental parameters, on the sequence under study,1 and on the conformation adopted by the sequence.2 The latter point is important because it offers a means of detecting conformational changes that occurred in solution. This approach has been validated by circular dichroism spectroscopy and ion mobility spectrometry,2 and applied to monitor co-solvent induced conformational changes in 12-mer telomeric DNA G-quadruplexes.3

When comparing the ammonium ion distribution between ligand-free and ligand-bound telomeric G-quadruplexes, two cases can occur: (1) ligand binds without changing the number of ammonium ions bound, and in that case we interpret the binding as external and non-disruptive for the G-quartets, or (2) ligand binds and changes the number of ammonium ions bound, and in that case ligand-induced conformational changes to the G-quadruplex can be envisaged as a possible explanation. We will present recent examples showing ligand-induced structural transitions towards either antiparallel structures with two G-quartets indicated by the predominance of the 1-NH4 peak,4,5 or towards parallel structures with a stabilization of two inner ammonium ions.5 Ligands could therefore be classified according to their binding affi nities and their ability to induce structural transitions.

Acknowledgements: We thank Marie-Paule Teulade Fichou, Anton Granzhan, and Daisuke Miyoshi for sharing ligands 360A, TrisQ, PhenDC3, PhenDC6 and Thiofl avin T, and for fruitful discussion. This work was supported by the Fonds de la Recherche Scientifique-FNRS (research associate position and FRFC grant 2.4528.11 to VG), Inserm (ATIP-Avenir grant R1286GS), CNRS (Mission pour l’Interdisciplinarité), EU (FP7-PEOPLE-2012-CIG n°333611) and Conseil Régional d’Aquitaine (n° 2012-1304005).

References :1. Balthasart, F.; Plavec, J.; Gabelica, V., J. Am. Soc. Mass Spectrom. 2013, 24, 1.2. Ferreira, R.; Marchand, A.; Gabelica, V., Methods 2012, 57, 56.3. Marchand, A.; Ferreira, R.; Tateishi-Karimata, H.; Miyoshi, D.; Sugimoto, N.; Gabelica V., submitted.4. Gabelica, V.; Maeda, R.; Fujimoto, F.; Yaku, H.; Murashima, T.; Sugimoto, N.; Miyoshi, D., submitted.5. Marchand, A.; Granzhan, A.; Teulade-Fichou, M.-P.; Gabelica, V., in preparation.



Raman Spectroscopic Studies of G-quadruplexes at High DNA Concentration

Peter Mojzeš,1 Jan Palacký,1,2 Michaela Vorlíčková,3 Martin Golan,1 Iva Kejnovská3

1 Charles University in Prague, Faculty of Mathematics and Physics, Prague, Czech Republic2 Palacky University in Olomouc, Faculty of Medicine, Olomouc, Czech Republic

3 Institute of Biophysics, ASCR, Brno, Czech [email protected]

A wide range of experimental methods is currently used for investigation of G-quadruplex structures, their structural transitions and properties of their complexes with other molecules. Although X-ray diffraction and nuclear magnetic resonance undoubtedly remain the ultimate sources of the absolute quadruplex structures at atomic resolution, majority of our knowledge about structural transitions and thermodynamic properties of G-quadruplexes comes from structurally-indirect methods of optical spectroscopy (UV-VIS absorption, electronic CD, fl uorescence), calorimetry, gel electrophoresis and mass spectroscopy, often in sophisticated combinations with various methods of molecular biology and chemical probing. Other methods of optical spectroscopy, e.g. infrared absorption, vibrational CD and Raman scattering, are still rather infrequent, in spite of their considerable informational potential.

The aim of the present contribution is to persuade the audience interested in G-quadruplex studies that Raman spectroscopy can be useful in their research, especially for studies of quadruplex properties at wide range of DNA concentrations. As inside the cells conditions of molecular crowding prevail, a question about the effect of high DNA concentration on the quadruplex topology arises. To solve the problem, in vitro studies at high DNA concentrations would be desirable. However, high DNA concentrations are hardly accessible by UV-VIS absorption and CD spectroscopy because of high optical densities. Therefore, the molecular crowding conditions are often simulated by addition of various cosolutes. However, the exact role of the cosolutes in the quadruplex transitions is unclear, since structural changes may be ascribed to dehydration caused by the cosolutes, instead of a simple molecular crowding. As Raman spectroscopy can be easily applied to a wide range of DNA concentrations ranging from aqueous solutions still accessible to absorption and CD up to highly concentrated gels and even crystals, it offers a unique possibility to study the crowding effects induced solely by DNA itself. Raman spectroscopy can thus bridge, in a methodologically consistent way, an informational gap between experimental methods restricted to low and high DNA concentrations.

Usability of Raman spectroscopy for quadruplex studies will be demonstrated on structural polymorphism of human telomeric sequences controlled by DNA concentration1. In combination with multivariate statistical methods of data treatment, Raman spectroscopy will be presented as practical mean for determination of quadruplex melting profiles within wide range of DNA concentrations, providing more detailed structural information and better insight into the melting process than the profi les from absorption measurements.

References1. Palacký J. et al., Nucleic Acids Res. 41, 2013, 1005-1016.



Photocrosslinking Quadruplex DNA

Daniela Vergaa,b, Florian Hamonb, Florent Poyet, bSophie Bombardc

and Marie-Paule Teulade-Fichoub

a) Department of Chemistry, Chair of Organic Chemistry & Cellular Chemistry, University of Konstanz, 78457 Konstanz (Germany); b) CNRS UMR 176, Institut Curie, Centre Universitaire, Bâtiment 110, 91405 Orsay (France); c) Laboratoire de Chimie et Biochimie Pharmacologiques et Toxicologiques,

CNRS-UMR8601, Universite´ Paris Descartes, 45 rue des Saints-Pères, 75006 Paris, France. [email protected]

Oligonucleotides containing runs of three or four adjacent guanines may arrange in four-stranded DNA supramolecular structures called G-quadruplexes (G4s).1 These non-canonical structures have been found in functional genomic regions, suggesting possible functional roles in multiple processes, such as telomere maintenance, replication, transcription and translation.2 G-quadruplex DNA can be stabilized by small synthetic molecules sharing common features: potential for a planar conformation and the presence of cationic or protonable moieties.3 Up to date, most G4 ligands bind their DNA target by non covalent interactions in a reversible binding process.3,4 Beside non covalent G4 binders, hybrid ligands able to establish a stronger interaction with quadruplexes were developed by using the ability of transition metal cations (Pt2+, Pd2+) to coordinate to heterocyclic nucleic bases,5 and more recently hybrid G4-binders bearing a mild chemically activatable alkylating moiety have been reported.6 To investigate the possibility of photo-triggering the alkylation of G-quadruplex structures, we developed hybrid agents possessing a validated G4 binding motif (the bisquinolinium PyridoDiCarboxamide PDC-360A) tethered to a photoreactive group. Two well-known G-quadruplex structures were chosen as targets: the human telomeric sequence (22AG) and the oncogene promoter c-myc sequence (myc 22/G4T-G23T-). Remarkably, the new derivatives retained the high quadruplex vs duplex selectivity of the PDC core which resulted in selective alkylation of G-quadruplexes in harsh competition conditions.The presence of two structurally different photoactivatable functions, allowed us to selectively alkylate G-quadruplex structures on specific nucleobases and to stabilize them irreversibly. Cellular results are promising since only irradiated compounds are cytotoxic.7

References: 1. a) D. J. Patel, A. T. Phan, V. Kuryavyi, Nucleic Acids Res. 2007, 35, 7429-7455; b) J. B. Chaires, FEBS J. 2010, 277, 1098-1106; 2. a) H. J. Lipps, D. Rhodes, Trends Cell Biol. 2009, 19, 414-422; 3. D. Monchaud, M.-P. Teulade-Fichou, Org. Biomol. Chem. 2008, 6, 627-636; 4. a) G. W. Collie, R. Promontorio, S. M. Hampel, M. Micco, S. Neidle, G. N. Parkinson, J. Am. Chem. Soc. 2012, 134, 2723-2731; b) M. Petenzi, D. Verga, E. Largy, F. Hamon, F. Doria, M. P. Teulade-Fichou, A. Guedin, J. L. Mergny, M. Mella, M. Freccero, Chemistry 2012, 18, 14487-14496; 5. H. Bertrand, S. Bombard, D. Monchaud, E. Talbot, A. Guedin, J.-L. Mergny, R. Grunert, P. J. Bednarski, M.-P. Teulade-Fichou, Org. Biomol. Chem. 2009, 7, 2864-2871; 6) F. Doria, M. Nadai, M. Folini, M. Scalabrin, L. Germani, G. Sattin, M. Mella, M. Palumbo, N. Zaffaroni, D. Fabris, M. Freccero, S. N. Richter, Chem.--Eur. J. 2013, 19, 78-81.7) D.Verga, F.Hamon, S.Bombard, M.-P. Teulade-Fichou submitted.



The BCL-2 Promoter DNA i-Motif Exists in a Dynamic State That Allows for Transcriptional Regulation and Drug Targeting to Produce Chemosensitization

Samantha Kendrick,1 Hyun-Jin Kang,2 Prashansa Agrawal,2 Danzhou Yang,1–3 Sidney M. Hecht,4,5 and Laurence H. Hurley1–3

1Arizona Cancer Center, University of Arizona, Tucson, Arizona 85724 2College of Pharmacy, University of Arizona, Tucson, Arizona 85721

3BIO5 Institute, University of Arizona, Tucson, Arizona 857214Center for BioEnergetics, Biodesign Institute, Arizona State University, Tempe, Arizona 852875Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287

[email protected]

In this presentation I will show that the intrinsic dynamic state of the i-motif, similar in many respects to the dynamic nature of RNA, makes the dynamic equilibrium of the non-canonical DNA structure an attractive target for small molecule control of gene expression. The BCL-2 promoter region forms two secondary DNA structures, the G-quadruplex and i-motif. We identifi ed a nuclear protein (hnRNP LL) and a steroid (IMC-76) that activates or silences transcription, respectively, by binding to the i-motif in a mutually exclusive manner. hnRNP LL recognizes the i-motif and subsequently unfolds it, enabling transcription to proceed. The steroid binds to a fl exible hairpin that is in dynamic chemical equilibrium with the i-motif. Binding of the steroid to the hairpin precludes binding of hnRNP LL to the i-motif; consequently, transcription is silenced. Combination of the steroid with etoposide or cyclophosphamide in lymphoma cells and in a SCID mouse lymphoma model, which both overexpress BCL-2, produced a signifi cant chemosensitization effect. We show the unexpected dynamic nature of the DNA i-motif, akin to that associated with RNA secondary structures, and defi ne a novel strategy for modulating gene expression using small molecules. This brings the i-motif into focus as an alternative structure to the G-quadruplex in promoter elements as a therapeutic target. It is anticipated that the tools of the medicinal chemist can be harnessed to identify additional molecules that function at this locus to control gene expression.



Promoter DNA G-Quadruplexes and Their Interactions with Small Molecules

Danzhou YangProfessor, College of Pharmacy, University of Arizona, Tucson, AZ 85721

Dept of Chemistry and Biochemistry, University of Arizona, Tucson, AZ 85721Comprehensive Member, Arizona Cancer Center, Tucson, AZ 85724

Faculty Member, BIO5 Institute, University of Arizona, Tucson, AZ [email protected]

DNA G-quadruplex secondary structures formed in specific G-rich sequences, in particular, those formed in gene proximal promoter regions as transcriptional regulators, have recently emerged as a new class of cancer-specifi c molecular targets for cancer therapeutics. In my talk, I will discuss our recent progress on structural studies of the promoter G-quadruplexes and their interactions with small molecule compounds.



Parallel-Stranded Quadruplex Structures of Recombination Hotspotsfrom Human and Prokaryotic Genomes

Vitaly V Kuryavyi and Dinshaw J PatelSloan-Kettering Institute for Cancer Research, New York, USA

[email protected]

Replication, transcription, repair and recombination are four major aspects of DNA function in the cell. While complementary interactions between information donor and information recipient strands are essential for replication, repair and transcription, DNA recombination does not necessarely require them.

Various topologies of Holliday Junctions (HJ) that coordinate four strands engaged in recombination have been put forward within the paradigm of double-stranded DNA structure and under assumption that crossing-over between two DNA duplexes takes place in an arbitrary genomic spot. Genetic evidences have revealed thereafter that recombination occurs not randomly, but in specific places called “hotspots”. In the context of a hotspot, recombination through a HJ intermediate encounters a diffi culty known as “hotspot resolution paradox”: recombinational repair of a hotspot sequence on a coldspot template destroys the hotspot sequence as a result.

High-resolution genetic maps of human genome obtained recently show that most often occuring meiotic recombination hotspot sequences are G-rich. The classic hotspot recombination sequence χ from E.coli and H.infl uenzae is also G-rich. Prior to recombination, hotspot sequences in eu- and prokaryotes are processed into a singlestranded form. We present NMR solution structures of major recombination hotspot from the human genome and the structures adopted by G-rich χ sequence from bacteria. Non-templated recombination mediated by a quadruplex structure preserves the hotspot sequence. A G-quadruplex that coordinates four DNA strands offers an alternative structural design for HJ recombination intermediate which might be involved at the sites of programmed genome rearrangements.



Insights into Molecular Recognition of G-quadruplexes

Brahim Heddi, Wan Jun Chung, Vee Vee Cheong, Herry Martadinata and Anh Tuân PhanSchool of Physical and Mathematical Sciences, Nanyang Technological University, Singapore.

[email protected]

Analysis of human genome reveals a scattered distribution of G-rich sequences; in vitro those sequences are able to form four-stranded structure called G-quadruplexes. Occurring relevance of such nucleic acid configuration in vivo has been elusive, until recent years where several studies have shown their biological importance. However, little is known about the molecular recognition of G-quadruplexes either by small molecules or by proteins. In this study, we highlight some of these recognition principles using solved G-quadruplex complexes.



Replication: RPA To Unfold G4 and G4 to Direct Origins

Jean-François RiouStructure des Acides Nucléiques, Télomères et Evolution, Inserm U565, CNRS UMR 7196,

Muséum National d’Histoire Naturelle, 43 rue Cuvier 75231 Paris cedex 05, [email protected]

G-quadruplexes (G4) is a growing fi eld of investigation for a number of laboratories in cell biology, pharmacology and biophysics. Their implication in cancer therapy using specific compounds targeting telomere replication has been widely explored during the last decade. Additional pieces of evidences sustain their involvement in a more general mechanism to control transcription, splicing and translation. Due to the high polymorphism of DNA and RNA G4, it has been suggested that G4 represent a new level of regulation of nucleic acids metabolism besides epigenetic modifi cations. Since G4 may represent a potentially diffi cult structure to solve, their involvement in multiple processes thus explain the large number of conserved proteins able to bind and/or unfold them. Their regulation and the control of their dynamic between folded and unfolded states certainly represent the clue for their conserved function during evolution.Replication protein A is a single-stranded DNA binding protein that plays essential role in telomere maintenance. RPA is able to bind and to unfold G4 formed in telomeric DNA in order to permit its replication. To unravel the mechanism of binding and opening of telomeric G4 by RPA, we used a combination of biochemical and biophysical approaches compiling the use of small G4 molecules and photocrosslinking probes. Our results led us to propose a novel model in which RPA approaches the G4 from its 3’ extremity and opens it with a non conventional 3’-5’ extension, positioning the RPA2 subunit on the 3’ end and the RPA1 subunit along the central part of the unfolded DNA, and permitting the binding of a second RPA at the 5’ extremity, through RPA11.Genome-wide studies in vertebrates have recently identified a consensus G-rich motif potentially able to form G4 in most replication origins. We bring now evidences, thanks to a unique ability to manipulate DNA sequences in avian DT40, that G4 are directly involved in the choice and the modulation of the replication origin fi ring, together with a 200 bp cis-regulatory element2.In conclusion, our studies confirm the predicted role of G4 in replication initiation and reveal the unusual mechanism of binding of RPA to unfold G4.References :1 Safa, L., Delagoutte, E., Petruseva, I., Alberti, P. Lavrik, O., Riou, J.F. and Saintomé, C. The molecular assembly of hRPA subunits at telomeric G-quadruple DNA: a small molecule and photo-crosslinking approaches, submitted. 2 Valton, A.L., Hassan-Zadeh, V., Lema, I., Boggetto, N., Alberti, P., Saintomé, C., Riou, J.F. and Prioleau, M.N. A consensus sequence determines replication start sites in vertebrates, submitted.

Jean-François Riou is Professor at the Muséum National d’Histoire Naturelle in Paris (France). He graduated from the School of Pharmacy (Paris) and got is Ph.D. in Molecular and Cellular Pharmacology (university Paris VI) in 1986 under the supervision of J.B. Le Pecq. He went for a postdoctoral with J.C. Schwartz on dopaminergic receptors and got an Assistant Professor position. Afterwards he was hired in 1989 to manage the Molecular Pharmacology department in Rhône-Poulenc (then Aventis) to work on taxoids, topoisomerase inhibitors and to initiate the G4 approach. In 2001, he joined Reims University to focus his research on G4 ligands. He moves to the Muséum in Paris in 2007 and now is in charge of the Muséum INSERM-CNRS unit.



The Use of Ciliated Protozoa to Study the Regulation of G-Quadruplex Structures in Vivo

Hans J. Lipps1 and Daniela Rhodes2

1Institute of Cell Biology, University Witten/Herdecke, Witten, Germany [email protected]

2School of Biological Sciences, Nanyang Technological University, Singapore [email protected]

Ciliated protozoa were the fi rst model systems to study telomere structure and function. During sexual reproduction, the macronuclear genome is fragmented into short DNA-molecules (nanochromosomes), each being terminated by a telomere. One macronucleus contains about 108 telomeres and consequently a high concentration of telomeric DNA within a single cell. In addition, DNA replication takes place in a morphological distinct region, the replication band, allowing the study of the behaviour of replicating DNA in situ. We have made use of these unicellular organisms to analyze the presence and regulation of G-quadruplex structure in vivo.Using highly specifi c anti-G-quadruplex antibodies to probe the macronucleus of ciliates, we provided the fi rst direct evidence that G-quadruplex structures are present at telomeres in vivo1, and that their formation is cell-cycle regulated. Throughout the cell cycle ciliate telomeres are associated with two telomere-binding proteins (TEBP, TEBP), telomerase and a telomerase-associated helicase. TEBP homologous to the human POT1, binds to the 3’-G-overhang of telomeres and recruits TEBP a homologue to the human TPP1, which in turn folds the telomeric 3’-overhang into the antiparallel G-quadruplex structure. During S-phase, TEBP becomes phosphorylated and this results in the recruitment of telomerase and a telomerase-associated helicase, resulting in the G-quadruplex structure unfolding during replication 2-5. During interphase, telomeres in their G-quadruplex conformation bind to the nuclear matrix or skeleton, via an interaction of TEBP with three proteins of this subnuclear structure. Phosphorylation of the matrix proteins releases telomeres from the nuclear matrix, which coincides with telomeric G-quadruplexes becoming resolved6.Furthermore, a number of ligands have been described to stabilize or induce telomeric G-quadruplex structure. Since telomeric G-quadruplexes become resolved during replication, ciliates provide a useful cell system for the study of the effect and functioning of such ligands in situ.References1. Schaffi tzel et al. (2001) Proc. Natl. Acad. Sci. 98, 8572-85772. Paeschke et al. (2005) Nat. Struct. Mol. Biol. 12, 847-8543. Paeschke et al. (2008) Nat. Struct. Mol. Biol. 15, 598-6044. Postberg et al. (2012) Gene 12, 147-1545. Lipps, H.J. and Rhodes, D. (2009) Trends Cell Biol. 19, 414-4226. Paeschke et al. (2008) Chrom. Res. 16, 721-726

Hans J. Lipps is full professor for cell biology at the University Witten/Herdecke, Germany. He received is Diploma and PhD in Biology at the University Tübingen and worked as a postdoctoral fellow at the Institute of Animal Genetics, Edinburgh and the MRC LMB, Cambridge. He was visiting professor at the University of Colorado and the University of Rome. His research interests are telomere structure, chromatin and the epigenetic regulation of cell differentiation .



Structure of Active Dimeric Human Telomerase

Anselm Sauerwald, Sara Sandin, Gaël Cristofari, Sjors H W Scheres, Joachim Lingner & Daniela Rhodes 1,2

1MRC Laboratory of Molecular Biology, Hills Road, Cambridge,UK2Nanyang Technological University, School of Biological Sciences, Singapore

[email protected]

Telomeres, the protein–DNA complexes that cap the ends of eukaryotic chromosomes, are essential for genome stability and cell viability. In eukaryotes, telomere length is maintained by telomerase, a specialized reverse transcriptase that adds TTAGGG repeats to the chromosome ends. The telomerase enzyme consist a large RNA subunit, TER, and a protein catalytic subunit, TERT. Telomere maintenance in the majority of human cancer cells involves the activation of telomerase.

I will report the fi rst determination of the three-dimensional structure of the active full-length human telomerase dimer, determined by single-particle EM. Telomerase has a bilobal architecture with the two monomers linked by a flexible interface. The monomer reconstruction at 23-Å resolution and fitting of the atomic structure of the Tribolium castaneum TERT subunit into the EM density, reveal the spatial relationship between RNA and protein subunits, providing important insights into telomerase architecture. The structural information is supported by biochemical and labeling data that show that in vivo–assembled human telomerase contains two TERT subunits and binds two telomeric DNA substrates. Remarkably, we demonstrate that catalytic activity requires both TERT active sites to be functional, which demonstrates that human telomerase functions as a dimer.

References1. Anselm Sauerwald, Sara Sandin, Gaël Cristofari, Sjors H W Scheres, Joachim Lingner & Daniela Rhodes, Structure of active dimeric human telomerase, (2013) NSMB 4: 454-460



Structural Conversion of G-quadruplex, in Solution and in Cell

Ta-Chau Chang,1,2,3

1 Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C2 Department of Chemistry, National Taiwan University, Taipei 106, Taiwan, R.O.C

3 Institute of Biophotonics, National Yang-Ming University, Taipei 106, Taiwan, [email protected]

Recently, the in cell studies of Human telomere G-quadruplex (G4) formation have attracted more attention in the G4 field. However, one of the main challenges in the structural studies of human telomeric G-rich sequences is the variety of structures and, moreover, the possible interconversion between them upon the change of environmental condition. Thus, it is of interest to monitor whether structural conversion of human telomere G4s occurs in solution and in cell. In this work, we first show that G4s can undergo Na+/K+-dependent structure conversion; however, detailed understanding of the underlying mechanism has been limited not least because of the lack of sufficient structural information at different stages along the conversion process for one given oligonucleotide. We have determined the topology of the Na+ form of the Tel23, d(TAGGG(TTAGGG)3), which turns out to be the same hybrid form as the K+ form of Tel23 G4 despite the distinct spectral patterns in their respective NMR and CD spectra. We present the fi rst example of DNA G4 for which the topologies of the Na+ and K+ forms have been determined in solution. In addition, a G4 ligand, named BMVC-8C3O [Wang & Chang, Nucleic Acids Res., 40, 8711 (2012)], is used to induce the structural conversion of Tel23 G4 from hybrid to parallel form for comparison. We then apply the small fl uorescence probe, BMVC and dye-label oligonucleotide strategy to verify the structural conversion of human telomeric G4 in cell. We monitor the cellular uptake of Tel23 G4 and map its intracellular localizations in living cells. We further detect the structural conversion of Tel23 G4 induced by BMVC-8C3O in CL1-0 living cell. Our results are not only provide a new insight to the mechanism of Na+/K+ structural conversion of human telomeric G4s but also introduce the fi rst in cell example of structural conversion of human telomere G4 induced by a novel ligand, and opens a new venue for a rational design of selective G4 ligands.



Molecular Crowding Effects on Functions of G-Quadruplex Ligands

Hidenobu Yaku, Takashi Murashima, Hisae Tateishi-Karimata, Shu-ichi Nakano, Naoki Sugimoto, Daisuke Miyoshi

Faculty of Frontiers of Innovative Research in Science and Technology (FIRST) and FrontierInstitute for Biomolecular Engineering Research (FIBER), Konan University, 7-1-20

Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, [email protected]

G-quadruplex-ligands have attracted great interest as a promising new class of anticancer drugs. Pioneering studies elucidated a basis for designing such G-quadruplex-ligands. However, many drug candidates, including some G-quadruplex-ligands, do not exert the desired activity in vivo even though their in vitro properties are promising. This divergence is at least partly due to differences between in vitro and in vivo conditions. Thus, for the rational design of drugs and ligands, one should consider how intracellular factors might influence drug action. Biomolecules in living cells exist at a high concentration (400 g/L), which is known as ‘molecular crowding’ (MC), despite diluted solution under test tube conditions 1. MC critically affects properties and reactions of biomolecules, including DNA G-quadruplex2-4, by altering properties of the solution, including a decrease in the dielectric constant and water activity and an increase in viscosity and excluded volume.

Here, we aimed to identify those structural features of G-quadruplex-ligands that specifi cally facilitate G-quadruplex-ligand binding and telomerase inhibition under conditions of MC, which are presumed to be similar to conditions in living cells. For this purpose, we systematically studied the properties of four typical G-quadruplex-ligands, which differ in the size of the π-planar core and the charge of the functional groups; specifi cally, we examined two cationic G-quadruplex-ligands and two anionic G-quadruplex-ligands (Fig. 1).

Binding assays with the cationic ligands showed that electrostatic attractions made little contribution to binding between the ligand and G-quadruplex under MC conditions; electrostatic attractions have been considered essential for binding under test tube conditions. As a result, telomerase inhibition of cationic ligands was reduced with MC. On the contrary, the binding affinity of the anionic G-quadruplex-ligands was not infl uenced by MC, indicating that π-π stacking interactions were able to maintain their affinity with G-quadruplex under conditions of MC. This feature of the anionic ligands resulted in effi cient inhibition of telomerase activity even with MC. These results highlight the importance for rational drug design of considering how intracellular environmental factors affect the function and activity of ligands.References1. D. Miyoshi and N. Sugimoto, Biochimie, 90, 1040 (2008).2. D. Miyoshi et al., J. Am. Chem. Soc., 131, 3522 (2009).3. H.-Q Yu et al., J. Am. Chem. Soc., 134, 20060 (2012).4. T. Fujimoto et al., J. Phys. Chem. B, 117, 963 (2013).



Quadruplex Nucleic Acids as Targets for Anticancer Drug Design

Stephen NeidleSchool of Pharmacy, University College London, London WC1N 1AX, UK

[email protected]

The folding, topology and detailed structures of quadruplex nucleic acids are highly variable, and depend on the nature and size of the guanine tracts, as well as other factors such as the sequence and length of the intervening sequences. Experimental structures are currently available from crystallographic and NMR studies for a small number of quadruplex types. The small number of tertiary structures established to date for promoter quadruplexes exemplify this structural diversity, which is important for therapeutic target considerations. Of continuing interest (and controversy) continues to be those quadruplexes formed by human telomeric DNA (and RNA) sequences, which comprise repeats of the sequences d(TTAGGG) or r(UUAGGG). Although it is not currently possible to reliably predict complex quadruplex folds from primary sequence, some general features are emerging, which will be discussed during this presentation.

Small molecules that stabilise telomeric and oncogene promoter quadruplexes can have anti-proliferative effects that generally relate to their effectiveness in binding quadruplexes and their ability to discriminate between these structures and duplex DNA. A structure-based approach to optimizing these properties will be presented using libraries of substituted naphthalene diimides as exemplars. In particular the stages in identifying a lead tetra-substituted naphthalene diimide compound with signifi cant activity against human pancreatic cancer cells will be described.

Stephen Neidle is the Professor of Chemical Biology and Research Director at the School of Pharmacy, University College London and was previously Professor of Biophysics and Dean at the Institute of Cancer Research UK for a number of years. He is a graduate of Imperial College London (DSc, PhD). His current interest include:•cancer and anti-infective drug discovery, especially of novel agents interacting with and recognizing nucleic acids.•X-ray crystallography and molecular modeling of nucleic •structure-based drug design of small molecules targeting nucleic acids.•the role of water in stabilizing nucleic acid structures



Posters


Binding of Carbazole Ligands to Quadruplexes of Human Telomeric Sequence (22Htel) – Spectroscopic and Computational Studies, Biological Activity

Agata Głuszyńska1, Ewa Rajczak1, Bernard Juskowiak1, Błażej Rubiś2, Maria Rybczyńska2, Martyna Kuta3, Marcin Hoffmann3

1 Laboratory of Bioanalytical Chemistry, Faculty of Chemistry, Adam Mickiewicz University, Umultowska 89b, 61-614 Poznan, Poland

2 Department of Clinical Chemistry and Molecular Diagnostics, University of Medical Sciences, Przybyszewskiego 49, 60-355 Poznan, Poland

3 Laboratory of Quantum Chemistry, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60-780 Poznan, Poland

[email protected]

Small molecules can noncovalently interact with DNA via intercalation or minor groove. Since the first report on G-Quadruplexes activity (inhibition of human telomerase) in 1997, the number and diversity of “G-quadruplex ligands” has grown rapidly, but until now only a few carbazole derivatives have been studied.

Our research group is interested in synthesis of small carbazole ligands, which can bind to higher structures of DNA. Two ligands, synthesized via the Knoevenagel type of condensation, were used in the preliminary comparative study of binding of carbazole derivatives to quadruplexes of human telomeric sequence 5’-AGGG(TTAGGG)3-3’ (22HTel) (Figure 1).

I-

N

S

N+

I-

N

S

N+

N

N

NLigand 1 Ligand 2

Figure 1. Structures of ligands used in this study

The effects of the ligands interaction with DNA were studied by spectroscopic methods: pectrophotometry UV-Vis (Scatchard analysis of titration data, melting measurements), spectrofluorymetry, circular dichroism. The anticancer properties of these compounds have been studied in vitro (IC50 ca. 1.5 μM). Experimental research have been completed by the theoretical studies.

Acknowledgement: This work was supported by the Foundation for Polish Science in the framework of the PARENT-BRIDGE programme (the project: “Synthesis of new carbazole ligands, potential inhibitors of telomerase in antitumor therapy”).

Poster 18


Xanthene and Xanthone Derivates as G-Quadruplex Stabilizing Ligands:ESI-MS and FRET Studies on G-Quadruplex Forming OligonucleotidesAlessandro Altieri1, Antonello Alvino1, Stephan Ohnmacht2 , Stephen Neidle2,

Armandodoriano Bianco1, Marco Franceschin1

(1) “Sapienza” Università di Roma, Dipartimento di Chimica, Piazzale Aldo Moro5, 00185 Roma,Italy(2) The School of Pharmacy, University of London, 29-39 Brunswick Square, WC1N 1AX, London, UK

[email protected]

The G-quadruplex structure which is attributed to a Hoogsteen base pairs, forming of guanine-rich base sequences, has attracted attention as a genetic control element, because G-quadruplex formation most likely occurs in living cells. In addition, water soluble molecules can regulate the thermodynamics of G-quadruplex formation, thus inducing effects on cell proliferation. In the literature, there are numerous examples of molecules that have been shown to form non covalent adducts with DNA G-quadruplexes in vitro.1These molecules are characterized by an aromatic core which favours stacking interactions with the G-tetrads and, in most cases, by basic positively charged side chains, which interact with the quadruplex loops and helix grooves.2

Recently, we have designed and synthesized a series of xanthene and xanthone hydro-soluble derivatives to test an additional simple aromatoid moiety. The affinity of these ligands at various concentrations towards different DNA structures, was studied by ESI-MS measurements3 and FRET

assay4.

Mass spectrometry is a method of choice for the determination of the stoichiometry of supramolecular assemblies. It has found numerous applicat ions in the field of G-quadruplexes as well since G-quadruplexes form stable structures in ammonium acetate, a volatile buffer compat ib le wi th e lec t rospray mass spectrometry (ESI-MS).

We have found that our molecules are able to bind and stabilize the four-stranded structure. Moreover, we have also studied the selectivity of these compounds between

G-quadruplex over duplex DNA. In fact, the selectivity is surely a highly relevant topic and could be related to the specifi city of the biological activity of these compounds.

The experimental results were rationalized with appropriate computational studies: the binding-mode of each ligand molecule with the G-quadruplex DNA has been investigated by docking studies using Autodock 4.1 software.

References1 M. Franceschin, Eur. J. Org. Chem. 2009 14 2225.2 Neidle, S.; Nat. Rev. Drug Discov. 2002, 1, 383.3 a) Rosu F. J. Mass Spectr. 2006; 253. b) V. Casagrande, J. Mass Spectrom. 2009, 44, 530.4 Mergny, J. Chembiochem 2001, 2, 124.

Poster 19


SELEX and G-quadruplexes: the Hidden LinksA. Renaud de la Faverie, A. Guédin, S. Amrane, A. Bedrat, J-L. Mergny

1. University of Bordeaux, ARNA laboratory, F-33000 Bordeaux, France.2. INSERM, U869, IECB ARNA laboratory, F-33600 Pessac.

[email protected]

The combinatorial procedure named SELEX (Systematic Evolution of Ligands by EXponential enrichment) is a technique that allows the identification of new DNA or RNA molecules–so-called aptamers-which possess a high affi nity or a special activity for a target. A chemical bank of nucleic acids with a random sequence is used, and several rounds of selection and amplification are done. The target can be proteins, known to fi x nucleic acids (like polymerases, transcription factors) or not, but also small organic molecules, nucleic acids, whole cells … In the literature, one can interestingly notice that a lot of aptamer can adopt a particular structure named G-quadruplex or G4.

Indeed, guanine-rich nucleic acid sequences can form a non-canonical secondary structure named G-quadruplex. This tetrahelical structure results from the stacking of several quartets, each quartet being composed of four guanines linked together by Hoogsteen hydrogen bonding. Computational approaches have revealed a high number of genomic regions compatible with quadruplex formation. Intramolecular G-quadruplexes can be formed in DNA but also in RNA, so they can be fi nd at the eukaryotic telomeric sequences, oncogene promoter sequences, minisatellites or in 5’ or 3’ UTR region.

These unusual structures are not taken in account by classic algorithm such as MFOLD. That is why a lot of aptamer experiment miss out of a probable G4 folding for a selected G-rich sequence. We collected all the aptamer sequences available in the literature (more than a thousand) and re-evaluted the G4 potential in silico than in vitro for the best candidates. We shown than that this structural motif can be frequently found in the SELEX process.

Poster 20


In Silico Techniques for the Hit Identifi cation of New DNA G-Quadruplex BindersAnna Artese

Dipartimento di Scienze della Salute, Università degli Studi “Magna Græcia” di Catanzaro, Campus “Salvatore Venuta”, Viale Europa, 88100 Catanzaro, Italy

[email protected]

G-quadruplex (G4) structures are nucleic acid arrangements assumed by guanine-rich sequences and stabilized by the planar pairing of four guanines through eight Hoogsteen hydrogen bonds. These sequences are found in crucial positions of the genome, such as at telomeric ends, ribosomal DNA (rDNA), RNA, or gene promoter regions. Nowadays, it has been demonstrated that DNA G4 arrangements are involved in cellular aging and cancer, thus boosting the discovery of selective binders for these structures. The Protein Data Bank contains several crystallographic and NMR models of such DNA conformation, allowing the development of new ligands by means of the “structure based drug design”.In particular we applied different in silico techniques to identify novel derivatives as lead compounds with high affi nity toward the human telomeric sequence d[AG3(T2AG3)3] and to develop descriptors and computational protocols useful to rationalize molecular activity profiles. A high throughput in silico screening of commercially available molecules databases was performed by merging ligand- and strucure-based approaches followed by docking experiments, thus indicating a psoralen derivative as a new promising scaffold for G4 binders.Moreover the existence of different polymorphisms in the DNA quadruplex and the absence of a uniquely precise binding required the application of structural descriptors and integrated computational methods able to correlate calculated properties derived from the chemical structure of compounds to experimentally determined biological activity.

In this communication a selection of the in silico experiences carried out in our laboratory will be discussed with special emphasis to those related with the identifi cation of new G4 binders.

This research work is supported by the Italian Ministry of Education FIRB_IDEAS for the years 2009-2014 (code RBID082ATK_002), PRIN 2009 (code 2009MFRKZ8_002) and by “Commissione Europea, Fondo Sociale Europeo - Regione Calabria”.

Poster 21


Study of the Interaction of the G-Quadruplex Ligand 360A and a Dimer Analog with Human Telomeric DNA

Anthony Bugaut, Patrizia Alberti, Chantal Trentesaux, Jean-Francois Riou, Patrick MaillietStructure des Acides Nucléiques, Télomères et Evolution, Inserm U565, CNRS UMR 7196, Muséum

National d’Histoire Naturelle, 43 rue Cuvier 75231 Paris cedex 05, France. [email protected]

In our lab we are interested in using chemical probes to investigate the biology of the chromosome ends, i.e. the telomeres. Human telomeric DNA possesses a G-rich single-stranded 3’-overhang composed of repeats of the GGGTTA sequence. This overhang is able to form multiple G-quadruplexe (G4) structures.

Small molecules that target G4 structures represent powerful tools to interrogate the biology of telomeres and may also provide “hits” toward new anticancer drugs. We have previously designed and synthesized a 2,6-pyridine-dicarboxamide derivative, named 360A, that displays preferential binding to chromosome ends in cultured human cells (Granotier C. et al., Nucleic Acids Res. 2005).

Here, we present the first results of a biophysical study (UV-melting, FRET-melting, Circular Dichroism) aiming to elucidate in detail the binding properties of the 360A ligand and a newly synthesized 360A dimer analog ([360A]2A) to human telomeric G4 structures. In this work we have used oligonucleotides that can form either one (Hum21), two (Hum45) or three (Hum69) G4. In addition we will provide data on the antiproliferative effects of both G4 ligands in human A549 lung carcinoma cells and in A105R, a derivative cell line that is resistant to 360A.

Poster 22


Investigation of Guanine Rich Motifs from the Proximal GATA4 Gene PromoterBeata Klejevskaja, Liming Ying, Michael Schneider, Jean-Louis Mergny(*), Ramon Vilar

Chemistry Department, Institute of Chemical Biology, Imperial College London, UK and (*) Univ. Bordeaux, France

[email protected]

GATA4 is a zinc finger transcription factor activating a number of genes critical in embryogenesis and a variety of physiological processes. Fundamental understanding of GATA4 gene regulation is currently of high interest, in particular due to its signifi cant role in heart development and its possible involvement in heart regeneration. A number of studies have suggested that guanine rich motifs found in gene promoters could potentially adopt G- quadruplex DNA structure and play a role in regulation of gene expression, either as suppressors or activators of gene expression.

To explore the possibility of G-quadruplex-mediated regulation of GATA4 gene expression we have identifi ed two highly conserved guanine rich motifs in the proximal GATA4 promoter. Motif-1 overlaps two Sp-1 binding sites and contains one 12b length loop. Motif-2 does not have any predicted binding sites for transcription factors and contains 9b length cytosine rich middle loop. Biophysical characterization of both motifs was carried out by EMSA, CD spectroscopy, 1H NMR spectroscopy and both UV and FRET melting studies.

Our work showed that motif-1 can fold into a stable quadruplex structure in the presence of potassium but not sodium ions, whereas motif-2 under similar conditions adopted a hairpin structure. To determine whether the identifi ed motifs could be functional in the GATA4 promoter luciferase assays were carried out. These studies showed that mutation of guanine- rich motif-1 without disruption of Sp-1 binding site did not have a signifi cant effect on GATA4 promoter activity. In addition, the effect of G4 structure stabilising ligand TMPyP4 and TMPyP2 as a control on motif-1 was evaluated by CD spectroscopy, FRET melting and luciferase assay. These studies have shown that TMPyP4 but not TMPyP2 can effi ciently stabilise GATA4 G-quadruplex structure in vitro. However, luciferase assay results have shown that TMPyP4 can down-regulate both wild type and G-quadruplex/Sp1 mutated GATA4 promoter activity, suggesting that its effect is not G-quadruplex specifi c.

Overall our studies have shown that while motif-1 can adopt a stable quadruplex structure and be stabilised with G-quadruplex ligands in vitro, they have not provided evidence that G-quadruplex structure is involved in regulation of the proximal GATA4 promoter. Furthermore, our studies suggested that the effect of G-quadruplex-stabilising ligand TMPyP4 is most likely due to a number of non-quadruplex specifi c interactions leading to down-regulation of GATA4 promoter activity. To gain more insight into regulation of GATA4 gene a wider range of ligands is currently being investigated both in vitro and in cellulo.

Poster 23


Characterizing DNA Secondary Structures in the KRAS Proximal PromoterChristine E. Kaiser, Laurence H. Hurley

University of Arizona, Tucson, [email protected]

The KRAS proximal promoter has three regions capable of forming DNA secondary structures: of these, the Mid-region is the most thermodynamically stable, and the different structures can form intermolecular interactions. This promoter system is a potential target for the treatment of pancreatic cancer, as activating mutations or upregulation of the KRAS gene occur in more than 90% of pancreatic adenocarcinomas. The KRAS proximal promoter contains a GC-rich nuclease hypersensitivity site; under transcription-induced negative superhelicity, this site can open up to form unique secondary structures: the G-quadruplex (G4) on the G-rich strand and the i-Motif (iM) on the C-rich strand. This promoter is unique in that it contains three potential DNA secondary structure-forming regions, referred to as the Far-, Mid-, and Near-upstream promoter regions (Figure 1). The Near-region G-quadruplex has been previously characterized by Cogoi and Xodo, and shown to modulate KRAS transcription. To investigate the entire promoter system we initially used circular dichroism (CD) spectra and thermal stability analyses to assess the ability of each region to form a G4 or iM: the Far-region does not form a stable G4 or iM, the Near-region forms a stable G4 but an unstable iM, and the Mid-region forms a thermodynamically stable G4 and iM. Considering all available results, we choose to focus our efforts on the C-rich strand, specifi cally the Mid-region. The iM structure that forms in this region is unique as it contains a stem-loop structure with fi ve Watson-Crick base pairs in its central loop. As the three secondary structure-forming regions are separated by relatively few base pairs, we investigated the potential for the individual iMs to interact. Preliminary results show that the Far-Mid tandem sequence exhibited a greater–than-additive molar ellipticity, which indicates an intermolecular interaction between the two regions. Our efforts are also focused on utilizing Förster resonance energy transfer (FRET)-based screening to identify compound probes capable of stabilizing or destabilizing the Mid-region i-Motif. These probes will be utilized to better understand the role of i-Motifs in the KRAS promoter system.

Poster 24


Guanine Base Stacking in G-quadruplexes: Energetic and Electron Transport PropertiesChristopher J. Lech, Maria-Elisabeth Michel-Beyerle, Alexander Voityuk and Anh Tuân Phan

School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371

[email protected]

The stacking of Guanine bases from neighboring G-tetrads is a fundamental interaction in the formation of G-quadruplex structures. We survey the geometries of stacked guanine bases from experimental structures within the Protein Data Bank. A variety of G-tetrad stacking geometries are observed, both within the core of a single G-quadruplex unit and at the interface of stacked G-quadruplexes. Using a variety of QM computational approaches, we investigate the energies and electronic transport properties of commonly observed G-tetrad geometries. We show that the heavily overlapped 5/6-ring geometry is the most energetically favorable and demonstrates superior electron-hold transport properties. The fi ndings present here provide insight into how base stacking geometry effects the formation and higher order assemblies of G-quadruplexes. Our research also provides a foundation for the rational design of optimized conductive G-wire systems.

Poster 25


Investigation of G-Quadruplex Folding and Sensing Using its Intrinsic FluorescenceChun Kit Kwok, Madeline E. Sherlock, Philip C. Bevilacqua

Department of Chemistry, Center for RNA Molecular Biology, Pennsylvania State University, University Park, PA 16802, USA.

[email protected]

Guanine quadruplex structures (GQS) have been of great interest for decades and are important in the regulation of replication, transcription and translation. GQS contain the general consensus pattern GwLaGxLbGyLcGz, where w, x, y, and z are ≥2 nt, and loops a, b, and c are ≥1 nt. The unique quartet structure and folding of GQS lead to unique spectroscopic features including an inverse UV melting profi le at 295 nm, distinctive circular dichroism (CD) features, and intrinsic fl uorescence. We investigated the effect of loops and G-stretch lengths on GQS folding in several RNA systems. We fi nd that in general, longer loops in GQS give weaker potassium ion binding affi nity (K+1/2), which is likely due to increase in fl exibility. In addition, we observe a general decrease in folding cooperativity (Hill coeffi cient, ‘n’) as the length of the G-stretch increases (i.e. G2 GQS to G6 GQS), leading to a broad ~5-log response range. We demonstrated that this decrease in cooperativity is due to populating intermediates in the GQS folding pathway, showing a clear 3-state transition in G3 and G4 GQS. Lastly, we found that RNA GQS exhibit intrinsic fl uorescence1.

The intrinsic fl uorescence of GQS was further explored in DNA systems with varying loop sequence, loop length, and G-stretch length. Potassium ion titrations were performed and folding was monitored by fluorescence spectroscopy. We found that longer G-stretches (i.e. G3 GQS vs G2 GQS) exhibit stronger fl uorescence. Interestingly, we also observed that the GQS with loops of 1 nucleotide have the strongest fl uorescence. Looking into the available NMR structures of dG3T and dG2A, we found that the T loops in dG3T are fl ipped out; whereas the A loops in dG2A interact with the G-quartet. This result is especially interesting as dG2A has a heptad, which suggests that A loops (λmax >385 nm) exhibit maximal fl uorescence at longer wavelength than T loops (λmax <385 nm) due to extended conjugation. Also, the flipped out nature of the T loops in dG3T likely minimizes fluorescence quenching by loop bases and thus leads to stronger fl uorescence2.

Overall, GQS folding can occur in a molecular switch (high n) or rheostat (low n) mode, depending on the G-stretch length. Also, the intrinsic fl uorescence of GQS is useful for nucleic acid studies and the development of label-free detection methods. These studies serve to provide a deeper understanding of structure and folding properties of GQS folding, and shed light on possible roles of GQS in cells.

References1. Kwok, C. K., Sherlock, M. E., and Bevilacqua, P. C. (2013) Angew. Chem. Int. Ed. 52, 683-686.2. Kwok, C. K., Sherlock, M. E., and Bevilacqua, P. C. (2013) Biochemistry 52, 3019-3021.

Poster 26


Characterization of the Promoter Region of the Proto-Oncogene C-Kit in Canine Mast Cell TumourSilvia Da Ros1, Eleonora Zorzan2, CaterinaMusetti1, Mery Giantin2, Lara Zorro Shahidian2, Manlio

Palumbo1, Mauro Dacasto2, Claudia Sissi1

1Dept. of Pharmaceutical and Pharmacological Sciences, v. Marzolo 5, 35131 Padova, Italy2Dept. of Comparative Biomedicine and Food Science, Viale Dell'Universita', 16, Legnaro, Italy

[email protected]

In medicinal chemistry, G-quadruplex (G4) represents a promising chemotherapeutic target. The unveiling of telomerase role in cell cycle progression and the defi nition of its mechanism of action prompted the search of small molecule able to block it by promoting G4 formation at the telomere ends. More recently, the role of conformational equilibria of G-rich sequences as modulator of gene expression has been assessed and opened new perspectives. In particular, several oncogene promoters were found to contain G-rich sequences and have been considered as targets for anticancer therapy. Among them, we were interested in c-kit, due to its widespread relevance in tumorigenesis and tumor maintenance. Interestingly, two distinct G-rich sequences were identifi ed in c-kit promoter and both are now structurally characterized in their G4 conformation.

The knowledge of the target is defi nitely a great advantage to the identifi cation and/or optimization of new ligands directed towards these genomic portions. However, we also need solid models to assess the pharmacological effi ciency of potential new drugs. In this context dog can represent a remarkable translational animal for human cancer.

Indeed, mast cell tumour (MCT) is the most common (7% to 21%) cutaneous skin tumour of dogs and, interestingly, the MCT aggressive behaviour, (which results in poor outcome) is often characterized either by an overexpression or a mutational status of c-Kit. All this makes c-kit an important target for dog chemotherapy. Furthermore, c-kit mutations occurring in dog MCTs are similar to those found in human cancers, such as gastrointestinal stromal tumors (GIST), melanoma and mastocytosis. Therefore, canine MCT could represent a proper disease model to evaluate the functional consequences of c-kit abnormalities in cancer and the role of c-kit inhibitors in antitumor chemotherapy.

To validate such an assumption, we started a detailed characterization of the promoter region of c-kit in dogs. The sequence of canine upstream promotorial sequence was cloned and sequenced in both healthy and MCT-suffering dogs. Then, the canine sequences were compared to the human ones. In particular, large attention was devoted to clarify the conformational equilibria occurring in physiologically relevant conditions.

This work represents the required preliminary step for a better understanding of MCT biology, progression and treatment as well as to export this knowledge in the many c-Kit related human tumours.

Poster 27


Fan-Shaped Trinuclear Pt(II) Complexes Effectively Stabilize Human Telomeric G-quadruplex DNA

Cui-Xia Xu, Liang-Nian Ji, Zong-Wan Mao*MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and

Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275, [email protected]

G-quadruplexes, which consist of four-stranded nucleic acids, are described as presenting a high-order secondary DNA structure, have drawn attention regarding their potential use in anticancer therapies.[1] In past decades, many small organic molecules and complexes, especially the Pt(II) complexes[2] that interact with G-quadruplexes have been reported. Here we present four fan-shaped trinuclear Pt(II) complexes (Fig. 1)

{[Pt(dien)]3(ptp)}(NO3)6 (1), {[Pt(dpa)]3(ptp)}(NO3)6 (2), {[Pt(dien)]3(tib)}(NO3)6 (3) and {[Pt(dpa)]3(tib)}(NO3)6 (4), which exhibit effectively stabilities for human telomeric G-quadruplex (hTel) DNA. (dien: diethylenetriamine; dpa: bis(2-pyridylmethyl)amine; ptp: 6'-(pyridin-3-yl)-3,2':4',3''-terpyridine; tib: 1,3,5-tri(1H-imidazol-1-yl)benzene)

Firstly, fl uorescence resonance energy transfer (FRET) and surface plasmon resonance (SPR) assays were performed to investigate he binding abilities of the Pt(II) complexes with different DNA sequences (hTel, three promoter sequences: c-myc, bcl2, c-kit and a duplex DNA sequence), and found that all of the four complexes can bind more strongly to the hTel G-quadruplex than to promoters (such as c-myc and bcl2) or to duplex DNA. Secondly, the circular dichroism (CD) titration assays indicated that these Pt(II) complexes can stabilize certain conformation of G-quadruplex structures at low concentrations with high CD signals. Thirdly, polymerase chain reaction (PCR) stop assay revealed that the Pt(II) complexes could bind to and stabilize the hTel G-quadruplex. Furthermore, their effi cacy towards telomerase and other further studies in in vitro are undergoing.

References1. H. Han, L. H. Hurley, Trends in pharmacological sciences, 2000, 21, 136-142.2. C.-X. Xu, Y.-X. Zheng, X.-H. Zheng, Q. Hu, Y. Zhao, L.-N. Ji, Z.-W. Mao, Scientifi c Reports, 2013, accepted.

Poster 28


Guanine Quadruplex in the Promoter of the Embryonic Stem Cell Pluripotency Regulator Oct-4Daniel Renciuk1, Iva Kejnovska1,2, Tomas Simonsson3, Michaela Vorlickova1,2

1CEITEC – Central European Institute of Technology, Masaryk University, Kamenice 5, 62500 Brno, Czech Republic; 2Institute of Biophysics of the Academy of Sciences of the Czech Republic, Kralovopolska

135, 61265 Brno, Czech Republic; 3Medical Biochemistry Division, The Sahlgrenska Academy at University of Gothenburg, P.O. Box 440, 40530 Gothenburg, Sweden

[email protected]

Embryonic stem cells (ES), with their abilities to differentiate into any cell type and to self-renew, represent promising curative approach. Formation of ES cells requires activation of the Oct4 gene. Oct4 gene is under regulation of three main upstream regions: proximal promoter containing Sp1 binding site, RARE element and 1A-like site, proximal enhancer and distal enhancer. Both Sp1 binding site and 1A-like site are guanine rich regions, possibly able to participate in the formation of guanine quadruplex. These sites are also targeted by several transcription factors.

We were interested whether and how the short synthetic oligonucleotides derived from both human and mouse genomic sequences of the guanine rich region covering 1A-like site, form guanine quadruplexes. Mouse-derived 27-nt long sequence, containing five G-blocks, forms intramolecular quadruplex both in potassium and in sodium, whereas sodium form has more than 20°C lower Tm. 3’ end expansion of the sequence to 37-nt completely prevents quadruplex formation in sodium. 41-nt long human analog behaves similarly. Chemical and P1 nuclease probing revealed that the fl anking end of 37-nt mouse or 41-nt human sequence forms some WC-pair based structure, probably hairpin. When we split the 37-nt sequence into 20-nt quadruplex core and 18-nt tail and make a sum of their CD spectra in potassium, i.e. parallel quadruplex one of 20-nt core and B-like one of 18-nt tail, the resulting spectrum almost exactly follows the CD spectrum of 37-nt sequence. Comparison of the thermodynamic stabilities of 37-nt sequence and its fragments show that both fragments alone have lower Tm than 37-nt: Although the two parts of the 37-nt complex behave independently when followed by CD spectroscopy, in the thermodynamic context they have synergistic effect, probably due to formation of some B-like capping structure on the top of quinine quadruplex. We were interested whether such capping structure is just an artifact caused by sequence selection or not. We thus designed three human-genome based longer sequences, ranging between 67 and 92-nt, covering different parts of proximal promoter region and we studied their conformational properties: guanine quadruplex around 1A-like site is formed in all cases, but entirely in potassium solution. Rest of the sequences either forms some W-C pairs based secondary structures or remains unstructured. This indicates that whether the guanine quadruplex may be of some biological relevance, the rest structures are probably artifacts caused by sequence selection.

Within the 37-nt sequence, the C31 was described to be methylated upon the differentiation of ES cells. This methylation does not alter the conformation of DNA in any of the studied fragments but it stabilizes short 18-bp hairpin-forming tail.

Poster 29


Towards an Analytical Methodology for the Screening of G-Quadruplex-Binding LigandsDomenica Musumeci,a Bruno Pagano,b Jussara Amato,b Ettore Novellino,b Concetta Giancola b and

Daniela Montesarchioa

a Department of Chemical Sciences, University of Napoli Federico II, via Cintia 4, I-80126 Napoli, Italyb Department of Pharmacy, University of Napoli Federico II, via D. Montesano 49, I-80131 Napoli, Italy

[email protected]

The discovery of small organic molecules selectively recognizing G-quadruplex structures is one of the “hottest” research field in the study of these unusual nucleic acids conformations, particularly motivated by the need for effective anticancer agents in an antitelomerase therapeutic strategy.1 This goal requires a methodology that provides the rapid and unambiguous identifi cation of ligands, able to selectively bind a peculiar G-quadruplex structure but not recognized by DNA duplex. Affinity chromatography is a powerful method for probing small molecule-biomacromolecule interactions by immobilizing either of them on a solid support. This technique has been widely applied in the rapid selection of bioactive compounds from complex mixtures, and is, for example, the basis of success of SELEX methodologies in the identifi cation of aptamers.2

Our research efforts are currently aimed at developing an affinity chromatography-based assay allowing to fish for effective ligands selectively targeting G-quadruplex conformations. Affinity chromatographic assays are simple and efficient in principle, also allowing for screenings of large libraries. To the best of our knowledge, there is only one precedent in the literature where this concept has been applied to G-quadruplex-forming oligonucleotides, immobilized onto a stationary phase to select specifi cally binding proteins.3

We here present our preliminary results towards the development of an efficient analytical tools to implement the concept of nucleic acids-based affinity chromatography in the search for effective G-quadruplex targeting drugs.

References1. For recent reviews, see: a) Pagano, B.; Cosconati, S.; Gabelica, V.; Petraccone, L.; De Tito, S.; Marinelli, L.; La Pietra, V.; di Leva, F.S.; Lauri, I.; Trotta, R.; Novellino, E.; Giancola, C.; Randazzo, A. Curr. Pharm. Des. 2012, 18, 1880; b) Li, Q.; Xiang, J.F.; Zhang, H.; Tang, Y.L. Curr. Pharm. Des. 2012, 18, 1973; c) Vy Thi Le, T.; Han, S.; Chae, J.; Park, H.J. Curr Pharm Des. 2012, 18, 1948; d) Balasubramanian, S.; Hurley, L.H.; Neidle, S. Nat. Rev. Drug Discov. 2011, 10, 261; e) Monchaud, D.; Teulade-Fichou, M.P. Org Biomol. Chem. 2008, 6, 627-636; f) De Cian, A.; Lacroix, L.; Douarre, C.; Temime-Smaali, N.; Trentesaux, C.; Riou, J.F.; Mergny, J.L. Biochimie 2008, 90, 131.2. For selected reviews, see: a) Shamah, S.M.; Healy, J.M.; Cload, S.T. Acc. Chem. Res. 2008, 41, 130. b) Famulok, M.; Mayer G. Curr. Top. Microbiol. Immunol. 1999, 243, 123.3. Zhao Q., Li X. F., Shao Y. H., Le X. C. Anal. Chem. 2008, 80, 7586.

Poster 30


Conformational Rearrangements in Telomeric G-Quadruplex Induced by Tetracationic Carboxymethyl Porphyrins

1,2Kovaleva O.A., 1Mamaeva O.K., 3Makarenkov A.V., 1Shchyolkina A.K., 3Ol’shevskaya V.A., 1Livshits M.A., 4Shtil A.A., 1Borisova O.F., 1Kaluzhny D.N.

1Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Russia2Moscow Institute of Physics and Technology (State University), Russia;

3Nesmeyanov Institute of Organoelement Compounds, Russian Academy of Sciences, Russia.4Blokhin Cancer Center, Russian Academy of Medical Sciences, Russia.

[email protected]

Chemical modifi cations of biologically active compounds are expected to improve the effects of drugs due to targeting a specifi c molecule in the cell. The telomeric G-quadruplexes are perspective drug targets. We studied the interaction of carboxymethyl porphyrin derivative 5,10,15,20-tetrakis(N-carboxymethyl-4-pyridinium)porphyrin (P1) and its metal derivatives having Ni2+(NiP1) , Zn2+(ZnP1) and Co2+(CoP1) cations in the porphyrin core with the antiparallel telomeric G-quadruplex d(TTAGGG)4. The binding affi nity of the modifi ed porphyrins was found to be similar to that of the known TMPyP4, the only exception being CoP1 whose binding affi nity was one order of magnitude smaller. Different modes of interaction of porphyrins with the double stranded DNA were detected: groove binding for ZnP1, intercalation for NiP1, and the mixed intercalation/groove binding mode for metal free P1. Thus, the presence of the metal cation in the porphyrin macrocycle can seriously affect ligand-quadruplex interaction. We next studied the antiparallel telomeric G-quadruplex in the presence of NaCl in comparison with its mutant non-quadruplex form having single G-A mutation d(TTAGGGTTAGAGTTAGGGTTAGGG). Significant conformational changes in the telomeric G-quadruplex structure upon its binding with the porphyrins was observed in circular dichroism (CD) spectra. The first tightly bound P1 molecule did not affect the G-quadruplex conformation. The two other bound P1 molecules decreased the magnitude of the long wave positive CD band twofold, probably due to disruption of the G-quartet. The metal-free P1 showed a mixed binding mode. Binding with the TTA loops of G-quadruplex did not disrupt the antiparallel G-quadruplex fold whereas stacking with guanines of one of the terminal G-quartets led to its disruption. Despite the structural distortion the stabilization effect of P1 on d(TTAGGG)4 was observed. Binding of six or seven NiP1 molecules led to CD spectra characteristic for the double stranded B-form DNA. Of note, binding of NiP1 to the mutant telomeric sequence resulted in similar CD spectra. Major stabilization of d(TTAGGG)4 structure in complex with NiP1 was detected. In summary, tight binding of NiP1 to the telomeric sequence induced DNA rearrangement presumably into a hairpin with mismatched base pairs. In contrast, groove binding of ZnP1 did not disrupt but stabilized the G-quadruplex fold.

Poster 31


Probing the Structure of CGG Repeats in HeLa Cell Extract by NMR SpectroscopyDorota Gudanis, Eliza Wyszko, Zofi a Gdaniec

Institute of Bioorganic Chemistry Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan, Poland

[email protected]

G-quadruplex structures depend not only on the nucleotide sequence but also on sample preparation and solvent conditions. The same sequences often form different topologies depending on the salt type (Na+, K+), the presence of a co-cation or sample annealing and quenching. The intracellular environmental factors such as molecular crowding, hydration and the presence of small molecules can infl uence G-quadruplex structure and it is possible that under physiological conditions the same molecule can fold into different topology than it adopts in vitro.

We have studied the conformational properties of RNA fragments composed of two or four trinucleotide CGG repeats. The CGG triplet repeat found within the 5'UTR of the FMR1 gene is involved in the pathogenesis of both fragile X syndrome and fragile X-associated tremor/ataxia syndrome (FXTAS). Depending on solution conditions UCGGCGGU, GCGGCGGC and GCGGCGGCGGCGGC molecules can exist in equilibrium between duplex and quadruplex form. In the presence of sodium ions these molecules adopt mainly duplex structures. Our previous study have shown that high concentration of GCGGCGGC drives the equilibrium toward four-stranded structure with four G:G:G:G tetrads and two mixed G:C:G:C tetrads. On the other hand, GCGGCGGC and UCGGCGGU molecules form only quadruplexes in the presence of potassium ions while GCGGCGGCGGCGGC exists in conformational equilibrium between duplex and quadruplex in this conditions. Additionally, the ratio of quadruplex/duplex forms depend on the method of the samples annealing or quenching. It is important to determine which structure is formed under physiological conditions. In order to get insight into structural preferences of molecules composed of CGG repeats in conditions close to physiological we have studied the ability of CGG repeat molecules to form quadruplex structures in HeLa cell extract. In NMR spectra, G-quadruplexes give characteristic signals in the range 10.5-12 ppm which corresponds to imino protons resonances of guanine residues involved in G-tetrad formation. This spectral region is separated from signals which originate from HeLa cell extract (0-9 ppm). Therefore, NMR spectra provides a convenient method for monitoring the formation of a G-quadruplex structure using HeLa cell extract. The experimental results will be presented.

Acknowledgements:

This work has been supported by research grant form National Science Centre (No N N301 707040).

Poster 32


Interaction of G4-Ligands with Different G-Quadruplex Forming Sequences of Oncogene Promoters

Emanuela Micheli1, Lorenzo Cianni2, Alessandro Altieri2, Sara Iacchettini3, Annamaria Biroccio3, Marco Franceschin2, Armandodoriano Bianco2, Stefano Cacchione1

1Department of Biology and Biotechnology, 2Department of Chemistry,Sapienza University of Rome, P.le Aldo Moro 5, 00185 Roma, Italy;

3Experimental Chemotherapy Laboratory, Regina Elena Cancer Institute, Via delle Messi d’Oro 156, 00158 Rome, Italy

[email protected]

Several lines of evidence have shown that DNA G-quadruplex structures can form in biologically significant regions, such as telomeres and the proximal promoter regions of several oncogenes. Although the regulatory functions of G-quadruplex structures have not been clarified yet, they are likely to play an important role in biological processes and can represent a molecular target in anti-cancer strategies.

Promoter G-quadruplexes are very variable in their sequence, with differences particularly in the loop length and base content; these sequence differences result in a large structural diversity due mainly to the geometry of grooves and loops1. For this reason, many researchers are involved in designing small molecules to selectively recognize and stabilize these structures, with the aim of developing more effi cient G-quadruplex ligands.

We have synthesized several G-quadruplex ligands, characterized by a large aromatic core and basic side chains (such as perylene2,3 and (emi)coronene derivatives4), and studied their ability to bind and stabilize the human telomeric G-quadruplex structure. Here we present an analysis of the interaction of these ligands with structurally different G-quadruplexes of some oncogene promoters, with the aim to identify the features important for the recognition specifi city. G-quadruplex forming sequences from the promoters of c-Myc, Bcl2, VEGF and hTERT have been characterized by circular dichroism and polyacrylamide gel electrophoresis,

allowing us to select the most appropriate sequences for the subsequent studies. The affinity of our G-quadruplex ligands for the different structures was studied by mass spectrometry (ESI-MS). The ligands ability to stabilize the G-quadruplex structures was investigated by FRET (Fluorescent Resonance Energy Transfer) and by Polymerase stop assay. In addition, the inhibitory effect of the molecules on the expression of some of the oncogenes has been assayed in cultured cells by measuring the corresponding mRNA and protein levels.

References1. Chen Y., Yang D. (2012) Curr Protoc Nucleic Acid Chem Chapter 17, Unit17.5.2. D’Ambrosio D., Reichenbach P., Micheli E., Alvino A., Franceschin M., Savino M., Lingner J. (2012) Biochimie 94, 854-863.3. Casagrande V., Salvati E., Alvino A., Bianco A., Ciammaichella A., D’Angelo C., Ginnari-Satriani L., Serrilli A.M., Iachettini S., Leonetti C., Neidle S., Ortaggi G., Porru M., Rizzo A., Franceschin M., Biroccio A. (2011) J. Med. Chem. 54, 1140-56.4. Franceschin M., Rizzo A., Casagrande V., Salvati E., Alvino A., Altieri A., Ciammaichella A., Iachettini S., Leonetti C., Ortaggi G., Porru M., Bianco A., Biroccio A. (2012) ChemMedChem 7, 2144 – 2154.

Poster 33


A High-throughput G4-FID Assay for Screening and Evaluation of Quadruplex LigandsEric Largy, Florian Hamon and Marie-Paule Teulade-Fichou

Institut Curie, CNRS UMR-176, centre universitaire, 91405 Orsay, [email protected]

G4-FID (G-quadruplex fluorescent intercalator displacement) is a simple and fast method that allows to evaluate the affi nity of a compound for G-quadruplex DNA (G4-DNA) and its selectivity towards duplex DNA.1 This assay is based on the loss of fl uorescence of thiazole orange (TO) upon competitive displacement from DNA by a putative ligand. We describe the development of a high-throughput version of this assay performed in a 96 and 384-well microplates.2 Additionally, the spectral range of the test was enlarged using two other fluorescent on/off probes whose absorption are red-shifted (TO-PRO-3) and blue-shifted (Hoechst 33258) respectively as compared to that of TO. These labels enable to screen a large diversity of compounds with various optical (absorption/emission) properties, which was exemplifi ed by evaluation of affi nity and selectivity of the porphyrin derivative TMPyP4 that could not be evaluated previously.

HT-G4-FID assay offers the possibility to label a large variety of G-quadruplexes of biological interest (telomeres, oncogene promoters,…) and enable screening of collections of putative G4-ligands of high structural diversity (e.g. chemical libraries).3 An example of chemical library screening by HT-G4-FID coupled to chemoinformatics and molecular modeling techniques, which lead to the discovery of a quadruplex binder discriminating among various quadruplexes, will be presented.4 HT-G4-FID thus represents a powerful tool to bring into light new ligands able to discriminate between quadruplexes of different structures.

References1. a) D. Monchaud, C. Allain, M.-P. Teulade-Fichou, Bioorg. Med. Chem. Lett. 2006, 16, 4842-4845; b) D. Monchaud, C. Allain, M. P. Teulade-Fichou, Nucleosides, Nucleotides Nucleic Acids 2007, 26, 1585-1588; c) D. Monchaud, C. Allain, H. Bertrand, N. Smargiasso, F. Rosu, V. Gabelica, A. De Cian, J. L. Mergny, M. P. Teulade-Fichou, Biochimie 2008, 90, 1207-1223; d) D. Monchaud, M.-P. Teulade-Fichou, in G-QuadruplexDNA, Vol. 608 (Ed.: P. Baumann), Springer, Kansas City, 2010, pp. 257-271.2. E. Largy, F. Hamon, M.-P. Teulade-Fichou, Analytical and Bioanalytical Chemistry 2011, 400, 3419-3427.3. Largy, E.; Teulade-Fichou, M.-P. In Guanine Quartets: Structure and Application; 2013; pp. 248–262.4. E. Largy, N. Saettel, F. Hamon, S. Dubruille, M.-P. Teulade-Fichou, Current Pharmaceutical Design 2012, 18,1992-2001.

Poster 34


A Selective G-quadruplex Alkylating Agent Activated by Green Light.Filippo Doria,1 Luca Germani,1 Matteo Nadai,2 Sara N. Richter2 and Mauro Freccero1

1Dipartimento di Chimica, Università di Pavia2Dipartimento di Medicina Molecolare Università di Padova

fi [email protected]

In the last few years we have studied the synthesis and the reactivity of ligand alkylating hybrid structures targeting G-quadruplexes,1-4 exhibiting electrophilic properties upon thermal activation (24h incubation at 40°C). The present study reports the fi rst example of selective G4 alkylation induced by irradiation using visible green light (λ = 530 nm). In particular, we have engineered a naphthalene diimide (NDI-1) as a donor-acceptor dyad, exhibiting a water soluble naphthalene diimide core acting as both electron-poor G4 binding moiety and photo-oxidant, tethered to an electron-rich phenol derivative. The latter acted as precursor of the reactive specie upon intramolecular photo-oxidation, which was capable of G4 covalent modification. The NDI-1 was photostable upon 24h irradiation when free in water solution, but it became reactive in the presence of a G4 folding oligonucleotides. The binding interaction between the NDI moiety and the G4 measured by FRET melting experiment and CD measurements, triggers the photo-reactivity. Surprisingly, the use of green light ensures the best alkylation effi ciency, in comparison to UV irradiation (350 nm). The alkylating properties were assayed on a model of a human telomeric sequence (hTel22) by gel electrophoresis. Our data showed a highly selective alkylation of G4 vs scrambled single-stranded (ss) and double-stranded (ds) DNA, with alkylation effi ciency up to 20%. The alkylation site was investigated by enzymatic assays and mass-spectrometry.

References1 F. Doria, M. Nadai, M. Folini, M. Scalabrin, L. Germani, G. Sattin, M. Mella, M. Palumbo, N. Zaffaroni, D. Fabris, M. Freccero, S.N. Richter, Chem. Eur. J. 2013, 19, 78-81.2 M. Nadai, F. Doria, M. Di Antonio, G. Sattin, L. Germani, C. Percivalle, M. Palumbo,S.N. Richter, M. Freccero, Biochimie 2011, 93, 1328-1340.3 F. Doria, M. Nadai, M. Folini, M. Di Antonio, L. Germani, C. Percivalle, C. Sissi, N. Zaffaroni, S. Alcaro, A. Artese, S.N. Richter, M. Freccero, Org. Biomol. Chem. 2012, 10, 2798-2806.4 M.Di Antonio, F. Doria, S.N. Richter, C. Bertipaglia, M. Mella, C. Sissi, M. Palumbo, M. Freccero, M. J. Am. Chem. Soc. 2009, 131, 13132-13141.

Poster 35


Structural Motifs that Govern the Recognition Process between Thrombin and Aptamers Inhibiting Exosite I or II.

Irene Russo Kraussa; Andrea Picaa; Antonello Merlinoa,b; Lelio Mazzarellaa,b; Filomena Sicaa,b

aDepartment of Chemical Sciences, University of Naples “Federico II”, Naples, ItalybInstitute of Biostructures and Bioimages, CNR, Naples, Italy

fi [email protected]

Human α-thrombin is a multifunctional serine protease that plays a pivotal role in hemostasis. Two binding sites on its surface, the fibrinogen recognition site (exosite I) and the heparin binding site (exosite II), control its catalytic function. Promising thrombin inhibitors are aptamers, short single-stranded oligonucleotides able to bind target proteins with high selectivity and affi nity (Bock et al, Nature, 1992, 355, 564-6). Among them a 15-mer aptamer recognizing exosite I (TBA) (Macaya et al, PNAS, 1993, 90, 3745-9) and a 29-mer binding exosite II (HD22) aptamer (Tasset et al, JMB, 1997, 272, 688-98) were selected for their high affinity towards thrombin. Structural data on thrombin-aptamer complexes are essential to understand recognition mechanism(s) of TBA and HD22 and to design novel aptamers with improved pharmaceutical properties. We have performed an X-ray structural characterization of the complexes of thrombin with TBA (Russo Krauss et al, NAR, 2012, 40, 8119-28), TBA variants (Russo Krauss et al, NAR, 2011, 39, 7858-67) and mutants or a shorter variant of HD22 (HD22-27mer). This study has been complemented with a CD analysis of aptamers both free and in complex with thrombin, in the presence of Na+ or K+. All together our results have provided a clear picture of the recognition process between thrombin and its aptamers. Moreover, they allow to defi ne the effect that ions have on structure and fl exibility, and therefore on thrombin affi nity and inhibition, of the various aptamers.

Notably, the thrombin-HD22-27mer complex has provided the first crystallographic model of an aptamer with a mixed duplex-quadruplex fold and reveals unexpected novel structural features.

Poster 36


Understanding the G-quadruplex-mediated Genomic Instability in S. cerevisiae: the Loop Size Is Important

F. Samazan(1), A. Piazza(1), M. Adrian(2), M-P. Teulade-Fichou(3) A.T. Phan(2) and A. Nicolas(1)

1Institut Curie Centre de Recherche, CNRS UMR3244, Université Pierre et Marie Curie, 26 rue d’Ulm, 75248 Paris (France); 2School of Physical and Mathematical Sciences, Nanyang Technological

University, 637371 Singapore ; 3Institut Curie Centre de Recherche, CNRS UMR176, Université Paris XI, 91405 Orsay (France)

[email protected]

GC-rich minisatellites are a class of tandem repeats massively present in the human genome, among which some are able to form G quadruplex in vitro. We focused our study on two G-quadruplex-forming human minisatellites: CEB1 (Ribeyre et al., 2009, PLoS Genetics) and CEB25 (Amrane S. et al., 2012, Journal of the American Chemical Society). Minisatellite stability was monitored over mitotic generations upon insertion in the S. cerevisiae chromosome III near the ARS305 origin of replication. CEB1 is destabilized (undergoes frequent expansion or contraction) in the absence of the G-quadruplex-unwinding Pif1 helicase (Ribeyre et al., 2009, PLoS Genetics) or in WT cells treated with the G-quadruplex ligand Phen-DC3 (Piazza et al., 2010, Nucleic Acids Research). In contrast, CEB25 remains stable in these conditions.

To elucidate the molecular reasons of their different behavior, we built a comprehensive set of CEB1 and CEB25 mutated tandem arrays and assayed their behavior in yeast. Sharply, the shortening of the central loop of the CEB25 G-quadruplex from 9 to 1 or 2 nt triggers its instability in both pif1� and Phen-DC3-treated WT cells. Conversely, the introduction of a 9 nt loop between the CEB1 G-tracts abolished the natural CEB1 instability. We systematically varied the size of the loops between the CEB25 G tracts and conclude that their size plays an important role in the stability of these sequences, also prone to breakage and “at risk” of spontaneous rearrangements (Piazza et al., 2012, PLoS Genetics). These results addressing the G4 structure/function relationship will be presented.

Poster 37


Functionalization of a G4-ligand: How Polyvalent a Pyridodicarboxamide Scaffold Can Be?Florian Hamon1; Reuben Ovadia1; Amandine Renaud de la Faverie2; Daniela Verga1; Eric Largy1;

Corinne Guetta, C.1; Aurore Guédin2; Jean-Louis Mergny2 et Marie-Paule Teulade-Fichou1

1 UMR176 CNRS, Institut Curie, Centre de Recherche Centre Universitaire, 91405 Orsay 2 Université Victor Segalen Bordeaux II, Laboratoire ARNA (INSERM U869), Institut Européen de Chimie

et Biologie, 2 rue Robert Escarpit 33 076 Pessac Cedex fl [email protected]

The presence of guanines repetitions allows the formation of a particular DNA conformation: the G-quadruplexe1 (G4). These structures seem to be involved in various processes of cellular regulation: telomeric DNA, messenger RNA and oncogene promoters. The presence of putative G4-forming sequences in key regions of the genome encouraged us to synthetize small molecules able to interact specifi cally with G4 as potential therapeutic agents or as tool to analyze fi ne mechanisms.

For these reasons, we used the well-known G4-ligand, called PyridoDiCarboxamide bisquinolinium (PDC-360A) as a versatile platform to develop various tools. Thus, we several PDC derivative functionalized by a biotin or a fluorophore (BODIPY). These 2 compounds PDC-Biotin and PDC-Bodipy were evaluated by HT-G4-FID (High throughput fl uorescent Intercalator displacement). The PDC-Biotin was also evaluated by FRET-melting studies showing a global conservation of the affi nity of the PDC scaffold toward G4. A SELEX experiment was conducted with the PDC-biotin leading to unexpected results2. PDC-BODIPY was used to develop a new competition assay (G4-POSCA)3 to evaluate the optical selectivity of quadruplex fl uorescent probes.

These 2 examples reveal the potential of the PDC scaffold to build chemical and biochemical tools dedicated to G4 analyses.

I- I-

O NH

OHN3

N O

HN

O

NHN+ N+

= biotine, fluorophore,...

References1.H. J. Lipps and D. Rhodes, Trends Cell Biol., 2009, 19, 414-422.2.A. Renaud de la Faverie, F. Hamon, C. Di Primo, E. Largy, E. Dausse, L. Delaurière, C. Landras-Guetta, J.-J. Toulmé, M.-P. Teulade-Fichou and J.-L. Mergny, Biochimie, 2011, 93, 1357-1367.3.E. Largy, F. Hamon and M. P. Teulade-Fichou, Methods, 2012, 57, 129-137.

Poster 38


Incorporation of Thio-pseudoisocytosine into Triplex-Forming Peptide NucleicAcids for Selective Recognition of RNA Duplexes

Gitali Devi, Zhen Yuan, and Gang Chen*School of Physical and Mathematical Sciences, Nanyang Technological University, 637371 Singapore

[email protected]

The major grooves of DNA and RNA duplexes are recognized by Triplex-Forming Oligonucleotides (TFOs) through sequence specifi c hydrogen bonding, base stacking, and other molecular interactions.1 Therefore, TFOs have a great potential in biotechnology and therapeutics. Here, we report on the synthesis and binding studies of chemically modified Triplex-Forming Peptide Nucleic Acids (TFPNAs) incorporated with a novel Peptide Nucleic Acid (PNA) monomer, thio-pseudoisocytosine (L). L incorporated Triplex-Forming PNAs (TFPNAs) show superior affinity and specificity in recognizing RNA duplex region to form (RNA)2-PNA triplexes without strand invasion at near physiological conditions.We reason that L has steric repulsion with G in a Watson-Crick-like L-G pair but has enhanced van der Waals interaction with G in a Hoogsteen-like L∙G pair. Thus, incorporation of L in TFPNAs may minimize both pH dependence and strand invasion to favor (RNA)2-PNA triplex formation, and hence facilitate sequence specific and selective recognition of RNA duplex over single strand regions at near-physiological condition. These promising properties of L modified TFPNAs suggest that it is possible to develop PNA based ligands that sequence specifi cally bind the duplex but not single strand regions in large complex RNAs for diagnostic and therapeutic applications.

References1. a) K. R. Fox, T. Brown, Q. Rev. Biophys. 2005, 38, 311-320; b) K. M. Vasquez, P. M. Glazer, Q. Rev. Biophys. 2002, 35, 89-107; c) H. Han, P. B. Dervan, Proc. Natl. Acad. Sci. U S A 1993, 90, 3806-3810; d) R. K. Kumar, D. R. Davis, Nucleic Acids Res. 1997, 25, 1272-1280.

Poster 39


Visualization of G-quadruplex Structures in Human CellsGiulia Biffi 1, David Tannahill1, John McCafferty2 & Shankar Balasubramanian1,3 *

1Cancer Research UK Cambridge Institute, Cambridge, CB2 0RE, UK2Department of Biochemistry, University of Cambridge, Cambridge, CB2 1GA, UK

3Department of Chemistry, University of Cambridge, Cambridge, CB2 1EW, [email protected]

Four-stranded G-quadruplex (G4) nucleic acid structures are of great interest as their high thermodynamic stability under near-physiological conditions suggests that they could form in cells. Previously, G4 structures have only been convincingly visualized by fluorescent imaging in ciliate macronuclei that harbor millions of telomeres. Despite these fi ndings, it has remained an important challenge to visualize G4 structures in the DNA of human cells. To address this, we employed phage display to select in vitro a high affi nity G-quadruplex structure-specifi c antibody (BG4), which was used for immunofluorescence microscopy on human cells. In all cell lines examined, we observed punctate nuclear staining that disappeared after pre-incubation of BG4 with G4 oligonucleotides or by DNase treatment. Some BG4 foci also co-localized with the telomeric protein TRF2, highlighting the formation of G4 structures at human telomeres. We next corroborated the detection of G4 structures in the human genome by evaluating their distribution on individual metaphase chromosomes. Approximately 25% of BG4 foci were localized at chromosome ends, whereas the majority of BG4 foci were found outside telomeres, suggesting G4s form across the genome. In some cases, we observed symmetrical staining of sister chromatids suggesting that G4 formation occurs within the same genomic locations in newly replicated DNA. DNA G4 structure formation was also found to be modulated during cell cycle progression, in a manner that appeared to be DNA replication-dependent as inhibitors of DNA replication decreased the number of BG4 foci. In human cells, we also demonstrated that endogenous DNA G4s can be trapped by the small molecule G4-stabilizing ligand, pyridostatin. These results represent the fi rst quantitative visualization of DNA structures in human cells, and further validate how G4 structures in the genome can be directly targeted by small molecules to interfere with cellular function. We will also report our recent observations exploring G-quadruplex formation in different cellular states such as cancer versus normal cells. Taken together, these studies have great potential to highlight G-quadruplex-related vulnerabilities that could be exploited for future intervention strategies in diseases such as cancer.

Poster 40


G-quadruplex DNA: A Chiral Scaffold for Asymmetric CatalysisGuoqing Jia, Changhao Wang, Yinghao Li, Can Li*

State Key Laboratory of Catalysis, Dalian Institute of Chemical Physics,Chinese Academy of Sciences, China

[email protected], [email protected] Homepage: http://www.canli.dicp.ac.cn

G-quadruplex DNA is characterized by conformational polymorphism. In our previous study, we employed spectroscopic methods, including Raman, Fluorescence and Circular Dichroism (CD), to investigate the topology of G-quadruplex DNA1 and also its interaction with drugs2 under dilute buffer or molecular crowding conditions. The underlying chirality from variable topology inspires us to make G-quadruplex DNA as a chiral catalyst for asymmetric catalysis. In this communication, we report our recent research process on the G-quadruplex DNA-based asymmetric catalysis3.As an example shown in Figure 1, we select human telomeric G-rich sequence (5’-G3(T2AG3)3-3’, ht-G4DNA) to construct G-quadruplex DNA and investigate its catalytic performance in asymmetric Diels-Alder reaction between aza-chalcone (1a) and cyclopentadiene (2). It is found that antiparallel ht-G4DNA alone can catalyze the D-A reaction but showing limited enantioselectivity of 17 % enantiomeric excess (ee) with the major endo isomer (Route I in Figure 1). Upon binding copper(II) ion to antiparallel ht-G4DNA, the enantioselectivity can be enhanced to 74% ee (Route II in Figure 1). More interestingly, when tuning ht-G4DNA to the parallel one, the enantioselectivity of the major endo isomer displays a opposite sign with -47% ee (Route III in Figure 1). These data clearly indicate that G-quadrupelx DNA can be used as a controllable catalyst in asymmetric catalysis owing to its intrinsic conformational polymorphism. Very recently, 92% ee was obtained with finely designed G-quadruplex DNA. Our research highlights a new chemical application of G-quadruplex DNA in vitro as chiral scaffold in the DNA-based biocatalysis.The authors are grateful for fi nancial support from National Natural Science Foundation of China (grant number 31000392).

1 Zhou J., Wei C., Jia G., Wang X., Feng Z., and Li C., Chem. Commun., 2010, 46, 1700-1702; Zhou J., Wei C., Jia G., Wang X., Tang Q., Feng Z., and Li C., Biophys Chem, 2008, 136,124-127.2 Jia G., Feng Z., Wei C., Zhou J., Wang X., and Li C. J. Phys. Chem. B, 2009, 113, 16237-16245; Wei C., Jia G., Zhou J, Han G., and Li C., Phys. Chem. Chem. Phys., 2009,11,4025-4032; Wei C., Jia G., Yuan J, Feng Z., and Li C., Biochemistry, 2006, 45, 6681-6691.3 Wang C., Jia G., Zhou J., Li Y., Liu Y., Lu S., and Li C., Angew. Chem. Int. Ed., 2012, 51, 9352-9355.; Wang C., Li Y., Jia G., Liu Y., Lu S., and Li C., Chem. Commun., 2012, 48, 6232-6234.

Poster 41


Studies on the Stability and Dynamics of Human RNA G-quadruplex StructuresHelena Guiset Miserachs, Daniela Donghi, Roland K.O. Sigel

University of Zurich, Institute of Inorganic Chemistry, Winterthurerstrasse 190, CH-8057Zurich (Switzerland)

[email protected]

Guanine-rich nucleic acid sequences fold into non-canonical helical structures known as G-quadruplexes (GQ) 1. Four guanine bases associate through Hoogsteen hydrogen bonds, resulting in a planar G-tetrad. Two or more G-tetrads π stack upon each other, giving rise to the GQ, stabilized by central metal ions (see image) 2.

We are interested in the study of human RNA GQ-forming sequences, relevant as possible targets for antitumor strategies. We chose the GQ in the mRNA of the NRAS gene (neuroblastoma RAS viral oncogene homolog), which has been shown to inhibit protein synthesis in vitro 3, as well as the TERRA sequence (telomeric repeat-containing RNA), which is relevant for telomere maintenance and inhibits telomerase activity when forming stable GQs 4.

GQ formation has been typically linked to the presence of K+ as a stabilizing ion in the central axis of the structure. The general pattern of DNA GQ-stability has been previously reported to be K+ >> Na+ ≥ Rb+ > Cs+ ≥ Li+ and Sr2+ >> Ba2+ > Ca2+ > Mg2+ for monovalent and divalent cations, respectively 5. We are now investigating the behavior of RNA GQs in the presence of mono- and divalent cations by using different techniques, i.e. circular dichroism, UV thermal melting and NMR spectroscopy.

Finally, NRAS GQ formation and dynamics are being studied by bulk and single molecule FRET (Förster Resonance Energy Transfer) spectroscopy.

Acknowledgements. Financial support by the Swiss State Secretariat for Education and Research (COST Action CM1105) and ERC Starting Grant 2010 (R.K.O.S.), by the Swiss National Science Foundation (to D.D. and R.K.O.S.) and by the University of Zurich is gratefully acknowledged.References

1. J. R. Williamson, Annu. Rev. Biphys. Biomol. Struct. 1994, 23, 703.2. J.L. Huppert, S. Balasubramanian, Nucleic Acids Res. 2007, 35, 2, 406.3. S. Kumari, A. Bugaut, J.L. Huppert, S. Balasubramanian, Nat. Chem. Biol. 2007, 3, 4, 218.4. B. Luke, J. Lingner, EMBO J. 2009, 28, 2503.5. K. Halder, J.S. Hartig, Met. Ions Life Sci. 2011, 9, 125.

Poster 42


Visual Detection of Metal Ions Based on Cyanine Dye Supramolecular Aggregate Selectively Recognizing G-Quadruplex

Hongxia Sun, Lijia Yu, Qianfan Yang, Junfeng Xiang, and Yalin Tang*Beijing National Laboratory for Molecular Sciences (BNLMS), Center for Molecular Sciences, State Key

Laboratory for Structural Chemistry for Unstable and Stable Species, Institute of Chemistry, Chinese Academy of Sciences (ICCAS), Beijing,100190, P. R. China.

[email protected]

The diverse aggregation states and peculiar physicochemical properties make the cyanine dye supramolecular aggregates to be a special G-quadruplex ligand (Nucleic Acids Res. 2013, 41, 2709; Nucleic Acids Res. 2009, 38, 1022; Chem. Commun. 2009, 1103; Anal. Chem. 2010, 82, 9135.). Induced switch of cyanine dye aggregates followed by color changes is observed when they interact with some specifi c G-quadruplex structures. This endows the cyanine dye aggregates the function as G-quadruplex-specifi c visual probes.G-quadruplex structures are sensitive to metal ions, and some G-quadruplex conformations only responding to some specific metal ions. Based on recognizing the G-quadruplex conformation by cyanine dye aggregates, constructing a probe for visual detection of metal ions is possible. The probes for visual detection of K+ and Na+/K+ ratios have been fabricated and their succeed in measuring urinary K+ and Na+/K+ ratios implies their potential clinical application (Chem. Commun. 2013, 49, 4510; Analyst 2012, 137, 5713.).Encouraged by these results, we then develop a Pb2+ probe by using a novel clip-like cyanine dye TC-P4 (Fig. 1a) and the PS2.M G-quadruplexes. With increasing [Pb2+], TC-P4 shows a weakened affi nity for the G-quadruplex-Pb2+ conformation accompanying with a decreased dimer/monomer ratio of TC-P4 and a lightened color (Fig. 1b). The probe has been proved to have a high specifi city to Pb2+, suggesting real application may be possible.

Poster 43


Label-Free Detection of Sub-Nanomolar Lead(Ii) Ions in Aqueous Solution Using a Metal-Based Luminescent Switch-On Probe

Hong-Zhang He, Ka-Ho Leung, Chung-Hang Leung and Dik-Lung MaDepartment of Chemistry, Hong Kong Baptist University

[email protected]

A label-free oligonucleotide-based luminescence switch-on assay has been developed for the selective detection of sub-nanomolar Pb2+ ions in aqueous solution and real water samples. An iridium(III) complex was employed as a G-quadruplex specifi c luminescent probe and a guanine rich DNA (PS2.M, 5'-GTG3TAG3CG3T2G2-3') was employed as recognition unit for Pb2+ ions. The PS2.M exists in a single-stranded conformation in the absence of Pb2+ ions,

and the weak binding of the iridium(III) probe to ssDNA results in a weak luminescence signal. Upon binding to Pb2+ ions, the single-stranded DNA sequence (PS2.M) is induced into a G-quadruplex conformation, which greatly enhances the luminescence emission of the iridium(III) probe. The assay can detect Pb2+ ions in aqueous media with a limit of detection of 600 pM. It also exhibits good selectivity for Pb2+ ions over other heavy metal ions. Furthermore, the application of the assay for the detection of Pb2+ ions in spiked river water samples has been demonstrated.

Poster 44


Time-resolved NMR Studies of the K+-induced Folding of Human Telomeric G-QuadruplexIrene Bessi, Anna Lena Lieblein, Christian Richter and Harald SchwalbeInstitute for Organic Chemistry and Chemical Biology , BMRZ, Goethe

Universit y, Max-von-Laue Strasse 7 , 60438,Frankfurtam Main, German ybessi@nm r.uni-frankfurt.de

The folding pathway of human telomeric G-quadruplex is far from being completely understood and an investigation of the folding/unfolding kinetics is necessary to shed light on the functions of telomeres as well as to improve the effi ciency of nanoswitches. NMR is a powerful tool to characterize the species involved in the folding process at atomic resolution and to point out the folding topologies actually present.

We report our initial results on the K+-induced folding kinetic of the human telomeric sequence wtTel26 ([TTAGGG]4TT) monitored by real-time NMR spectroscopy, using a rapid-mixing device.1

Furthermore, we have investigated the K+-induced conformational transition of the human telomeric sequence Tel22 (AGGG[TTAGGG]3) from the basket-type form to the mixture of hybrid-type forms,2,3,4 previously studied by means of CD, DSC and 2-aminopurine fl uorescence.5,6

Acknowledgements: The European community (Bio-NMR and EAST-NMR), the DFG-funded Cluster of Excellence: Macromolecular Complexes and the state of Hessen (BMRZ) are acknowledged for the fi nancial support.

References1. Mok K. H., Nagashima T., Day I. J., Jones J. A., Jones C. J., Dobson C. M., Hore P. J., J. Am. Chem. Soc., 125, 12484 – 12492 (2003)2. Wang Y., Patel D. J., Structure, 1, 263−282 (1993)3. Dai J. X., Punchihewa C., Ambrus A., Chen D., Jones R. A., Yang D. Z., Nucleic Acids Res., 35, 2440−2450 (2007)4. Dai J. X., Carver M., Punchihewa C., Jones R. A., Yang D. Z., Nucleic Acids Res., 35, 4927−4940 (2007)5. Gray R. D., Li J., Chaires J. B., J. Phys. Chem. B, 2676-2683 (2009)6. Gray R. D., Petraccone L., Trent J. O., Chaires J. B., Biochemistry, 49(1), 179-94 (2010).

Poster 45


Interaction of Human Telomeric G-quadruplex with GW2974 and SCH-442416 as Potential Anticancer Agents

Ismail M. El Haty, Alaa A. Salem and Ibrahim M. AbdouDepartment of chemistry, Faculty of Science, United Arab Emirates University, P.O. Box 15551, Al Ain,

[email protected]

DNA G-quadruplex has received a growing attention over the last two decades due to its potential for developing new selective and effi cient anti-cancer drugs. Presence of DNA G-quadruplex structures in the cells were found associated with the presence of the reverse transcriptase telomerase enzyme responsible for re-elongating the telomeres DNA. This enzyme is active in stem cells and in almost 85% of cancer cells. G-quadruplex has also been detected in promoter regions of some oncogenes such as c-myc, k-ras and c-kit. Stabilizing the G-quadruplex structures using small molecules is associated with inhibition of the telomerase enzyme that results in stopping DNA replication and subsequently cancer proliferation.

GW2974 (N4-(1-Benzyl-1H-indazol-5-yl)-N6,N6-dimethyl-pyrido¬[3,4-d]¬pyrimidine-4,6-diamin-e) was reported to selectively inhibit both EGFR and ErbB-2 tyrosine kinase receptors in tumor cells. Inhibition of EGFR was found effective in prevention and treatment of gallbladder carcinoma in mice. A synergistic inhibitory effect was also reported for GW2974 against the growth of MCF-7, MCF-18, and MTR-3 human breast cancer cell lines in combination of HA14-1 or GX15-070. On the other hand, SCH-442416 (5-Amino-7-[3-(4-methoxy)phenylpropyl]-2-(2-furyl)-pyrazolo[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine) has been reported as highly potent and selective human A3 adenosine receptor antagonists.

In this work, interaction mechanisms of GW2974 and SCH-442416 with each of telomeric DNA G-quadruplex (AGGG(TTAGGG)3) and Calf thymus DNA were investigated. Stoichiometry, binding affinity and selectivity of these compounds towards G-quadruplex over duplex were studied using UV-Vis, fluorescence and circular dichorism spectroscopies. GW and SCH were found to interact with G-quadruplex through two dependent binding sites with binding constants of K=1.3x105 and 7x106 M-1 for GW and K= 7.3x104 and 1x107 M-1 for SCH, respectively. Melting temperatures of the DNA G-quadruplex and drug-complex were found 65.3, 75.4 °C for GW and 65.3, 75.1 °C for SCH, respectively.

Poster 46


Interactions of Novel Cyclic Naphthalene Diimide with Different Nucleic AcidsIzabella Czerwinska, Md. Monirul Islam, Shinobu Sato, and Shigeori Takenaka

Research Center for Bio-microsensing Technology; Department of Applied Chemistry; Kyushu Institute of Technology; 1-1 Sensui-cho, Tobata-ku, Kitakyushu-shi, Fukuoka

804-8550 Japan, Tel&Fax: [email protected]

More recently, G-quadruplex structures in human cells have been quantitatively visualized and proof of G-quadruplexes formation in human DNA during cell-cycle has been reported. Moreover, it was also proved that small organic molecule (ligand) can trap tetraplex structures in the cells, suggesting that the effects of ligands on G-quadruplex structures formed in a biochemically functional context will easily assist in the future development of anticancer drugs [1]. Stabilization of telomeric G-quadruplex structures by naphthalene diimide compounds in vitro has been already studied [2,3,4]. In this report, we present differences in affinity of cyclic naphthalene diimide to the different structural forms of telomeric DNA, depending on the conditions (Fig. 1. shows docking of cyclic derivative on external G-tetrad of hybrid-type quadruplex). The results have been compared to non-cyclic derivative and revealed that preferential binding of ligands to G4 DNA strongly depends on G-quadruplex topology and structural features of ligands. Additionally, we studied interactions of both investigated compounds to double-stranded DNAs. TOPO I assays and CD measurements confi rmed intercalation mode of binding of cyclic derivative as well as non-cyclic derivative. Stopped fl ow experiments showed quite different association-dissociation rate for each compound, suggesting formation of “pseudo-catenane” complex with double-stranded DNAs in case of cyclic derivative. Similar conclusion has been made from the results obtained in thermodynamic experiments.

In our studies we have used following methods: absorption and circular dichroism spectroscopies, and stopped fl ow technique. Topoisomerase I and TRAP assays were also conducted.

References1. G. Biffi , D. Tannahill, J. McCafferty, and S. Balasubramanian, Nature Chemistry, 5 (2013) 182-186.2. S. M. Hampel, A. Sidibe, M. Gunaratnam, J. Riou, and S. Neidle, Bioorganic & Medicinal Chemistry Letters, 20 (2010), 6459-6463.3. A. Peduto, B. Pagano, C. Petronzi, A. Massa, V. Esposito, A. Virgilio, F. Paduano, F. Trapasso, F. Fiorito, S. Florio, C. Giancola, A. Galeone, and R. Filosa, Bioorganic & Medicinal Chemistry 19 (2011) 6419-6429.4. I. Czerwinska, S. Sato, and S. Takenaka, Bioorganic & Medicinal Chemistry 21 (2012) 6416-6422.

Poster 47


Driving Forces in Human Telomeric DNA FoldingMatjaž Bončina, Iztok Prislan, Gorazd Vesnaver and Jurij Lah

Faculty of chemistry and chemical technology, University of Ljubljana, Aškerčeva 5, 1000 Ljubljana, Slovenia

[email protected]

G-quadruplexes have attracted signifi cant attention due to their growing biological importance, mainly as possible regulators of transcription of cancer cells DNAs in gene promoter regions of oncogenes and telomeric regions.1 Therefore, development of new anticancer G-quadruplex stability ligands seems a novel anticancer strategy. Understanding of pathways and driving forces of human telomeric DNA folding into G-quadruplex structures is thus of fundamental and practical interest in development G-quadruplex stabilizing drugs.

In the present study we focused on folding pathways of the model telomeric human DNA, 5’-AGGGTTAGGGTTAGGGTTAGGG-3’ (Tel22) in the presence of K+ ions. We performed global thermodynamic analysis of calorimetric (DSC, ITC) and spectroscopic (CD, UV-absorption) data obtained on monitoring the folding process of Tel22 induced by changes of temperature and K+ concentration. We show that folding of human telomeric DNA in K+ solution may be described as an equilibrium three-state process2 which suggest formation of stable intermediate triplex structure3,4 in the pathway between fully unfolded DNA and intramolecular G-quadruplex structure. Each step in the folding mechanism is characterized by extensive enthalpy-entropy compensation, with substantial negative change in heat capacity in the fi rst transition step (unfolded DNA → triplex) and ~1.5 bound ions in both transitions steps. Heat capacity changes and number of bound ions in each transition step can reasonably be explained only if intermediate conformation is taken into account.2

References1. Balasubramanian S.; Hurley, L.H.; Neidle S. Nature, 2011, 10, 261-275.2. Bončina, M.; Lah, J.; Prislan, I.; Vesnaver, G. J. Am. Chem. Soc. 2012, 134, 9657-9663.3. Mashimo, T.; Yagi, H.; Sannohe, Y.; Rajendran, A.; and Sugiyama, H. J. Am. Chem. Soc. 2010, 132, 14910-14918.4. Koirala, D.; Mashimo, T.; Sannohe, Y.; Yu, Z.; Mao, H.; Sugiyama, H. Chem. Commun. 2012, 48, 2006-2008.

Poster 48


New Systems Based on Peroxidase-Mimicking DNAzymesJoanna Kosman, Bernard Juskowiak

Laboratory of Bioanalytical Chemistry, Adam Mickiewicz University, Poznan, [email protected]

The promising analytical systems that recently attract attention are DNAzymes based on catalytically active DNA molecules. One of these systems – peroxidase-mimicking DNAzyme [1] – exploits G-quadruplex/hemin complex as an active unit and its potential in bioanalytical applications has been proven [2]. Most of the assays involving such a setup is based on a PS2.M oligonucleotide (5’GTG GGT AGG GCG GGT TGG3’), which is responsible for DNAzyme formation and possesses one of the highest activity among all peroxidase-like DNAzymes. The sequences capable to form G-quadruplexes from human genome have been also investigated from the point of their potential peroxidase activity after forming the complex with hemin. The usage of the DNAzyme based on telomeric DNA sequence could have a potential in bioassays especially for telomerase activity.

The G-quadruplex topology is infl uenced not only by the nucleotide order but also by environmental conditions. Variation of such conditions can alter telomeric G-quadruplex structure and hence its peroxidase activity. We have investigated the infl uence of many factors on the telomeric DNAzyme activity such as: the type and concentration of cation, surfactant, molecular crowding agent, pH, temperature and the way of DNAzyme preparation [3]. We showed that aside of potassium cation presence, the addition of magnesium ion to the solution signifi cantly improved the DNAzyme activity. This is particularly interesting when bioassays are considered, since potassium and magnesium are the two most abundant cations in cellular fl uids. The optimization of catalytic reaction conditions allowed for designing the telomerase assay based on DNAzyme formed on elongated telomeric DNA strands.

The development of new assays based on peroxidase-mimicking DNAzymes requires novel substrates for the enzymatic reaction, which will give the sensitive and easy to measure response. The most of methods employed two substrates: ABTS and luminol. We have investigated also the usage of fl uorogenic compounds, which would allow for more sensitive measurements. The studies involved thiamine, Amplex Red and 4-(N-Methylhydrazino)-7-nitro-2,1,3-benzooxadiazole (MNBDH). In an another approach, we have studied the possibility of applying DNAzyme to catalyze the reaction of silver deposition.

Acknowledgements: This work was supported by Grant Nr. NCN 2011/03/NST4/00653 from National Center of Science, Poland and COST action MP0802.

References1. P. Travascio, Y. Li, D. Sen, Chem. Biol. 5 (1998) 505-517.2. J. Kosman, B. Juskowiak, Anal. Chim. Acta. 707 (2011) 7-17.3. J. Kosman, B. Juskwiak, Centr. Eur. J. Chem. 10 (2012) 368-372.

Poster 49


Unusual Quadruplex: Tri-G-quadruplex and Double-quadruplex Jun Zhou, Samir Amrane, Anne Bourdoncle, Frédéric Rosu, Valérie Gabelica, Jean-Louis Mergny

Université de Bordeaux, Laboratoire ARNA, F-33000 Bordeaux and INSERM, U869, Institut Européen de Chimie et Biologie, F-33600 Pessac, France.

[email protected] (J. Zhou ); [email protected] (J.-L. Mergny)

Guanine-rich oligonucleotides being able to self-associate to form G-quadruplex, However, all the G-quadruplex structures investigated to date are formed by one, two and four G-rich strands. Therefore, an important question remains unanswered: can G-quadruplex structures be formed by three strands, leading to a tri-G-quadruplex species? Interestingly, cytosine-rich sequence, the complementary of G-rich strand can form another quadruplex structure, i-motif, at acidic condition.

Herein, we first report, to the best of our knowledge, the formation of a tri-G-quadruplex [1] and double-quadruplex structure (coexistence of G-quadruplex and i-motif) in the same strand [2], respectively. Our results showed that G-quadruplex can be formed by three strands by using conventional Watson-Crick duplex to approach G-tract. Furthermore, we demonstrated that G-quadruplex and i-motif can be formed at the same strand. The principle of our design is similar to our previous finding: G-quadruplex formation requires the presence of a G4-compatible cation, whereas i-motif demands acidic conditions [3]. In addition, we found that the double-quadruplex structure can be visualized using crystal violet as an external probe. The structural switching can be employed as a NOTIF logic gate.

The two simple “unusual” quadruplex structures can be constructed easily and economically; therefore, they may provide a new route to nanoscale materials.

References[1] Zhou J, Bourdoncle A, Rosu F, Gabelica V, Mergny JL. Angew Chem Int Ed. 2012, 51: 11002–11005.[2] Zhou J, Amrane S, Korkut DN, Bourdoncle A, He HZ, Ma DL, Mergny JL. Angew Chem Int Ed. DOI: 10.1002/anie.201301278[3] Phan AT, Mergny JL, Nucleic Acids Res. 2002, 30: 4618–4625.

Poster 50


Tetramolecular G-quadruplex Assembly: Effects of Polarity Site InversionsJussara Amato, Stefano De Tito, Nunzia Iaccarino, Ettore Novellino, Bruno Pagano,

Antonio RandazzoDepartment of Pharmacy, University of Naples “Federico II”, via D. Montesano 49, 80131 Napoli, Italy

[email protected]

Guanine-rich nucleic acid motifs are able to form G-quadruplex structures characterized by a core of at least two stacked G-tetrads, stabilized by monovalent cations. The biological interest towards G-quadruplexes is constantly increasing due to the evidence of their in vivo existence1-3. Beyond their biological relevance, the self-assembly, stability, and rigidity of G-quadruplexes are also interesting for nanotechnology and biotechnology applications4. G-quadruplex structures possess a remarkable polymorphism due to several mutually interconnected structural features5, including number of strands and their mutually orientation (e.g. parallel vs antiparallel), loop topology (e.g. lateral vs diagonal vs propeller) and syn/anti conformation of guanine glycosidic bonds. As a matter of fact, each of the four possible strand arrangements is characterized by different type of tetrads, all G-anti for A4 (all strands parallel), syn–syn–syn–anti or anti–anti–anti–syn for A3B (three strands parallel and the other antiparallel) and syn–syn–anti–anti for A2B2 (two adjacent strands parallel and the others antiparallel) and syn–anti–syn–anti for (AB)2, (each strand running in the opposite direction respect to the adjacent ones)4.The structural variability of G-quadruplexes has been further increased by introducing modifi cation on both bases6 and sugar-phosphate backbone7,8. For example, it has been reported that the introduction of polarity site inversions (3’–3’ or 5’–5’) in some cases may lead to the formation of guanines in syn in an all parallel G-quadruplex structure [9]. Particularly, the 5’–5’ modifi ed sequences d-TG3T and d-TG4T form tetramolecular Gquadruplexes containing an all G-syn tetrad on a position adjacent to the inversion of polarity site [9].The effect of polarity site inversions (3’–3’ or 5’–5’) on the structure and the stability of Gquadruplexes formed by d-TG5T and d-TG6T have been investigated by NMR, PAGE and circular dichroism. We show that the effect of the 5’-5’ inversion in the d-TG5’-5’GGGGT and d-TG5’-5’GGGGGT sequences is of promoting higher order G-quadruplex structures, thus increasing the variability of G-quadruplex structures.

References1. Biffi G., Tannahill D., McCafferty J., Balasubramanian S. Nat. Chem. 2013, 5, 182-6.2. Lam E.Y., Beraldi D., Tannahill D., Balasubramanian S. Nat. Commun. 2013, 4, 1796.3. Xu Y., Komiyama M. ChemBioChem 2013, 14, 927-8.4. Davis J.T. Angew. Chem. Int. Ed. Engl. 2004, 4, 668-98.5. Burge S., Parkinson G.N., Hazel P., Todd A.K., Neidle S. Nucleic Acids Res. 2006, 34, 5402-15.6. Gros J., Rosu F., Amrane S., De Cian A., Gabelica V., Lacroix L., Mergny J.L. Nucleic Acids Res.2007, 35, 3064-75.7. Datta B., Bier M.E., Roy S., Armitage B.A. J. Am. Chem. Soc. 2005, 127, 4199-207.8. Nielsen J.T., Arar K., Petersen M. Nucleic Acids Res. 2006, 34, 2006-14.9. Esposito V., Virgilio A., Randazzo A., Galeone A., Mayol L. Chem. Commun. 2005, 3953-5.

Poster 51


The Biological Function of Parallel Intermolecular G-Quadruplexes at TelomeresKatherine G. Zyner†, Liana Oganesian†‡, Paul Bonnefi n†, Scott Cohen†, Roger Reddel†

and Tracy M. Bryan†

† Children’s Medical Research Institute, Australia;‡Current Address: The Salk Institute for Biological Studies, United States

[email protected]

Due to their guanine-rich nature, the 3’ overhang of telomeres can form compact secondary nucleic acid structures called G-quadruplexes. In 1991 it was shown that intramolecular telomeric G-quadruplexes could inhibit telomere extension by telomerase, an enzyme which is over-expressed in 85% of tumour cells1. As a result, many laboratories are currently developing small molecules for use as anti-cancer therapeutics due to their ability to a) lock telomeric sequences in G-quadruplex conformations and subsequently inhibit telomerase activity in vivo and b) disrupt telomere protective capping proteins and cause apoptosis through the stabilisation of telomeric G-quadruplex structures2. However, the biologically significant G-quadruplex telomeric conformations and their roles within human cells and tumours have not yet been identified. As such, global telomeric G-quadruplex stabilisation may result in unintended consequences during clinical use.

Our lab has shown that intermolecular parallel telomeric G-quadruplex structures from both ciliate3 and human species can be extended by telomerase, suggesting the importance of this conformation in vivo. This particular G-quadruplex has been hypothesised to facilitate homologous chromosome alignment and telomere clustering during prophase I of meiosis4. In order to analyse the biological relevance of telomerase’s interaction with the parallel quadruplex, we have utilised the ciliated protozoan Tetrahymena thermophila, which is a valuable model system for studying both telomeres and meiosis. A mutant T. thermophila strain was created using the telomerase TERT mutation K538A, which allows telomerase to elongate linear telomeric sequences but not parallel G-quadruplexes5. Cells expressing mutant telomerase exhibit a “monster cell” phenotype and multiple nuclei, suggesting that the G-quadruplex/telomerase interaction is of critical importance for mitotic division.

References1. Zahler, A. M., et al (1991) Nature 350, 718-7202. Neidle, S. (2010) FEBS J. 277, 1118-11253. Oganesian, L., et al (2006) EMBO 25, 1148-11594. Sen, D. and Gilbert W. (1988) Nature 334, 364-3665. Oganesian L., et al (2007) ACS Publications Biochemistry 46, (40), 11279–11290

Poster 52


Interaction Analysis of Long Telomeric G-Quadruplex and Marocyclic Polyoxazole LigandsKeisuke Iida, Satoki Majima, Takahiro Nakamura, and Kazuo Nagasawa

Department of Biotechnology and Life Science, Faculty of Engineering, Tokyo University of Agriculture and Technology

[email protected]

Telomeric DNA contains repeating sequences of TTAGGG, with a single-stranded region of approximately 150 bases, G-overhang, at its 3’ terminal. This guanine-rich single strand is believed to fold into G-quadruplex (G4) in cell. Telomeric G4 is regarded as a molecular target for cancer chemotherapy, and many small molecules that stabilize the G4 structure have been reported so far as candidate anti-cancer agents and chemical-biology tools. However, interaction analysis of longer telomeric DNA and G4 ligands were still remained.

In this study, we investigated the interactions of long telomeric DNAs with G4 ligands, macrocyclic hexaoxazole ligands of L2H2-6OTD and its dimer, by means of electrophoresis mobility shift assay, circular dichroism (CD) titration analysis, and DNA melting measurements.

References1. K. Iida, G. Tsubouchi, T. Nakamura, S. Majima, H. Seimiya and K. Nagasawa, Med. Chem. Commun., 2013, 4, 260-264.2. K. Iida, S. Majima, T. Nakamura, H. Seimiya and K. Nagasawa, Molecules, 2013, 18, 4328-4341.

Poster 53


Binding Interactions between Nickel Schiff Base Complexes and Quadruplex DNAK.J. Davis, C. Richardson, J.L. Beck, and S.F. Ralph

School of Chemistry, University of Wollongong, Wollongong, NSW, Australia, [email protected]

The work presented here explores the ability of nickel(II) Schiff base complexes to bind selectively to quadruplex DNA (qDNA), and therefore act as potential inhibitors of telomerase. Reed et al. demonstrated previously that nickel Schiff base complexes effectively bind to qDNA.1,2 We are modifying nickel Schiff base structures through a two-pronged approach; the first is where the number and position of aromatic ring systems present is varied, and the second is where the identity of pendant groups designed to interact with the grooves of qDNA structures are positioned. One particular complex of interest is1, which was prepared using meso-1,2-diphenylethylenediamine. Electrospray ionization mass spectrometry (ESI-MS), absorption spectrophotometry and circular dichroism spectroscopy all show that this complex binds poorly to duplex DNA. In contrast, the above techniques demonstrate that1 binds to d(TTGGGGGT)4, a parallel, tetramolecular qDNA structure. This shows that the incorporation into a Schiff base ligand of a non-planar structural unit such as that obtained using meso-1,2-diphenylethylenediamine can engender significant levels of binding selectivity for qDNA over double stranded DNA (dsDNA). This is unexpected, and we are currently exploring the binding properties of 1 and other novel nickel Schiff base complexes towards a range of other qDNA molecules.

References1. Reed, J.E.; Arnal, A.A.; Neidle, S.; Vilar, R.; J. Am. Chem. Soc. (2006) 128:5992-59932. Campbell, N.H.; Karim, N.H.A; Parkinson, G.N.; Gunaratnam, M.; Petrucci, V.; Todd, A.K.; Vilar, R; Neidle, S.; J. Med. Chem (2012) 55:209-222

Poster 54


Nuclear Magnetic Resonance Spectroscopy Study of The Human Telomeric I-Motif Under in Vivo Conditions

Laurie Lannes, Harald SchwalbeInstitute of Organic Chemistry and Chemical Biology, Biomolecular Magnetic Resonance Center, Goethe

University,Max-von-Laue-Strasse 7, 60438, Frankfurt am Main, Germany

[email protected]

Both human telomeric (HT) strands respectively composed of the repeats: d(TTAGGG)n and d(CCCTAA)n are known to show a self-association capacity1,2. Indeed under specifi c conditions these sequences form two distinct quadruplex structures namely G-quadruplex and i-motif. The latter one sets on the C-rich strand and is characterized by intercalated hemiprotonated cytidine.cytidine+ base pairs triggered in vitro by decreasing the pH to slightly acidic values. Despite the fact that it exists through the genome numerous C-rich sequences able to fold in an i-motif assemble, there is no direct evidence to stand for the formation of such structure in vivo.

The in vitro kinetics of folding of the HT i-motif has been solved by our group using time-resolved NMR spectroscopy3. Now we want to investigate this kinetics in cell-like conditions. These investigations could give an insight of how the putative i-motif sequence present in the genome or i-motif-based nanodevices may behave in vivo under folding-favorable conditions. This investigation represents also a preliminary study before carry out in-cell experiments. The Krishnan group developed a FRET-based cellular pH-sensor named I-switch relying on the i-motif folding pH-response4,5. By using in-cell NMR we expect to monitor an I-switch device built on the HT sequence through the endosome maturation pathway, and then bring a structural proof of the relevance of such devices.

Meanwhile we try to develop a PCR-based method to produce isotope-labeled (15N, 13C) complementary but single-stranded G-quadruplex and i-motif DNA sequences for NMR applications.

References1. Leroy, J.L., Gueron, M., Mergny, J.L. and Helene, C. (1994) Intramolecular folding of a fragment of the cytosine-rich strand of telomeric DNA into an i-motif. Nucleic acids research, 22, 1600-1606.2. Williamson, J.R., Raghuraman, M.K. and Cech, T.R. (1989) Monovalent cation-induced structure of telomeric DNA: the G-quartet model. Cell, 59, 871-880.3. Lieblein, A.L., Buck, J., Schlepckow, K., Furtig, B. and Schwalbe, H. (2012) Time-resolved NMR spectroscopic studies of DNA i-motif folding reveal kinetic partitioning. Angewandte Chemie, 51, 250-253.4. Modi, S., M, G.S., Goswami, D., Gupta, G.D., Mayor, S. and Krishnan, Y. (2009) A DNA nanomachine that maps spatial and temporal pH changes inside living cells. Nature nanotechnology, 4, 325-330.5. Modi, S., Nizak, C., Surana, S., Halder, S. and Krishnan, Y. (2013) Two DNA nanomachines map pH changes along intersecting endocytic pathways inside the same cell. Nature nanotechnology.

Poster 55


Exploring G-quadruplex Unfolding in Higher-Order DNA StructuresIolanda Fotticchia1, Concetta Giancola2, Luigi Petraccone3

1Dipartimento di Scienze Farmaceutiche, Università di Salerno, Via Ponte Don Melillo, 84084,Fisciano (SA), Italy. E-mail:[email protected]

2Dipartimento di Farmacia, Università di Napoli “Federico II”, Via D. Montesano 49, 80131 Napoli, Italy. E-mail:[email protected]

3Dipartimento di Scienze Chimiche, Università di Napoli “Federico II”, Via Cintia 4, 80126 Napoli, Italy. E-mail:[email protected]

G-quadruplex structures have generated considerable attention as they are implicated in important biological processes such as aging and cancer and, more generally, in the regulation of gene expression.1, 2 Studying the factors governing the quadruplex folding/unfolding is a key step to understand their biological role and for developing effi cient drugs. The majority of the biophysical studies on G-quadruplexes are focused on single quadruplex when isolated from its biological environment. However, in the genomic context, G-quadruplex can be part of higher order structures formed by more DNA secondary structural elements as duplex or other quadruplexes.3-5 The interactions between neighboring G-quadruplexes or between a quadruplex and an adjacent duplex region could greatly affect the kinetics and thermodynamics of the single quadruplex folding/unfolding.

In this work, we studied the quadruplex unfolding in a quadruplex-quadruplex (Q-Q) or a quadruplex-duplex (Q-D) higher order structure using a DNA telomeric sequence as model system. Particularly, we have characterized the hybridization reactions of the (T2AG3)8T2 telomeric sequence, forming a Q-Q higher order structure,5 with the shorter (A2TC3)4 complementary single strand having the length of a single quadruplex forming sequence. We show that a fi rst hybridization reaction leads to the unfolding of a quadruplex unit in the Q-Q structure leading to the formation of Q-D structures whereas a second hybridisation event leads to the unfolding of the remaining quadruplex in the Q-D structures. The unfolding processes were characterised by gel electrophoresis, isothermal titration calorimetry, CD and fl uorescence spectroscopy. The obtained results suggest that both the Q-Q and Q-D interactions affect the unfolding properties of the quadruplex unit. Further, we found that the kinetics and thermodynamics of quadruplex opening depends on the type of higher order structure (Q-Q or Q-D) involving the quadruplex unit. These effects could play a crucial role in the biological processes involved in stabilizing or resolving quadruplex structures in the genome.

References1. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S., Quantitative visualization of DNA G-quadruplex structures in human cells. Nat Chem 2013, 5, (3), 182-6.2. Balasubramanian, S.; Neidle, S., G-quadruplex nucleic acids as therapeutic targets. Curr Opin Chem Biol 2009, 13, (3), 345-53.3. Palumbo, S. L.; Ebbinghaus, S. W.; Hurley, L. H., Formation of a unique end-to-end stacked pair of G-quadruplexes in the hTERT core promoter with implications for inhibition of telomerase by G-quadruplex-interactive ligands. J Am Chem Soc 2009, 131, (31), 10878-91.4. Petraccone, L., Higher-Order Quadruplex Structures. Top Curr Chem 2013, 330, 23-46.5. Petraccone, L.; Spink, C.; Trent, J. O.; Garbett, N. C.; Mekmaysy, C. S.; Giancola, C.; Chaires, J. B., Structure and stability of higher-order human telomeric quadruplexes. J Am Chem Soc 2011, 133, (51), 20951-61.

Poster 56


AGG, CGG and UGG Tandem Repeats RNA Sequences Fold into G-quadruplex StructuresMagdalena Malgowska1, Dorota Gudanis1, Valérie Gabelica2, Zofi a Gdaniec1

1Institute of Bioorganic Chemistry Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan, Poland; 2 Physical Chemistry and Mass Spectrometry Laboratory, Department of Chemistry, University of

Liège, Belgium [email protected]

Tandem trinucleotide repeat sequences (TNRs) are present in many eukaryotic and prokaryotic genomes and transcriptomes. The TNRs demonstrate extreme instability and are often polymorphic in length. Abnormal expansion of certain TNR sequences in some specifi c genes underlies a number of severe neuromuscular and neurodegenerative disorders. Detailed analysis of the whole human genome and the exome has shown that some of repeats are widespread, while others are very rare1. It is believed that the knowledge of spatial structure of TNRs may be crucial for understanding the pathogenesis of many human diseases associated with their expansion2.

We have focused our attention on RNA sequences composed of tandem trinucleotide repeats containing GG tracts separated by A, C or U residues. Biochemical and biophysical methods showed that (AGG)17 and (UGG)17 transcripts can easily fold into G-quadruplexes.3 In contrast, data from structure probing and non-denaturating gel electrophoresis indicated that (CGG)17 molecule formed stable hairpin, while CD spectra provided ambiguous results.3

Our objective was to fi nd out what type of structural changes occur when different bases (A, C, U) are used to separate GG tracts. Are these molecules able to form G-quadruplexes? How do different ions infl uence the fi nal topology? To answer these questions we have examined a set of RNA samples composed of two or four AGG, CGG and UGG repeats in the presence of K+, Na+ and NH4+ ions using NMR, CD, UV spectroscopies and mass spectrometry. Our results indicate that molecules containing AGG or UGG repeats tend to fold G-quadruplex structures in all tested solution conditions, whereas the molecule composed of CGG repeats preferentially folds into G-quadruplex only in the presence of potassium ions. In the presence of sodium ions the equilibrium between duplex and quadruplex structures was observed, while using ammonium ions only a duplex structure was detected.

Acknowledgements:

This work has been supported by research grant form National Science Centre (No N N301 707040) and by EU COST action MP0802 (STSM n°11227 to MG).

References1. P. Kozlowski, M. de Mezer and W.J. Krzyzosiak, Nucleic Acids Research, 2010, 38, 4027 – 40392. W.J. Krzyzosiak, K. Sobczak, M. Wojciechowska, A. Fiszer, A. Mykowska, P. Kozlowski, Nucleic Acids Research, 2012, 40, 11-263. K. Sobczak, G. Michlewski, M. de Mezer, E. Kierzek, J. Krol, M. Olejniczak, R. Kierzek and W.J. Krzyzosiak, J. Biol. Chem., 2010, 285, 12755 – 12764

Poster 57


Shedding Light on the Activity of G-quadruplex Ligands in CellsMarco Di Antonio†,‡ Olivia Walker†,‡ and Shankar Balasubramanian†,‡

†Cancer Research UK Cambridge Institute, Li Ka Shing Centre, Robinson Way, Cambridge, CB2 0RE, UK.‡Department of Chemistry, University of Cambridge, Lensfi eld Road, Cambridge, CB2 1EW, UK.

[email protected]

Cellular studies could be used to ascertain what phenotypes are associated with G-quadruplex stabilization in cells.1 We have already reported that the G-quadruplex ligand pyridostatin (PDS) generates a DNA damage response in a transcriptional and replication dependent fashion.2

Herein, we investigated the cellular behaviour of a panel of G-quadruplex ligands that have been rationally designed or selected to have diverse chemical structures and G-quadruplex binding properties. We have found that introducing conformational flexibility in the PDS scaffold provides the molecule with groove binding properties and that this analogue no longer induces a DNA damage response in MRC-5-SV40 cells despite retaining the high G-quadruplex stabilization properties of PDS measured by FRET melting assays. We have also shown that another potent G-quadruplex ligand, Phen-DC3,

3 does not induce DNA damage under the same conditions despite the strong quadruplex stabilization properties measured in biophysical assays. However, by treating MRC-5-SV40 with these ligands, a strong staining increase of the selective G-quadruplex antibody BG4 was observed in each case.4 This suggests that these ligands are still able to stabilize G-quadruplexes in cells and implies that DNA damage response is not a phenotype necessarily associated with the cellular stabilization of these structures.The value of biophysical assays to estimate the affi nity of small molecules for G-quadruplex nucleic acids is unquestionable. However, we show that cellular studies with ligands represent the ultimate way to assess their capability of recognizing the target in vivo and that even ligands with moderate biophysical potential can have very interesting cellular properties. We also anticipate that the use of the G-quadruplex selective antibody BG4 will provide an unprecedented strategy to measure the variation of G-quadruplex occurrence in cells upon treatment with small molecule ligands.

References1. M. Di Antonio, R. Rodriguez, S. Balasubramanian, Methods 2012, 57, 84-922. R. Rodriguez, K. M. Miller, J. V. Forment, C. R. Bradshaw, M. Nikan, S. Britton, T. Oelschlaegel, B. Xhemalce, S. Balasubramanian, S. P. Jackson, Nat. Chem. Biol. 2012, 8, 301-310.3. A. De Cian, E. Delemos, J. L. Mergny, M. P. Teulade-Fichou, D. Monchaud, J. Am. Chem. Soc. 2007, 129, 1856-1857;4. G. Biffi , D. Tannahill, J. McCafferty, S. Balasubramanian, Nat. Chem. 2013, 5, 182-186.

Poster 58


Clerocidin-mediated DNA Footprinting Discriminates among Different G-Quadruplex Conformations and Detects Tetraplex Folding in a Duplex Environment

Matteo Nadaia, Manlio Palumbob, Sara N. Richtera

aDepartment of Molecular Medicine, University of Padua, via Gabelli 63, 35121 Padua. Italy; bDepartment of Pharmaceutical and Pharmacological Sciences, University of Padua, via Marzolo 5,

35131 Padua, Italy [email protected]

Background

G-quadruplexes are polymorphic non-canonical nucleic acid conformations involved both in physiological and pathological processes. Given the high degree of folding heterogeneity and comparable conformational stabilities, different G-quadruplex forms can occur simultaneously, hence rendering the use of basic instrumental methods for structure determination, like X-ray diffraction or NMR, hardly useful. Footprinting techniques represent valuable and relatively rapid alternative to characterize DNA folding. The natural diterpenoid clerocidin is an alkylating agent that specifi cally reacts at single-stranded DNA regions, with different mechanisms depending on the exposed nucleotide.

Methods

Clerocidin was used to footprint G-quadruplex structures formed by telomeric and oncogene promoter sequences (c-myc, bcl-2, c-kit2), and by the thrombin binding aptamer.

Results

The easy modulability of CL reactivity towards DNA bases permitted to discriminate fully and partially protected sites, highlight stretched portions of the G-quadruplex conformation, and discriminate among topologies adopted by one sequence in different environmental conditions. Importantly, CL displayed the unique property to allow detection of G-quadruplex folding within a duplex context.

Conclusions

CL is a finely performing new tool to unveil G-quadruplex arrangements in DNA sequences under genomically relevant conditions.

Poster 59


Design, Synthesis and Evaluation of a New Series of Bis-Triazoles as G-Quadruplex Ligands Maysaa Saleh1,2, Christopher Moody2, and Charlie Laughton1

1School of Pharmacy and 2School of Chemistry, University of Nottingham, Nottingham NG7 2RD. [email protected]

[email protected]

The unlimited proliferation of cancer cells depends on a telomere maintainance mechanism which is most commonly provided by the telomerase enzyme1. The telomeric ends form structures called G-quadruplexes. Stabilization of these structures by small binding molecules called G4 ligands inhibits telomere elongation, and targets telomere maintainance mechanisms, resulting ultimately in delayed cell death and abrogation of tumourigenicy in vivo2. In this project, we are developing a new series of triazoles which are designed to bind to and stabilize G-quadruplex structures selectively, and which may therefore have potential as anti-cancer drugs. The target ligands have been produced through multi-step synthesis in moderate to good yields, as the QM-predicted regioisomers. Their selectivity for G-quadruplex DNA over duplex DNA was investigated using a FRET-based assay. This showed four compounds to be moderately effective G4 binders over the concentration rage examined, with particular affi nity for the quadruplex formed by the Hsp90a promoter sequence. Encouragingly, good selectivity for G-quadruplex DNA vs. duplex DNA was displayed by all the ligands over the concentration range used. Molecular modelling studies were performed to rationalize the affi nity and selectivity of the ligands in binding to G4-DNA. The study showed a moderate correlation between Glide docking scores and the experimental FRET results. MTT assay was performed to measure the cytotoxicity and potency of the ligands against cancer and normal cell. The ligands showed higher potency against cancer cells than it is with normal cells. To rationalise the affi nity and selectivity of the ligands in binding to G4-DNA, docking studies were done using Glide programme. Good correlation between the FRET assay results and Glide docking scores was obtained, that can be used to design the optimised structure of a new strong G4 binder.

References1. Moorhouse, A. D.; Haider, S.; Gunaratnam, M.; Munnur, D.; Neidle, S.; Moses, J. E., Mol. BioSyst., 4, 629–642, 2008.2. Campbell, N. H.; Patel, M.; Tofa, A. B.; Ghosh, R.; Parkinson, G. N.; Neidle, S., Biochemistry, 48, 1675–1680, 2009.

Poster 60


Towards Specifi c Sensing of Individual DNA and RNA G-QuadruplexesMazen Sleiman, Sylvain Ladame.

Imperial College London, Department of Bioengineering, South Kensington CampusLondon SW7 2AZ, UK.

[email protected], [email protected]

Until recently, the existence of functional G-quadruplex structures in the context of a cell remained subject to controversy and debate. Earlier this year, Balasubramanian et al. (Nature Chem. 2013, 5, 182-186) have reported the engineering of highly specifi c and fl uorescently labeled antibodies directed against G-quadruplexes. Using these powerful tools, they have shown for the first time that DNA G-quadruplex formation was modulated during cell-cycle progression in human cells. However, to be best of our knowledge, there is no example of fl uorescent probes capable of sensing unique DNA (or RNA) quadruplexes in vivo, i.e. small molecules that can discriminate between one quadruplex and another. This would however help identifying specifi c genes in which quadruplexes form in vivo and could therefore be targeted for therapeutic purposes. Herein, our aim is to generate a highly specifi c set of fl uorogenic probes that will serve as tools for sensing the formation of unique DNA and RNA G quadruplex structures both in vitro and in human cells. In 2010, Ladame et al. (Angew. Chem. Int. Ed. 2010, 49, 2738–2742) have reported a novel fl uorogenic OFF-ON system for the detection of unique DNA G-quadruplexes in vitro. G-quadruplex detection relies on a templated reaction of cyanine dye formation between two short Peptide Nucleic Acid (PNA) strands complementary to both flanking regions of the quadruplex of interest and functionalized by two non-fl uorescent precursors. Herein, we report the synthesis of a small library of fl uorogenic probe-heads (e.g. cyanine dye non-fl uorescent precursors) and their potential application for the “sequence+structure”-specific sensing of unique DNA and RNA quadruplexes both in vitro and in cellulo.

Poster 61


Conformational Dynamics of a Stacked Dimeric G-quadruplex Formed by HumanCEB1 Minisatellite

Michael Adrian, Christopher J. Lech and Anh Tuân PhanSchool of Physical and Mathematical Sciences, Nanyang Technological University,

21 Nanyang Link, Singapore 637371 [email protected]

We report on the structure of a G-quadruplex formed by short G-rich fragment of a highly unstable CEB1 minisatellite d(AGGGGGGAGGGAGGGTGG) in potassium solution. A dimeric G-quadruplex is resulted from the stacking of two subunits, each of which folds into a parallel scaffold with blunt-ended 5’-tetrad acting as dimeric interface. The subunits exhibit conformational dynamics in millisecond time scale at their 5’-end involving swapping motion of two guanine bases. Due to the symmetry at the stacking interface, different orientations between the two subunits have been observed.

Figure 1. The stacked dimeric G-quadruplex structure of CEB1. (Left panel) Ribbon view of a representative structure. (Right panel) Ten superimposed structures following distance-restrained molecular dynamics refinement in explicit solvent. Anti and syn guanines are colored cyan and magenta, respectively; adenines, green; thymines, orange; backbone and sugar, gray; O4’ atoms, yellow; phosphorus atoms, red.

Poster 62


Unfolding Kinetic of Telomeric G-quadruplex Studied by NMR SpectroscopyMing-Hao Li,1,2 Zi-Fu Wang,1,3 Shang-Te Danny Hsu,4,* Ta-Chau Chang,1,2,3,*

1 Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C2 Institute of Biophotonics, National Yang-Ming University, Taipei 112, Taiwan, R.O.C

3 Department of Chemistry, National Taiwan University, Taipei 106, Taiwan, R.O.C4 Institute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan, R.O.C

[email protected]

The study of folding and unfolding kinetics of human telomeric G-quadruplex (G4) structures is important for biomedical research and material design. Of interest is that that slight variations of human telomeric sequences can form different types of G4 structures. It is important to examine whether there is a correlation between structural stability and unfolding kinetics of these various G4 structures. Hence, we measured the melting temperature (Tm) and determined the Gibbs free energy (DG) based on the circular dichroism (CD) melting curve and differential scanning calorimetry (DSC) of these various G4 structures. Both of them showed slight structure-dependence, except the Tm of parallel G4 structure is ~10oC higher than that of nonparallel G4 structure. We further used imino proton NMR spectra to monitor unfolding kinetics of these various telomeric G4 structures as a function of time based on hybridization DNA and hydrogen-deuterium exchange (HDX) experiments. The hybridization results showed that the decay times of different imino proton signals for each telomeric G4 structure are quite similar, which are also consistent with the decay times obtained from HDX measurements. It is suggested that the unfolding process of G4 structure is not a step-by-step sequential process, but a randomly global unfolding. The key fi nding is that the unfolding times of these various G4 structures are quite different and shows no correlation between structural stability and unfolding kinetics. Considering the physiological condition, the folding and unfolding kinetics are more realistic for better understanding of biological function of G4 structures.

Poster 63


Interaction of Berberine Derivatives with Human Telomeric Nucleic AcidsMonica Birrento*, Karina Porter†, Siritron Samosorn‡, Tracy Bryan† and Jenny Beck*

* University of Wollongong, Australia† Children’s Medical Research Institute, Australia

‡ Srinakharinwirot University, Thailand [email protected]

Human telomeric DNA is capable of forming four-stranded helical structures known as G-quadruplexes. Ligand-based stabilisation of quadruplex DNA (qDNA) structures has been suggested as a possible selective method for anti-cancer therapy. In previous work we showed that some 13-substituted berberine-based ligands exhibited selectivity for qDNA over double-stranded DNA.1-2 The presence of qDNA was confi rmed by circular dichroism (CD) spectroscopy and stoichiometry of binding was assessed using electrospray ionisation mass spectrometry (ESI-MS). In the current work, we expanded the ligand set in efforts to identify parallel qDNA-specific and antiparallel qDNA-specific ligands. The experiments were extended to probe whether the ligands stabilised or destabilised the qDNA. In particular, tandem mass spectrometry (ESI-MS/MS) was used to distinguish among the stabilities of two qDNA-ligand complexes in the gas-phase compared with their solution stabilities as judged by CD melting experiments. The correlation between ESI-MS and CD measurements will be presented. Furthermore, it has been proposed hybrid RNA-DNA quadruplex structures may form during telomerase extension.3 Preliminary ESI-MS studies using qRNA-DNA hybrid structures will also be presented.

References[1] Gornall, K. C., Samosorn, S., Talib, J., Bremner, J. B., Beck, J. L., ; Selectivity of an indolyl berberine derivative for tetrameric G-quadruplex DNA. Rapid Communications in Mass Spectrometry 2007, 21, 1759-1766.[2] Gornall, K. C.; Samosorn, S.; Tanwirat, B.; Suksamrarn, A.; Bremner, J. B.; Kelso, M. J.; Beck, J. L.; A mass spectrometric investigation of novel quadruplex DNA-selective berberine derivatives. Chemical Communications 2010, 46, 6602-6604.[3] Xu, Y.; Ishizuka, T.; Yang, J.; Ito, K.; Katada, H.; Komiyama, M.; Hayashi, T.; Oligonucleotide Models of Telomeric DNA and RNA Form a Hybrid G-quadruplex Structure as a Potential Component of Telomeres. Journal of Biological Chemistry 2012, 287, 41787-41796.

Poster 64


Copper(II) Complexes of Substituted Salicylaldehyde Dibenzyl Semicarbazones:Synthesis, Cytotoxicity, and Interaction with Quadruplex DNA

Munira Siti Haidad Alia, Yaw Kai Yana,*, Peter P. F. Leea, Kenny Z. X. Khonga,Ramon Vilarb, Beata Klejevskajab

a Natural Sciences and Science Education, National Institute of Education, NanyangTechnological University, 1 Nanyang Walk, Singapore 637616

b Department of Chemistry, Imperial College London, London SW7 2AZ, UK* Email: [email protected]

The main goals of this project are to synthesize copper(II) complexes of substituted salicylaldehyde semicarbazones, examine their cytotoxicity against human cancer cells, and study their binding to DNA. Copper(II) complexes of unsubstituted salicylaldehyde semicarbazones were shown to have anticancer properties, and we envisaged that higher cancer cell cytotoxicity and selectivity could be shown by their substituted analogues. Moreover, these complexes are planar, and thus can potentially bind to quadruplex DNA, thereby inhibiting the enzyme, telomerase, which is responsible for the uncontrolled proliferation of cancerous cells.

All the copper(II) complexes synthesized in the first phase of the project (Figure 1) show high cytotoxicity towards MOLT-4 leukaemia cells. The binding of these complexes with quadruplex and duplex DNA were then studied by the fluorescent intercalator displacement assay, UV-vis spectrophotometric titration and circular dichroism spectroscopy. Only the hydroxyl-substituted complex showed high binding affinity with quadruplex DNA and high selectivity for quadruplex over duplex DNA. Thus, analogous complexes with the hydroxyl group at other positions on the salicylaldehyde ring were explored. Of these, only the 4-hydroxyl analogue exhibit high affi nity and selectivity for quadruplex DNA. Derivatization of the 4- and 5-hydroxyl complexes with pyridine (Figure 2) results in a vast increase in affi nity and selectivity for quadruplex DNA.

Poster 65


New Anti-HIV Aptamers Based on Tetra-End-Linked DNA G-quadruplexes: Effects of the Base Sequence and ODN Length on Anti-HIV Activity

Valentina D’Atri,a Giorgia Oliviero,a Jussara Amato,a Stefano D’Errico,a Luciano Mayol,a

Vincenzo Piccialli,b Shozeb Haider,c Bart Hoorelbeke,d Jan Balzarini,d Gennaro Piccialli,a and Nicola Borbonea

aDepartment of Pharmacy, University of Naples Federico II, Naples, ItalybDepartment of Chemistry, University of Naples Federico II, Naples, Italy

cCentre for Cancer Research and Cell Biology, Queen’s University of Belfast, UK dRega Institute for Medical Research, KU Leuven, Belgium

[email protected]

The fi rst stage of the HIV infection requires the entry of HIV virus into host cells. This stage involves the sequential interaction of the virion surface glycoprotein gp120 with the CD4 glycoprotein and a chemokine receptor, either CCR5 or CXCR4, on the host cell surface.1 The CD4 glycoprotein is expressed on the surface of T-lymphocytes, monocytes, dendritic cells and brain microglia, and its expression makes these cells a target for HIV in vivo. Furthermore, an interesting function of CD4 binding is to induce conformational changes in gp120 that allow binding to the co-receptor, which is essential for viral entry.2 The third variable region of gp120 (designated as the V3 loop) is a pivotal component of the co-receptor binding site, typically consisting of a 35 amino acid-loop (range 31 to 39), closed by two cysteines that form a disulfi de bridge. The crystal structure of gp120 complexed with the CD4 receptor and a neutralizing antibody (PDB ID 2B4C) revealed that the V3 loop is extended away from the gp120 protein and is involved in co-receptor binding and selection, acting as a ‘‘molecular hook’’ that organizes associations within the viral spike.3 The importance of gp120 and the role of the V3 loop in HIV-1 entry and pathogenesis have led to the recent pursuit of drugs targeted against it. One of the most studied alternatives is the use of aptamer technology. Several quadruplex-forming ODN aptamers have shown the ability to bind the gp120 V3 loop, thus showing in vitro anti-HIV activity. The first of them were SA-10424 and ISIS 5320,5 independently reported by H. Hotoda and J. R. Wyatt, respectively, in 1994. Because all the gp120-binding aptamers present in the literature needed chemical modifi cations to improve their resistance against nucleases and to improve the kinetics of quadruplex formation, in 2010 we synthesized a series of new monomolecular anti-HIV aptamers by exploiting the Tetra-End-Linker (TEL) strategy proposed by some of us in 2004.6,7 Several TEL-(TGGGAG)4 aptamers were prepared and analyzed in order to probe the infl uence of lipophilic groups and TEL size and position on the structural and anti-HIV properties of the resulting TEL-quadruplexes.8 The results showed that (i) the presence of the TEL at either 5’- or 3’-ends was required for the anti-HIV activity, and (ii) lipophilic tert-butyldiphenylsilyl (TBDPS) groups at the 5’-ends strongly enhanced both the stability of TEL-quadruplexes and their anti-HIV activity. The EC50 of the best aptamer was 0.082 ± 0.04 μM. In this poster communication we present the results of the subsequent studies focused on the investigation of the binding role of nucleobases9 and on the search for the optimal ODN length aimed at improving the anti-HIV activity of TEL-ODN aptamers.

References:1P. D. Kwong et al., Nature, 1998, 393, 648–659; 2R. Wyatt, Science, 1998, 280, 1884–1888; 3C. C. Huang, Science, 2005, 310, 1025–1028; 4H. Hotoda et al., Nucleosides and Nucleotides, 1994, 13, 1375–1395; 5J. R. Wyatt et al., Proc. Natl. Acad. Sci. U.S.A., 1994, 91, 1356–1360; 6G. Oliviero et al., Tetrahedron Lett, 2004, 45, 4869–4872; 7G. Oliviero et al., Biopolymers, 2006, 81, 194–201; 8G. Oliviero et al., Chem. Commun., 2010, 46, 8971–8973; 9V. D’Atri et al., Chem. Commun., 2012, 48, 9516–9518.

Poster 66


Cross-Linking the Loops of a Chair Type G-Quadruplex Architecture to ReduceG-Quadruplex Polymorphism

Nicole M Smith,a,b Samir Amrane,a Frédéric Rosu,a,c Valérie Gabelica a,c and Jean-Louis Mergnya

aUniv. Bordeaux, Inserm U869, IECB, 2 rue Robert Escarpit, 33607 Pessac, France.bSchool of Chemistry and Biochemistry, The University of Western Australia, Crawley

WA-6009, AustraliacDepartment of Chemistry, Univ. Liège, Belgium

[email protected]

G-quadruplex DNA is an attractive target for selective anti-cancer therapy and drug development. Small molecules that stabilize the G-quadruplex structure can lead to the arrest of proliferation of cancer cells by down-regulation of oncogene expression or disruption of telomere function. The majority of these small molecules display good quadruplex over duplex selectivity. However, due to the high polymorphic nature of G-quadruplex DNA, a major challenge is to design small molecule ligands that can discriminate between different G-quadruplex topologies. In order to achieve this goal of developing ligands that display intra-quadruplex specifi city, it is important that we are able to study the interaction of small molecule ligands with a single G-quadruplex DNA topology. Hence, we have devised a method to reduce the polymorphism of chair-type G-quadruplex DNA architectures by utilizing the Thymine-Mercury-Thymine bond to cross-link the two lateral loops. Two out of the fi ve cross-linking geometries are able to increase the melting temperature and simultaneously reduce the polymorphism of the G4-DNA conformations.1

References1. Smith, N. M., Amrane, S., Frédéric, Rosu., Valérie, Gabelica., M., Mergny, J.-L., Chem. Commun. 2012, 48, 11464.

Poster 67


Novel Anthraquinone Derivatives Target Both Telomeric G-Quadruplex and DoubleStranded DNA

Nikolay S. Ilyinsky1,2, Anna K. Shchyolkina2, Olga F. Borisova2, Mikhail A. Livshits2, Maria E. Zvereva3, Dulat M. Azhibek3,Vladimir B. Tsvetkov4,5, Alexander A. Shtil6, Andrey E. Shchekotikhin7,

Dmitry N. Kaluzhny2

1 Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Russia2 Engelhardt Institute of Molecular Biology RAS, 119991 Moscow, Russia

3 Faculty of Chemistry, Lomonosov Moscow State University, 119991 Moscow, Russia4 Orekhovich Institute of Biomedical Chemistry RAMS, 119121 Moscow, Russia

5 Topchiev Institute of Petrochemical Synthesis, RAS, 119991 Moscow, Russia6 Blokhin Cancer Center RAMS, 115478 Moscow, Russia

7 Gause Institute of New Antibiotics RAMS, 119021 Moscow, Russia [email protected]

Anthraquinone antibiotics are a leading class of anticancer chemotherapeutics. Targeting DNA is a major prerequisite for therapeutic efficacy of these compounds. We synthesized a series of original DNA-ligand based on previously described anthrathiophenedione 1. Modifications of the side chains of 1 were include the alteration of terminal guanidines to amino, methylamino, acetimidoamino groups. In addition, the series analogues of 1 with variation of heterocyclic ring (furan and pyrrole) was synthesized. The role of individual chemical moieties in the affinity to duplex DNA and to ‘hybrid’ 3+1 telomeric G-quadruplex (telQ) was identifi ed using FRET melting assay as a screening method. We determined the optimal number of side chains (two), the heteroatom oxygen and two guanidines the side chains as factors that provided a strong G-quadruplex stabilization (ΔT1/2 up to 17°C). The quadruplex vs. duplex preference was the highest for the furan-fused derivative with the guanidine moiety in the side chains. Theoretical estimation of ligand-DNA binding constants and binding competition was developed by us for the first time using melting temperature shifts. Calculations were based on the relationship of equilibrium concentrations of the reaction components and the Gibbs free energy. High association constants with telQ were in good agreement with ITC data (Kb≈107 M-1 for 1). Structural impact of novel anthraquinone derivatives and the clinical drug mitoxantrone on telQ was investigated by UV melting and circular dichroism. Molecular dynamic simulations supported the guanine quartet destruction by ligands observed experimentally1. Additionally, FRET melting has shown that the sugar-phosphate backbone of telQ remained folded in the ligand- DNA complex. The best telQ stabilizers reduced the activity of telomerase at micromolar concentrations as demonstrated by RQ-TRAP assay. The leading derivatives showed an antiproliferative effect against human tumor cell lines including drug resistant variants2. Thus, the compounds with two guanidine groups in the side chains demonstrate the highest affi nity to telQ. The furan core provides some quadruplex vs duplex preference of ligand. The novel approach for deriving the binding constants from FRET melting experiments can help to directly defi ne the ligands affi nity to cell targets. This study provides structural insight into the design of potent telQ binders/telomerase inhibitors as anticancer drug candidates.

References: 1. Kaluzhny D, Ilyinsky N, Shchekotikhin A et al. (2011) Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione. PLoS One 6(11), e27151.2. Shchekotikhin A, Glazunova V, Dezhenkova L et al. (2009) Synthesis and cytotoxic properties of 4,11-bis[(aminoethyl)amino]anthra[2,3-b]thiophene-5,10-diones, novel analogues of antitumor anthracene-9,10-diones. Bioorg Med Chem 17(5), 1861-1869. The study was supported with RFBR grant 11-04-0038a.

Poster 68


RNA G-quadruplexes within Gammaherpesviruses Modulate Translationand MHC Class I Antigen Presentation

Pierre Murat1, Jie Zhong2, Lea Lekieffre2, Nathan P. Cowieson3, Jennifer L. Clancy4, Thomas Preiss4, Shankar Balasubramanian1, Rajiv Khanna2 and Judy T. Tellam2.

1Department of Chemistry, University of Cambridge, Cambridge CB2 1EW, UK; 2TumourImmunology, Department of Immunology, Clive Berghofer Cancer Research Centre and

Australian Centre for Vaccine Development, Queensland Institute of Medical Research, Brisbane, 4006 QLD, Australia, 3Centre for Synchroton Science, Monash University, Victoria 3800, Australia, 4Genome Biology Department, The John Curtin School of Medical Research, The Australian National University,

Building 131, Garran Road, Acton, Canberra, 0200 ACT, Australia. [email protected]

Persistent viruses that establish latent infections have evolved unique mechanisms to avoid host immune recognition. Maintenance proteins of these viruses regulate their synthesis to levels suffi cient for maintaining persistent infection but below threshold levels for host immune detection. The mechanisms governing this finely tuned regulation of viral latency are unknown. Here we show that ORFs of mRNAs encoding gammaherpesviral maintenance proteins contain clusters of G-quadruplexes, which are responsible for the cis-acting regulation of viral mRNA translation. By studying the Epstein-Barr encoded nuclear antigen 1 (EBNA1) mRNA, we demonstrate that relaxation or stabilization of EBNA1 G-quadruplex structures using either antisense oligonucleotides or small molecules strongly impacts on viral protein synthesis and importantly, immune recognition by host virus-specific T-cells. These findings highlight the importance of G-quadruplexes within virally encoded transcripts as unique regulatory signals for translational control and immune evasion.

Poster 69


G-Rich Strands in the Absence of Cations: Formation of Long-Lived IntermediatesPrimož Šket1,2, Slavko Čeru2, Iztok Prislan3, Jurij Lah3, Janez Plavec1,2,3

1 Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, SI-1001, Ljubljana, Slovenia2 EN-FIST Centre of Excellence, Dunajska 156, SI-1001, Ljubljana, Slovenia

3 Faculty of Chemistry and Chemical Technology, University of Ljubljana, Askerceva cesta 5, SI-1000 Ljubljana

[email protected]

G-quadruplexes are higher order secondary structures formed by guanine-rich DNA sequences that can be found in biologically signifi cant regions of the genome such as telomeres, immunoglobulin switch regions and promoter regions of eukaryotic cells. They have also been associated with human diseases, as therapeutic targets in drug design and in applications as nanomolecular devices. The presence of cations such as K+ or Na+ seems to be essential for the formation of G-quadruplexes, due to their role in reducing repulsions amongst guanine carbonyl oxygen atoms within G-quartets and additionally enhancing base-stacking interactions. With the use of solution-state NMR spectroscopy and other experimental techniques (PAGE, TDS, UV, CD, DSC) we have studied the behavior of guanine-rich sequences and explored their features in an environment almost completely free of G-quadruplex promoting cations. Experimental data has shown the formation of a new structure, which can be considered as an intermediate on the way to folding into G-quadruplexes. It is interesting to note that the guanine bases are not held together by Hoogsteen hydrogen bonds like in G-quartets but rather by alternative base pairing.

Our study, where G-rich intermediates were characterized in detail and their kinetic roles determined, provides an important step in elucidating general principles by which G-quadruplexes adopt their native folds. G-rich DNA sequences can in the presence of certain cations fold very rapidly and not by chance in to a large number of structurally diverse G-quadruplex structures with mechanisms of varying complexity through the population of different intermediates, which are generally unstable and hard to detect.

Poster 70


Verifi cation of Specifi c G-Quadruplex Structure by Novel Cyanine Dye Probe: Clip-Like Dimer Structure Enhanced the Sensitivity and Selectivity Against Excess Duplex

Lijia Yu†,‡, Qianfan Yang†*, Wei Gai†,‡, Junfeng Xiang†, Hongxia Sun†,‡ and Yalin Tang†*

† Beijing National Laboratory for Molecular Sciences (BNLMS), Center for Molecular Sciences, State Key Laboratory for Structural Chemistry for Unstable and Stable Species, Institute of Chemistry, Chinese

Academy of Sciences (ICCAS), Beijing,100190, P. R. China.‡ University of Chinese Academy of Sciences, Beijing, 100049, P. R. China

[email protected]; [email protected]

Although various types of organic fluorescence probes for specific G-quadruplexes have been reported, high sensitively detect G-quadruplex, especially overwhelmed with duplex, is still a big challenge. We previously reported verifying and detecting specific G-quadruplex by using cyanine dye ETC [Fig 1(a)], which achieved high selectivity (40-200 folds) against duplex owing to the unique property of ETC supramolecular assembly. However, both the sensitivity and the selectivity of ETC are not enough to be applied in practice under great excess duplex. Herein, we designed a novel clip-like cyanine dye TC-P4 [Fig 1(a)], which is composed of two planar dye frames linked by a fl exible chain. The cavity between the two frames matches the dimension of parallel G-quadruplex c-myc (TGAGGGTGGGGAGGGTGGGGAA), and it proved the novel clip-like structure could provide higher sensitivity and selectivity in recognition, especially under excess linear duplex D24 [(TTAGGG)4-3']/[5'-(CCCTAA)4].The fl uorescence intensities of 5 μM TC-P4 with 200 nM c-myc are ~20 [Fig 1(b), black columns], much higher than that of ETC, ~2.5 (dark gray column), and indicates the sensitivity of TC-P4 to c-myc is ~8 times higher than that of ETC. Besides, in the presence of ~15 μM D24, ETC emits higher fl uorescence intensity [Fig 1(b), dark gray line] than that in the presence of 200 nM c-myc, inferring that under [D24] is ~75 times higher than that of c-myc, ETC cannot verify c-myc effectively. For TC-P4, the endurable ratio could be much more than 200, since the fl uorescence intensity of TC-P4 with D24 reaches the maximum when [D24] is ~40 μM or higher, which is less than that in the presence of 200 nM c-myc.Brief mechanism study shown that the binding ratio of TC-P4 to c-myc is about 1:1 [Fig 1(c)]. Furthermore, the 1H-NMR results (data not shown) inferred that the two planar frames of TC-P4 probably externally stack at the two terminals of c-myc, respectively [Fig 1(c), insert].

Poster 71


Identifi cation of hnRNPU/SAF-A as a Telomere G-quadruplex Binding Protein Capable of Excluding RPA from Mammalian Telomeres

Rikard Runnberg, Dzeneta-Vizlin Hodzic, Keiko Funa, Tomas SimonssonDepartment of Medical Biochemistry, University of Gothenburg, Sweden

[email protected]

Telomeres are the ribonucleoprotein structures that cap the ends of eukaryotic chromosomes. They are needed for the evasion of DNA damage response machineries, which when activated can lead to senescence or cell death. Telomeric DNA consists of repeats of a G-rich sequence and ends with a 3’-overhang of single stranded DNA. Such sequences have the potential to form four-stranded G-quadruplex DNA structures. While the exact sequences of telomeres have diverged trough evolution of different eukaryotes, the potential to form G-quadruplexes remains conserved. Despite this, little is known about their biological functions at telomeres.

Here we show that hnRNPU/SAF-A binds and stabilizes telomeric G-quadruplexes, and that by doing so prevents RPA, a protein complex taking part in ATR mediated DNA damage response, from accumulating at telomeres. We found by using an in situ proximity ligation assay that hnRNPU is associated to telomeres of mouse embryonic stem cells and human cancer cells. Using a DNA pull-down assay with substrates designed to resemble different parts of the telomere, with or without the ability to form G-quadruplex DNA structures (due to substitutions of dG for 7-deaza-8-aza-dG), we show that endogenous hnRNPU in mouse embryonic stem cell extracts preferentially binds G-quadruplex DNA structures near a double/single strand DNA border. In the same extracts RPA preferentially binds single stranded telomeric DNA in its extended conformation. The basic C-terminal, RGG-box containing, domain (CTD) of hnRNPU was required and suffi cient for telomere DNA-binding, and could catalyze the formation of G-quadruplex DNA structures in an exonuclease I protection assay. When pre-coating a telomere oligonucleotide with hnRNPU CTD, RPA in cell extract was inhibited from binding, showing that G-quadruplex formation catalyzed by hnRNPU can serve to protect telomeres from DNA damage recognition.

Telomeres are known fragile sites owing to the formation of G-quadruplexes that halt the replication machinery, and several proteins involved in resolving these structures have been identifi ed. This begs the question why such a problematic structure is conserved within telomeres in different species. We have found a novel telomere binding protein with DNA-binding characteristics that stabilizes G-quadruplexes, and we show that this can protect telomeres from the DNA damage response. Our results show that G-quadruplexes may indeed have a positive role at mammalian telomeres.

Poster 72


Both G-Quadruplex and i-Motif Forming Sequences are Important in Understanding the Mechanisms for Transcriptional Regulation in the Pdgfr-Β Promoter

Robert V. Brown and Laurence H. HurleyUniversity of Arizona

[email protected]

Our understanding of gene regulation through higher order DNA secondary structures has centered on the dynamics of single stranded purine-rich DNA while the contributions of its complimentary pyrimidine rich strand have been ignored. In order to fully understand G-quadruplex (G4) function in gene regulation it is critical that the contribution of both purine and pyrimidine-rich strands are taken into consideration. In this study we highlight the importance of considering both purine-rich (G4) and pyrimidine-rich (i-Motif) DNA secondary structures in regulating the promoter activity of platelet-derived growth factor receptor-beta (PDGFR-β). In human disease, PDGFR-β acts as a potent mitogen initiating a myriad of intracellular signaling cascades that ultimately promotes growth, survival, metastasis and angiogenesis. Previous studies have demonstrated that inhibition of PDGFR-β activity by either small molecule or siRNA knockdown has equally adverse effects on tumor growth. The purine-rich region within the PDGFR-β promoter is capable of forming an equilibrating set of up to four distinct G4s. It’s pyrimidine-rich complement was found to be highly dynamic and capable of adopting multiple stable i-Motifs (iM) with a transition pH of 6.5. Previously, we have described the predominant G4 within this equilibrating set as having a snapback structure with a 2+1 discontinuity (Y. Chen et al., JACS 2012). We have recently identified an unusual 3’end G4, which contains a 3’end poly-purine run of GGA, as an important drug target for selective repression of PDGFR-β gene expression. This adenine-containing G4 has a unique structure, which allows for specific molecular recognition by G4 interactive compounds that furthermore provides selectivity amongst the equilibrating set of G4’s within this region. Signifi cantly, we have identifi ed a unique ellipticine derivative, GSA-1129, that selectively stabilizes this adenine-containing G4. Furthermore, our fi ndings indicate that the dynamic equilibrium of G4 structures within the PDGFR-β core promoter can be shifted to favor the GGA G4 upon addition GSA-1129. In cells, this compound elicits promoter specifi c gene inhibition. Conceivably, GSA-1129 is mimicking the actions of a G4 stabilizing protein by behaving as a molecular-clamp, to lock the adenine in the tetrad and stabilize the GGA G4. Further investigation into this mechanism of action utilizing point mutated luciferase constructs designed to mimic the effects of GSA-1129 yielded apparent confl icting results. A more critical evaluation of the mutant constructs revealed that the mutations have a profound affect on the dynamics and stability of both the G4s and iMs. By applying these single-stranded based findings to our double-stranded luciferase constructs the initial conflicting results can be understood. While proteins and drugs are likely to affect one strand/structure at a time, mutations in the duplex sequence affect the equilibrium of both G4 and iM. These fi ndings underscore the critical importance of understanding higher order DNA structure formation from G4/iM forming strands when interpreting transcriptional outcomes.

Poster 73


Targeting G-quadruplexes in the HIV-1 Integrated Genome: A Novel Antiviral Strategy?Rosalba Perrone1, Matteo Nadai1, Ilaria Frasson1, Elena Butovskaya1, Jerrod A. Poe2, Manlio Palumbo3,

Giorgio Palù1, Thomas E. Smithgall2, Sara N. Richter1

1Department of Molecular Medicine, University of Padua, via Gabelli 63, 35121 Padua, Italy; 2Department of Microbiology and Molecular Genetics, University of Pittsburgh, School of Medicine, Pittsburgh, PA, USA; 3Department of Pharmaceutical and Pharmacological Sciences, University of

Padua, via Marzolo 5, 35131 Padua, Italy [email protected]

G-quadruplexes (G-4s) have been proposed to be involved in gene regulation, directly at the transcriptional level and as silencer elements in the promoter regions of human genes. Very little evidence of the presence and function of G-4s at the viral level has been so far provided. We investigated here the presence of G-rich sequences in the HIV-1 proviral genome, their ability to fold in G-4, and their eventual stabilization/induction by G-4 ligands. We found important regulatory G-4 regions 1) in the HIV-1 LTR promoter region, essential for viral transcription and replication; 2) in the HIV-1 nef gene that encodes for Nef, a fundamental factor for effi cient viral replication, infectivity and pathogenesis in vitro and in vivo. Biophysical and biomolecular methods were employed to thoroughly elucidate the multiple G-4 structures that form in these two regions. We found that currently available G-4 ligands were able to effi ciently stabilize the viral G-4s. Cellular assays performed in the presence of G-4 ligands indicated the possibility to inhibit both HIV-1 promoter activity and Nef expression through G-4 stabilization. Importantly, HIV-1 infectivity was effi ciently suppressed by G-4 ligands. These findings open up the possibility to successfully target and inhibit HIV-1 by a G-4-mediated mechanism of action.

Poster 74


The First Crystal Structure of an All LNA G-Quadruplex: a Compact Moiety with Potential Application in Nanotechnology

Irene Russo Krauss,a Gary Parkinson,b Antonello Merlino,a,c Antonio Randazzo,d Ettore Novellino,d Carlo Andrea Mattia,e Lelio Mazzarella,a,c Filomena Sicaa,c

aDepartment of Chemical Sciences, University of Naples “Federico II”, Complesso Universitario di Monte Sant’Angelo, I-80126, Napoli, Italy; bCRUK Biomolecular Structure Group, UCL School of

Pharmacy, University College London, 29-39 Brunswick Square, WC1N 1AX, London, UK; cInstitute of Biostructure and Bioimages, CNR, Via Mezzocannone 16, I-80134, Napoli, Italy; dDepartment of

Pharmacy, University of Naples “Federico II”, Via D. Montesano, 49, I-80131 Napoli, Italy; eDepartment of Pharmaceutical and Biomedical Sciences, University of Salerno, Via Ponte Don Melillo, I-84084

Fisciano, Italy. [email protected]

Locked nucleic acids (LNAs) are formed by bicyclic ribonucleotides where the O2’ and C4’ atoms are linked through a methylene bridge and the sugar is blocked in a 3’-endo conformation (Singh, S.K. et al., Chem Commun, 1998, 455-6). They represent a promising tool for therapeutic and diagnostic applications, characterized by higher thermal stability and nucleases resistance with respect to their natural counterparts (Doessing, H. and Vester, B., Molecules, 2011, 16, 4511-26; Kaur, H. et al., Chemical reviews, 2007, 107, 4672-97). However, structural descriptions of LNA-containing quadruplexes are rather limited, and up to now no crystal structure was reported. Here we present the fi rst crystallographically derived model of an all LNA-substituted quadruplex forming sequence 5’-TGGGT-3’. Structural details derived from this fi rst high resolution crystallographic model of an all-LNA quadruplex add important information to our knowledge of the effect of modifi ed nucleotides in quadruplex structure and stability. In particular, we observe a regular terminal thymine-tetrad, the fi rst to be observed in crystallographic structure of G-quadruplexes and a likely contributor to the high thermal stability of this molecule. Moreover, the unusual stacked arrangement of the two quadruplexes in the asymmetric unit suggests how sequential quadruplexes can arrange in the crowded cell environment, while at the same time the structure provides an opportunity in the design of LNA-based blocks for developing scaffolds within nanotechnology applications.

Poster 75


G-Quadruplexes in the HIV-1 promoterSamir Amrane, Amina Bedrat, Marie-Line Andréola and Jean-Louis Mergny

INSERM U869, IECB, Université de Bordeaux, France [email protected]

HIV-1 is a RNA retrovirus which genome is reversed transcribed by a retro-transcriptase into a double strand DNA ; this provirus is then inserted into the genome of the infected host cell. It then has its own promoter that will regulate the expression level of 9 viral genes. At the end of the 1990, the setting of an antiviral therapy targeting different enzymes of the viral cycle was a tremendous step forward in the battle against AIDS. However this treatment did not succeed into the defi nitive eradication of the virus and due to some mutation in the genome of the virus, resistance against these molecules can occur. The discovery of new inhibitors targeting new targets is still an important issue in this research fi eld.

Using a new bioinformatics approach, we identifi ed a sequence from HIV provirus that is able to adopt a non-canonical DNA structure called G-Quadruplex. These structures are robust and based on the stacking of 2, 3 or 4 guanine tetrads. This 50-nt sequence is located on the promoter of the provirus, at 40 nt upstream from transcription initiation site. This sequence contains four G-rich recognition sites for SP1 and NFκB transcription factors. We performed a sequence alignment showing that this quadruplex motif is conserved trough all the HIV-1 subtypes. Our biophysical results show that this sequence is indeed able to form 4 different G-quadruplex structures with thermal stabilities much higher than 37°C. Using NMR spectroscopy, we determined the topologies adopted by these G4 structures. We also showed that our newly designed G4 ligands are able to inhibit HIV-1 replication in vivo, with IC50 as low as 70 nM. This study paves the way to a new category of anti-HIV drug.

Poster 76


Comparison of Interaction between Two Structurally Similar Putative Anticancer Agents, Sanguinarine and Chelerythrine, from Plant Source with Two Quadruplex Forming Sequences

Saptaparni Ghosh1, 2 and Dipak Dasgupta1, 3

1Biophysics Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, [email protected], [email protected]

[email protected]

Polyguanine sequences fold into G-quadruplexes in presence of monovalent cations like Na+ or K+ in vitro. They adopt various geometries which can be identifi ed and distinguished by CD and NMR techniques1. In vivo such sequences are found in telomeric region of chromosomes and transcription regulatory region of several oncogenes2. Recently, small molecules with potential to bind and stabilize quadruplexes have emerged as effective anticancer agents3,4.

We report the interaction of two structurally s i m i l a r p u t a t i v e a n t i c a n c e r a g e n t s sanguinarine (SGR) and chelerythrine (CHEL) from plant source with two quadruplex forming sequences - human telomeric DNA sequence, H24 (5´-TTAGGGTTAGGGTTAGGGTTAGGG-3´) and NHE III1 upstream of the P1 promoter of c-myc oncogene, Pu27 (5´-TGGGGAGGGTGGGGAGGGTGGGGAAGG-3´) in the presence of K+ ions using spectroscopy, calorimetry and biochemical assay. H24 adopts a (3+1) hybrid 1 structure and Pu27 adopts a parallel structure consisting of two conformers (1:2:1 and 1:6:1 conformer) in K+ ions.

Two molecules of both SGR and CHEL bind to H24. Pu27 binds three SGR but it binds to only two CHEL molecules. SGR has a higher binding affi nity than CHEL for both sequences. The interactions are both enthalpy and entropy driven. Linear relationship of H with TS with slope close to unity indicates complete enthalpy-entropy compensation for the interactions and non-zero Cp values. Large negative Cp values indicates that the interactions proceed with (a) burial of water accessible hydrophobic surface area and (b) destacking of bases in the loop region of the quadruplexes as a sequel to end stacking of the alkaloid molecules on the G-quartet. Enhanced melting temperatures of the quadruplexes after association with the two ligands suggest that the quadruplexes are stabilized on ligand binding, SGR imparting greater stability than CHEL. Results from CD studies help to throw light on the nature of ligand(s) - induced structural transition in the two quadruplexes. TRAP assay indicates that SGR inhibits telomerase in a concentration dependent manner in cell extracts from MDAMB-231 breast cancer cell lines. The results will be discussed from the perspective of the difference in structures of the ligands.

References(1) Phan, A. T.; Kuryavyi, V.; Patel, D. J. Curr. Opin. Struct. Biol. 2006, 16, 288-98.(2) Biffi , G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Nat. Chem. 2013, 5, 182-186.(3) Chen, Y.; Yang, D. Curr. Protoc. Nucleic Acid Chem. 2012, 17.5. 1-17.5. 17.(4) Bryan, T. M.; Baumann, P. Methods Mol. Biol. 2011, 608, 1-16.

Poster 77


Synthesis and G-Quadruplex Binding and Selectivity of Novel Tri- and Tetra-Substituted Ethynyl Naphthalene Diimides

Sara Artusi1, Matteo Nadai1, Filippo Doria2, Mauro Freccero2, Sara N. Richter1

1Dipartimento di Medicina Molecolare, Università di Padova, via Gabelli 63, 35121 Padova, Italy; 2Dipartimento di Chimica, Università di Pavia, v.le Taramelli 10, 27100 Pavia, Italy.

[email protected]

Tri- and tetra-substituted naphthalene diimides have recently shown promising binding properties towards G-quadruplex (G-4) DNA. We here present the synthesis and binding properties of a new class of ethynyl NDI derivatives (Scheme). The ethynyl side chain confers to the ligands structural rigidity and unique optical and electronic NIR properties as result of the extended electronic conjugation. Synthetically, di- and -trisubstituted NDIs at the aromatic core are accessible from 2,6-dibromonaphthalene dianhydride by imidization with primary amines, followed by substitution of the bromine atoms at the naphthalene core. This procedure was exploited for the effi cient palladium catalyzed cross-coupling reactions between 2,6-dibromonaphthalene diimides and alkynylphenols to afford the ethynyl NDI derivatives (Scheme).

The new compounds were assayed for their ability to bind and stabilize G-4 structures of the human telomeric sequence and oncogene promoters. FRET, circular dichroism and surface plasmon resonance (SPR) experiments proved that dimethylamino compounds most efficiently stabilized the telomeric G-4, while morpholino derivatives were the least effective. All compounds were G-4 selective and displayed no affi nity towards uncoiled single-stranded or double-stranded DNA. The tetra-substituded derivatives were better stabilizers than their tri-substituted counterparts. FRET competition experiments demonstrated that G-4 structures formed by long G-rich sequences, such as hTert, bcl-2 and c-myc, were able to potently compete for the binding towards the telomeric sequence. This effect was not observed with a long (36 bp) human telomeric sequence indicating that the competitive effect was due to the oncogene promoter sequence itself rather than to the structural complexity of the resulting G-4. In contrast, c-kit1 and c-kit2 G-4s were very poor competitors. The chemical features and the encouraging binding properties of the new ethynyl NDIs towards G-4s make them promising compounds for the development of G-4 selective alkylating agents.

Poster 78


Structure Based Function: Investigating the Role of G-Quadruplex Structures in De Novo DNA Methylation

Macmil, S.L1, Fredericks, R.2, Miller, A.1, Fee, C.2, Filichev, V.V.3, Kennedy, M.A.1

1 Department of Pathology, University of Otago, Christchurch, New Zealand; 2Department of Chemical and Process Engineering, University of Canterbury, Christchurch, New Zealand; 3 Institute of Fundamental

Sciences, Massey University, Palmerston North, New Zealand; [email protected]; [email protected]

The human DNA (cytosine-5) methyl transferase is capable of actively methylating unusual DNA structures1. This mode of action is based on its ability to recognize mispaired bases, that are prevalent in unusual structures containing distorted bases, and represent its transcriptional state analogs2. Based on the abundance of potential G-quadruplex forming sequences within the human genome and the expanding number of cellular proteins that promote the formation and unwinding of these structures, positive selection of these motifs has been suggested as a mechanism of increasing the number of conformational states available to modifi cations for enhanced epigenetic complexity3.

In order to investigate the role of G-quadruplex structures in DNA methylation (see Stevens et al., poster at this meeting), we identified potential G-quadruplex forming motifs within the promoter regions of imprinted human genes. Upon confi rming the formation of G-quadruplex structures based on circular dichroism and native gel electrophoresis, we studied the interaction of G-quadruplex structures and human de novo methyl transferases. Based on Surface Plasmon Resonance (SPR) measurements, G-quadruplex structures strongly interact with de novo methyl transferases DNMT3A and 3B when compared to its duplex form.

References1. Smith S.S., Kan J.L.C., Baker D.J., Kaplan B.E., Dembek P. (1991) Recognition of unusual DNA structures by human DNA (cytosine-5) methyltransferase. J. Mol. Biol. 217: 39–51.2. Smith S.S. (1998) Stalling of DNA methyltransferase in chromosome stability and chromosome remodelling. Int. J. Mol. Med. 1: 147–156.3. Smith S.S. (2010) Evolutionary expansion of structurally complex DNA sequences. Cancer Genomics Proteomics. 7: 207–215.

Poster 79


Characterization of the Promoter Region of the Proto-Oncogene C-Kit in Canine Mast Cell Tumour

Silvia Da Ros1, Eleonora Zorzan2, Caterina Musetti1, Mery Giantin2, Lara Zorro Shahidian2, Manlio Palumbo1, Mauro Dacasto2, Claudia Sissi1

1 Dept. of Pharmaceutical and Pharmacological Sciences, v. Marzolo 5, 35131 Padova, Italy2 Dept. of Comparative Biomedicine and Food Science, Viale Dell'Universita', 16, Legnaro, Italy

[email protected]

In medicinal chemistry, G-quadruplex (G4) represents a promising chemotherapeutic target. The unveiling of telomerase role in cell cycle progression and the defi nition of its mechanism of action prompted the search of small molecule able to block it by promoting G4 formation at the telomere ends. More recently, the role of conformational equilibria of G-rich sequences as modulator of gene expression has been assessed and opened new perspectives. In particular, several oncogene promoters were found to contain G-rich sequences and have been considered as targets for anticancer therapy. Among them, we were interested in c-kit, due to its widespread relevance in tumorigenesis and tumor maintenance. Interestingly, two distinct G-rich sequences were identifi ed in c-kit promoter and both are now structurally characterized in their G4 conformation. The knowledge of the target is defi nitely a great advantage to the identifi cation and/or optimization of new ligands directed towards these genomic portions. However, we also need solid models to assess the pharmacological effi ciency of potential new drugs. In this context dog can represent a remarkable translational animal for human cancer. Indeed, mast cell tumour (MCT) is the most common (7% to 21%) cutaneous skin tumour of dogs and, interestingly, the MCT aggressive behaviour, (which results in poor outcome) is often characterized either by an overexpression or a mutational status of c-Kit. All this makes c-kit an important target for dog chemotherapy. Furthermore, c-kit mutations occurring in dog MCTs are similar to those found in human cancers, such as gastrointestinal stromal tumors (GIST), melanoma and mastocytosis. Therefore, canine MCT could represent a proper disease model to evaluate the functional consequences of c-kit abnormalities in cancer and the role of c-kit inhibitors in antitumor chemotherapy. To validate such an assumption, we started a detailed characterization of the promoter region of c-kit in dogs. The sequence of canine upstream promotorial sequence was cloned and sequenced in both healthy and MCT-suffering dogs. Then, the canine sequences were compared to the human ones. In particular, large attention was devoted to clarify the conformational equilibria occurring in physiologically relevant conditions.This work represents the required preliminary step for a better understanding of MCT biology, progression and treatment as well as to export this knowledge in the many c-Kit related human tumours.

Poster 80


Investigation of G-Quadruplex Conformations with Single Molecule FRET MicroscopySofi e Louise Kragh1, Asger Christian Krüger1, Daniel Gudnason1, Jean-Louis Mergny2, Florian Hamon3,

Marie-Paule Teulade-Fichou3 and Victoria Birkedal1

(1) Interdisciplinary Nanoscience Center (iNANO), Aarhus University, Denmark(2) Univ. Bordeaux, ARNA Lab, INSERM, U869, IECB, Pessac, France

(3) Institut Curie, CNRS, UMR 176, Université Paris-Sud, Orsay, France sofi [email protected]

G-quadruplex DNA structures can adopt different topologies depending on sequence and experimental conditions such as the presence of ions. Previous studies have shown that DNA sequences with human telomere repeats adopt several different G-quadruplex conformations in presence of K+ 1,

2. We are interested in identifying the different G-quadruplex conformations in human telomeres and investigating their interaction with ligands, which have a high affinity towards G-quadruplex structures3. We would like to address the question of how ligands influence the G-quadruplex conformational diversity.To gain insight into the G-quadruplex polymorphism and conformational changes, we use single molecule Förster Resonance Energy Transfer (FRET) microscopy. Single molecule experiments allow indeed following the behavior in time of each molecule independently. They allow a direct insight into both dynamically or statistically heterogeneous molecular populations and thus provide more information than traditional bulk experiments. We have investigated the conformational diversity of several sequences containing the human telomeric repeat TTAGGG or a sequence variant with CTAGGG repeats. Sequences containing the mutated repeat, which can occur in vivo, have been found to adopt a chair like G-quadruplex conformation in the presence of K+ 4.Our results show broad FRET distributions in K+ for sequences containing the TTAGGG repeat, which contain two main FRET peaks. These observations, which are consistent with previous FRET studies (2), imply that, under these conditions, G-quadruplexes can fold into different conformations. The FRET distributions obtained for oligos with the sequence variant CTAGGG contain one main relatively narrow peak. This indicates one major conformation. The obtained FRET peak value, which can be linked to a chair G-quadruplex conformation, matches with one of the two major FRET peaks observed for sequences containing the TTAGGG repeat. By comparing the FRET distributions obtained under different experimental conditions, we obtain new insights into how various foldings contribute to the G-quadruplex conformation diversity. Our first results with ligand show that the G-quadruplex FRET distribution changes in the presence of the PhenDC3 ligand. Our experiments provide a clean system for identifying the different G-quadruplex conformations and for investigating G-quadruplex ligand interactions and ligand-induced conformational changes.Acknowledgements:We acknowledge support from the Danish Council for independent Research’s research career program Sapere Aude from the Lundbeck Foundation

References1. J. Dai, M. Carver, C. Punchihewa, R.A Jones, and D. Yang. Structure of the hybrid- 2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Research 35 15:4927–4940, 2007.2. J. Y. Lee, B. Okumus, D. S. Kim, T. J. Ha, Extreme conformational diversity on human telomeric DNA. PNAS 102 52: 18938-18943, 2006.3. P. L. H. Tran, E. Largy, F. Hamon, M.P. Teulade-Fichou and J.L. Mergny. Fluorescence intercalator displacement assay for sceening G4 ligands towards a variety of G-quadruplex structures. Biochimie (93) 1288-1296, 2011.4. K. Lim, P. Alberti, , A. Guédin, L. Lacroix, J.F. Riou, N. J. Royle, J.L. Mergny, and A. T. Phan. Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex Nucleic Acids Res. 37,6239, 2009.

Poster 81


Conformational Dynamics of the Human Propeller Telomeric DNA Quadruplex on a Microsecond Time Scale

Shozeb Haider1, B.Islam1, M. Sgobba1, C. Laughton2, M. Orcozo3, J. Sponer4, S. Neidle5 1Centre for Cancer Research and Cell Biology, Queen's University of Belfast

2School of Pharmacy & Center of Biomolecular Sciences, University of Nottingham, Nottingham, UK3Institute of Research in Biomedicine (IRB Barcelona), Barcelona, Spain

4Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic5School of Pharmacy, University College London, London, UK

[email protected]

The human telomeric DNA sequence with four repeats can fold into a parallel-stranded propeller type topology. NMR structures solved under molecular crowding experiments correlate with the crystal structures found with crystal-packing interactions that are effectively equivalent to molecular crowding. This topology has been used for rationalization of ligand design and occurs experimentally in a number of complexes with a diversity of ligands, at least in the crystalline state. Although G-quartet stems have been well characterized, the interactions of the TTA loop with the G-quartets are much less defi ned. To better understand the conformational variability and structural dynamics of the propeller-type topology, we performed molecular dynamics simulations in explicit solvent up to 1.5 us. The analysis provides a detailed atomistic account of the dynamic nature of the TTA loops highlighting their interactions with the G-quartets including formation of an A:A base pair, triad, pentad and hexad. The results present a threshold in quadruplex simulations, with regards to understanding the fl exible nature of the sugar-phosphate backbone in formation of unusual architecture within the topology. Furthermore, this study stresses the importance of simulation time in sampling conformational space for this topology.

Poster 82


Allelic-dropout During PCR of the Imprinted MEST Promoter Caused by Interaction Between G-quadruplex Structures and DNA methylation

Stevens, A.J.1, Stuffrein-Roberts, S.1, Macmil, S.1, Gibb, A.1, Doudney, K.1, Miller, A.L.1, Bagshaw, A.1, Aitchison, A.1, Eccles, M.R.2, Joyce, P.R.4, Filichev, V.V.3, Kennedy, M.A.1

1 Department of Pathology, University of Otago, Christchurch, New Zealand; 2 Department of Pathology, University of Otago, Dunedin School of Medicine, Dunedin, New Zealand;

3 Institute of Fundamental Sciences, Massey University, Palmerston North, New Zealand;4 Department of Psychological Medicine, University of Otago, Christchurch, New Zealand.

[email protected]; [email protected]

While exploring genetic variability in the maternally imprinted human gene MEST, which plays a role in development and maternal behaviour, we discovered three SNPs in a CpG island located at the 5’ end of the gene. These SNPs are in total linkage disequilibrium, such that there are two haplotypes in the human population. When these SNPs were typed in many subjects we observed a non-Mendelian pattern whereby only one haplotype was detectable in each subject, never both, despite the use of multiple methods. Experiments in which genomic DNA from different subjects was mixed prove that the assays were capable of detecting both haplotypes simultaneously.

The absence of observed heterozygotes was most likely due to allelic dropout of one allele, although dropout of different alleles in different subjects was puzzling. We tested the effect of methylation in PCRs where amplified products for both MEST haplotypes were mixed to mimic heterozygous templates, and found that artificially methylated templates dropped out of these reactions. This suggested that DNA methylation is important in dropout, but alone this seems unlikely to completely account for it.

Sequences in the MEST promoter region appear capable of forming non-B DNA structures known as G-quadruplexes (G4). Circular dichroism and native gel electrophoresis with oligonucleotides confi rmed that at least three MEST promoter regions are capable of forming marked G4 structures, and the corresponding complementary strand for each region was capable of forming i-motifs. These data led us to suggest that methylated DNA causes stabilization of G4 structures in vitro, leading to polymerase blockage and allelic dropout of the imprinted allele. This would account for the loss of different alleles in different subjects. We have now proven that it is indeed the imprinted, methylated allele present on the G-quadruplex forming strand that drops-out of PCR reactions, suggesting that methylated G-quadruplex forming regions are prone to allelic drop-out and genotyping errors. We have yet to determine the precise nature of the interaction between DNA methylation which leads to this effect.

Poster 83


Aptamer Selection Based on Genomic Information; Focusing on G-Quadruplex Forming Sequence

Taiki Saito, Wataru Yoshida, Tomomi Yokoyama, Kazunori Ikebukuro*Department of Biotechnology and Life Science, Graduate School of Engineering, Tokyo University of

Agriculture and Technology [email protected]

Introduction

Aptamers are generally selected in vitro by SELEX (Systematic Evolution of Ligands by EXponential enrichment) (Ellington and Szostak, Nature 1990; Tuerk and Gold, Science 1990). SELEX is an effi cient method for aptamer screening, but it sometimes fails to obtain aptamers with high affi nity and specificity against target. Therefore, method for aptamer selection without SELEX is required. We have obtained many aptamers, which might fold into G-quadruplex (G4) structure, against target proteins by SELEX. We regarded G4 DNA as an excellent scaffold for aptamers to recognize target proteins. It has been reported that about 40% of human gene promoters contain one or more potential G4 forming sequences and the G4 DNAs may be involved in gene regulation. Previously, the G4 forming sequence in the insulin promoter (ILPR) was shown to have the binding ability to insulin. We thus assumed G4 DNAs, which exist in promoter regions, could be DNA aptamers against the proteins whose genes are encoded in the downstream of G4 DNAs. To demonstrate that DNA aptamers can be obtained by the our strategy, we analyzed binding ability of the G4 DNAs from promoter regions of vascular endothelial growth factor A(VEGFA), platelet-derived growth factor A (PDGFA), and retinoblastoma 1 (RB1), and c-KIT against VEGFA, PDGFA, RB1, and c-KIT respectively.

Moreover, we applied our strategy to RNA aptamer selection. G4 structures are found in the transcribed RNA, thus we assumed that G4 from transcribed RNA would also be an aptamer against target protein. Therefore, we analyzed binding ability of G4 RNA from VEGFA, PDGFA, and PDGFB against their target protein.

Result and Discussion

We fi rst evaluated the binding ability of G4 DNAs to VEGFA, PDGFA, and RB1 by gel shift assay. It was observed that each G4 DNA bound to their target protein, though c-KIT G4 DNA did not. For further analysis, we next evaluated binding abilitiy of G4 DNAs by SPR. As a result, each G4 DNA bound to its respective target. The dissociation constant (Kd value) of VEGFA G4 DNA, PDGFA G4 DNA, and RB1 G4 DNA against their target protein were estimated to be 180 nM 6 nM, and 430 nM respectively. Binding ability of G4 RNA against VEGFA, PDGFA, and PDGFB were evaluated by SPR. These G4 RNA also bound to their target protein.

These results indicated that G4 structures in the promoter region or transcribed RNAs could be the aptamers for the target proteins. We believe our strategy of aptamer selection based on genomic information could be applied to other protein.

Poster 84


Fluorescent Ligand-Mediated Screening of G-Quadruplex Structure Using a DNAMicroarray

Takahiro Nakamura1, Keisuke Iida1, Wataru Yoshida1, Masayuki Tera2, Kazunori Ikebukuro1, Kazuo Nagasawa1

1 Department of Biotechnology and Life Science, Faculty of Engineering, Tokyo University of Agriculture and Technology (TUAT)

2 Bioorganic Research Institute, Suntory Foundation for Life [email protected]

G-quadruplexes (G4s) are non-canonical nucleic acid structures formed by stacking of G-quartets planar. Many G4-forming oligonucleotides (GFOs) have been identifi ed in promoter regions, as well as regions containing clusters of ribosomal RNA genes, and may be associated with transcriptional repression of oncogenes or inhibition of ribosome biogenesis in cancer cells, respectively. Although some GFOs have been identifi ed so far, bioinformatics studies suggest that huge numbers of GFOs are present in the genome1,2. These putative GFOs are concentrated in gene-regulatory elements, including gene promoters, nuclease hypersensitive sites and CpG islands (CGIs), which are involved in epigenetic transcriptional modulation3–5.

During our studies for development of G4 ligands, we found series of heptaoxazole compounds with macrocyclic structure (7OTD) showed potent and GFO-selective interacting properties6,7. Here, we describe methodology for direct screening of GFOs by using a 7OTD-strcutre based fl uorescent G4 ligand of L1Cy5-7OTD (1), which consists of a Cy5 fluorescent functional group linked to L1H1-7OTD (2, Figure 1), to probe a large microarray of 88,737 probes in 16,030 CGIs.

References1. Todd, A. K., Johnston, M. & Neidle, S. Nucleic Acids Res. 33, 2901–2907 (2005).2. Huppert, J. L. & Balasubramanian, S. Nucleic Acids Res. 33, 2908–2916 (2005).3. Du, Z., Zhao, Y. & Li, N. Nucleic Acids Res. 37, 6784–6798 (2009).4. De, S. & Michor, F. Nat. Struct. Mol. Biol. 18, 950–955 (2011).5. Halder, R., Halder, K., Sharma, P., Garg, G., Sengupta, S. & Chowdhury, S. Mol. BioSyst. 6, 2469–2447 (2010).6. Tera, M. et al. ChemBioChem 10, 431–435 (2009).7. Tera, M., Iida, K., Ikebukuro, K., Seimiya, H., Shin-ya, K. & Nagasawa, K. Org. Biomol. Chem. 8, 2749–2755 (2010).

Poster 85


Fluorescence Enhancement by Base Stacking in G-quadruplexesNguyen Thuan Dao, Reinhard Haselsberger, Maria-Elisabeth Michel-Beyerle, and

Anh Tuân PhanSchool of Physical and Mathematical Sciences, Nanyang Technological University,

21 Nanyang Link, Singapore 637371 [email protected]

We characterized and compared the intrinsic fluorescence[1-2] of various well-defined G-quadruplex structures. The increase of intrinsic fluorescence of G-rich DNA sequences when they form G-quadruplexes can be used to monitor the folding and unfolding of G-quadruplexes as a function of cations and temperature.[2] We report on a new excimer fluorescence emission at 400 nm region for a stacked DNA G-quadruplex dimer[3] upon UV excitation.[4] We show that this excimer emission with a nanosecond lifetime only occurs for a particular base overlap pattern between two stacked G-quadruplex blocks[5] and demonstrate the ability to manipulate the excimer formation by changing the DNA fl anking sequence and other experimental conditions. This fi nding has allowed us to assign the 400 nm region intrinsic DNA fl uorescence band to a well-defi ned structure.[4]

References1. M. A. Mendez, V. A. Szalai, Biopolymers 2009, 91, 841-850.2. N. T. Dao, R. Haselsberger, M. E. Michel-Beyerle, A. T. Phan, FEBS Lett. 2011, 585, 3969-3977.3. N. Q. Do, K. W. Lim, M. H. Teo, B. Heddi, A. T. Phan, Nucleic Acids Res. 2011, 39, 9448-9457.4. N. T. Dao, R. Haselsberger, M. E. Michel-Beyerle, A. T. Phan, ChemPhysChem 2013, accepted5. C. J. Lech, B. Heddi, A. T. Phan, Nucleic Acids Res. 2013, 41, 2034-2046.

Poster 86


Small-Molecule-Induced Transcription Repression through NM23-H2 Together with G-Quadruplex Structure

Jing Lin, Tianmiao Ou*, Jiaheng Tan, Zhishu Huang*, Lianquan GuSchool of Pharmaceutical Sciences, Sun Yat-sen University

[email protected] (T. Ou); [email protected] (Z. Huang)

NM23-H2 is a transcription factor that bind specifi cally to defi ned DNA sequences to promote gene expression, such as c-myc and k-ras. Our chromatin immunoprecipitation sequencing analysis of NM23-H2 provided the genome-wide distribution of NM23-H2 binding sites revealed that NM23-H2 targets gene bodies containing clusters of sequences with a propensity for G-quadruplex formation. Targeting transcription factors with small molecules to modulate the expression of certain genes has been notoriously diffi cult to achieve. We screen and fi nd an isaindigotone derivative interacts directly with NM23-H2 protein using SPR. Further biophysical analyses of the isaindigotone-NM23H2 interaction provide additional insights on the molecular mode of action of isaindigotone. In cellular experiments, we show that isaindigotone can inhibit the binding of NM23-H2 to genomic target sites and induce cell apoptosis and death. These fi ndings illustrate the potential druggability of transcription factors and provide a molecular basis for targeting the NM23-H2 family with small molecules.

Figure1. The interference effects of SYSU-ID-01 on NM23-H2 functions. (a) SPR for binding of SYSU-ID-01 to NM23-H2. (b) Gel mobility shift assays of NM23-H2 protein binding to the single-stranded guanine-rich strand with the increasing concentration of SYSU-ID-01. (c) FRET measurement profi les of single-stranded guanine-rich strand at different conditions. (d) ChIP assays using antibodies against NM23-H2 in HeLa cell. Immunoprecipitated DNA samples were amplifi ed to show NM23-H2 occupancy of c-myc promoter. (e) RT-PCR to determine the transcription of c-myc in the HeLa cells treated with different concentrations of SYSU-ID-01 for 72 hours. (f) Western blotting for the C-MYC protein in the HeLa cells treated with different concentrations of SYSU-ID-01 for 72 hours.

Poster 87


Optical Imaging of Exogenous G-Quadruplex DNA by Fluorogenic Ligands in Living CellTing-Yuan Tseng,1,2 Zi-Fu Wang,2,3 Cheng-Hao Chien,1,2 Ta-Chau Chang,1,2,3,*1 Institute of Biophotonics, National Yang-Ming University, Taipei, Taiwan

2 Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei, Taiwan3 Department of Chemistry, National Taiwan University, Taipei, Taiwan

[email protected]

Guanine-rich oligonucleotides (GROs) are promising therapeutic candidate for cancer treatment and other biomedical application. We have introduced a G-quadruplex (G4) ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), to monitor the cellular uptake of naked GROs and map their intracellular localizations in living cells by using confocal microscopy. The GROs that form parallel G4 structures, such as PU22, T40214, and AS1411, are detected mainly in the lysosome of CL1-0 lung cancer cells after incubation for 2 h. On the contrary, the GROs that form nonparallel G4 structures, such as human telomeres (HT23) and thrombin binding aptamer (TBA), are rarely detected in the lysosome, but found mainly in the mitochondria. Moreover, the FRET studies of fl uorophore-labeled GROs show that the parallel G4 structures can be retained in CL1-0 cells, while the nonparallel G4 structures are likely distorted in CL1-0 cells after cellular uptake. Of interest is that the distorted G4 structure of HT23 from the nonparallel G4 structure can reform to a probable parallel G4 structure induced by a G4 ligand in CL1-0 living cells. These fi ndings are valuable to the design and rationale behind the possible drug delivery targeting specifi c cellular organelles using GROs.

Acknowledgements

The authors thank the support from Academia Sinica (AS-102-TP-A07) and the National Science Council of the Republic of China (Grant NSC-101-2113-M001-022).

Poster 88


Biological Relevance of G-Quadruplex in Gene Expression by Using PI-polyamidesTomohiro Takenaka, Hironobu Morinaga, Toshikazu Bando, Hiroshi Sugiyama

Department of Chemistry, Graduate School of Science Kyoto University [email protected]

In guanine-rich sequences, guanines form a non-canonical secondary structure called G-quadruplex (G4). This G4 sequences are located in the promoter region and the telomere. The G4 structure in promoter region is considered to suppress gene expression through inhibition of polymerase activity. So the ligands which bind and stabilize G4 have potential to act as antitumor drugs. Although several compounds were reported to decrease gene expression through stabilization of G4, no compound has been identified yet to increase gene expression through suppression of G4 formation in a gene-specifi c manner. Here, we developed a Pyrrole-Imidazole (PI) polyamide to increase gene expression of c-Myc through the decrease of the rate of G4 formation in the promoter region. PI-polyamides are small organic molecules that bind to DNA with sequence specific manner and stabilize duplex DNA. PI-polyamides which binds in the protein binding site stabilize duplex DNA and therefore inhibits the direct access of protein. However PI-polyamides which bind DNA except for protein binding site cannot interfere polymerase activity. Herein we built the hypothesis that the stabilization of duplex DNA by PI-polyamides could be utilized for suppression of G4 formation. In this context, we conducted various experiment in vitro and in vivo.

Poster 89


Identifi cation of HGF and HBEGF Aptamers by “G4 Promoter-derived Aptamer Selection (G4PAS)”Tomomi Yokoyama, Wataru Yoshida, Taiki Saito, Kazunori Ikebukuro*

Department of Biotechnology and Life Science, Graduate School of Engineering, Tokyo University of Agriculture and Technology

*[email protected]

Introduction

We developed a method for aptamer selection based on genomic information without in vitro selection, and named it as “G4 promoter-derived aptamer selection (G4PAS)”. G4PAS consists of three steps: (i) exploration of sequences that possibly form G-quadruplex (G4) structures from the promoter region of the target proteins (QCSs), (ii) chemical synthesis of these sequences, (iii) experimental evaluation of binding affi nity between QCSs and target proteins.

In our previous study, we identifi ed DNA aptamers by G4PAS against VEGFA and PDGFA, which contain heparin binding domain (PLOS ONE, in press), thus we expected that aptamers would be identifi ed against proteins that contain heparin binding protein by G4PAS. Therefore, we attempted to identify DNA aptamers against hepatocyte growth factor (HGF) and heparin-binding EGF-like growth factor (HBEGF), which contain heparin binding domain.

Result and Discussion

We obtained nine QCSs from the promoter region of HGF gene (HGF-QCS1~9), and fourteen QCSs from the promoter region of HBEGF gene (HBEGF-QCS1~14). As a result of evaluating the binding affinity by SPR measurement, three HGF-QCSs bound to HGF and two HBEGF-QCSs bound to HBEGF. Those results indicated that HGF and HBEGF aptamers were identifi ed by G4PAS.

We next evaluated the binding specifi city of three HGF aptamers and two HBEGF aptamers to HGF and HBEGF. As a result, these aptamers bound to their non-target protein, indicating that those aptamers have low specifi city. Therefore, we tried to improve the specifi city of those aptamers.

Conclusion

In this study, we identified DNA aptamers against HGF and HBEGF by G4PAS. These aptamers showed high affi nity but low specifi city.

Poster 90


Selective G-Quadruplex Acyclic Oligoheteroaryl LigandsMichele Petenzic, Daniela Vergaa, Eric Largyb, Florian Hamonb, Filippo Doriac, Marie-Paule Teulade-

Fichoub, Aurore Guédin- Beaurepaired, Jean-Louis Mergnyd, Mariella Mellac, Mauro Frecceroc.a) Department of Chemistry, Chair of Organic Chemistry & Cellular Chemistry, University of Konstanz,

78457 Konstanz (Germany); b) CNRS UMR 176, Institut Curie, Centre Universitaire, Bâtiment 110, 91405 Orsay (France); c) Dipartimento di Chimica, Università di Pavia, V.le Taramelli 10, 27100 Pavia (Italy); d) Institut Européen de Chimie et Biologie, INSERM U869, 2 rue Robert Escarpit, 33607 Pessac

(France)[email protected]

Organic compounds capable of recognizing and stabilizing G-quadruplex structures of nucleic acids (G4) have attracted great attention as selective probes1 and anticancer agents.2 A key aspect of the development of effective diagnostic and pharmacological applications for G4 ligands is the quadruplex vs. duplex DNA selectivity and among different G4 structures.3 In spite of the large variety of synthetic ligands created to date, the natural macrocycle telomestatin still exhibits a unique neutral molecular architecture, combining excellent binding, selectivity and remarkable antitumor activity.4 Its structural characteristics prompted the synthesis of both cyclic and acyclic polyheterocyclic derivatives, including the recent ToxaPy with its unexpected high selectivity, probably due to groove interactions.5 To fully investigate the potential of polyheterocyclic structures we designed and synthesized a family of analogous scaffold containing 1,2,4-oxadiazoles moieties. Water soluble cationic pentaheteroaryles have been synthesized by a microwave assisted functionalization of the prototype BOxAzaPy. Their binding interactions with G4-DNA was investigated by FRET-melting, fluorescent intercalator displacement assay (HT-G4-FID) and CD spectroscopy. Attention was focused on the human telomeric repeat, and sequences from the c-kit and c-myc oncogene promoters. The results revealed that G4 binding is clearly controlled by the nature of the cationic moieties and optimized by the oxadiazole core.6

References1. Largy E, Granzhan A, Hamon F, Verga D, Teulade-Fichou MP. Top Curr Chem. 2013, 330, 111-177. 2. S. Balasubramanian, S. Neidle, Curr. Opin. Chem. Biol. 2009, 13, 345-353 ; 3. a) I. M. Dixon, F. Lopez, A. M. Tejera, J. P. Esteve, M. A. Blasco, G. Pratviel, B. Meunier, J. Am. Chem. Soc. 2007, 129, 1502-1503; b) Largy, E.; Teulade-Fichou, M.-P. In Guanine Quartets: Structure and Application 2013, 248–262; 4. J. Linder, T. P. Garner, H. E. L. Williams, M. S. Searle, C. J. Moody, J. Am. Chem. Soc. 2011, 133, 1044 – 1051; 5. F. Hamon, E. Largy, A. Guédin-Beaurepaire, M. Rouchon-Dagois, A. Sidibe, D. Monchaud, J. L. Mergny, J. F. Riou, C. H. Nguyen, M. P. Teulade-Fichou, Angew. Chem. Int. Ed. 2011, 50, 8745 – 8749; 6. Petenzi M, Verga D, Largy E, Hamon F, Doria F, Teulade-Fichou MP, Guédin A, Mergny JL, Mella M, Freccero M. Chemistry. 2012 , 18, 14487-14496.

Poster 91


Single Molecule FRET Microscopy of G-Quadruplex Structures: Focus on Data AnalysisAsger C. Krüger, Sofi e L. Kragh, Søren Preus, Victoria Birkedal

iNANO center, Aarhus University, 8000 Aarhus, [email protected]

Single molecule Förster resonance energy transfer (FRET) is a powerful technique for uncovering the structural dynamics of nucleic acid structures1. FRET has the ability to measure distance changes on the nanometer scale and single molecule experiments allow accessing the properties of the individual molecules that would otherwise be hidden in the ensemble average. Single molecule FRET studies of G-quadruplex structures have contributed to reveal the large conformation diversity of G-quadruplex structures with human telomeric repeat2, 3 and to access dynamic information of the interconnection between the different G-quadruplex conformations.

Here, we present studies of surface immobilized G-quadruplex structures with the human telomeric repeat by single molecule FRET widefi eld microscopy. We show how careful analysis of the data can lead to more quantitative information on the structure’s conformations.

References1. S. Weiss, Science 283 (1999) 1676.2. L. M. Ying, J. J. Green, H. T. Li, D. Klenerman, S. Balasubramanian, Proc. Nat. Acad. Sci. 100 (2003) 14629-14634; J. Y. Lee, B. Okumus, D.S. Kim, T. Ha., Proc. Nat. Acad. Sci. 102 (2005).3. A. C. Krüger, V. Birkedal, Methods, (2013) doi: 10.1016/j.ymeth.2013.04.001.

Poster 92


Noncanonical Structures of G-Rich Regions Which Also Contain Cytosine ResiduesVojč Kocman1, Primož Šket1,2, Janez Plavec1,2,3

1 Slovenian NMR Centre, National Institute of Chemistry, Ljubljana, Slovenia2 EN-FIST Centre of Excellence, Slovenia

3 Faculty of Chemistry and Chemical Technology, University of Ljubljana, [email protected]

G-rich RNA and DNA sequences can form several different noncanonical secondary structures. G-quadruplexes are one of the most famous representatives. The basic building blocks of G-quadruplexes are G-quartets which are comprised of four Hoogsteen H-bonded guanine residues. There is plenty of compelling evidence for functions of some G-rich regions and the corresponding quadruplexes in essential biological processes1. Unusual structural motifs and variability in loop regions that connect residues involved in a G-quadruplex core are especially interesting since they could be specific binding sites for other biomolecules and small therapeutic agents. Some of the sequences that potentially form G-quadruplexes also contain cytosine residues in the same strand. The cytosine residues can be part of loop regions which protrude into solution or associate with guanine residues into Watson-Crick GC base pairs. Two of such base pairs can exist in close proximity without forming H-bonds with each other. Alternatively, GCGC-quartets exhibiting different H-bonding geometries are highly susceptible to the surrounding conditions such as presence of different cations2. The stacking of GC pairs on nearby G-quartets modulates cation preferences which are typically observed for G-quadruplexes. Potential cation binding sites can also be occupied with water molecules3. The alignment of the GC base pairs in the same plane can be slipped. Quadruplex structures stabilized only by slipped GCGC-quartets have been observed4. Such alignments allow for unique H-bonding geometries, or alternatively coordination of cations by the two guanine residues. The folding possibilities can be further expended by the formation of different base pairs which do not belong to the most common Watson-Crick or Hoogsteen types. NMR is an ideal method to get insight in to overall topologies as well as local structural details.

References1. Maizels, N. and Gray, L. T. Plos. Genet., 2013, 9, e1003468.2. Kettani, A., Bouaziz, S., Gorin, A., Zhao, H., Jones, R. A. and Patel, D. J. J. Mol. Biol., 1998, 282, 619. ibid. 6373. Zavasnik, J., Podbevsek, P. and Plavec, J. Biochemistry, 2011, 50, 4155.4. Escaja, N., Gomez-Pinto, I., Pedroso, E. and Gonzalez, C. J. Am. Chem. Soc., 2007, 129, 2004.

Poster 93


Structural Transfer of G-rich DNA and Its Modulation on Functional NanomaterialsWei Li, Yan Fu, Xian Wang, Lu Liu, Yingming Fu

School of Chemical Engineering & Technology, Tianjin University, Tianjin 300072, People’s Republic of China.

[email protected]

G-rich DNAs, enriched in eukaryotic telomeres and proto-oncogene promoters and potentially involved in inhibition of telomere extension and modulation of gene transcription, can fold into polymorphic G-quadruplexes with cyclic Hoogsteen base pairs of four guanine bases, of which the conformational structures are infl uenced not only by their sequence, but also by their surroundings, involving cations, temperature, drug, and molecular crowding agents. Here introduce three research topics including 1) the structural competition between G-quadruplex and the duplex regulated by natural compounds, 2) orderly microaggregates of G-/C-Rich Oligonucleotides associated with Spermine, 3) fl uorescent silver modulated by polymorphic DNA templates.

1) Soy isofl avones, mainly including daidzein and genistein,together with their respective glycosidic conjugates of daidzin and genistin, have received considerable attention for their potential role in reducing the risk of head and neck, lung, breast and prostate cancers. We intensively studied the role of isofl avones including daidzein and genistein, and glycosidic daidzin and genistin on the structural competition of G-quadruplex d[AG3(T2AG3)3] and its related WC duplex d[AG3(T2AG3)3-(C3TA2)3C3T] in the presence of sodium and potassium ions by using CD, ESI-MS, CD stopped-fl ow kinetic experiment, UV and molecular modeling methods. It is indicated that the dissociation rate of quadruplex (kobs290nm) is decreased by 40.3% at the daidzin/DNA molar ratio of 1.0 in K+, whereas in Na+ the observed rate constant is reduced by about 12.0%.

2) We studied the infl uence of spermine on the condensation of G-quadruplex and i-motif forming sequences, i.e., a series of G-rich and C-rich oligonucleotides from eukaryotic genome, involving telomeric regions and promoters of proto-oncogenes. It is intriguing to find out that the parallel G-quadruplexes is preferential to condense into anisotropic microaggregates in the presence of spermine, whereas the hybrid-type and the antiparallel G-quadruplexes have no signifi cant interactions with spermine.

3) We synthesized fluorescent silver with the emission wavelength from 538 nm to 706 nm modulated by a series of G-rich/C-rich DNA templates involving i-motif, G-quadruplex and the duplex, and these fluorescent silver probes are successfully used to label HeLa cells with low cytotoxity.

References1. Nucleic Acids Research, 2009, 37(8) 2471–24822. Biomacromolecules, 2011, 12(3)747-7563. J. Phys. Chem. C 2011, 115, 10370–103794. J. Phys. Chem. B, 2012, 116 (5), 1655–1665

Poster 94


The Binding Affi nity, Thermodynamic Stability and Structural Conversion of Bcl2 Quadruplex Binding with Four Natural Flexible Cyclic Small Molecules

Wei Tan, Gu YuanDepartment of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University,

Beijing 100871, [email protected]

G-quadruplexes are formed by guanine rich DNA sequences and have shown important biological functions. Ligands that can bind and stabilize quadruplexes have the potential of quadruplex targeted disease treatment1. We found four natural molecules with flexible rings which were very different from classical G-quadruplex binders (Figure 1). Electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) melting experiments showed that fangchinoline (P3) and tetrandrine (P4) had excellent binding affinities and thermodynamic stabilization effects on bcl2 quadruplex2 compared with berbamine (P1) and cepharanthine (P2) . CD titration of bcl2 with fangchinoline (P3) and ESI-MS experiments proved the binding stoichiometry was 2 and the bind constant was 3.44×105. Furthermore, CD experiments showed that the four molecules could convert the mixed parallel/antiparallel bcl2 quadruplex to a parallel type structure which may result from the water depletion effect of the four molecules when specifically binding with bcl2 quadruplex. Our results provided insights into the development of new quadruplex binders and the structural transition of the bcl2 quadruplex presented a novel method to regulate biological functions.

References1. Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S., Quadruplex DNA: sequence, topology and structure. Nucleic acids research 2006, 34 (19), 5402.2. Dai, J.; Dexheimer, T. S.; Chen, D.; Carver, M.; Ambrus, A.; Jones, R. A.; Yang, D., An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution. Journal of the American Chemical Society 2006, 128 (4), 1096.

Poster 95


Mechanical Unfolding of Human Telomere G-quadruplex DNA Probed by Integrated Fluorescence and Magnetic Tweezers Spectroscopy

Xi Longa, Joseph W. Parksa, Clive R. Bagshawa and Michael D. Stonea,b

a.Department of Chemistry and Biochemistry, University of California, Santa Cruz, Santa Cruz, CA 95064, USA

b.Center for Molecular Biology of RNA, University of California, Santa Cruz,Santa Cruz, CA 95064, USA

[email protected]

The ends of human chromosomes evade recognition by DNA damage response proteins due to the presence of specialized chromatin structures called telomeres. The foundation of human telomere structure is a long array of tandem DNA repeat sequences (TTAGGG), which can fold into a class of secondary structures known as G-quadruplexes (GQ). GQs are proposed to play a role in regulating telomere homeostasis and small molecules which selectively bind GQ have shown potential as anti-cancer drugs. Previous studies revealed that GQs are highly polymorphic and a variety of topologically distinct forms may coexist under a single folding condition1-3. Single molecule Förster resonance energy transfer (smFRET) experiments directly demonstrated the dynamic nature of GQ structure, and suggested that inter-conversion between topologically distinct GQ folds proceeds through an obligatory transient intermediate4. To further characterize this GQ folding intermediate we developed an integrated fluorescence and magnetic tweezers spectroscopy technique, which permits the application of a wide range of stretching forces (0.1-50 picoNewtons) to individual GQ folds, together with simultaneous detection of GQ folding and unfolding through smFRET. Here, we present our investigation of the Na+-induced anti-parallel GQ conformation. We have directly measured the force-dependent rate constants for folding and unfolding the anti-parallel GQ, and using simple transition state theory, we have estimated the position of transition state for GQ unfolding along the stretching coordinate. Interestingly, comparison of the previously described unfolded GQ conformation to a model polyT construct suggests the transient folding intermediate does not possess the elastic properties of a simple single stranded DNA molecule. Rather, the transient folding intermediate is in a collapsed non-native conformation, reminiscent of the molten globule state typically described in the context of protein folding pathways.

References1. Ambrus, D. Chen, J. Dai, T. Bialis, R. A. Jones, D. Yang, Nucleic Acids Research2006, 34, 2723-27352. K. N. Luu, A. T. Phan, V. Kuryavyi, L. Lacroix, D. J. Patel, J Am Chem Soc 2006, 128, 9963-9970.3. R. D. Gray, J. Li, J. B. Chaires, J Phys Chem B 2009, 113, 2676-2683.4. J. Y. Lee, B. Okumus, D. S. Kim, T. Ha, Proc Natl Acad Sci U S A 2005, 102, 18938-18943

Poster 96


Exciplex Formation by Thiazole Orange and Adenine using DNA i-motif as ScaffoldBaochang Xu, Fangwei Shao*

Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore 637371, Singapore

[email protected]

DNA quadruplexes fold into define three dimensional structures with noncanonical base spatial orientations, which could be an ideal scaffold to form fluorescent excimer/exciplex via dye-DNA conjugations. Excimer systems often exhibit unique absorption spectra and emission spectra with large Stokes shifts and hence have great potentials in the application to molecular beacon and microarrays techniques. Typically, the excimer/exciplex systems are assembled by incorporating multiple chromophores to DNA scaffolds. The excimer-DNA system fabricated with single dye still remains rare.1 Herein, exciplex formed by single Thiazole Orange (TO) and adenine was fabricated using i-motif as the assembly scaffold. Single Thiazole Orange tethered on D-threoninol as base surrogate was successfully incorporated into a cytosine-rich telomeric DNA sequence to displace one of the loop thymines between the cytosine repeats. Circular Dichroism (CD) and UV melting indicate that the incorporation of TO unit has little disturbance to the stability and pH sensitivity of i-motif structure. Once adjusting the solvent pH from 7.3 to 5, TO containing DNA strands assemble into unimolecular i-motif as the unmodified oligomers. TO in quadruplex i-motif exhibits a fluorescent emission at approximately 580 nm, while the same sequence in duplex is observed a typical green TO emission with a maximum at approximately 530 nm. The red shift in TO fl uorescence is due to the formation of fl uorescent excimer between TO and loop adenine via π-π* stacking in i-motif scaffold (fi gure above).The formation of exciplex is highly dependent on i-motif structure, since the excimer fluorescence can be reversibly turned on and off by adding acid or base, respectively. Ultrafast spectroscopy further shows that the excimer formed by TO and loop adenine exhibits long life time as 2.49 ns, which is similar as the excimer formed by dual TO incorporated DNA duplex. To our knowledge, exciplex formed by single TO-adenine stacking in DNA has not been reported yet to date. This TO-adenine excimer is a good tool to monitor the dynamics of i-motif folding. The large Stokes shift of the TO of nearly 90 nm makes this single TO-attached DNA a powerful fl uorescent framework for a variety of applications in fl uorescent bioanalytics, real-time PCR, bioimaging in cell biology and nanodevices.Key word: Excimer/ Exciplex; Thiazole Orange; DNA oligomer; i-motif

References1. 1. (a) Seo, Y. J.; Lee, I. J.; Yi, J. W.; Kim, B. H. Chem. Commun. 2007, 27, 2817; (b) Kawai, T.; Ikegami, M. and Arai, T. Chem. Commun., 2004, 824.

Poster 97


Electronic DNA Switches Driven by K+ and Sr2+ Ions are Topologically and Electronically DistinctYu Chuan Huang1 and Dipankar Sen1,2*

1Department of Molecular Biology & Biochemistry and2Department of Chemistry,

Simon Fraser University, Burnaby, British Columbia V5A 1S6, Canada [email protected]

Guanine-rich sequences occur in telomeres at the ends of linear chromosomes. They are able to form G-quadruplexes stabilized around metal cations, in four-stranded structures supported by Hoogsteen base pairing. Our previous published results had shown DNA duplexes which incorporated two clusters of G•G mismatches behaving as mechatronic switches. These switches can toggle reversibly between a structurally extended conformer of poor conductivity (E) in lithium to a contracted G-quadruplex containing a conformer of higher conductivity (C) in potassium. DNAs and RNAs that fold via the formation of guanine quartets generate G-quadruplexes that are often highly diverse in terms of structureand topology. All G-quadruplexes are stabilized specifi cally by the K+ and Sr2+ cations, not by Li+. Herein, we used a variety of spectroscopic and biochemical techniques to demonstrate that the driven C states of K+ and Sr2+ are distinct from each other structurally, topologically and electronically. Observation of a single species of DNA duplex existing in at least three distinct mechatronic states in aqueous solution, suggests that the addition and removal of specifi c cations fuel the possibility of complex patterns of switching.

Poster 98


Effect of LNA, 2’-F and 2’-ANA substitutions on G-quadruplex Structure and StabilityZhe Li, Christopher J. Lech, and Anh Tuân Phan

School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371

[email protected]

G-quadruplexes can form by guanine-rich DNA and RNA sequences, and have been reported to have anti-cancer and anti-HIV activity. LNA, 2'-F, 2'-F-ANA are modifi ed nucleosides that possess benefi ts such as resistance to nuclease degradation, non-toxicity, good water solubility and compatibility with traditional DNA synthesis chemistry, making them promising candidates for DNA-based drug design and molecule engineering. We employed various biophysical techniques (NMR, CD and UV spectroscopy) to assess the effects of inserting these modifi ed nucleosides into different G-quadruplex platforms. Our studies show that LNA, 2'-F and 2'-F-ANA universally destabilize G-quadruplexes, when substituted in a guanine that adopts syn conformation. This property can be used to push equilibrium towards different folding topologies in a manner dependent on the substitution positions. While 2'-F and 2'-F-ANA are versatile tools for substitutions at anti guanines, LNA can destabilize a G-quadruplex when inserted at the 5' end of a short loop. Our results will enable aptamer optimization and rational design of anti-cancer/anti-HIV drugs in the future.

Poster 99


Cotranscriptional Formation of DNA:RNA Hybrid G-Quadruplex and Potential Function as Constitutional cis Element for Transcription Control

Ke-wei Zheng, Shan Xiao, Jia-quan Liu, Jia-yu Zhang, Yu-hua Hao, Zheng TanInstitute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China

[email protected]

G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts and structure formation has rarely been studied in physiologically relevant processes. Here we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ), that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a nontemplate DNA strand (Fig. 1). Putative HQ-forming sequences (PHQS) are present in >97% of human genes, with an average of >73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes (Fig. 2). These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

A Intramolecular G-quadruplex

G

G

G

G G

G G

B Hybrid DNA/RNA

G-quadruplex (HQ)

RNA G

G

G

G

G

RNA, 5’

G-tr

act

Loop

Loop

Figure 1. Structure of (A) an intramolecular G-quadruplex composed of three G-quartet layers with four G-tracts connected by three loops, (B) a DNA:RNA hybrid G-quadruplex (HQ) with two G-tracts from the nontemplate DNA strand and two from a RNA transcript.

Figure 2. Correlations between the maximal expression value and the number of PHQS in genes in 79 and 11 human tissues, respectively. The maximal expression value for each gene among the indicated number of tissues was plotted against the number of PHQS in the gene.

Poster 100


Evolutional Selection of DNA:RNA Hybrid G-Quadruplex Sequences as Putative Transcription Regulatory Elements in Worm-Blooded Animals

Shan Xiao, Jia-yu Zhang, Ke-wei Zheng, Yu-hua Hao, Zheng TanInstitute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China

[email protected]

We reported in a separate abstract the cotranscriptional formation of DNA/RNA hybrid G-quadruplex (HQ) by the nontemplate DNA strand and nascent RNA transcript, which in turn modulates transcription under both in vitro and in vivo conditions. Here we present detailed bioinformatic analysis on putative HQ-forming sequences (PHQS) in the genomes of eukaryotic organisms in the Ensemble genome database. Starting from amphibian, PHQS motifs are concentrated in the immediate 1000 nt region downstream of transcription start sites, implying their role in transcription regulation. Moreover, their strand distribution shows a strong preference to the nontemplate over the template strand. Interestingly, this strand bias is reversed in lower species, suggesting that the selection of PHQS/HQ depended on the living temperature of the organisms. We provide evidences that the efficiency of HQ formation is a driving force for the selection of this strand bias. Our calculation shows that PHQS has become constitutional in genes in warm-blooded animals. Overall, PHQS is far more prevalent and abundant than that of the putative intramolecular G-quadruplex-forming sequences (PQS), thus HQs are the major physiological form of G-quadruplexes that may form in transcription. Collectively, these results are supportive of our hypothesis that HQ may function as general cis control elements for transcription regulation in warm-blooded animals. Furthermore, HQ may play a role in other transcription-mediated processes that involve the transcription of DNA with guanine-rich nontemplate strand.

Poster 101


Consecutive Transcription of G-Rich DNA Generates DNA:RNA Hybrid G-Quadruplex by Displacing RNA in R-Loop

Jia-yu Zhang, Shan Xiao, Ke-wei Zheng, Yu-hua Hao, Zheng TanInstitute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China

[email protected]

We reported in a separate abstract that DNA:RNA hybrid G-quadruplexes (HQ) forms during transcription of DNA that bears a minimum of two guanine tracts (G-tract) in the non-template strand. Putative HQ-forming sequences (PHQS) are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of worm-blooded animals and HQ formed regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge on the mechanism of HQ formation is crucial for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces a R-loop, a RNA:DNA heteroduplex formed by the nascent transcript and the DNA template. In the next round of transcription, the RNA in the R-loop is displaced, releasing the RNA in a single-stranded form (ssRNA). Then the G-tracts in the RNA jointly form HQ with those in the nontemplate DNA strand. We demonstrate that this structural cascade of R-loop -> ssRNA -> HQ offers opportunities to intercept HQ formation, which may be used to manipulate gene expression.

Poster 102


DNA:RNA Hybrid G-Quadruplexes of Two-G-Quartet Layers Form in Transcription: Short-Lived but the Most Prevalent and Abundant G-Quadruplex Structures in Genomes

Shan Xiao, Jia-yu Zhang, Ke-wei Zheng, Yu-hua Hao, Zheng TanInstitute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China

[email protected]

G-quadruplexes are secondary structures formed by guanine-rich DNA or RNA. Putative G-quadruplex sequences are widely present in genomes and G-quadruplexes can affect transcription and replication. Previous studies in genomic sequences almost focused on intramolecular G-quadruplexes containing three or more G-quartet layers. G-quadruplexes of two G-quartet layers has only been show to form in a few single-stranded sequences, but it is not clear whether such two-layer G-quadruplexes can form in genomic DNA in physiological processes. In this work, we describe the identification and characterization of DNA:RNA hybrid G-quadruplexes (HQ) of two G-quartet layers that form in transcription. These structures are short-lived with half-life of a few minutes, far shorter than that of HQs of three G-quartet layers that can last for hours. Their stability can be signifi cantly improved by G-quadruplex-stabilizing ligand. Bioinformatic analysis on human, mouse, and rat genome revealed a weak selection of sequences that can form these structures and their presence is more than six times that of the sequences that can form HQ of three or more G-quartet layers. Although being less stable, the two-layer HQs may have the capability to affect transcription and other related processes due to their great prevalence and abundance.

-1000 0 100010

20

3055

65

2G

3G

4G+

Human

Distance to TSS (nt)

PHQ

S/10

0 Se

quen

ces

-1000 0 100010

20

3055

65Mouse

2G

3G

4G+

Distance to TSS (nt)-1000 0 1000

5

15

25

50

60

70 Rat 2G

3G

4G+

Distance to TSS (nt)-1000 0 100010

20

30

60

70 All 2G

3G

4G+

Distance to TSS (nt)

A

Figure 1. Selection of putative HQ-forming sequences with potential to form HQ of two quartet layers in the genome of human, mouse, and rat.

Poster 103


DNA G-Quadruplex Formation in Response to Remote Downstream Transcription ActivityChao Zhang, Hong-he Liu, Ke-wei Zheng, Yu-hua Hao, Zheng Tan

Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, P. R. China [email protected]

G-quadruplexes have gained intense attention in recent years because of the prevalence of putative G-quadruplex-forming sequences (PQS) in the genome and their implication in physiological and pathological processes. Explicit evidence for the formation of G-quadruplex in the genome of mammalian cells has recently been provided. Given the prevalence of PQS, how G-quadruplexes are generated in vivo and what function they can perform is an important issue for understanding the physiological role of G-quadruplexes.

In this work, we studied whether transcription-generated mechanical disturbance on dsDNA can induce G-quadruplex formation. It is known that a moving polymerase generates negative and positive supercoilings behind and in front of the polymerase, respectively. In response to these two differential supercoiling states, intramolecular G-quadruplex formation was observed in the region upstream, but not downstream of a transcribed sequence. Interestingly, G-quadruplex formation can be effi ciently induced at sites that are thousands of base pairs away from a promoter. The induction is insensitive to the distance a polymerase travels, but depends on and is proportional to the moving speed of the polymerase. The transcriptionally induced G-quadruplex alters the recognition of the DNA by protein and causes transcription termination near the PQS. In correlation with the transcription orientation-dependence in G-quadruplex induction, genome-wide analysis revealed a preferential enrichment of PQS in the region upstream, but not downstream of genes in warm-blooded animals. This biased PQS enrichment supports an evolutional selection of PQS and biological function of G-quadruplex in transcription. Collectively, our results suggest that the PQS motifs can sense remote DNA tracking activity to regulate local physiological activities via G-quadruplex formation, thus providing long-range communication between distal genomic locations and function to coordinate regulatory transactions in genomic DNA (Fig. 1).

Poster 104


Investigation of Structure Conversion of Human Telomeric G-quadruplexes Induced by a Novel Ligand

Zi-Fu Wang,1,2 Ming-Hao Li,1,3 Shing-Jong Hunag,4 Shang-Te Danny Hsu,5,* Ta-Chau Chang,1,2,3,*

1 Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C2 Department of Chemistry, National Taiwan University, Taipei 106, Taiwan, R.O.C

3 Institute of Biophotonics, National Yang-Ming University, Taipei 106, Taiwan, R.O.C 4 Instrument Center, National Taiwan University

5 Institute of Biological Chemistry, Academia Sinica, Taipei 106, Taiwan, [email protected]

Human telomeres contain guanine-rich sequences that can adopt various G-quadruplex (G4) conformations that could potentialy be targeted for cancer therapy. Moreover, the G4 structures can interconvert between them upon environmental change, but detailed structural understanding of the underlying mechanism has been limited. Since the solvent effect of PEG (polyethylene glycol) can induce structural conversion of human telomeric G4s, we applied this idea to ligand design by substituting a tetraethylene glycol in the N-9 position with a methyl-piperidinium cation to a G4 ligand of 3,6-Bis(1-methyl-4-vinylpyridium) carbazole diiodide (BMVC) molecule named BMVC-8C3O (Wang & Chang, Nucleic Acid Research 2012, 40, 8711). Here, we used the ligand BMVC-8C3O and applied the techniques of CD, ITC, DSC, and NMR to investigate structure conversion of human telomere G4. We fi rst used NMR with site-specifi c isotope (15N) labeling to determine each imino proton signal of the complex structure of BMVC-8C3O with HT23 (dTAGGG[T2AG3]3). We further studied time-resolved NMR from initial state and final state to explore the kinetics of single base during structure conversion. Together with temperature-dependent studies, we found an intermediate state for the structural conversion of HT23 from a hybrid G4 structure to a propeller G4 structure induced by BMVC-8C3O. Moreover, hydrogen-deuterium exchange experiments suggested that the process of structural conversion undergoes loop rearrangement instead of global unfolding and involves slowly gradual rearrangement. This result provides an insight to the kinetic pathway of structural conversion and opens a framework for understanding the underlying mechanism of G4 structural conversion.

Poster 105


Investigating the Role of T7 and T12 Residues on the Biological Properties of Thrombin-Binding Aptamer

Nicola Borbone, Mariarosaria Bucci, Giorgia Oliviero, Elena Morelli, Jussara Amato, Valentina D’Atri, Stefano D’Errico, Valentina Vellecco, Giuseppe Cirino, Gennaro Piccialli, Caterina Fattorusso, Michela

Varra, Luciano Mayol, Marco Persico, Maria ScuottoDepartment of Pharmacy, Università degli Studi di Napoli Federico II, Naples, Italy

[email protected]

Thrombin is a sodium-activated allosteric enzyme playing a key role in blood coagulation.1 Due to its central role in the coagulation cascade, malfunctions in the regulatory mechanism of thrombin activity cause pathological states such as hemorrhage or abnormal clot growth. Thrombosis and connected diseases are among the main causes of mortality in Western countries;2 thus, the discovery of molecules capable of modulating thrombin activity represents a major target for the development of anticoagulant strategies.3 Aptamer technology has been effi ciently employed to obtain new direct thrombin inhibitors by selecting thrombin-binding oligonucleotides. The first reported consensus sequence able to inhibit thrombin activity was the 15-mer oligonucleotide GGTTGGTGTGGTTGG, usually known with the acronym TBA (Thrombin-Binding Aptamer).4 In the presence of thrombin and/or monovalent cations TBA folds into a monomolecular chair-like G-quadruplex, consisting of two G-tetrads connected by one TGT loop and two TT loops, that dictates its thrombin-binding affi nity. The structures of TBA alone and in complex with thrombin were determined by NMR5 and X-ray6 methods, respectively. Binding of thrombin by TBA leads to the inactivation of the former and to signifi cant prolongation of blood clotting time.

In this communication we present our recent results on the synthesis and the anticoagulant property of new TBA analogues in which an acyclic pyrimidine analogue, containing a five-member cycle fused on the pyrimidine ring, was introduced at position 7 or 12 of the TBA.7 Characterization by 1H NMR and CD spectroscopies of the resulting aptamers showed their ability to fold into the typical antiparallel chair-like G-quadruplex structure formed by TBA. The anticoagulant activity of new aptamers was valued with PT (measured on human plasma) and fi brinogen (using human and bovine thrombin) assays. The obtained structure-activity relationships were investigated by structural and computational studies. Taken together, our results have revealed the active role of TBA residues T7 and T12 and the relevance of some amino acids located in the anion binding exosite I of the protein in aptamer-thrombin interaction.

References1. J. A. Huntington, J. Thromb. Haemost., 2005, 3, 1861–1872; 2. B. Dahlbäck, J. Intern. Med., 2005, 257, 209–223;3. S. M. Nimjee et al., RNA, 2009, 15, 2105–2111; 4. L. C. Bock et al., Nature, 1992, 355, 564–566;5. R. Macaya et al., Proc Natl Acad Sci US A, 1993;6. I. Russo Krauss et al., Nucleic Acids Res, 2012, 40, 8119–8128;7. N. Borbone et al., J Med Chem, 2012, 55, 10716–10728.

Poster 106


An Improved Algorithm for G-Quadruplex Search in Genome Sequences1Pozmogova G.E., 1Smirnov I.P., 1,2Varizhuk A.M., 1Tatarinova O.N., 1Severov V.V., 2Kaluzhny D.N.

1Institute for Physical-Chemical Medicine, Federal Medico-Biological Agency, Russia.2Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Russia

[email protected]

The growing body of data suggests that secondary structures adopted by G-rich polynucleotides may be more diverse than previously thought. New types of G-quadruplexes (GQs) have been reported recently and the maximum length of GQ loops has been questioned. This has led the researches to a conclusion that the definition of GQ-forming sequences needs to be broadened. In most of the available GQ-search algorithms, GQs are described by the formula G3+NL1G3+NL2G3+NL3G3+.

We studied solution structures of a series of naturally occurring and model single-stranded DNA fragments defying the G3+NL1G3+NL2G3+NL3G3+ formula, used in most of the GQ-search algorithms, by physicochemical methods (UV-melting and CD and NMR spectroscopy). Our results confi rm the GQ-forming potential of such sequences and suggest the existence of a GQ type which has not been described so far. We developed an improved GQ-search algorithm taking into account the new types of GQs. These new types are the recently reported ‘GQs with bulges’ and the ‘imperfect GQs’ (imGQs). GQs with bulges are GQ structures in which two stacked tetrad-forming guanosines in one column are separated by a projecting nucleoside. By imGQs we mean GQs with one or more G substitutions for other nucleotides in tetrads. (The mismatching nucleosides may participate in stacking). We present the fi rst evidence for stability of imGQs under physiological conditions. Sequences containing discontinued arrangements of guanosines can fold into either imGQs or GQs with bulges. We show that the line between these two GQ types is not always as sharp as it may seem.

The improved algorithm allowed us to estimate more accurately genomic abundancy and distribution of putative GQ-forming sites. 130,000 Putative ImGQ sites were found in human genome in addition to the 70,000 previously known ‘perfect’ GQ sites.

Poster 107


Interaction of Human Telomeric DNA with Thymoquinone: Changing the Paradigm ofThymoquinone Anticancer Mechanism

Alaa A. Salem, Ibrahim M. Abdou and Ismail M. El HatyDepartment of chemistry, Faculty of Science, United Arab Emirates University, P.O. Box

15551, Al Ain, [email protected]

Phytochemical compounds represent an excellent approach for developing anticancer agents because of their limited toxicity in patients. Therapeutic effects of thymoquinone on cancer, inflammation, sepsis, atherosclerosis and diabetes diseases have been reported. Numerous mechanisms have been assumed for the anticancer effects of thymoquinone, but none of them has been yet, fully justifi ed.

Small molecules with high binding affi nity to stabilize DNA G-quadruplexes have been characterized by having (1) delocalized system to stack on the face of the guanine quartet and

(2) a partial positive charge to occupy the center of guanine quartet and substitute the potassium or sodium cationic charges. Positive charges were also assumed to enable interaction of small molecules with grooves, loops and negatively charged phosphate backbones of G-quadruplexes.

In this work, interaction mechanisms between thymoquinone and each of telomeric G-quadruplex (AGGGTTAGGGTTAGGGTTAGGG) and calf thymus DNAs were investigated. Selectivity, binding affi nity and stoichiometry of thymoquinone towards G-quadruplex over duplex were studied using UV-Vis, fluorescence, circular dichorism and solid and liquid NMR spectrometry. Although, thymoquinone does not fulfil all features of G-quadruplex stabilizers listed above, a mechanism of its anticancer effect based on selectivity and binding affi nity to G-quadruplex was justifi ed. Results obtained were discussed and a conclusion regarding changing the paradigm of thymoquinone anticancer mechanism was drawn.

Fig. 1: Effect of telomeric duplex DNA (0.00, 10.00, 50.00 and 100.00 folds) on fl uorescence of fl uorescein aptamer of G-quadruplex-thymoquinone complex.

Poster 108


Contact List


Name Affi liation E-mail Abstract

A. Renaud de la Faverie INSERM U869 [email protected] P20,38

Aaron Stevens University of Otago [email protected] P83Agata Gluszynska Adam Mickiewicz University [email protected] P18Alaa El Din Salem United Arab Emirates University [email protected] P46Alain Nicolas Institut Curie Centre de Recherche [email protected] OP21; P37Alessandro Altieri “Sapienza” Università di Roma [email protected] P19,33Alexandre Serero Institut Curie [email protected] OP21

Anh Tuân Phan Nanyang Technological University [email protected] OP09,21,37; P25,37,62,86,99

Anjali Sengar Nanyang Technological University [email protected] -Anna Artese Università “Magna Græcia” di Catanzaro [email protected] P21Anthony Bugaut Mnhn / Inserm U565 / Cnrs Umr 7196 [email protected] P22Antonio Randazzo University of Naples “Federico II” [email protected] OP08; P51, 75Baochang Xu Nanyang Technological University [email protected] P97Beata Klejevskaja Imperial College London [email protected] P23, 65Bruno Pagano University Of Naples “Federico Ii” [email protected] P51Chao Zhang Chinese Academy of Sciences [email protected] P104Christine E. Kaiser University of Arizona [email protected] P24Christopher Lech Nanyang Technological University [email protected] P25, 62, 99Chun Kit Kwok Pennsylvania State University [email protected] P26Claudia Sissi Padova University [email protected] P27, 80Concetta Giancola University of Napoli Federico II [email protected] P30, 56Cui-Xia Xu Sun Yat–Sen University [email protected] P28Daisuke Miyoshi Konan University [email protected] OP42; P17Dang Thanh Dung Nanyang Technological University [email protected] -Daniel Renciuk Central European Institute of Technology [email protected] P29Daniela Montesarchio University Of Naples "Federico Ii" [email protected] P30Daniela Rhodes MRC Laboratory of Molecular Biology [email protected] OP39, 40Daniela Verga Universitat Konstanz [email protected] OP33; P15, 38, 91Danny Porath The Hebrew University of Jerusalem [email protected] OP14; P5Danzhou Yang University of Arizona [email protected] OP34, 35Dik-Lung Ma Hong Kong Baptist University [email protected] OP17Dipankar Sen Simon Fraser University [email protected] OP30Dmitry Kaluzhny Russian Academy of Sciences [email protected] P31,68,107Dorota Gudanis Polish Academy of Sciences [email protected] P32, 57Emanuela Micheli Sapienza University of Rome [email protected] P33Eric Largy Institut Curie [email protected] P34 ,38, 91Fangwei Shao Nanyang Technological University [email protected] P97

Filippo Doria Università degli Studi di Pavia [email protected] OP20; P8,35, 78,91

Filomena Sica University of Naples “Federico II” fi [email protected] P36, 75

Florian Hamon Institut Curie fl [email protected] OP21,33; P15,34, 38,81,91

Frederic Samazan Institut Curie [email protected] OP21; P37Gary Parkinson University College London [email protected] OP10; P3,75Gitali Devi Nanyang Technological University [email protected] P39Giulia Biffi Cancer Research UK Cambridge Institute [email protected] P40Guoqing Jia Chinese Academy of Sciences [email protected] P41Hanbin Mao Kent State University [email protected] OP12Hans J. Lipps University Witten/Herdecke [email protected] OP39Heddi Brahim Nanyang Technological University [email protected] OP37


Helena Guiset Miserachs University of Zurich [email protected] P42Herman O. Sintim University of Maryland [email protected] OP23; P9Hiroshi Sugiyama Kyoto University [email protected] OP07; P89Hongxia Sun Chinese Academy of Sciences [email protected] P43, 71Hong-Zhang He Hong Kong Baptist University [email protected] P44Huaqiang Zeng National University of Singapore [email protected] OP19; P7Irene Bessi Goethe University [email protected] P45Irene Russo Krauss University of Naples “Federico II” [email protected] P36, 75Ismail M. El Haty United Arab Emirates University [email protected] P46Izabella Czerwinska Kyushu Institute of Technology [email protected] P47Iztok Prislan University of Ljubljana [email protected] OP13; P4, 48, 70Janez Plavec National Institute of Chemistry, Slovenia [email protected] OP06; P70, 93Jean-François Riou Muséum National d’Histoire Naturelle [email protected] OP38

Jean-Louis Mergny Institut Européen de Chimie et Biologie [email protected], 11,33; P15, 23, 38, 50, 67, 76, 81

Jean-Pierre Perreault Universite de Sherbrooke [email protected] OP24; P10

Jia-yu Zhang Chinese Academy of Sciences [email protected] OP02; P100,102,103

Joanna Kosman Adam Mickiewicz University [email protected] P49Jörg S. Hartig University of Konstanz [email protected] OP27Jun Zhou Institut Européen de Chimie et Biologie [email protected] P50, 76Jussara Amato University of Naples “Federico II”, Naples [email protected] P30, 51, 66Kah Wai Lim Nanyang Technological University [email protected] OP09Katherine G. Zyner Children’s Medical Research Institute [email protected] P52Kazuo Nagasawa Tokyo University of Agriculture & Technology [email protected] OP16; P53, 85Keisuke Iida Tokyo University of Agriculture & Technology [email protected] P53, 85

Ke-wei Zheng Chinese Academy of Sciences [email protected] OP02; P100, 102- 104

Kimberley Davis University of Wollongong [email protected] P54Laurence Hurley University of Arizona [email protected] OP34; P24,73Laurent Lacroix Inserm, France [email protected] -Laurie Lannes Goethe University [email protected] P55Linda B. McGown Rensselaer Polytechnic Institute [email protected] OP28; P12Luigi E. Xodo University of Udine [email protected] OP29; P13Luigi Petraccone University of Naples “Federico II” [email protected] P56Magdalena Malgowska Institute of Bioorganic Chemistry PAS Poznan [email protected] P57Mahesh Uttamchandani DSO National Laboratories [email protected] OP15; P6Marco Di Antonio University of Cambridge [email protected] P58

Marie-Paule Teulade-Fichou Institut Curie mp.teulade-fi [email protected]

OP07, 21, 33; P15, 34, 37, 38, 81,91

Martin Kennedy University Of Otago [email protected] P79, 83

Matteo Nadai University of Padua [email protected] OP04; P1, 35, 59, 74,78

Mauro Freccero University of Pavia [email protected] OP20; P8, 35, 78, 91

Maysaa Saleh University Of Nottingham [email protected] P60Mazen Sleiman Imperial College London [email protected] P61Michael Adrian Nanyang Technological University [email protected] OP21; P37, 62Ming-Hao Li Academia Sinica [email protected] P63,105Monica Birrento University of Wollongong, Australia [email protected] P64Munira Siti Haidad Ali Nanyang Technological University [email protected] P65


Nancy Maizels University of Washington [email protected] OP01Nguyen Thuan Dao Nanyang Technological University, Singapore [email protected] P86Nicola Borbone Università degli Studi di Napoli Federico II [email protected] P66,106Nicole M Smith The University of Western Australia [email protected] P67Nikolay S. Ilyinsky Moscow Institute of Physics and Technology [email protected] P68Peter Mojzeš Charles University in Prague [email protected] OP32; P14Pierre Murat University of Cambridge [email protected] P69Primož Šket National Institute of Chemistry,Slovenia [email protected] P70, 93Qianfan Yang Chinese Academy of Sciences [email protected] P43, 71Ranjani Narayanan Nanyang Technological University [email protected] -Rikard Runnberg University of Gothenburg [email protected] P72Robert V. Brown University of Arizona [email protected] P73Rosalba Perrone University of Padua [email protected] OP04; P1,74Samir Amrane Université de Bordeaux [email protected] P50, 67, 76Saptaparni Ghosh Saha Institute of Nuclear Physics [email protected] P77Sara Artusi University of Padua [email protected] P78

Sara N. Richter University of Padua [email protected] OP04,20; P1, 8, 35, 59, 74, 78

Shan Xiao Chinese Academy of Sciences [email protected] OP02; P100-103Shankar Balasubramanian University of Cambridge [email protected] OP26; P40,58,69

Shantanu Chowdhury CSIR-Institute of Genomics and Integrative Biology [email protected] OP03

Shozeb Haider Queens University Of Belfast [email protected] OP10, P3, 66Silvia Da Ros University Of Padua [email protected] P27, 80Simone Macmil University of Otago [email protected] P79Sofi e Louise Kragh Aarhus University sofi [email protected] P81, 92Stefano Alcaro Università Magna Graecia Di Catanzaro [email protected] P82Stephan Ohnmacht University College London [email protected] P19Stephen Neidle University College London [email protected] OP43; P19

Ta-Chau Chang Academia Sinica, Taiwan [email protected] OP41; P63, 88, 105

Taiki Saito Tokyo University of Agriculture & Technology [email protected] P84, 90Takahiro Nakamura Tokyo University of Agriculture & Technology [email protected] P53, 85Tianmiao Ou Sun Yat-sen University [email protected] P87Ting-Yuan Tseng National Yang-Ming University [email protected] P88Tomohiro Takenaka Kyoto University [email protected] P89Tomoko Mashimo Kyoto Univeristy [email protected] -Tomomi Yokoyama Tokyo University of Agriculture & Technology [email protected] P84, 90Tracy M. Bryan Children’s Medical Research Institute [email protected] OP22; P52, 64

Valérie Gabelica IECB Bordeaux [email protected] OP31; P50, 57, 67, 91

Vee Vee Cheong Nanyang Technological University [email protected] OP37Victoria Birkedal Aarhus University [email protected] P81, 92Vitaly V Kuryavyi Sloan-Kettering Institute for Cancer Research [email protected] OP36; P16Vladimir Kuznetsov Bioinformatics Institute, Singapore [email protected] OP05; P2Vojč Kocman National Institute of Chemistry Slovenia [email protected] P93Wan Jun Chung Nanyang Technological University [email protected] OP37Wei Tan Peking University [email protected] P95Wei Li Tianjin University [email protected] P94Wouter Koole Leiden University Medical Center [email protected] OP25; P11Xi Long University of California [email protected] P96Xiangjun Zeng Nanyang Technological University [email protected] -


Xiaogang Qu Chinese Academy of Sciences [email protected] OP18Yaw Kai Yan National Institute of Education, Singapore [email protected] P65Yu Chuan Huang Simon Fraser University [email protected] P98Zhaoqi Yang Jiangnan University [email protected] -Zhe Li Nanyang Technological University [email protected] P99Zheng Tan Chinese Academy of Sciences [email protected] OP02, P100 -104Zi-Fu Wang Academia Sinica [email protected] P63, 88, 105 Notes:OP - Oral PresentationP - Poster


Useful Information


Useful Telephone Numbers

Emergency/Medical Police 999 (toll-free)Ambulance 995 (toll-free) 1777 (non-emergency)Flight Information 1800 542 4422Singapore Immigration Department (65) 6391 6100Singapore Tourism Board 24hrs Touristline 1800 736 2000Global Refund Singapore (GST Refund) (65)6225 6238NTU Campus Emergency Hotline (65) 6790 4777

Taxi ServiceDial-A-Cab (65) 6342 5222CityCab (65) 6552 1111Comfort Taxi (65) 6552 1111SMRT Taxis (65) 6555 8888SMART Cabs (65) 6485 7777TransCab (65) 6555 3333Premier Taxi (65) 6363 6888Prime Taxi (65) 6778 0808Yellow-Top Taxi (65) 6293 5545

Credit CardsAmerican Express 1800-296-0220Visa Global Customer Assistance 800-4481-250MasterCard Global Service 800-1100-113Diners Club (65) 6292 7566

Nanyang Executive Center (accommodation location)60 Nanyang ViewNanyang Technological UniversitySingapore 639673Telephone: (65) 6790 6699/ 6790 6697


G F E D C B A

G F E D C B A

1

2

3

4

5

6

7

8

9

Print correct as

BUS199

BUS199

BUS199

BUS199

BUS199

BUS199

BUS199

BUS199

BUS199

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS179/179A

BUS

S7

B9/

79

NA

NY

AN

G D

RIV

E

NANYANG

DRIV

E

NA

NY

AN

G

V A

L LEY

N A N YA N G D

R I VE

L I EN YIN

G C

HO

W

DR IV E

NA

NY

AN

G

C IRCLE

NA

NY

AN

G

C

RE S

C ENT

N A N YA N G

CR E S C EN

T

NANYANG

CR E S C EN T

N

AN

YA

NG

CR

ES

CE

NT

N

A N YA NG

VI E

W

NA

NYA

NG

A

VE

NU

E

N

AN

YA

NG

AV

EN

UE

NANYANG

AVENU

STU

DE

NT

WA

LK

NA

NYA

NG

H I L L

FACU

LTY

A

VEN

UE

NA NYAN

G W

ALK

NANYANG TERRACE NANYANG TERRACE

NANYANG GREEN

NA

NYA

NG L INK

NANYANG DR IV

E

NA

NY

AN

G C

RE

SC

EN

T

PAN-ISLA

ND EXPRES

SWAY (P

IE)

NAN

YANG L

INK

S Raja

ratnam

Schoo

l of

Intern

ational

Studie

s

National Institute of Education

North Spine

South Spine

Library

Lab BlockPhysical

Education

Hockey Pitch

Swimming

Pool

Art Gallery

Green House

PondTennis, Basketball & Netball Courts

Science

Arts

Education

NIE Adm

inistration

Nanyang Playhouse

Nanyang

Auditor

ium

Blk 5Blk 5

Blk 3Blk 3

Blk 2Blk 2

S2S2

S3S3

S4S4

S1S1S2.1S2.1

S3.1S3.1

N3N3

N3.1N3.1

N3.1aN3.1a

N3.

2N

3.2

N4N4

N2N2

N1.1N1.1

N1.2N1.2

N2.1N2.1

N1.3N1.3N1N1

N4.1N4.1

S2.2S2.2

S3.2S3.2

Blk 1Blk 1Blk 7Blk 7

Blk 7ABlk 7A

Blk 4Blk 4

Hall 3

Hall 13Hall 13

Hall 15

Hall 9

Hall 8

Hall 2

Hall 6Hall 2Hall 2

Hall 4

Hall 5Hall 5

Hall 1Hall 1

Hall 1Hall 1

Hall 10

Hall 11Hall 11

Graduate Graduate HallHall

Hall 16

Hall 12Hall 12

Hall 14Hall 14

Nanyang View Apartments

Nanyang Heights Apartments

Nanyang Nanyang Executive CentreExecutive Centre

Tennis Courts

Tennis Courts

Basketball Courts

Tennis Courts

Swimming Swimming PoolPool

PondPlaying Field

Sports Hall

Sports Hall Annexe

Nanyang House

Running Track & Field

Netball Court

Squash Courts

Sepak Takraw Courts

Staff Club

Nanyang Nanyang Meadows Meadows ApartmentsApartments

Information Kiosk

President’s President’s LodgeLodge

Nanyang Nanyang LakeLake

Yunnan Garden

Chines

e Herit

age

Centre

School

of Hum

anities

&

Social

Science

s

Nanyang

Busines

s Scho

ol

School

of Ele

ctrical

&

Electro

nic En

gineer

ing

Wee Kim Wee

School

of Com

municat

ion

& Inform

ation Sch

ool of

Electri

cal &

Electro

nic En

gineer

ing

Innovation Centre

Research Techno Plaza

School of Physical &

Mathematical Sciences

Adminis

tration

Adminis

tration

Building

Building

The QuadSchool of Biological Sciences

School of Chemical & Biomedical Engineering

School of Civil & Environmental Engineering

School of Computer Engineering

School of Mechanical & Aerospace Engineering

School of Materials Science & Engineering

Tan Chin Tuan Lecture Theatre

LT2A

LT19A

LT 1A

LT1

Hall 7

SIMTech Tower Block

SIMTech Valley Block

Nanyang Child Care

Centre

Yunnan Corner

School of Art, Design & Media

International International HouseHouse Student

Student

Services Services

CentreCentre

Student Activities Centre

Sports & Sports & Recreation Recreation

CentreCentre

Lee Kong Chian Lee Kong Chian School of MedicineSchool of Medicine

BUS199

BUS179/179A

LEGEND

AVENU

NTUEntrance from Jalan Bahar

Halls of Residence

Staff Housing

Administration

South Spine (South Academic Complex)

North Spine (North Academic Complex)

National Institute of Education

Café

Eateries

Bus Stops / Bus Routes

G4 Meeting 2013


COLLEGES & SCHOOLS Location Grid

College of EngineeringSchool of Chemical and Biomedical 62 & 70 F6Engineering (SCBE) Nanyang Drive• College of Engineering (CoE) N1.3, Level 1• Division of Chemical & Biomolecular Engineering (CBE) N1.2, Level B3• Division of Bioengineering (BIE) N1.3, Level B5

School of Civil and Environmental Engineering (CEE) 50 Nanyang Avenue F6• CEE General Offi ce N1, Level 1• Laboratories/Workshops N1, Level B1-B5

School of Computer Engineering (SCE) 50 Nanyang Avenue E6/D6• SCE General Offi ce N4, Level 2• Laboratories N4, Level 1, B1-B3

School of Electrical and Electronic Engineering (EEE) 50 Nanyang Avenue F7/E7/E8• EEE General Offi ce S1, Level B1 S2, Level B2• Laboratories/Workshops S1, Level B2-B4 S2, Level B3-B7

School of Materials Science and Engineering (MSE) 50 Nanyang Avenue D6• MSE General Offi ce N4.1, Level 1• Laboratories N4.1, Level B1-B4

School of Mechanical and Aerospace Engineering (MAE) 50 Nanyang Avenue E5/D5• MAE General Offi ce N3, Level 2• Laboratories/Workshops N3, Level 1-B4 N3.1, Level B1-B4 N3.2, Level B1-B4

College of ScienceCollege of Science (CoS) General Offi ce 60 Nanyang Drive F6School of Biological Sciences (SBS) Level 1• SBS General Offi ce

School of Physical and Mathematical Sciences (SPMS) 21 Nanyang Link E8• SPMS General Offi ce Level 4• Chemistry & Biological Chemistry General Offi ce SPMS, CBC-Level 2• Physics & Applied Physics General Offi ce SPMS, PAP-Level 2• Mathematical Sciences General Offi ce SPMS, MAS-Level 3

College of BusinessNanyang Business School (NBS) 50 Nanyang Avenue E7/D7• NBS General Offi ce S3, Level B3

College of Humanities, Arts, & Social SciencesSchool of Art, Design and Media (ADM) 81 Nanyang Drive D4• ADM General Offi ce Level 1 & 3

School of Humanities and Social Sciences (HSS) 14 Nanyang Drive D7• HSS General Offi ce Block 1

Wee Kim Wee School of Communication 31 Nanyang Link F8and Information (WKWSCI)• WKWSCI General Offi ce Level 4

Lee Kong Chian School of Medicine (LKCSoM) • LKCSoM General Offi ce 50 Nanyang Drive F7 Research Techno Plaza, Level 4

INSTITUTES & CENTRES Location Grid

Cornell-Nanyang Institute of Hospitality Management 50 Nanyang Avenue E7 S3, Level B1

Earth Observatory of Singapore 50 Nanyang Avenue F6 N2, Level 1

National Institute of Education (NIE) 1 Nanyang Walk• Arts Block 3 G5• Education Block 2 F5• Library & Canteen Block 4 G5• NIE Administration Block 1 E4/E5• Physical Education Block 5 G4• Science Block 7 F4

Research Techno Plaza 50 Nanyang Drive F7• Nanyang Technopreneurship Center (NTC) Level 2

Singapore Centre on Environmental Life Sciences 60 Nanyang Drive F6Engineering SBS, Level 1

Singapore-MIT Alliance 50 Nanyang Avenue F6 N2, Level B2

S. Rajaratnam School of International Studies (RSIS) 50 Nanyang Avenue E7 S4, Level B4

Sport Science and Management (SSM) 1 Nanyang Walk G4 NIE, Block 5, Level 3

LECTURE THEATRES Location Grid

Lecture Theatres 1 & 1A Level 2 & 1 E5/F5Tan Chin Tuan Lecture Theatre Level 2 E6Lecture Theatre 2A Level 1 E6Lecture Theatres 3-18 Level 2 & 4 E6Lecture Theatres 19, 19A & 20 Level B1 & B2 F6Lecture Theatres 22-27 Level B2 E6Lecture Theatres 28 & 29 Level B1 E8Lee Kong Chian Lecture Theatre Level B2 E8SPMS Lecture Theatre 1 SPMS, Level 4 E8SPMS Lecture Theatres 2, 3, 4 & 5 SPMS, Level 3 E8

LIBRARIES Location Grid

ADM Library ADM, Level 1 D4Asian Communication Resource Centre (ACRC) WKWSCI Level 1 F8Business Library N2, Level B2 F6Chinese Library S3.2, Level B5 E7Humanities and Social Sciences Library S4, Level B3c E7Lee Wee Nam Library North Spine, Level 2 E5NIE Library NIE, Block 4 G5Wang Gung Wu Library Chinese Heritage D7 Centre, Level 1

LANDMARKS Location Grid

Chinese Heritage Centre Nanyang Drive D7Nanyang Lake Nanyang Drive C6/C7 D6/D7Yunnan Garden Nanyang Drive C7/C8 D7/D8The Quad Nanyang Drive F6/F7

ADMINISTRATIVE OFFICES Location Grid

Administration Building 50 Nanyang Avenue E7• Corporate Communications Offi ce Level 1• Offi ce of Human Resources Level 4• President’s Offi ce Level 6

Centre for Excellence in Learning & Teaching (CELT) 76 Nanyang Drive F5 N2.1, Level B1

Centre for IT Services 76 Nanyang Drive F5 N2.1, Level B1

Development Offi ce 76 Nanyang Drive F5 N2.1, Level B4

International House 36 Nanyang Avenue D6• Offi ce of Global Education & Mobility Level 1 & 2• International Student Centre Level 2

Nanyang Executive Centre (NEC) 60 Nanyang View B3• Alumni Affairs Offi ce Level 2• Institute of Advanced Studies Level 2• NEC Offi ce Level 2

Offi ce of Development & Facilities Management 76 Nanyang Drive F5 N2.1, Level B2

Offi ce of Finance 76 Nanyang Drive F5 N2.1, Level B3

Research Support Offi ce 76 Nanyang Drive F5 N2.1, Level B4

Student Services Centre 42 Nanyang Avenue D6• Career and Attachment Offi ce Level 4• Graduate Studies Offi ce Level 3• Offi ce of Academic Services Level 1• Offi ce of Admissions and Financial Aid Level 2• Offi ce of Finance (Student Section) Level 3• Offi ce of Human Resources Level 4• Offi ce of International Affairs Level 5• Students Affairs Offi ce Level 5 & 6• Student Counselling Centre Level 5

BANKS & ATMS Location Grid

Citibank ATM N2.1, Level 1 F5

OCBC Bank, NTU Branch North Spine, Level 1 E5

OCBC ATM Canteen B, Level B3 E8

OCBC ATM Canteen 2, Level 1 C5

POSB ATM Canteen 2, Level 1 C5

POSB ATM N2.1, Level 1 F5

POSB ATM Canteen B, Level B3 E8

State Bank of India N2.1, Level 1 F5

UOB ATM N2.1, Level 1 F5

RETAIL OUTLETS Location Grid

7-Eleven North Spine, Level 1 E5

Bookshop (Campus Book Centre) NIE, Block 4 G5

Bookshop (Yunnan Bookstore) S4, Level B5 E7

Computer Shop South Spine, Level B3 E7

Convenience Shop SBS, Level B1 F6

Convenience Shop (The Grocer by Sterling) NEC, Level 1 B3

Dental Centre South Spine, Level B2 E7

Medical Centre South Spine, Level B2 E7

Hair Salon Centeen 2, Level 1 C5

Supermarket Centeen 2, Level 1 C5

SERVICE STATIONS Location Grid

AXS Station Canteen B, Level B3 E8

AXS Station N2.1 Level 1 F5

AXS Station Centeen 2, Level 1 C5

Photo-Me Machine N2.1, Level 1 F5

Photo-Me Machine Canteen B, Level B3 E8

Photocopy Services Business Library, B3 F6

Photocopy Services S4, Level B1 E7

Photocopy Services LWN Library Level 2 E5

Photocopy Services N1, Level B1 F6

Self-Service Automated Machine (SAM) Canteen B, Level B3 E8

Self-Service Automated Machine (SAM) North Spine, Level 1 E5 (Outside 7-Eleven)

OTHER BUILDINGS / FACILITIES Location Grid

Centre for Chinese Language & Culture Nanyang Drive D7

Innovation & Technology Transfer Offi ce Nanyang Drive D8

Nanyang Auditorium Nanyang Avenue F7

Nanyang House Nanyang Hill B4

President’s Lodge Nanyang Circle C6

Sports & Recreation Centre Nanyang Green A4/B4 A5/B5

Student Activities Centre (SAC) NS3, Level 1 E5

Yunnan Corner Student Walk C5

EATERIES Location Grid

Café Al Fresco International House D6

Café by the Quad SBS, Level B1 F6

Caffe Express Nanyang Auditorium E7

Canadian Pizza N2.1, Level 1 F5

Canteen B South Spine, Level B4 E8

Executive Café N2.1, Level 2 F5

Food Connection N2.1, Level 2 F5

McDonald’s N2.1, Level 1 F5

Mr Bean Centeen B, Level B4 E8

Old Chang Kee N2.1, Level 1 F5

Sakae Sushi N2.1, Level 1 F5

Staff Club (NV50 Restaurant) Nanyang View B4

Starbucks Coffee SAC, Level 1 E5

Subway N2.1, Level 1 F5

The Palette N2.1, Level 1 F5

Vänner Bistro Nanyang Auditorium E7 Level 1

NTU CAMPUS DIRECTORY

1

2

3

4

5

6

7

8

9

s of April 2012

UE

Blk 5

Blk 3

Blk 2

S2

S3

S4

S1S2.1

S3.1

N3

N3.1

N3.1a

N3.

2

N4

N2

N1.1

N1.2

N2.1

N1.3N1

N4.1

S2.2

S3.2

Blk 1Blk 7

Blk 7A

Blk 4

Hall 13

Hall 2

Hall 5

Hall 1

Hall 1

Hall 11

Graduate Hall

Hall 12

Hall 14

Nanyang Executive Centre

Swimming Pool

Nanyang Meadows Apartments

Guard House

President’s Lodge

Nanyang LakeAdm

inistra

tion

Building

International House Student

Services Centre

Sports & Recreation

Centre

Lee Kong Chian School of Medicine

UE

Guar


Expl

ore

Sin

gapo

re M

RT

map

Joo

Koo

n - P

asir

Ris

/Cha

ngi A

irpor

t

Juro

ng E

ast -

Mar

ina

Bay

Har

bour

Fron

t - P

ungg

ol

Har

bour

Fron

t - D

hoby

Gha

ut

/Mar

ina

Bay

EW NS

NE

CC

NS7

May

201

2

Joo

Koon

Boon

Lay

Lake

sideCh

ines

e Ga

rden

Juro

ng E

ast

Pion

eer

Buki

t Bat

ok

Buki

t Gom

bak

Choa

Chu

Kan

g

Yew

TeeKr

anji

Mar

silin

gW

oodl

ands

Adm

iral

tySe

mba

wan

g

Yish

un

Khat

ib

Yio

Chu

Kang

Ang

Mo

Kio

Bish

an

Sera

ngoo

n

Dho

by G

haut

Out

ram

Par

k

Tana

h M

erah

Dov

er

Buon

a Vi

sta

Com

mon

wea

lth

Que

enst

own Re

dhill

Tion

g Ba

hru

Har

bour

Fron

t

Clar

ke Q

uay Ch

inat

own

Tanj

ong

Paga

r

Mar

ina

Bay

City

Hal

l

Bugi

s

Lave

nderKa

llang

Alju

nied

Paya

Leb

ar

Euno

s

Kem

bang

an

Bedo

kEx

po

Chan

gi A

irpo

rt

Litt

le In

dia

Pasi

r Ri

s

Tam

pine

s

Sim

ei

Mar

ymou

nt

Cald

ecot

t

Bota

nic

Gard

ens

Farr

er R

oad

Hol

land

Vill

age

Telo

k Bl

anga

h

Labr

ador

Par

k

Pasi

r Pa

njan

g

Haw

Par

Vill

a

Kent

Rid

geone-

nort

h

Brad

dell

Toa

Payo

h

Nov

ena

New

ton

Orc

hard

Som

erse

t

Loro

ng C

huan

Kova

n

Bart

ley Ta

i Sen

g

Mac

Pher

son

Dak

ota

Mou

ntba

tten

Stad

ium

Nic

oll H

ighw

ay

Prom

enad

e

Bayf

ront

Espl

anad

e

Bras

Bas

ah

Poto

ng P

asir

Woo

dlei

gh

Boon

Ken

g

Farr

er P

ark

Pung

gol

Seng

kang

Buan

gkok H

ouga

ng

Clem

enti

Sout

hVi

ew

Keat

Hon

gTeck

Why

e Phoe

nix

Buki

tPa

njan

g

Senj

aSe

gar

Faja

r

Bang

kit

Peti

r

Renj

ong

Tong

kang

Laya

r

Fern

vale

Than

ggam

Farm

way

Kada

loor

Rivi

era

Cora

l Edg

e

Mer

idia

n

Cove

Com

pass

vale

Rum

bia

Baka

u

Kang

kar

Rang

gung

Oas

is

Jela

pang

Pend

ing

NE1

EW22

EW21

EW20

EW19

EW23

EW18

EW17

NE3

EW16

EW15

NE4

NE5

CC1

NE6

NS2

4

NS7

NS8

NS9

NS1

0N

S11

NS1

3

NS1

4

NS1

5

NS1

6

NS1

7CC

15

CC14

CC16

CC17

CC19

CC20

CC21

CC22

CC23

CC24

CC25

CC26

CC27

CC28

CC29

NS1

EW24

NS2

NS3

NS5

BP1

BP2

BP3

BP5

BP4

BP6

BP13

BP11

Jela

pang

BP12

Pend

ing

BP8

BP7

BP9

BP10

EW29

EW27

EW25

EW28

EW26

NS2

6EW

14NS2

5EW

13

NS2

7

EW12

EW11

EW10

CC2

NS2

3N

E7

NS2

2

NS2

1

NS2

0

NS1

9

NE8

NE9

NE1

0

EW9

NS1

8

CC13

NE1

2

CC12

CC11

CC10

EW7

EW5

EW6

EW4

EW3

EW2

EW1

CG1

CG2

CC8

CC7

CC6

CC5

CC4

CE1

CE2

CC3

EW8

CC9

NE1

3

NE1

4

NE1

5

SE5

SE4

SE3SE

2

SE1

NE1

6

SW8

SW7

SW6

SW5SW

4

SW2

PTC

PE1

PE2

PE3PE

4PE5

PE6

NS4

STC

NE1

7

NE1

1

7

56

9108

2

3

1

4

expl

orem

etro

ww

w.e

xplo

rem

etro

.com

Lice

nse:

Cre

ativ

e Co

mm

ons

Attr

ibut

ion-

Non

com

mer

cial

-Sha

re A

like

http

://c

reat

ivec

omm

ons.

org/

licen

ses/

by-n

c-sa

/3.0

/Pl

ease

feel

free

to p

rint a

nd s

hare

.If

you

wan

t to

use

this

map

com

mer

cial

ly, c

onta

ct u

s: h

ttp:

//su

ppor

t.exp

lore

met

ro.c

om

Closest MRT

station near NTU


Notes


1 July 2013, Monday11.30-13.45 Registration and Welcome13.45-16.00 Keynote lecture 1: N. Maizels (University of Washington)

Z.Tan (Chinese Academy of Sciences); S.Chowdhury (Institute of Genomics and Integrative Biology, India); S.Richter (University of Padua); V.Kuznetsov (Bioinformatics Institute, Singapore)

16.00-16.30 Coffee/Tea break16.30-18.30 J.Plavec (National Institute of Chemistry, Slovenia); H.Sugiyama (Kyoto University);

A.Randazzo (University of Naples Federico II); K.W.Lim (Nanyang Technological University); G.Parkinson (University College London)

19.00-21.00 Dinner + Poster Session 12 July 2013, Tuesday

8.45-11.00 J.L.Mergny (Institut Européen de Chimie et Biologie); H.Mao (Kent State University); I.Prislan (University of Ljubljana); D.Porath (Hebrew University of Jerusalem); M.Uttamchandani (National University of Singapore)

11.00-12.30 Coffee/Tea break + Poster Session 212.30-14.00 Lunch + Poster Session 314.00-16.00 K.Nagasawa (Tokyo University of Agriculture & Technology); D.L.Ma (Hong Kong

Baptist University); X.Qu (Chinese Academy of Sciences); H.Zeng (National University of Singapore); M.Freccero (Università di Pavia)

16.00-16.30 Coffee/Tea break16.30-18.15 A.Nicolas (Institut Curie); T.Bryan (University of Sydney); H.O.Sintim (University of

Maryland); J.P.Perreault (Universite de Sherbrooke); W.Koole (Leiden University Medical Center)

18.30-20.00 Light Dinner + Poster Session 43 July 2013, Wednesday

8.45-10.30 Keynote lecture 2: S.Balasubramanian (University of Cambridge)J.Hartig (University of Konstanz); L.B.McGown (Rensselaer Polytechnic Institute); L.E.Xodo (University of Udine)

10.30-11.00 Coffee/Tea break11.00-12:30 D.Sen (Simon Fraser University); V.Gabelica (Institut Européen de Chimie et Biologie);

P.Mojzeš (Charles University in Prague); D.Verga (University of Konstanz)12.30-14.00 Lunch + Poster Session 514.00-18.30 Free Afternoon – Guided Tour19.00-22.00 Banquet

4 July 2013, Thursday8.45-10.30 Keynote lecture 3: Laurence H. Hurley (University of Arizona)

D.Yang (University of Arizona); V.Kuryavyi (Sloan-Kettering Institute for Cancer Research); B.Heddi (Nanyang Technological University)

10.30-11.00 Coffee/Tea break11.00-12.30 J.F.Riou (Muséum National d’Histoire Naturelle); H.J.Lipps (University Witten/Herdecke);

D.Rhodes (Nanyang Technological University)12.30-14.00 Lunch14.00-15.30 T.C.Chang (Academia Sinica); D.Miyoshi (Konan University)

Keynote lecture 4: S.Neidle (University College London)15.30-15.45 Closing

Download - GGG G GGG A GGG A GG G T G GGG TT A Program and GGG G G ...g4meeting2013.com/G4_Conference_Program.pdf · GGG A GGG A GGG TT TT A GGG A GGG A GGG A GGG TT TT A GGG A GGG A GGG A GG

Top Related