secreted bioactive factors from bifidobacterium infantis enhance epithelial cell barrier function

Bioactive factors modulate epithelial barrier function Ewaschuk et al

1

Secreted bioactive factors from Bifidobacterium infantis enhance epithelial cell barrier function

Julia B. Ewaschuk, Hugo Diaz, Liisa Meddings, Brendan Diederichs, Andrea Dmytrash, Jody Backer, Mirjam Looijer-van Langen, Karen L. Madsen

Department of Medicine, University of Alberta, Edmonton, Alberta, Canada

Short running Title: Bifidobacterium enhances barrier function

Address correspondence to:

Karen L Madsen, PhD University of Alberta

6146 Dentistry Pharmacy Building Edmonton, Alberta Canada T6G 2N8

Phone: (780) 492-5257 Fax: (780) 492-7593

e-mail: [email protected]

Articles in PresS. Am J Physiol Gastrointest Liver Physiol (September 11, 2008). doi:10.1152/ajpgi.90227.2008

Copyright © 2008 by the American Physiological Society.

Probiotic bacteria maintain barrier function Ewaschuk et al

2

Abstract

Live probiotic bacteria are effective in reducing gut permeability and inflammation. We have previously

shown that probiotics release peptide bioactive factors that modulate epithelial resistance in vitro. Aim:

The objectives of this study were to determine the impact of factors released from Bifidobacteria

infantis on intestinal epithelial cell permeability and tight junction proteins, and to assess whether these

factors retain their bioactivity when administered to IL-10 deficient mice. Methods: B. infantis

conditioned media (BiCM) was applied to T84 human epithelial cells in the presence and absence of

TNFα and IFNγ. Transepithelial resistance (TER), tight junction proteins (claudins 1, 2, 3, and 4, ZO-

1, and occludin) and MAP kinase activity (p38 and ERK) were examined. Acute effects of BiCM on

intestinal permeability were assessed in colons from IL-10 deficient mice in Ussing chambers. A

separate group of IL-10 deficient mice was treated with BiCM for 4 wks and then assessed for intestinal

histological injury, cytokine levels, epithelial permeability, and immune response to bacterial antigens.

Results: In T84 cells, BiCM increased TER, decreased claudin-2, and increased ZO-1 and occludin

expression. This was associated with enhanced levels of phospho-ERK and decreased levels of phospho-

p38. BiCM prevented TNFα and IFNγ induced drops in TER and re-arrangement of tight junction

proteins. Inhibition of ERK prevented the BiCM-induced increase in TER and attenuated the protection

from TNFα and IFNγ. Oral BiCM administration acutely reduced colonic permeability in mice while

long-term BiCM treatment in IL-10 deficient mice attenuated inflammation, normalized colonic

permeability, and decreased colonic and splenic IFNγ secretion. Conclusion: Peptide bioactive factors

from B. infantis retain their biological activity in vivo and are effective in normalizing gut permeability

and improving disease in an animal model of colitis. The effects of BiCM are mediated in part by

changes in MAP kinases and tight junction proteins.


3

Key words: interleukin-10, intestine, tight junctions, permeability, cytokine, probiotics, Bifidobacterium sp


4

Introduction

Humans normally exist in a remarkably harmonious relationship with over 500 species of intestinal

microbes (8). Aberrant immune responses to luminal microbes can result in chronic inflammation in the

gut, and numerous lines of inquiry have implicated bacteria in the development of inflammatory bowel

diseases (IBD) (10, 46). Identification of the link between intestinal microflora and IBD has lead to an

abundance of studies investigating the therapeutic potential of bacterial modification of the luminal

environment by introducing probiotic microbes to the gastrointestinal tract (11). Through these studies,

it has become clear that certain strains of bacteria are integral in maintaining intestinal homeostasis.

Various categories of activity have been identified, including enhanced barrier function, modulation of

the mucosal immune system, production of antimicrobials, and alteration of the intestinal microflora

(30). Despite much recent research in this field, the enormous complexity of the relationships between

the prokaryotic and eukaryotic cells of the intestine indicates that numerous mechanisms likely remain

undiscovered.

Many identified interactions between intestinal epithelial cells and microbes are related to signaling

that occurs due to close contact and interaction between live cells. However, several probiotic and

commensal bacteria, including Lactobacillus GG (LGG), Bifidobacterium breve, Streptococcus

thermophilus, Bifidobacterium bifidum, and Ruminococcus gnavus have been shown to secrete

metabolites that are capable of eliciting responses in epithelial and other immune cells (25, 47). These

metabolites are also capable of traversing the intestinal barrier and have been shown to contribute to

intestinal homeostasis and barrier function. Two isolated and purified peptides secreted by LGG have

been shown to promote intestinal homeostasis by inducing Akt activation, inhibiting cytokine-induced

epithelial cell apoptosis, and promoting cell growth (47). Other low molecular-weight peptides secreted

from Lactobacillus GG induce expression of heat shock proteins and activate MAP kinases (40). In its


5

live form, the probiotic compound VSL#3 attenuates inflammation in the IL-10 deficient mouse model

of colitis (21) and has shown efficacy in several clinical trials for IBD (11). We have previously shown

that epithelial barrier function and resistance to Salmonella invasion is enhanced by exposure to a

proteinaceous soluble factor secreted by the bacteria found in the VSL#3 compound (21). VSL#3

conditioned media has also been shown to inhibit proteasome activity, inhibit NFκB signaling, and

induce expression of cytoprotective heat shock proteins in intestinal epithelial cells (32).

Barrier function in the intestine is maintained via a number of structures. Epithelial cells comprise

the largest amount of surface area and are sealed at paracellular interfaces by tight junctions (TJs) (41).

TJs are made up of complex lipoprotein structures that form fibrils that traverse the lateral plasma

membrane to interact with proteins from the adjacent cell. To date, the primary proteins identified as

tight junction-specific integral trans-membrane proteins are claudins and occludin (41). Claudins are a

multigene family that have been shown to impart resistance and ion selectivity to epithelial paracellular

pathways (41). Studies investigating the effects of probiotics on tight junction proteins have shown live

Streptococcus thermophilus and Lactobacillus acidophilus to alter phosphorylation of several related

tight junction proteins (34), while live E. coli Nissle 1917 has been shown to increase ZO-1 production

(49). In rats, administration of Lactobacillus plantarum increased colonic occludin expression in rats

with experimental abdominal infection (36).

The objectives of this study were first, to determine which strain in the VSL#3 probiotic compound

was the most efficacious in enhancing epithelial resistance and to examine whether these secreted

bioactive factors retained their efficacy when given orally. Secondly, we carried out long-term feeding

studies to determine if reducing intestinal permeability would attenuate colonic inflammation in the IL-

10 deficient mouse model of colitis.


6

Methods

Conditioned media

Individual strains of the VSL#3 probiotic cocktail (Bifidobacteria breve, B. infantis, B. longum,

Lactobacillus acidophilus, L. delbrueckii subsp. Bulgaricus, L. casei, L. plantarum, Streptococcus

salivarius subsp. Thermophilus) (VSL#3 Pharmaceuticals, Ft. Lauderdale, FL USA) were inoculated at

0.18% (w/v) into 25 ml of Tryptone Soy Broth (TSB) (Difco #0370-17-3) and grown statically overnight

(18 – 20 h) at 37oC. For both in vitro and in vivo studies, Bifidobacteria infantis was incubated

overnight in RPMI-1640 media, then adjusted to pH 7.4 and filtered through a 0.2 μm syringe filter to

remove live bacteria. To ensure the absence of any live bacteria, a sample of each preparation was

plated on MRS agar and incubated anaerobically.

T84 Cell Culture Studies

T84 cells at passages 30-34 were grown as monolayers in a 1:1 mixture of Dulbecco-Vogt modified

Eagle’s medium and Ham’s F-12 medium supplemented with 15mM Na+-HEPES buffer, pH 7.5, 14

mM NaHCO3, and 5% newborn calf serum. For subculture, a cell suspension was obtained from

confluent monolayers by exposing the monolayers to 0.25% trypsin and 0.9 mM EDTA in Ca+ and Mg+

free phosphate buffered saline. Cells were seeded at a density of 1 x 106 cells/1.13 cm2 polycarbonate

tissue culture treated filter and maintained at 370C in a 5% CO2 atmosphere. Cultures were refed daily

with fresh media. To qualitatively determine whether the T84 cells had reached confluence, formed tight

junctions, and established cell polarity, the electrical conductance across the monolayer were determined

using an EVOM voltohmeter and an STX-2 electrode set (World Precision Instruments, Sarasota, FL).


7

Epithelial Monolayer Barrier Measurements

For experiments testing effects of BiCM on monolayer resistance, cells were mounted either in

Transwells for measurement of mannitol flux, or into eight-well gold microelectrode chambers for

measurement of transepithelial electrical resistance (TER) using a real-time electric cell-substrate

impedance sensing (ECIS) system (Applied BioPhysics, Troy, NY, USA). In Transwells, a 1:100

dilution of BiCM was added to the apical surface of cells on day 2 after seeding by which time the cells

had reached confluence, and resistance measured over time using an EVOM voltohmeter.

Unidirectional flux of mannitol was assessed by adding 5 μCi [3H] mannitol into the serosal chamber

and sampling from the apical chamber. 1 mmol/L mannitol was present in both apical and serosal

chambers. Aliquots were counted in a scintillation counter. To determine if BiCM was effective in

preventing monolayer disruption by IFNγ or TNFα, monolayers were pre-incubated for 2 hours with

BiCM, followed by the addition of either IFNγ (10 ng/ml) or TNFα (10 ng/ml) to the serosal chamber.

For experiments assessing the role of MAPK, the ERK inhibitor PD98059 (25µM) was added to the

apical surface 15 minutes prior to the addition of BiCM. Resistance was measured with an EVOM

voltohmeter following 24 hrs of incubation. Measurements are expressed as ohms/cm2. For real-time

measurements of epithelial resistance by ECIS, T84 cells were plated on sterile eight-well gold-plated

electrode arrays (8W10E) pre-coated with 0.2% gelatin at 1 × 105/well (26). To study the role of the

ERK pathway in BiCM effects, cells were treated with BiCM in the presence and absence of the ERK

pathway inhibitor, PD-98059 (25 μM). Cells were pretreated with PD-98059 for 15 min followed by the

addition of BiCM to the apical surface of monolayers. The arrays were then mounted on the ECIS

system within an incubator (37°C, 5% CO2) and connected to its recorder device. Monolayer resistance

was measured continually and normalized for each well at time 0.


8

Western blotting

For Western blot analysis, T84 cells were lysed in Mono Q buffer (1.08 g β-glycerophosphate, 38.04 mg

EGTA, 0.5 ml Triton X-100, 200 μl 1 M MgCl2 per 100 ml), and 50 µg of protein subjected to

electrophoresis on 10% SDS-polyacrylamide gels as previously described (14). Antibodies used were

anti-claudins-1,2, 3, and 4, anti-ZO-1, and anti-occludin (Cell Signaling Technology, Beverly, MA).

Secondary staining was conducted using HRP-conjugated goat anti-rabbit Ig (1:3000, Amersham, Baie

d’Urfe, Quebec) followed by chemiluminescent detection using a commercial reagent following

manufacturers’ instructions (Lumilight, Roche, Laval, Quebec). Equivalent loading was confirmed by

Ponceau’s staining and multiple exposures were done to ensure that film was not over-exposed.

Immunofluorescence labeling

T84 cells were seeded (~5 x 105 cells/well) into four-chamber slides and incubated overnight, and then

pretreated with 100 μL BiCM for 4 h. Monolayers were then treated with 10 ng/mL TNFα, or 10 ng/mL

IFNγ for 24 h. Plates were washed twice with cold PBS, and incubated in 2% paraformaldehyde for 1 h.

After 1 h of blocking with 5% skim milk in PBS, cells were incubated with anti-claudin 1 or anti-

occludin antibody (1/100) for 60 min and then with Alexafluor 488-conjugated goat anti-mouse

secondary antibody for occludin and Cy5-conjugated goat anti-rat secondary antibody for claudin-1 or

(CTxB) (Invitrogen, Burlington, ON, Canada). Cells were mounted with coverslips in Fluorsave. Slides

were examined with a Zeiss Axiovert 100 M confocal microscope coupled with a Zeiss LSM510 laser

scanning system (Germany). Images were taken with a 63x Plan-apochromat n.a. 1.4 with a zoom factor

of 2. Alexafluor 488 was scanned with an argon laser (excitation wavelength, 488 nm; emission


9

wavelength, 505 nm), and Cy5 was scanned with an HeNe laser (excitation wavelength, 543 nm;

emission wavelength, 560 nm).

Animals and in vivo procedures

Wild-type and IL-10 deficient mice on a 129 Sv/Ev background had ad libitum access to 9% fat rodent

blocs and water and were housed behind a barrier under pathogen-free conditions. The facility’s

sanitation was verified by Health Sciences Lab Animal Services at the University of Alberta. For acute

experiments, mice were gavaged with 30 μl of BiCM or vehicle and sacrificed after 4 hours for

measurement of colonic permeability in vitro in Ussing chambers. For long-term studies, 8 week-old

mice were fed BiCM or vehicle (30 μL/2 x day) for 30 days. All experiments were performed according

to the Canadian Council of Animal Care guidelines for the care and use of laboratory animals in

research and with the permission of the local ethics committee.

Epithelial Function

For measurement of intestinal permeability, a colonic segment was mounted in Ussing chambers

exposing mucosal and serosal surfaces to 10 ml of oxygenated Krebs buffer (in mM: 115 NaCl, 8 KCl,

1.25 CaCl2, 1.2 MgCl2, 2 KH2PO4, 225 NaHCO3; pH 7.35). The buffers were maintained at 370C by a

heated water jacket and circulated by CO2/O2. Fructose (10 mM) was added to the serosal and mucosal

sides. For measurement of basal mannitol fluxes, 1 mM of mannitol with 10 μCi [H3-mannitol] was

added to the mucosal side. The spontaneous transepithelial potential difference (PD) was determined,

and the tissue clamped at zero voltage by continuously introducing an appropriate short-circuit current

(Isc) with an automatic voltage clamp (DVC 1000 World Precision Instruments, New Haven, CT),

except for 5-10 s every 5 minutes when PD was measured by removing the voltage clamp. Tissue ion

conductance (G) was calculated from PD and Isc according to Ohm’s Law (6). Isc is expressed as


10

μA/cm2, and G as mS/cm2. Baseline Isc and G were measured after a 20-minute equilibration period

and increases in Isc were induced by addition of the adenylate cyclase-activating agent, forskolin (10-5

M) to the serosal surface. Epithelial responsiveness was defined as the maximal increase in Isc to occur

within 5 minutes of exposure to the secretagogue.

Mucosal cytokine measurements

Mice were euthanized using cervical dislocation and whole colons removed, flushed with phosphate

buffered saline, and resuspended in tissue culture plates (Falcon 3046; Becton Dickinson Labware,

Lincoln Park, HJ) in RPMI-1640 media supplemented with 50mM 2-mercaptoethanol (2-ME), 10% fetal

calf serum, streptomycin (100U/ml) and penicillin (100 U/ml). Cultures were incubated at 37ºC in 5%

CO2 for 24 hours. Supernatants were harvested and stored at -70ºC for cytokine level quantification.

Levels of TNFα and IFNγ in culture supernatants were measured using enzyme linked immunosorbent

assay (ELISA) kits (Medicorp, Montreal, Quebec) according to manufacturers’ instructions. Total

RNA was isolated from tissue samples using Trizol (Gibco, Burlington, ON) following manufacturer’s

instructions. mRNA (1 μg) was reverse transcribed and amplified using the polymerase chain reaction

(PCR) and standardized to β-actin (14). TNFα, IFNγ and β-actin sequences were obtained from

GenBank and used to design intron-spanning primers. Primer sequences used for PCR are shown in

Table 1.

Histopathology

Colonic tissue was obtained at the time of sacrifice for histological analysis. Formalin-fixed and

paraffin-embedded sections were stained with hematoxylin and eosin. The slides were reviewed in a

blinded fashion and were assigned an intestinal inflammation histological score according to the sum of

4 scoring criteria: mucosal ulceration, epithelial hyperplasia, lamina propria mononuclear infiltration,

and lamina propria neutrophilic infiltration as previously described (21).


11

Preparation and Activation of Murine Spleen Cells

Spleens were removed aseptically from mice and teased into single cell suspensions in RPMI 1640

medium with 10% fetal calf serum. The cell suspension was centrifuged at 400 x g for 5 min and the cell

pellet resuspended in lysis medium (1 volume of 0.17 M Tris, pH 7.6, 9 volumes of 0.16 M NH4Cl) to

remove red blood cells and repelleted. Cells were washed twice with RPMI 1640 medium and placed

into 96-well plates at a concentration of 1 x 106 per well in the presence of bacterial sonicates at a

protein concentration of 50 μg/mL according to the method of Sydora et al (39). Bacterial sonicates

included Clostridium sordelli, Lactobacillus reuteri, and Bacteroides vulgatus (39). After 48 hrs

incubation at 37o C in a humidified incubator at 5% CO2, plates were centrifuged and IFNγ in the

supernatant quantified by ELISA. Controls included plate bound anti-CD3ε clone 145-2C1

(PharMingen Canada, Mississauga, ON) and medium alone.

Statistical Analysis

Data were tested for normality of distribution and analyses performed using the statistical software

SigmaStat (Jandel Corporation, San Rafael, CA). Differences between means were evaluated using

analysis of variance, paired t-tests, or by a nonparametric Mann-Whitney Rank Sum test where

appropriate. Specific differences were tested using the Student-Newman-Keuls test.

Results

Bifidobacterium infantis exerts the greatest effect on monolayer resistance

Live probiotics and commensals have been shown to improve monolayer barrier function in cultured

human epithelial cells (34). We have previously shown that conditioned media from VSL#3, with no

live cells, increases T84 cell monolayer resistance (21). In order to minimize the complexity of the


12

conditioned media utilized in further studies, we assessed the ability of each strain from the VSL#3

probiotic cocktail to enhance monolayer resistance in T84 cells. Of the 8 probiotic strains tested,

conditioned media from Bifidobacterium infantis (BiCM) had the greatest effect on transepithelial

electrical resistance and was thus selected for use in all further experiments performed in this study

(Figure 1).

BiCM enhances T84 cell monolayer resistance via the paracellular pathway

To determine the nature of the increased resistance induced by BiCM, we examined paracellular

permeability by measuring the movement of mannitol, a small, hydrophilic macromolecule with a cross-

sectional diameter of 6 Å. As shown in Figure 2, application of BiCM to T84 cells significantly

decreased apical-to-basolateral mannitol flux and increased resistance by 6 hours as measured by an

EVOM voltohmeter. This effect was maintained through 24 hrs. Figure 2B confirms these findings

using real-time electric cell-substrate impedance sensing (26), and demonstrates that effects of BiCM are

long-lasting.

MAPK phosphorylation is induced by BiCM

At least three distinct groups of MAPKs have been identified in mammals, including the extracellular

signal-regulated kinases (ERKs), the c-Jun NH2-terminal kinases (JNKs), and p38. ERK is typically

stimulated by growth-related signals, whereas the JNK and p38 MAP kinase cascades are activated by

various stress stimuli (16). Barrier function and paracellular permeability has been shown to be

regulated by ERK expression (12) whereas p38 activation contributes to the disruption of epithelial

barrier function (2). Activation of these kinases was assayed by using antibodies specific for the

phosphorylated, active forms of these kinases by Western blotting. As shown in Figure 3A, ERK1/2


13

was transiently phosphorylated following treatment with BiCM, with maximal phosphorylation evident

by 10 min and decreasing thereafter. In contrast, an anti-phospho-p38 blot of BiCM treated cells

showed levels of the phosphorylated form of p38 to decrease (Figure 3A). Densitometry analysis is

shown in Figure 3B. Inhibition of ERK1/2 with PD98059 abolished the BiCM-induced rise in resistance

(Figure 2B). A Western blot confirming the absence of the phosphorylated form of ERK1/2 in the

presence of PD98059 is shown in Figure 3C.

BiCM alters tight junction protein expression

Although the plasma membrane of intestinal epithelial cells is an effective barrier to hydrophilic

substances, the paracellular spaces must also be sealed to form an intact barrier. To accomplish this,

intestinal epithelial cells are joined together by a series of intercellular tight junction proteins along their

lateral membranes (29). To determine if the decrease in paracellular permeability induced by BiCM was

associated with altered tight junction protein expression, T84 cells were treated with BiCM and

expression of claudins 1, 2 , 3 and 4, ZO-1, and occludin were measured by Western blot (Figure 4).

Claudins responded in a time-dependent differential manner to BiCM. Treatment of monolayers to

BiCM resulted in enhanced protein expression of claudin-4, ZO-1, and occludin, while claudin-2 levels

decreased over time.

BiCM protects against IFNγ and TNFα induced permeability and tight junction disruption

Inflammatory cytokines IFNγ and TNFα both cause a functional disruption of epithelial tight junctions

primarily by altering the localization of tight junction proteins as well as by modulating the membrane

microdomain lipid composition (9, 19, 20). To determine if BiCM was effective in preventing a

cytokine-mediated drop in resistance, T84 cells were pre-incubated with BiCM followed by treatment


14

with either IFNγ or TNFα. Transepithelial resistance was measured, and claudin-1 and occludin protein

expression and organization were then assessed by western blot and immunofluorescence, respectively.

As seen in Figure 5, TNFα and IFNγ both caused a drop in transepithelial resistance by 24 hrs, which

was prevented when cells were pre-incubated with BiCM. Under normal conditions, the tight junction

proteins occludin and claudin-1 were localized in a pattern consistent with their distribution in tight

junctions (Figure 6A). IFNγ and TNFα induced a dramatic redistribution of occludin and claudin-1

from the tight junction membranes into the cytoplasm (Figure 6A). This alteration was characterized by

discontinuities in membrane staining and submembranous internalization of these proteins (Figure 6A).

Pretreatment with BiCM prevented the cytokine-induced tight junction protein disruption (Figure 6A)

and the drop in epithelial resistance (Figure 5). As seen in Figure 6B, BiCM had no effect on whole

cellular levels of these tight junction proteins in the presence of IFNγ or TNFα. The ability of BiCM to

protect against an IFNγ- and TNFα-induced drop in epithelial resistance was abolished by ERK1/2

inhibition (Figure 5).

The biological activity of BiCM is maintained in vivo

IL-10 deficient mice spontaneously develop colitis at approximately 6-8 weeks of age and demonstrate

increased colonic permeability prior to the onset of inflammation (15, 21). This enhanced gut

permeability is believed to have a causal role in the onset and perpetuation of inflammation in this

model. To determine if BiCM retained its ability to decrease permeability in vivo, adult IL-10 deficient

129 Sv/Ev mice (n=7) were administered BiCM or vehicle and colonic permeability was assessed in

Ussing chambers after 4 hours. As seen in Figure 7A, BiCM decreased mannitol permeability in the

proximal colon of IL-10 deficient mice within 4 hr of administration. This was accompanied by a

decrease in overall tissue conductance (Figure 7B).


15

BiCM improved clinical presentation and intestinal function in IL-10 mice

To assess whether the reduction in colonic permeability induced by BiCM would be effective in

improving clinical signs of colitis if given long-term, IL-10 deficient 129 Sv/Ev mice (n=8) were treated

with BiCM for 30 days. Mice receiving BiCM treatment showed enhanced weight gain, decreased

colonic weight, and decreased colon weight/length ratio compared to control animals (Table 2). This

was associated with a significant attenuation of histological inflammation and a significantly reduced

mannitol flux compared with controls (Table 3).

Epithelial Ionic Function

In vitro and in vivo studies have demonstrated that pro-inflammatory cytokines can alter epithelial

transport and barrier functions (4, 20). We have previously shown that colonic epithelium from IL-10

gene-deficient mice exhibit physiologic alterations in colonic ionic function (24). To determine if

treatment with BiCM was associated with enhanced intestinal function, colons from IL-10 deficient

mice were studied in Ussing chambers. IL-10 gene-deficient mice demonstrated significant reductions in

basal short-circuit current (Isc) and also demonstrated reduced short-circuit response to forskolin,

suggesting impairment in cAMP-dependent active chloride secretion (Table 3). BiCM treatment

normalized baseline Isc and Isc response to forskolin. Physiological function of colonic tissue from

control mice was not affected by BiCM treatment (data not shown).

BiCM reduced mRNA levels of IFNγ

Colonic epithelium from IL-10 gene-deficient mice exhibit high levels of TNFα and IFNγ (21, 22). To

assess whether the improvement in colonic histology and physiological function in mice treated with


16

BiCM was associated with altered expression of cytokines, levels of colonic mRNA were measured.

Mice receiving BiCM exhibited decreased levels of colonic IFNγ mRNA in conjunction with increased

TGFβ mRNA (Figure 8). However, interestingly, levels of TNFα were not altered. To determine if this

decrease in pro-inflammatory cytokine levels in the colon was due to a direct effect of BiCM on tissue,

small intestine and colon were incubated for 24 hrs in the presence of BiCM and levels of secreted

TNFα and IFNγ measured. BiCM had no effect on secretion of these cytokines (Figure 9), suggesting

that the decrease in cytokine secretion was not due to a direct effect of BiCM on intestinal tissue.

BiCM reduces systemic inflammatory response

Figure 10 shows IFNγ release from spleen cells stimulated with sonicates prepared from pure cultures of

Clostridium sordelli, Lactobacillus reuteri, and Bacteroides vulgatus. As previously shown in this

model (38), spleen cells from IL-10 deficient mice secrete significant amounts of IFNγ in response to

stimulation with bacterial sonicates as compared with control mice. Spleen cells from IL-10 deficient

mice treated with BiCM did not show any enhanced IFNγ secretion as compared with controls,

demonstrating that the increase in gut barrier function induced by treatment with BiCM was associated

with an altered systemic immune response to bacterial antigens in IL-10 deficient mice.

Discussion

Probiotics have become the subject of a great deal of investigation, particularly in the context of

inflammatory bowel disease. We previously showed that secreted factors from the probiotic cocktail

VSL#3 increase transepithelial resistance in vitro (21). Here, we further assessed the actions of soluble


17

secreted factors from Bifidobacteria infantis (a component of VSL#3) on epithelial barrier function both

in vitro and in vivo. We determined that conditioned media from Bifidobacterium infantis (BiCM)

increases transepithelial resistance by altering tight junction protein expression. Barrier disruption

induced by IFNγ and TNFα was also prevented by BiCM, and this activity appeared to be functioning

through an MAP kinase dependent pathway. We further demonstrated that oral treatment of IL-10

deficient mice with BiCM effectively decreases colonic permeability in conjunction with a reduction in

mucosal levels of pro-inflammatory cytokines, a significant improvement in colitis, and an altered

systemic response to bacterial antigens.

Tight junction proteins selectively modulate the passage of molecules and ions via the

paracellular pathway and also prevent the lateral diffusion of membrane proteins (43). In particular,

differential expression and properties of the claudin family of tight proteins appears to determine the

tissue-specific variations in electrical resistance and paracellular ionic selectivity (43). In cell culture

models, several claudins have been shown to decrease cation permeability (claudins 1,4, 5, 7, 8, and 14),

while others appear to express cation selective pores (claudins 2 and 16) and increase permeability (43).

In this study, treatment of T84 monolayers with BiCM resulted in a time-dependent increase in

transepithelial resistance. This correlated with a decrease in the expression of claudin-2, and an increase

in levels of ZO-1 and occludin. These findings of probiotic-induced increase in epithelial resistance and

tight junction protein expression are in agreement with other previously published findings. Live

Lactobacillus acidophilus, Streptococcus thermophilus, and E. coli Nissle, and secreted products from

VSL#3 are able to maintain or enhance tight junction protein expression under normal and physiological

stressed conditions (27, 34, 42, 49)

Patients with inflammatory bowel disease exhibit increased gut permeability (5). Further,

increases in permeability have been shown to precede clinical relapse in patients with Crohn’s disease


18

(1). Distribution and expression levels of various tight junction components have been shown to be

altered in Crohn’s disease patients (5). Increased expression of claudin-2 has been described in colonic

epithelium from Crohn’s and ulcerative colitis patients (33, 48). Other studies have shown occludin and

ZO-1 to be relocated to the basolateral membrane in Crohn’s disease patients (31) and claudin-5 and -8

to be redistributed from the tight junction region (48). These studies strongly suggest that alterations in

tight junction composition and protein localization may have a key role in the pathogenesis of chronic

inflammatory conditions. A link between altered levels of pro-inflammatory cytokines and intestinal

permeability has been described (5). In particular, levels of TNFα and IFNγ have been shown to be up-

regulated in patients with Crohn’s disease (28, 37). Numerous studies have demonstrated that TNFα and

IFNγ decrease transepithelial resistance by inducing re-distribution of various tight junction proteins by

internalization (4, 19) or by selectively activating different populations of paracellular pores (45). In

contrast, other cytokines such as IL-13 have been shown to increase permeability by increasing levels of

claudin-2 (33). In this study, conditioned media from Bifidobacterium infantis was effective in

attenuating both a TNFα and IFNγ-induced drop in epithelial resistance. Further, BiCM also prevented

the IFNγ-induced rearrangement of occludin and claudin-1 in T84 cells. Inhibition of ERK abolished

the BiCM-induced rise in resistance and ability to protect against TNFα and IFNγ-induced decreases in

barrier function. This is in agreement with other studies showing that beneficial effects on epithelial

barrier function exerted by probiotics are MAP kinase pathway-dependent (35, 40).

In addition to their ability to modulate epithelial responses to pro-inflammatory cytokines,

probiotics have also been shown to prevent a hydrogen peroxide-induced disruption of tight junctions

via a protein kinase C and MAP kinase dependent mechanism (35). This would suggest that probiotics

are effective at maintaining epithelial barrier function in the presence of varied insults.

The IL-10 gene-deficient mouse demonstrates an increase in colonic permeability that is absent


19

in mice raised under germ-free conditions (23). We have previously demonstrated that VSL#3 treatment

reduced colonic permeability in IL-10 gene-deficient mice and significantly improved colitis (21).

However, whether or not the improvement of colitis was due primarily to a bacterial-induced

improvement in permeability, or whether other effects of the probiotic bacteria found in VSL#3 on

immune cell function contributed to the improvement of colitis is unknown. Results from this study

indicate that bioactive factors released from B. infantis alone are also effective in attenuating colitis,

while having no effect on TNFα or IFNγ secretion when applied directly to gut tissue, suggesting that

modulation of gut permeability alone may be sufficient to improve inflammation in this model.

However, the application of the bioactive factors could have had effects on other cytokines not measured

in this study.

Probiotics have been consumed by humans in fermented dairy products for thousands of years

and have an excellent safety record with virtually no known side effects in healthy populations (13).

However, administration of probiotic bacteria to individuals with compromised immune systems,

pancreatitis and short gut syndrome may potentially lead to bacteremia (3, 7, 17). The risk of probiotic

sepsis may also be higher in premature infants (18). In one study of athymic neonatal mice, colonization

of L. reuteri led to sepsis and resulted in a high mortality rate (44). Administration of probiotic

components, such as BiCM may be useful in patients at risk for bacteremia, as physiological efficacy is

maintained without the accompanying risk of sepsis from live strains.

In conclusion, orally administered conditioned media from Bifidobacteria infantis is effective in

reducing colonic permeability and attenuating inflammation in a mouse model of colitis. Further, this

protection involves effects on tight junction proteins and is mediated through the MAPK pathway. In

that altered gut permeability is thought to drive gut inflammation in many different autoimmune

diseases, the use of probiotic-derived products rather than live bacteria to increase barrier resistance and


20

maintain the intestinal barrier may have significant clinical implications.

Grant Support: Alberta Heritage Foundation for Medical Research

Crohn’s and Colitis Foundation of Canada

Canadian Institutes for Health Research


21

Table 1. PCR primer sequences

Primer Name Sequence

TNFα forward primer

TNFα reverse primer

5’- ATGAGCACAGAAAGCATGATC –3’

5’- TACAGGCTTGTCACTCGAATT –3’

IFNγ forward primer

IFNγ reverse primer

5’- TACTGCCACGGCACAGTCATTGAA –3’

5’- GCAGCGACTCCTTTTCCGCTTCCT –3’

TGFβ forward primer

TGFβ reverse primer

5’ – CGGGGCGACCTGGGCACCATCCATGAC – 3’

5’- CTGCTCCACCTTGGGCTTGCGACCCAC – 3’

Actin forward primer

Actin reverse primer

5’ –CGTGGGCCGCCCTAGGCACCA- 3’

5’ –TTGGCCTTAGGGTTCAGGGGGG- 3’


22

Table 2. Morphological parameters and histological score of control mice, IL-10 deficient mice, and IL-10 deficient mice receiving BiCM for 30 days.

Group

Weight Gain (g)

Colon Length

(cm)

Colon

Weight (g)

Weight:Length

%

Histological

Score (0-10)

Control

(n=8)

2.4±0.4

8.8±0.02

0.29 ± 0.02

3.3±0.2

0.2±0.1

IL-10 deficient

(n=9)

1.1 ± 0.3*

8.3 ± 0.3

0.57 ± 0.06*

6.8 ± 0.5*

3.9 ± 0.4*

IL-10 deficient +

BiCM (n=8)

2.1 ± 0.3

8.9 ± 0.2

0.36 ± 0.04

4.4 ± 0.3

1.5 ± 0.5+

Values are means ± SEM *p<0.05 compared with control and IL-10 gene-deficient + BiCM +p<0.05 compared with control


23

Table 3. Electrical and permeability parameters of colons from control mice, IL-10 deficient mice, and IL-10 deficient mice receiving BiCM for 30 days

Group

Mannitol Flux (nmol/cm2/hr)

Isc

(μA/cm2)

Forskolin

(Δ μA/cm2)

G

(mS/cm2)

Control

(n=8)

13.2 ± 1.8

62 ± 7

86 ± 10

12.3 ± 1.9

IL-10 deficient

(n=9)

19.5 ± 2.1*

31 ± 5**

30 ± 6*

13.1 ± 1.9

IL-10 deficient +

BiCM (n=8)

12.4 ± 1.0

52 ± 12

54 ± 11

11.5 ± 0.8

Values are means ± SEM *p<0.05 compared with control and IL-10 gene-deficient + BiCM **p<0.05 compared with control


24

Figure Legends.

Figure 1. Changes in transepithelial resistance in T84 cells in response to conditioned media from

the probiotic bacterial strains in VSL#3. Each strain from VSL#3 was incubated separately in RPMI-

1640 media overnight, and live cells were filtered out. Application of conditioned media from 6 of the

strains to a T84 monolayer resulted in varying increases in epithelial resistance after 4 hrs of incubation,

with Bifidobacteria infantis conditioned media (BiCM) exerting the greatest effect. Mean ± SD of 2

experiments with 3 replicates each.

BI: Bifidobacterium infantis

BB: Bifidobacterium breve

LP: Lactobacillus plantarum

LA: Lactobacillus acidophilus

LC: Lactobacillus casei

ST: Streptococcus thermophilus

BL: Bifidobacterium longum

LB: L. delbrueckii subsp. Bulgaricus

C: vehicle

Figure 2. Effect of BiCM on mannitol flux and resistance in T84 cells. Application of BiCM to T84

cells in transwells significantly decreased apical-to-basolateral mannitol flux and increased resistance

within 6 hrs (A). This effect was maintained through 24 hrs. Values shown are calculated as % of

control values. (B) As measured by real-time electric cell-substrate impedance sensing (ECIS) BiCM

increased T84 cellular resistance and maintained the effect through 40 hrs. Inhibition of ERK1/2 with


25

PD98059 (25 µM) prevented the BiCM-induced rise in epithelial resistance. Values given are means ±

SD of 2 experiments with 3 replicates each. *p<0.05 relative to control.

Figure 3. BiCM increased phospho-ERK and decreased phospho-p38 in T84 cells. T84 cells were

treated with BiCM for various times and whole cell extracts were prepared for Western blotting.

Extracts were immunoblotted with antibodies specific for the phosphorylated (phospho) forms of ERK

and p38. All gels were run 3 times and equal protein loading was confirmed by protein assay and by

densitometric analysis of control Western blots by using antibodies specific for the nonphosphorylated

(total) forms of these kinases. ERK1/2 was transiently phosphorylated following treatment with BiCM,

with maximal phosphorylation evident by 10 min and decreasing thereafter while levels of the

phosphorylated form of p38 decreased (A). Densitometry analysis is shown in Figure 3B. A Western

blot confirming the absence of the phosphorylated form of ERK1/2 in the presence of PD98059 is

shown in C.

Figure 4. Analysis of the effects of BiCM on tight junction protein expression in T84 cells. T84

cells were treated with BiCM for various times and whole cell extracts were prepared for Western

blotting. Extracts were immunoblotted with antibodies specific for claudin 1, 2, 3, 4, ZO1, and

occludin. All gels were run 3 times and equal protein loading was confirmed by protein assay and by

densitometric analysis of control Western blots by using antibodies specific for β-actin. In response to

BiCM, claudin-2 showed a rapid decrease in expression, while ZO-1 and occludin levels both increased

by 6 hrs.


26

Figure 5. Effect of BiCM on resistance in T84 cells in the presence of IFNγ and TNFα

T84 cells were treated with ERK1/2 inhibitor (PD98059, 25 uM) for 15 minutes and then with BiCM or

media alone for 4 hours prior to addition of IFNγ (10 ng/ml) or TNF (10 ng/ml). Transepithelial

resistance was measured 24 hours after treatment using a volthometer. Both TNFα and IFNγ reduced

epithelial resistance as compared with control cells. BiCM pretreatment prevented the cytokine-induced

drop in epithelial resistance. The protective effect of BiCM on barrier function was abolished by the

inhibition of ERK1/2 with PD98059. Values are mean ± SD of 2 experiments with 3 replicates.

*p<0.05 compared with control

Figure 6. Confocal micrographs of T84 monolayers with dual immunofluorescent staining with

antibodies to claudin-1 and occludin (A) and the effects of TNFα and IFNγ on claudin and

occludin expression at 24 hrs (B). IFNγ and TNFα induced a dramatic redistribution of occludin and

claudin-1 from the tight junction membranes into the cytoplasm. Pretreatment with BiCM prevented the

cytokine-induced tight junction protein disruption. (B) Western blotting of whole cellular protein

lysates shows increased occludin in response to BiCM. Protein expression of occludin and claudin-1 as

determined by western blotting was unchanged following cytokine incubation. Experiments were

repeated three times with similar results.

Figure 7. Acute treatment of IL-10 deficient mice with BiCM. Adult IL-10 deficient 129 Sv/Ev

mice were administered BiCM or vehicle and colonic permeability was assessed in Ussing chambers

after 4 hours. BiCM decreased mannitol permeability in the proximal colon of IL-10 deficient mice

within 4 hr of administration (A). This was accompanied by a decrease in overall tissue conductance


27

(B). Values are means ± SE of duplicate samples for n=7 animals per group. *p<0.05 relative to colons

from untreated IL-10 deficient mice

Figure 8. Colonic cytokine mRNA levels in animals receiving BiCM. IL-10 deficient mice were

treated with BiCM daily (30 µl) for 30 days and colons removed for measurement of IFNγ, TNFα, and

TGFβ mRNA levels. After 30 days of treatment, mice receiving BiCM showed reduced mRNA levels

of colonic IFNγ and increased TGFβ levels. There was no difference in TNFα mRNA levels. Values are

means ± SE of duplicate samples for n=8 animals per group. *p<0.05 relative to untreated IL-10

deficient mice

Figure 9. Colonic cytokine secretion in vitro in response to BiCM. Whole colons were removed

from untreated IL-10 deficient mice and resuspended in tissue culture plates in the presence and absence

of BiCM. Cultures were incubated at 37ºC in 5% CO2 for 24 hours. Supernatants were harvested and

TNFα and IFNγ levels measured using ELISA. BiCM had no effect on either TNFα or IFNγ secretion.

Values are means ± SE of 6 animals per group.

Figure 10. IFNγ release from spleen cells. Spleens were removed aseptically from wild-type control

mice, IL-10 deficient mice, and IL-10 deficient receiving BiCM for 30 days. Spleen cells were placed

into 96-well plates at a concentration of 1 x 106 per well in the presence of bacterial sonicates (50

μg/mL: Clostridium sordelli, Lactobacillus reuteri, and Bacteroides vulgates) After 48 hrs incubation at

37o C, plates were centrifuged and IFNγ in the supernatant quantified by ELISA. Controls included

plate bound anti-CD3ε clone 145-2C1 and medium alone. IL-10 deficient mice had increased levels of

IFNγ release when stimulated with Clostridium sordelli, Bacteroides vulgatus, and Lactobacillus


28

reuteri. BiCM treatment reduced the splenic response to all three bacterial antigens. Values are means

± SE of duplicate samples for n=4-6 animals per group. *p<0.05 relative to wild-type and BiCM treated

IL-10 deficient mice


29

References

1. Arnott ID, Kingstone K, and Ghosh S. Abnormal intestinal permeability predicts relapse in

inactive Crohn disease. Scandinavian Journal of Gastroenterology 35: 1163-1169, 2000.

2. Beisswenger C, Coyne CB, Shchepetov M, and Weiser JN. Role of p38 MAP kinase and

transforming growth factor-beta signaling in transepithelial migration of invasive bacterial pathogens.

Journal of Biological Chemistry 282: 28700-28708, 2007.

3. Besselink M, van Santvoort HC, Buskens E, Boermeester MA, van Goor H, Timmerman HM,

Nieuwenhuijs VB, Bollen TL, van Ramshorst B, Witteman BJ, Rosman C, Ploeg RJ, Brink MA,

Schaapherder AF, Dejong CH, Wahab PJ, van Laarhoven CJ, van der Harst E, van Eijck CH, Cuesta

MA, Akkermans LM, Gooszen HG, and Group. DAPS. Probiotic prophylaxis in predicted severe acute

pancreatitis: a randomized, double-blind, placebo-controlled trial. Lancet 371: 651-659, 2008.

4. Bruewer M, Luegering A, Kucharzik T, Parkos CA, Madara JL, Hopkin Am, Nusrat A.

Proinflammatory cytokines disrupt epithelial barrier function in an apoptosis-independent mechanism. J

Immunol 171: 6164-6172, 2003.

5. Bruewer M, Samarin S, and Nusrat A. Inflammatory bowel disease and the apical junctional

complex. Annals of the New York Academy of Sciences 1072: 242-252, 2006.

6. Clarkson T. Measurement of short-circuit current and ion transport across the ileum. Am J

Physiol 206: 658-668, 1964.

7. De Groote MA, Frank DN, Dowell E, Glode MP, and Pace NR. Lactobacillus rhamnosus GG

bacteremia associated with probiotic use in a child with short gut syndrome. Pediatric Infectious

Disease Journal 24: 278-280, 2005.

8. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE,

and Relman DA. Diversity of the human intestinal microbial flora.[see comment]. Science 308: 1635-

1638, 2005.

9. Fink MP. Intestinal epithelial hyperpermeability: update on the pathogenesis of gut mucosal

barrier dysfunction in critical illness. Curr Opin Crit Care 9: 143-151., 2003.

10. Frank D, Amand AL, Feldman RA, Boedeker EC, Harpaz N, Pace NR. Molecular-phylogenetic

characterization of microbial community imbalances in human inflammatory bowel diseases. PNAS 104:

13780-13785, 2007.


30

11. Hedin C, Whelan K, Lindsay JO. Evidence for the use of probiotics and prebiotics in

inflammatory bowel disease: a review of clinical trials. Proceedings of the Nutrition Society 66: 307-

315, 2007.

12. Howe KL, Reardon C, Wang A, Nazli A, and McKay DM. Transforming growth factor-beta

regulation of epithelial tight junction proteins enhances barrier function and blocks enterohemorrhagic

Escherichia coli O157:H7-induced increased permeability. American Journal of Pathology 167: 1587-

1597, 2005.

13. Ishibashi N, and Yamazaki S. Probiotics and safety. American Journal of Clinical Nutrition 73:

465S-470S, 2001.

14. Jijon HB, Panenka WJ, Madsen KL, and Parsons HG. MAP kinases contribute to IL-8 secretion

by intestinal epithelial cells via a posttranscriptional mechanism. American Journal of Physiology - Cell

Physiology 283: C31-41, 2002.

15. Kennedy RJ, Hoper M, Deodhar K, Erwin PJ, Kirk SJ, and Gardiner KR. Interleukin 10-deficient

colitis: new similarities to human inflammatory bowel disease. British Journal of Surgery 87: 1346-

1351, 2000.

16. Kyosseva SV. Mitogen-activated protein kinase signaling. International Review of Neurobiology

59: 201-220, 2004.

17. Land MH, Rouster-Stevens K, Woods CR, Cannon ML, Cnota J, and Shetty AK. Lactobacillus

sepsis associated with probiotic therapy.[see comment]. Pediatrics 115: 178-181, 2005.

18. Lee SJ, Cho SJ, and Park EA. Effects of probiotics on enteric flora and feeding tolerance in

preterm infants. Neonatology 91: 174-179, 2007.

19. Li Q, Zhang Q, Wang M, Zhao, Ma J, Luo N, Li N, Li Y, Xu G, Li J. Interferon and tumor

necrosis factor disrupt epithelial barrier function by altering lipid compositin in membrane

microdomains of tight junction. Clinical Immunology 126: 67-80, 2008.

20. Madara JL, and Stafford J. Interferon-gamma directly affects barrier function of cultured

intestinal epithelial monolayers. Journal of Clinical Investigation 83: 724-727, 1989.

21. Madsen K, Cornish A, Soper P, McKaigney C, Jijon H, Yachimec C, Doyle J, Jewell L, and De

Simone C. Probiotic bacteria enhance murine and human intestinal epithelial barrier function.

Gastroenterology 121: 580-591, 2001.

22. Madsen KL, Doyle JS, Jewell LD, Tavernini MM, and Fedorak RN. Lactobacillus species

prevents colitis in interleukin 10 gene-deficient mice.[comment]. Gastroenterology 116: 1107-1114,


31

1999.

23. Madsen KL, Fedorak RN, Tavernini MM, and Doyle JS. Normal Breast Milk Limits the

Development of Colitis in IL-10-Deficient Mice. Inflammatory Bowel Diseases 8: 390-398, 2002.

24. Madsen KL, Malfair D, Gray D, Doyle JS, Jewell LD, and Fedorak RN. Interleukin-10 gene-

deficient mice develop a primary intestinal permeability defect in response to enteric microflora.

Inflammatory Bowel Diseases 5: 262-270, 1999.

25. Menard S, Candalh C, Bambou JC, Terpend K, Cerf-Bensussan N, and Heyman M. Lactic acid

bacteria secrete metabolites retaining anti-inflammatory properties after intestinal transport. Gut 53:

821-828, 2004.

26. Mitra P, Keese CR, and Giaever I. Electric measurements can be used to monitor the attachment

and spreading of cells in tissue culture. Biotechniques 11: 504-510, 1991.

27. Montalto M, Maggiano N, Ricci R, Curigliano V, Santoro L, Di Nicuolo F, Vecchio FM,

Gasbarrini A, and Gasbarrini G. Lactobacillus acidophilus protects tight junctions from aspirin damage

in HT-29 cells. Digestion 69: 225-228, 2004.

28. Niessner M, and Volk BA. Altered Th1/Th2 cytokine profiles in the intestinal mucosa of patients

with inflammatory bowel disease as assessed by quantitative reversed transcribed polymerase chain

reaction (RT-PCR). Clinical & Experimental Immunology 101: 428-435, 1995.

29. Nusrat A, Turner JR, and Madara JL. Molecular physiology and pathophysiology of tight

junctions. IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune

cells. American Journal of Physiology - Gastrointestinal & Liver Physiology 279: G851-857, 2000.

30. O'Hara AM, and Shanahan F. The gut flora as a forgotten organ. EMBO Reports 7: 688-693,

2006.

31. Oshitani N, Watanabe K, Nakamura S, Fujiwara Y, Higuchi K, and Arakawa T. Dislocation of

tight junction proteins without F-actin disruption in inactive Crohn's disease. International Journal of

Molecular Medicine 15: 407-410, 2005.

32. Petrof EO, Kojima K, Ropeleski MJ, Musch MW, Tao Y, De Simone C, and Chang EB.

Probiotics inhibit nuclear factor-kappaB and induce heat shock proteins in colonic epithelial cells

through proteasome inhibition. Gastroenterology 127: 1474-1487, 2004.

33. Prasad S, Mingrino R, Kaukinen K, Hayes KL, Powell RM, MacDonald TT, and Collins JE.

Inflammatory processes have differential effects on claudins 2, 3 and 4 in colonic epithelial cells.

Laboratory Investigation 85: 1139-1162, 2005.


32

34. Resta-Lenert S, and Barrett KE. Live probiotics protect intestinal epithelial cells from the effects

of infection with enteroinvasive Escherichia coli (EIEC). Gut 52: 988-997, 2003.

35. Seth A, Yan F, Polk DB, Rao RK. Probiotics ameliorate the hydrogen peroxide-induced

epithelial barrier disruptionby a PCK and MAP Kinase dependent mechanism. Am J Physiol 2008.

36. Shen TY, Qin HL, Gao ZG, Fan XB, Hang XM, and Jiang YQ. Influences of enteral nutrition

combined with probiotics on gut microflora and barrier function of rats with abdominal infection. World

Journal of Gastroenterology 12: 4352-4358, 2006.

37. Stallmach A, Giese T, Schmidt C, Ludwig B, Mueller-Molaian I, and Meuer SC.

Cytokine/chemokine transcript profiles reflect mucosal inflammation in Crohn's disease. International

Journal of Colorectal Disease 19: 308-315, 2004.

38. Sydora BC, Tavernini MM, Doyle JS, and Fedorak RN. Association with selected bacteria does

not cause enterocolitis in IL-10 gene-deficient mice despite a systemic immune response. Digestive

Diseases & Sciences 50: 905-913, 2005.

39. Sydora BC, Tavernini MM, Wessler A, Jewell LD, and Fedorak RN. Lack of interleukin-10

leads to intestinal inflammation, independent of the time at which luminal microbial colonization occurs.

Inflammatory Bowel Diseases 9: 87-97, 2003.

40. Tao Y, Drabik KA, Waypa TS, Musch MW, Alverdy JC, Schneewind O, Chang EB, and Petrof

EO. Soluble factors from Lactobacillus GG activate MAPKs and induce cytoprotective heat shock

proteins in intestinal epithelial cells. Am J Physiol Cell Physiol 290: C1018-1030, 2006.

41. Turner JR. Molecular basis of epithelial barrier regulation: from basic mechanisms to clinical

application. American Journal of Pathology 169: 1901-1909, 2006.

42. Ukena S, Singh A, Dringenberg U, Engelhardt R, Seidler U, Hansen W, Bleich A, Bruder D,

Franzke A, Rogler G, Suerbaum S, Buer J, Gunzer F, Westendorf A. Probiotic Escherichia coli Nissle

1917 inhibits leaky gut by enhancing mucosal integrity. PLoS Biology 2: e1308, 2007.

43. Van Itallie CM, and Anderson JM. Claudins and epithelial paracellular transport. Annual Review

of Physiology 68: 403-429, 2006.

44. Wagner RD, Warner T, Roberts L, Farmer J, and Balish E. Colonization of congenitally

immunodeficient mice with probiotic bacteria. Infection & Immunity 65: 3345-3351, 1997.

45. Watson CJ, Hoare CJ, Garrod DR, Carlson GL, and Warhurst G. Interferon-gamma selectively

increases epithelial permeability to large molecules by activating different populations of paracellular

pores. Journal of Cell Science 118: 5221-5230, 2005.


33

46. Xavier R, Podolsky, DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature

448: 427-434, 2007.

47. Yan F, Cao H, Cover TL, Whitehead R, Washington MK, and Polk DB. Soluble proteins

produced by probiotic bacteria regulate intestinal epithelial cell survival and growth. Gastroenterology

132: 562-575, 2007.

48. Zeissig S, Burgel N, Gunzel D, Richter J, Mankertz J, Wahnschaffe U, Kroesen AJ, Zeitz M,

Fromm M, and Schulzke JD. Changes in expression and distribution of claudin 2, 5 and 8 lead to

discontinuous tight junctions and barrier dysfunction in active Crohn's disease.[see comment]. Gut 56:

61-72, 2007.

49. Zyrek AA, Cichon C, Helms S, Enders C, Sonnenborn U, and Schmidt MA. Molecular

mechanisms underlying the probiotic effects of Escherichia coli Nissle 1917 involve ZO-2 and PKCzeta

redistribution resulting in tight junction and epithelial barrier repair. Cellular Microbiology 9: 804-816,

2007.

BiCM 0 5 10 15 30 45 60

Minutes

Phospho‐ERK1,2

Phospho p38

Total ERK1,2

Total p38

Figure 3.

PD98059

pERK1,2

ERK1,2

DMSO

C)A)

B)

BiCM - + - +

ERK1/2

R

atio

Pho

spho

ERK

/Tot

al

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

0 5 10 15 30 45 60 Minutes

0 5 10 15 30 45 60 Minutes

p38

Rat

io p

hosp

hop3

8/To

tal

0.0

0.1

0.2

0.3

0.4

0.5

Claudin 1Claudin 2Claudin 3

Claudin 4

Occludin

ZO-1

Bi CM 0 2 6 24 hrs

β-actin

Figure 4. A) Claudin-1

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.4

0.8

1.2

1.6

B) Claudin-2

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

C) Claudin-3

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.4

0.8

1.2

1.6

2.0

D) Claudin-4

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.4

0.8

1.2

1.6

E) ZO-1

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.1

0.2

0.3

0.4

F) Occludin

B

and

Inte

nsity

(rel

ativ

e to

βac

tin)

0.0

0.4

0.8

1.2

1.6

2.0

0 2 6 24 Hours

0 2 6 24 Hours

0 2 6 24 Hours

0 2 6 24 Hours

0 2 6 24 Hours

0 2 6 24 Hours

IFNγ IFNγ + BiCMTNFα TNFα + BiCM

C BiCM

Claudin-1

Occludin

Figure 6A

Stack size 73 μm x 73 μm

C BiCM TNFα TNFα + IFNγ IFNγ + BiCM BiCM

Claudin‐1

Occludin

β‐actin

BiCM − + − + − +

TNF‐α − − + + − −IFN‐γ − − − − + +

Figure 6B

Occludin

R

elat

ive

Inte

nsity

/ β-a

ctin

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

Claudin-1

Rel

ativ

e In

tens

ity/ β

-act

in

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

C BiCM TNFα TNFα IFNγ IFNγ + + BiCM BiCM

C BiCM TNFα TNFα IFNγ IFNγ + + BiCM BiCM

secreted bioactive factors from bifidobacterium infantis enhance epithelial cell barrier function

Documents