platelet activating factor contributes to bacillus anthracis lethal toxin-associated damage

12
Platelet-activating Factor Contributes to Bacillus anthracis Lethal Toxin-associated Damage * Received for publication, October 4, 2013, and in revised form, January 27, 2014 Published, JBC Papers in Press, January 29, 2014, DOI 10.1074/jbc.M113.524900 Johanna Rivera , Rani S. Sellers § , Wangyong Zeng , Nico van Rooijen , Arturo Casadevall ‡§1 , and David L. Goldman ** 1,2 From the Departments of Microbiology and Immunology, § Medicine (Division of Infectious Diseases), Pathology, and **Pediatrics, Albert Einstein College of Medicine, Bronx, New York 10461 and the Department of Molecular Cell Biology, Vrije Universiteit, 1081 BT Amsterdam, The Netherlands Background: PAF has been implicated as a potent lipid mediator of endotoxin-induced sepsis, but its role in anthrax- associated shock is unknown. Results: Increased serum levels of PAF were present in LeTx-challenged mice. Inhibition of PAF activity prolonged survival ameliorated increased vascular permeability and hepatic necrosis. Conclusion: PAF appears to be a mediator in lethal toxin-associated damage. Significance: PAF antagonists may be helpful as adjunctive therapy for anthrax-associated shock. The lethal toxin (LeTx) of Bacillus anthracis plays a central role in the pathogenesis of anthrax-associated shock. Platelet- activating factor (PAF) is a potent lipid mediator that has been implicated in endotoxin-associated shock. In this study, we examined the contribution of PAF to the manifestations of lethal toxin challenge in WT mice. LeTx challenge resulted in transient increase in serum PAF levels and a concurrent decrease in PAF acetylhydrolase activity. Inhibition of PAF activity using PAF antagonists or toxin challenge of PAF recep- tor negative mice reversed or ameliorated many of the patho- logic features of LeTx-induced damage, including changes in vascular permeability, hepatic necrosis, and cellular apoptosis. In contrast, PAF inhibition had minimal effects on cytokine lev- els. Findings from these studies support the continued study of PAF antagonists as potential adjunctive agents in the treatment of anthrax-associated shock. Severe respiratory distress, shock, multiorgan dysfunction, and bleeding are characteristics of anthrax. Despite the avail- ability of effective anti-microbial therapy, the morbidity and mortality of this disease remains exceedingly high (1), possibly reflecting the action of tissue-damaging toxins. Lethal toxin (LeTx), 3 edema toxin, and anthrolysin O have each been shown to contribute to Bacillus anthracis virulence, though LeTx is considered particularly important (reviewed in Ref. 2). LeTx is a Zn 2 -dependent endoprotease that cleaves MAPK kinases and alters cell signaling. In vitro, LeTx challenge induces rapid lysis of macrophages from susceptible mouse strains (3, 4). Further- more, LeTx challenge reproduces many of the clinical features of anthrax in animal models, and the administration of toxin specific antibody significantly reduces the mortality of experi- mentally B. anthracis-infected animals (5–7). Platelet-activating factor (PAF) is a potent lipid mediator that was originally described in the context of its ability to alter platelet function (8). PAF is produced in response to stimuli by a variety of cell types, including monocytes/macrophages, poly- morphonuclear leukocytes, eosinophils, basophils, platelets, mast cells, vascular endothelial cells, and lymphocytes. This lipid mediator exerts diverse biologic effects and has been implicated in several pathologic conditions including systemic inflammatory response and shock. Elevated serum PAF levels have been reported in septic patients (9, 10), and administration of PAF to animals reproduces many features of shock (11). PAF is rapidly inactivated by serum PAF acetylhydrolase (PAF-AH), and decreased levels of PAF-AH have been noted in patients with anaphylactic and septic shock (12–14). PAF antagonists have been studied as potential therapeutics in endotoxin-medi- ated shock (reviewed in Ref. 15), although initial results have been equivocal (16). Given the overlap in the clinical syndromes induced by LeTx and PAF, we sought to determine whether PAF contributes to the pathologic disturbances induced by LeTx. EXPERIMENTAL PROCEDURES Mice—Wild type female BALB/c (WT) (6 – 8 weeks old) mice were obtained from NCI (Bethesda, MD). Heterozygous breed- ing pairs of PAF receptor deficient BALB/c mice (PAFr / ) were a gift from Dr. Peter Murray (St. Jude Children’s Hospital) (17). Mice were bred to obtain homozygous PAFr / mice in a specific pathogen-free barrier facility at the Animal Institute of Albert Einstein College of Medicine. Genotypes were deter- mined by PCR using tail DNA with the following primers: AMS060, CAGCGACACAATAGGAGTCTG; AMS061, TTT- CGTGTGGATTCTGAGTTTC; and AMS062, CAGCCGAT- TGTCTGTTGTGC. Briefly, a sample of genomic tail DNA was * This work was supported, in whole or in part, by National Institutes of Health Grants AI33774-11, HL59842-07, AI33142-11, and AI52733-02 (to A. C.). This work was also supported by the Northeastern Biodefense Center under Grant U54-AI057158-Lipkin. 1 Both authors should be considered senior authors. 2 To whom correspondence should be addressed: Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Tel.: 718-430-2457; Fax: 718-430-8968; E-mail: [email protected]. 3 The abbreviations used are: LeTx, lethal toxin; PAF, platelet-activating fac- tor; PAF-AH, platelet-activating factor-acetylhydrolase; PAFr / , PAF receptor deficient; PA, protective antigen; LF, lethal factor; MTT, 3-(4,5-di- methyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide; HCT, hematocrit. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 10, pp. 7131–7141, March 7, 2014 © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7131 by guest on February 15, 2016 http://www.jbc.org/ Downloaded from

Upload: independent

Post on 22-Nov-2023

2 views

Category:

Documents


0 download

TRANSCRIPT

Platelet-activating Factor Contributes to Bacillus anthracisLethal Toxin-associated Damage*

Received for publication, October 4, 2013, and in revised form, January 27, 2014 Published, JBC Papers in Press, January 29, 2014, DOI 10.1074/jbc.M113.524900

Johanna Rivera‡, Rani S. Sellers§, Wangyong Zeng¶, Nico van Rooijen�, Arturo Casadevall‡§1,and David L. Goldman‡**1,2

From the Departments of ‡Microbiology and Immunology, §Medicine (Division of Infectious Diseases), ¶Pathology, and**Pediatrics, Albert Einstein College of Medicine, Bronx, New York 10461 and the �Department of Molecular Cell Biology,Vrije Universiteit, 1081 BT Amsterdam, The Netherlands

Background: PAF has been implicated as a potent lipid mediator of endotoxin-induced sepsis, but its role in anthrax-associated shock is unknown.Results: Increased serum levels of PAF were present in LeTx-challenged mice. Inhibition of PAF activity prolonged survivalameliorated increased vascular permeability and hepatic necrosis.Conclusion: PAF appears to be a mediator in lethal toxin-associated damage.Significance: PAF antagonists may be helpful as adjunctive therapy for anthrax-associated shock.

The lethal toxin (LeTx) of Bacillus anthracis plays a centralrole in the pathogenesis of anthrax-associated shock. Platelet-activating factor (PAF) is a potent lipid mediator that has beenimplicated in endotoxin-associated shock. In this study, weexamined the contribution of PAF to the manifestations oflethal toxin challenge in WT mice. LeTx challenge resulted intransient increase in serum PAF levels and a concurrentdecrease in PAF acetylhydrolase activity. Inhibition of PAFactivity using PAF antagonists or toxin challenge of PAF recep-tor negative mice reversed or ameliorated many of the patho-logic features of LeTx-induced damage, including changes invascular permeability, hepatic necrosis, and cellular apoptosis.In contrast, PAF inhibition had minimal effects on cytokine lev-els. Findings from these studies support the continued study ofPAF antagonists as potential adjunctive agents in the treatmentof anthrax-associated shock.

Severe respiratory distress, shock, multiorgan dysfunction,and bleeding are characteristics of anthrax. Despite the avail-ability of effective anti-microbial therapy, the morbidity andmortality of this disease remains exceedingly high (1), possiblyreflecting the action of tissue-damaging toxins. Lethal toxin(LeTx),3 edema toxin, and anthrolysin O have each been shownto contribute to Bacillus anthracis virulence, though LeTx isconsidered particularly important (reviewed in Ref. 2). LeTx is aZn2�-dependent endoprotease that cleaves MAPK kinases andalters cell signaling. In vitro, LeTx challenge induces rapid lysis

of macrophages from susceptible mouse strains (3, 4). Further-more, LeTx challenge reproduces many of the clinical featuresof anthrax in animal models, and the administration of toxinspecific antibody significantly reduces the mortality of experi-mentally B. anthracis-infected animals (5–7).

Platelet-activating factor (PAF) is a potent lipid mediatorthat was originally described in the context of its ability to alterplatelet function (8). PAF is produced in response to stimuli bya variety of cell types, including monocytes/macrophages, poly-morphonuclear leukocytes, eosinophils, basophils, platelets,mast cells, vascular endothelial cells, and lymphocytes. Thislipid mediator exerts diverse biologic effects and has beenimplicated in several pathologic conditions including systemicinflammatory response and shock. Elevated serum PAF levelshave been reported in septic patients (9, 10), and administrationof PAF to animals reproduces many features of shock (11). PAFis rapidly inactivated by serum PAF acetylhydrolase (PAF-AH),and decreased levels of PAF-AH have been noted in patientswith anaphylactic and septic shock (12–14). PAF antagonistshave been studied as potential therapeutics in endotoxin-medi-ated shock (reviewed in Ref. 15), although initial results havebeen equivocal (16). Given the overlap in the clinical syndromesinduced by LeTx and PAF, we sought to determine whetherPAF contributes to the pathologic disturbances induced byLeTx.

EXPERIMENTAL PROCEDURES

Mice—Wild type female BALB/c (WT) (6 – 8 weeks old) micewere obtained from NCI (Bethesda, MD). Heterozygous breed-ing pairs of PAF receptor deficient BALB/c mice (PAFr�/�)were a gift from Dr. Peter Murray (St. Jude Children’s Hospital)(17). Mice were bred to obtain homozygous PAFr�/� mice in aspecific pathogen-free barrier facility at the Animal Institute ofAlbert Einstein College of Medicine. Genotypes were deter-mined by PCR using tail DNA with the following primers:AMS060, CAGCGACACAATAGGAGTCTG; AMS061, TTT-CGTGTGGATTCTGAGTTTC; and AMS062, CAGCCGAT-TGTCTGTTGTGC. Briefly, a sample of genomic tail DNA was

* This work was supported, in whole or in part, by National Institutes of HealthGrants AI33774-11, HL59842-07, AI33142-11, and AI52733-02 (to A. C.).This work was also supported by the Northeastern Biodefense Centerunder Grant U54-AI057158-Lipkin.

1 Both authors should be considered senior authors.2 To whom correspondence should be addressed: Albert Einstein College of

Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Tel.: 718-430-2457; Fax:718-430-8968; E-mail: [email protected].

3 The abbreviations used are: LeTx, lethal toxin; PAF, platelet-activating fac-tor; PAF-AH, platelet-activating factor-acetylhydrolase; PAFr�/�, PAFreceptor deficient; PA, protective antigen; LF, lethal factor; MTT, 3-(4,5-di-methyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide; HCT, hematocrit.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 10, pp. 7131–7141, March 7, 2014© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7131

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

used in PCR with 2.5 mM deoxynucloside triphosphate and 20�M each primer under the following conditions with Taqpolymerase Gold (Applied Biosystems, Foster City, CA): 95 °Cfor 10 min, 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 2.5min for 33 cycles. All animal studies were carried out with pro-tocols approved by the Albert Einstein College of MedicineAnimal Care and Use Committee.

B. anthracis and Toxin Components—B. anthracis Sterne34F2 (pXO1�, pXO2�) was obtained from Dr. Alex Hoffmas-ter at the Centers for Disease Control (Atlanta, GA). Bacterialcultures were grown from frozen stock in brain-heart infusionbroth (Difco, Detroit, MI) at 37 °C for 18 h with shaking.Recombinant protective antigen (PA) and lethal factor (LF)proteins and endotoxin-reduced PA and LF were obtained fromthe Northeast Biodefense Center Expression Core of the NYSDepartment of Health (Albany, NY). Briefly, histidine-taggedPA and LF were expressed in Escherichia coli and purified byaffinity chromatography using a ready to use column prepackedwith precharged high performance nickel-Sepharose (HisTrapHP) (GE Life Sciences). Proteins were further purified by ionexchange (Mono Q) chromatography (GE Life Sciences). LPSmeasurements on these preparations revealed levels of �12.3endotoxin units/ml. To further reduce endotoxin, proteinswere purified by affinity chromatography using Endotrap Blueresin (Hyglos, Chandler, NC), which significantly reduced LPSlevels (0.023 enzyme unit/mg). Studies done with the endotoxinreduced and nonendotoxin reduced preparations gave compa-rable results. All proteins were quantitated using the colorimet-ric Bradford reagent (ThermoScientific Pierce). SDS-PAGEanalysis revealed more than 95% of the protein in one band atmolecular masses of 83 kDa (PA) and 89 kDa (LF).

PAF Antagonists—CV3988, WEB 2086, and quinacrine weresolubilized in ethanol and diluted in either PBS or normal salineand administered at doses of 3 and 5 mg/kg. Ginkgolide B wassolubilized in DMSO, diluted in PBS, and administered at adose of 5 mg/kg. CV3988 and WEB 2086 are competitive PAFreceptor antagonists. Ginkgolide B accelerates PAF degrada-tion by promoting PAF-AH I �2 homodimer activity andquinacrine inhibits PAF synthesis. For hematocrit studies,PAF antagonists were administered at 5 mg/kg intravenously1 h prior to toxin challenge. All antagonists except quina-crine (Sigma) were obtained from Enzo Life Science (Farm-ingdale, NY).

Macrophage Depletion—Dichloromethylene bisphospho-nate (CL2MBP), also known as clodronate, was a gift fromRoche and was encapsulated in liposomes as previouslydescribed (41). Liposome clodronate selectively depletesmacrophages after intravenous administration (5, 41). Clodro-nate liposomes and PBS liposomes were given to WT mice (n �6 per group) �48 h prior to toxin challenge. To confirm macro-phage depletion, mice (n � 3 per group) were given 0.1 ml ofclodronate liposomes or PBS liposomes intravenously. Twodays later, the mice were sacrificed, the spleens and livers wereremoved, and cells were prepared for FACS analysis. Briefly, thecells (106) were stained for 30 min on ice with 100 �l of thefollowing antibodies diluted in staining buffer (1% FCS/PBS): 2�g/ml of R-phycoerythrin-labeled anti-CD45 and 5 �g/ml ofFITC-labeled anti-mouse MAC-3 (Pharmingen, San Diego,

CA). The samples were washed twice in staining buffer andfixed in 1% paraformaldehyde. Stained samples were stored inthe dark at 4 °C overnight and analyzed on a Calibur FACscanflow cytometer (Becton Dickinson, Mountainview CA) usingthe CELLQuest (Becton Dickinson) software. Live cells weregated as judged from forward and side laser scatter andCD45� cells. Controls consisted of isoptype-matched irrel-evant antibodies.

Survival Studies—WT and PAFr�/� mice (n � 10 per group)were injected into the tail vein with 120 �g of PA and 50 �g ofLF in 100 �l of PBS as described (7). For some experiments,mice (n � 10 per group) were infected intravenously with 106

B. anthracis Sterne bacterial cells. For some experiments, WTmice were treated with 3 mg/kg CV3988 or WEB 2086 (n � 5per group) 2 h prior to LeTx injection. Control mice receivedPBS (n � 5 per group). The mice were monitored daily formortality.

PAF Measurements—WT mice were challenged with LeTx(120 �g of PA and 50 �g of LF) intravenously and euthanized at30 min, 2 h, and 16 h. Mice were bled from the retroorbitalsinus, and serum was collected and stored at �20 °C untiltested. The mice were then sacrificed, and the liver wasremoved and homogenized in 2 ml of PBS in the presence ofprotease inhibitors (Complete Mini; Roche Applied Science).Homogenates were centrifuged at 2000 � g for 10 min toremove cell debris, and the supernatant was frozen at �80 °Cuntil tested. PAF measurements were using ELISA kit for PAF(Cedarlane Laboratories (USCN Life Science), Burlington, NC)as per the manufacturer’s instructions. Briefly, samples wereadded into 96-well plate, 50 �l of detection reagent A was thenadded, and the plate was incubated for 1 h at 37 °C. ELISA platewas then washed 3� with wash solution, and 100 �l of detec-tion reagent B was added. The plate was then incubated for 30min at 37 °C, washed 3� with wash solution, and 90 �l of sub-strate solution was then added. The plates were again incubatedfor 25 min at 37 °C. Stop solution (50 �l) was added to each welland immediately read at 450 nm (Labsystems Multiskan,Franklin, MA). Average values were obtained, and calculationsof results were done based on the standard curve.

PAF Acetylhydrolase Measurements—PAF-AH activity wasmeasured as per the manufacturer’s instructions (Cayman, AnnArbor, MI). Briefly, 10 �l of 5,5�-dithiobis(nitrobenzoic acid),10 �l of sample, and 5 �l of PAF-AH assay buffer were added toa 96-well plate. The reactions were initiated by adding 200 �l of2-thio PAF substrate solution. Absorbance was read everyminute for 10 min at 405 nm (Labsystems Multiskan, Franklin,MA) to obtain 10 time points.

Histology—WT and PAFr�/� mice were evaluated histolog-ically after intravenous PBS or LeTx treatment at 2 h (n � 3 pergroup) and 24 or 48 h (n � 5 per group). The mice were eutha-nized at 2, 24, or 48 h post-LeTx injection. Lung, liver, andspleen were isolated and fixed in 10% neutral buffered formalin(Fisher Scientific). One animal from each the 24-h and 48-hdose groups had a full tissue evaluation (liver, kidney, spleen,heart, lungs, adrenal glands, bone marrow, thymus, brain, skel-etal muscle, nerve, small and large intestines, bladder, pancreas,submandibular salivary glands, and lymph nodes). Tissues wereprocessed for paraffin embedding, and histological sections of 5

Platelet-activating Factor and Anthrax

7132 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 10 • MARCH 7, 2014

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

�m were stained with hematoxylin and eosin. Sections wereevaluated by a board-certified veterinary pathologist in ablinded manner.

Apoptosis Studies—Apoptosis was studied by examination ofnuclear and cellular morphology in tissue sections stained withhematoxylin and eosin. Additional tissue samples were stainedfor cleaved caspase 3. Briefly, 5-�m sections were deparaf-finized in xylene followed by graded alcohols. Antigen retrievalwas performed by incubating sections in 10 mM sodium citratebuffer (pH 6.0) and heated to 96 °C for 20 min. Endogenousperoxidase activity was quenched using 3% hydrogen peroxidein PBS for 10 min. Sections were blocked with 5% normal don-key serum and 2% BSA in PBS for 1 h. The primary antibody tocleaved caspase 3 (Cell Signaling, Danvers, MA) was used at1:50 for 1 h at room temperature. The primary species (rabbitIgG1) was substituted for the primary antibody to serve as anegative control. Sections were stained by routine immunohis-thochemistry methods using HRP polymer conjugate (Invitro-gen) to localize the antibody bound to antigen with diamino-benzidine as the final chromogen. All immunostained sectionswere lightly counterstained with hematoxylin.

Pulmonary Function Analysis—Whole body plethysmogra-phy (Buxco Electronics, Inc., Wilmington, NC) was used tomeasure respiratory parameters including tidal volume, respi-ratory rate, inspiratory, and expiratory time by monitoring thebox flow pattern created by the animal’s respiration (18 –20).Unrestrained mice (n � 4 –5 per group) were placed in anenclosed chamber, and baseline readings were taken over aperiod of 3–5 min before intravenous injections of LeTx. Addi-tional lung function measurements were taken at various timeintervals after LeTx injection.

Hematocrit Measurements—WT and PAFr�/� mice (n �5– 6 per group) were challenged with LeTx or PBS intrave-nously and then bled from the retroorbital sinus using heparin-ized microhematocrit capillary tubes (Fisher Scientific). Tubeswere sealed with Hemato-Seal (Fisher Scientific) and spun inmicrocapillary centrifuge (Fisher Scientific) for 5 min. Hemat-ocrits were measured by determining the red blood cell volumerelative to the volume of whole blood.

Evans Blue Extravasation—A 100 �l of intraperitoneal injec-tion of 0.22-�m filtered 10 mg/ml Evans blue PBS was admin-istered 45 min prior to LeTx injection. For some experiments,WEB 2086 (3 mg/kg) was administered 2 h prior to LeTx injec-tion. The mice were sacrificed and perfused with 30 ml PBS.Lungs were removed and homogenized in 1.5 ml of PBS. Toextract the dye, TCA (60%) was added to each sample, vortexed,and centrifuged (1000 � g) for 30 min at 4 °C. Optical densitiesof the supernatants were measured at 620 nm (Labsystem Mul-tiskan, Franklin, MA).

Biochemical Profile—After challenge with LeTx (24 hpostchallenge), WT and PAFr�/� mice (n � 5 per group) werebled from the retroorbital sinus by use of heparinized microhe-matocrit capillary tubes (Fisher Scientific). Serum was then sep-arated and sent to a commercial veterinary laboratory (AntechDiagnostics, Lake Success, NY) for standard mammalian chem-istry and liver function tests.

Cytokine and Chemokine Studies—WT and PAFr�/� mice(n � 6 per group) were sacrificed 2 and 24 h post-intravenous

injection of LeTx or PBS. The mice were sacrificed, and thelungs were homogenized in 2 ml of PBS in the presence ofprotease inhibitors (Complete Mini; Roche Applied Science).Homogenates were centrifuged at 2000 � g for 10 min toremove cell debris, and the supernatant was frozen at �80 °Cuntil tested. Supernatants were assayed using mouse cytokineprotein array I (Ray Biotech, Norcross, GA) as per the manu-facturer’s instructions. Briefly, membranes were blocked with1� blocking buffer, washed three times, and then incubatedwith samples. Membranes were washed again and incubated for1 h with biotin-conjugated cytokines, which were detected byincubation with HRP-conjugated streptavidin. All incubationswere done at 37 °C for 1 h. Unbound reagents were removed bywashing and the membranes developed. This kit assays for thefollowing cytokines: GCSF, GM-CSF, IL-2, IL-3, IL-4, IL-5,IL-6, IL-9, IL-10, IL-12, IL-13, IL-17, IFN-�, MCP-1, MCP-5,RANTES, SCF, sTNFRI, TNF-�, and thrombopoietin. Super-natants were also assayed for IL-2, IL-4, IL-6, IL-10, MCP-1,and MIP-1� concentrations using ELISA kits (Pharmingen, SanDiego, CA and R&D Systems Inc., Minneapolis, MN). Thedetection limits of cytokine assays are 3.1 pg/ml for IL-2, 7.8pg/ml for IL-4, 15.6 pg/ml for IL-6 and TNF-�, and 31.3 pg/mlfor IL-10 and IFN-� as stated by the manufacturer. The detec-tion limits of the chemokine assays are 4.7 pg/ml for MIP-1�and 15.6 pg/ml for MCP-1 as determined by the manufacturer.

Macrophage and Hepatocyte Isolation—Peritoneal macro-phages were isolated from mice (PAFr�/� and WT) by perito-neal lavage without prior peritoneal irritation. Briefly, theabdominal cavity was washed five times with sterile Hanks bal-anced salt solution, 1% penicillin-streptomycin, 0.1 mM EGTA(Fisher Scientific) using a sterile Pasteur pipette. Following cen-trifugation, erythrocytes were lysed by resuspension in ice-cold0.17 M NH4Cl for 10 min. A 10-fold excess of DMEM solutionwas then added to make the solution isotonic, the cells werecollected by centrifugation, and live cells (trypan blue exclusionand morphological examination) were counted in a hemocy-tometer chamber. The cells were suspended in DMEM (Invit-rogen), 10% NCTC-109 medium, 1% penicillin-streptomycin,and 1% nonessential amino acids (Mediatech, Inc, Manassas,VA). Cells were plated at a density of 1 � 106 cells/well in a96-well tissue culture plate and incubated overnight at 37 °C.Primary mouse hepatocytes were isolated from WT andPAFr�/� mice as described with minor modifications (21).

MTT Assay—MTT (Sigma) assay was used to determineLeTx toxicity to peritoneal macrophages and primary hepato-cytes as described (22). Macrophages (106) and hepatocytes(5 � 104) per well were incubated in a 96-well plate with LeTxfor 4 h at 37°C. Dose-response experiments were done. All wellswere plated in duplicates. Macrophage supernatants wereremoved for PAF measurements as described above. A 25-�lvolume of 5 mg/ml stock-solution of MTT (in sterile PBS)was then added to each well and after 2 h of incubation of37 °C, 100 �l of the extraction buffer (12.5% SDS, 45% DMF)was added, and cells were incubated overnight at 37 °C.Optical densities were measured at 570 nm (Labsystem Mul-tiskan, Franklin, MA).

Statistics—For parametric data, individual comparisons weredone using a Student’s t test. Multiple comparisons were done

Platelet-activating Factor and Anthrax

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7133

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

with an ordinary one-way analysis of variance, and post hocanalyses were done with a Dunnett multiple comparison test.For nonparametric data, individual comparisons were done with aMann-Whitney test. Multiple comparisons were done using theKruskal-Wallis test, and post hoc analyses were done with theDunn test. Survival curves were compared by log rank analysis(Graphpad Prism; GraphPad Software, Inc., La Jolla, CA). Allvariance listed is standard deviation.

RESULTS

PAF and PAF-AH Activity—Serum and liver levels of PAFwere measured several times after injection of LeTx. At 30 min,serum from WT mice challenged with LeTx contained higheramounts of PAF (48 ng/ml 30.2 ng/ml) compared with PBS-treated mice (15 ng/ml 2.7 ng/ml) (p � 0.05). In addition,serum PAF levels at 2 and 16 h were not significantly differentbetween mice treated with LeTx and controls (data not shown).Administration of LeTx did not affect PAF levels in the liver(Fig. 1B). Serum PAF-AH activity was significantly lower inLeTx-treated mice (129 24 �mol/min/ml) compared withPBS-treated (155 22 �mol/min/ml) and untreated mice(178 18 �mol/min/ml) (p � 0.05) (Fig. 1C). There were nodifferences in serum PAF-AH activity between PBS-treated andPA-treated mice (data not shown).

PAF levels were measured in the supernatants of WT perito-neal macrophages at several times (15, 30, 60, 90, and 120 min).LeTx (100 ng of PA � 100 ng of LF) increased PAF levels as earlyas 15 min (271.7 57 pg/ml), after exposure when comparedwith untreated macrophages (191.3 12.5 pg/ml, p � 0.05).PAF levels remained elevated at later times relative to untreatedmacrophages: 30 min (294.5 4.04 pg/ml), 60 min (308.7 4.37 pg/ml), 90 min (228.6 10.8 pg/ml), and 120 min (290.6 25.3 pg/ml) (p � 0.05). Additionally, the increases in PAF levelswere independent of cell death (data not shown).

Survival and Illness—WT but not PAFr�/� mice, injectedwith LeTx were ill (rough hair coat, dehydrated, depressed, andhunched posture) by 24 h. PAFr�/� mice injected with LeTxsurvived longer (median survival time, 4 days) than WT mice(median survival time, 1 day) but still exhibited significant mor-tality over a 10-day period (Fig. 2A). Additionally, PAFr�/�

mice infected with B. anthracis Sterne bacterial cells survivedlonger (median survival time, 10.5 days) compared with WT

mice (median survival time, 6 days) (Fig. 2B). PAFr antagonists,CV3988 (median survival time, 5 days), and WEB 2086 (only 2deaths in an 11-day period) provided a survival benefit to WTchallenged with LeTx compared with PBS-treated WT mice(median survival time, 2 days) (Fig. 2C).

Because macrophages play a central role in LeTx pathogen-esis and produce PAF (23, 24), we investigated the possibilitythat macrophage depletion would provide protection againstlethal toxicity. Macrophage depletion by administration of clo-dronate liposomes provided a survival benefit to WT mice(median survival, 6 days) from LeTx-induced death comparedwith WT mice treated with PBS liposomes (median survival, 1day) (p � 0.05) (Fig. 2D).

Hematocrit—Administration of LeTx to WT mice resulted inan average 11% increase in HCT compared with PBS-treatedmice, 2 h following LeTx injection (Fig. 3A). This increase inHCT was still present at 6 h following LeTx injection. However,at 24 h WT mice manifested a 42% decrease in HCT comparedwith mice injected with PBS (Fig. 3B). Administration of somePAF antagonists (CV3988 and WEB 2086), but not others(quinacrine and ginkgolide B) ameliorated, but did notentirely prevent, the increase in HCT produced by LeTxinjection at 2 h (Fig. 3C). No effects on HCT by antagonistsin the absence of LeTx were observed (data not shown). Inaddition, PAFr�/� mice experienced smaller changes inHCT at 2 and 24 h in response to LeTx when compared withWT mice (Fig. 3, A and B).

Respiratory Function—Within 1.5 h of LeTx injection, WTmice developed labored breathing. Visible changes in breathingcorrelated with changes in respiratory function as measured bywhole body plethysmography, including a greater than 50%decrease in respiratory rate and a 20% decline in tidal volume(Fig. 4A). Inspiratory and expiratory times were also markedlyprolonged (Fig. 4B). Mice that showed improved respiratoryparameters by 24 h generally recovered, whereas animals withpersistent respiratory compromise generally died within 24 h(data not shown). In contrast to hematocrit studies, we wereunable to demonstrate an effect of the PAF antagonist WEB2086 on respiratory parameters (data not shown). Further-more, PAFr�/� mice still developed alterations in respira-tory function in response to LeTx, although tidal volume and

FIGURE 1. In vivo PAF measurements following LeTx injection. A, WT mice (n � 4 – 6) were injected intravenously with LeTx (120 �g of PA and 50 �g of LF)and sacrificed 30 min post-injection. Serum from LeTx-treated WT mice contained significantly higher amounts of PAF (p � 0.05) compared with PBS-treatedWT mice. No differences were detected in serum PAF levels of untreated and PA-treated WT mice compared with PBS-treated mice (p 0.05). B, no differenceswere detected in PAF levels in the livers of untreated and PBS- or LeTx-treated WT mice. C, serum from LeTx-treated WT mice contained lower amounts ofPAF-AH (*, p � 0.031) compared with untouched and PBS-treated WT mice. The lines represent medians for experimental groups. Statistical analyses were doneusing the Kruskal-Wallis test, and post hoc analyses were done using the Dunn multiple comparison test.

Platelet-activating Factor and Anthrax

7134 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 10 • MARCH 7, 2014

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

peak expiratory flow were not as affected compared with WTmice (Fig. 4C).

Biochemical Profile Studies—WT mice exhibited a dose-de-pendent increase in serum glutamic oxaloacetic transaminase(SGOT) and serum glutamate pyruvate transaminase (SGPT)levels (Fig. 5A) that did not occur in PAFr�/� mice (Fig. 5B) at24 h post-LeTx challenge. WT mice, but not PAFr�/� mice,injected with LeTx also exhibited a dose-dependent increase inblood urea nitrogen and a decrease in serum albumin concen-tration, also consistent with volume loss (Fig. 5, C and D).

Evans Blue Extravasation—Vessel leakage as manifested bythe increase in absorbance readings was present in WT micetreated with LeTx compared with PBS-treated WT mice (p �0.05) (Fig. 6). This effect was ameliorated by the PAFr antago-nist, WEB 2086 (Fig. 6). In contrast, no increases in absorbancewere noted for LeTx-treated PAFr�/�mice when comparedwith PBS-treated PAFr�/� mice (p � 0.23), although the back-ground for PAFr�/� mice was higher than for WT mice (A600:PBS, 0.541 0.12; LeTx, 0.661 0.07).

LeTx-related Histological Findings—Two hours after LeTxchallenge, there were minimal inflammatory changes. Severalhistologic findings were common to WT and PAFr�/� mice,including the presence of small cells with condensed nuclei sug-gestive of apoptotic cells within blood vessels in bone marrowand lung (data not shown). Loss of red blood cells within the redpulp was noted, consistent with splenic contracture (Fig. 7, Aand B), which is consistent with a physiologic response to vol-ume loss. The lungs of WT and PAFr�/� mice also hadincreased alveolar capillary cellularity and minimal acutefibrinous pneumonitis (data not shown).

Twenty-four hours after LeTx challenge, WT mice exhibitedhepatic necrosis that was widespread, with a centrilobular to

midzonal distribution (Fig. 7C, panel i). In contrast, PAFr�/�

mice did not have evidence of liver necrosis (Fig. 7C, panel ii).Other findings were generally similar to those identified at 2 h(circulating micronucleated/apoptotic cells) and splenic con-tracture without significant differences between WT andPAFr�/� mice. At 24 h, significant lymphocytic apoptosis wasevident in the spleen of WT (Fig. 7C, panel iii) and PAFr�/�

mice.Apoptosis Studies—Examination of the bone marrow and

lung of LeTx-challenged PAFr�/� mice revealed negative stain-ing for cleaved caspase 3 (Fig. 8, A and C). In contrast, numer-ous cells were positive for cleaved caspase 3 in the bone marrowand lungs of LeTx-challenged WT mice (Fig. 8, B and D). Neg-ative staining for cleaved caspase 3 was noted in PBS-treatedWT and PAFr�/� mice (data not shown).

Cytokine Expression—Given the role of PAF in systemicinflammatory response, we investigated cytokine/chemokineexpression in response to LeTx. Twenty-four hours after LeTxinjection, alterations in cytokine/chemokine expression wereobserved in the lungs of mice (WT and PAFr�/�) by cytokinearray (Fig. 9A). At 24 h, WT and PAFr�/� mice challenged withLeTx exhibited increased expression of MCP-1 and RANTEScompared with mice injected with PBS (Fig. 9, A and B). Thisinduction was confirmed by ELISA studies (Fig. 9B and data notshown). In addition, WT and PAFr�/� mice injected with LeTxexhibited a small, but statistically significant decrease in solubleTNFR-1 expression relative to PBS-injected counterparts.IL-12 expression was only detected in PAFr�/� WT miceinjected with LeTx. MIP-1� induction was not detected follow-ing LeTx injection (data not shown).

Cellular Toxicity—To determine whether survival differ-ences among WT and KO mice were related to differences in

FIGURE 2. Survival following LeTx injection. A, WT and PAFr�/� mice were intravenously injected with LeTx (120 �g of PA and 50 �g of LF). PAFr�/� micesurvived significantly longer than WT mice with median survival times of 4 and 1 days, respectively. B, PAFr�/� mice infected with B. anthracis Sterne strainsurvived significantly longer than WT mice with a median survival of 10.5 and 6 days, respectively (p � 0.05). C, administration of PAF inhibitors CV3988 (p �0.002) and WEB 2086 (p � 0.02) to mice before LeTx injection resulted in prolonged survival compared with PBS-treated mice. D, macrophage depletion of WTmice with clodronate liposomes resulted in prolonged survival compared with controls with median survival times of 6 and 1 days, respectively (p � 0.05). Forall experiments, n � 10 per group. Survival curves were compared by log rank analysis.

Platelet-activating Factor and Anthrax

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7135

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

macrophage susceptibility to LeTx, in vitro macrophage exper-iments were performed. Peritoneal macrophages isolated fromWT and PAFr�/� mice exhibited a dose-dependent decrease inMTT signal in response to LeTx treatment. However, therewere no differences between WT and PAFr�/� mousemacrophage susceptibility to LeTx at all concentrationstested (data not shown). At a LeTx concentration of 1 �g/ml,there were 29 and 31% decreases in MTT signal for WT andPAFr�/� mouse macrophages compared with cells treatedwith media alone (data not shown). In contrast, LeTx did notaffect viability of hepatocytes isolated from WT mice (datanot shown).

DISCUSSION

PAF is induced during inflammation by both exogenous (e.g.,LPS, HIV infection) and endogenous stimuli and is an activemediator of inflammation (25–27). In animal models, many ofthe features of endotoxin-induced shock can be reproduced byPAF injections (28). Our findings demonstrate that serum PAFlevels are transiently increased in response to LeTx challenge inWT mice. Our findings are consistent with recent studies thatreveal a rapid induction of inflammatory lipid mediators byLeTx-mediated activation of the inflammasome (29). In addi-tion, our studies suggest that PAF contributes to the mortalityof LeTx in WT mice because PAFr�/� mice and WT micetreated with PAF receptor antagonists exhibited prolonged sur-vival. We also observed that increased serum PAF levels corre-

FIGURE 3. Effects of LeTx on HCT. A and B, average HCT of WT and PAFr�/�

mice 2 h (A) and 24 h (B) after LeTx (120 �g of PA and 50 �g of LF) injection(n � 5 per group). Brackets denote standard deviation. Experiments weredone in separate sets of mice and repeated with comparable results. *, p �0.05 for comparison with control; **, p � 0.05 for comparisons between WTand PAFr�/� mice. C, HCT in WT mice treated with PAF antagonists prior toLeTx injection. HCT were measured 2 h following LeTx injection. *, p � 0.05 forcomparison between animals pretreated with PAF antagonist versus PBSprior to LeTx challenge. For individual comparisons (A and B), a Mann-Whit-ney test was used. For multiple comparisons (C), the Kruskall-Wallis test wasused, and post hoc analyses were done using the Dunn multiple comparisontest.

FIGURE 4. Effects of LeTx injection on pulmonary function. Respiratoryfunctions were measured using whole body plethysmography in unre-strained mice (n � 4 per group) at baseline and 1.5 h after injection LeTx (120�g of PA and 50 �g of LF). WT mice challenged with LeTx exhibited shallowand slower breathing compared with baseline. A, bars show the average per-cent decreases from baseline for different respiratory functions followingLeTx injection. B, bars show the average percent increase for inspiratory andexpiratory times. Brackets denote standard deviation. All changes shown arestatistically significant from baseline. C, WT and PAFr�/� mice developedchanges in respiratory function compared with baseline. However, decreasesin tidal volume and peak expiratory flow were less prominent for PAFr�/�

compared with WT mice. Bars represent the average percent decrease in res-piratory rate, tidal volume, peak inspiratory flow, and peak expiratory flow.Bars denote averages of n � 4 –5 mice, and brackets denote standard devia-tion WT (*, p � 0.05). FREQ, respiratory rate; TV, tidal volume; PIF, peak inspira-tory flow; PEF, peak expiratory flow; Ti, inspiratory time; Te, expiratory time.Statistical analyses were done using a Mann-Whitney test.

Platelet-activating Factor and Anthrax

7136 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 10 • MARCH 7, 2014

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

lated with a decrease in PAF-AH activity. PAF-AH is theenzyme primarily responsible for the degradation of PAF,normally limiting the half-life of PAF to minutes. Thus,decreased activity could result in increased PAF levels in ourexperiments. The magnitude of the observed decrease in

PAF-AH in response to LeTx in WT mice is similar to thatdescribed in endotoxin challenged gerbils and comparable tothe decreased activity observed in critically ill patients onpresentation (30, 31).

Early studies linked LeTx susceptibility in mice to macro-phage toxicity, although more recent studies dispute this asso-ciation (32). The effects of LeTx on macrophage viability aremediated by the NOD-like receptor sensor, NLRP1, and relatedto inflammasome assembly and caspase-1 activation (33–35).Our results suggest that PAF produced by macrophages con-tributes to LeTx-related pathology. In this regard, macrophagesfrom WT and PAFr�/� mice were both susceptible to LeTx-induced death. Furthermore, macrophage depletion providedsurvival benefits to WT mice from LeTx-induced death. There-fore, we hypothesize that LeTx-induced macrophage damagecontributes to increased PAF levels, either directly from macro-phages or from other cells in response to macrophage damage.

To understand the contribution of PAF in disease followingLeTx challenge in a toxin-susceptible mouse strain, we per-formed a variety of physiologic and biochemical studies. Severalof the clinical features of anthrax (e.g., pleural effusions, hemo-concentration, and bleeding) indicate significant alterations invascular permeability. Many of these features can be repro-duced by LeTx injections in animal models (36, 37). FollowingLeTx challenge, we observed several features consistent withincreased vascular permeability in WT mice including hemo-concentration, respiratory distress, increased serum bloodurine nitrogen, and decreased protein levels. Furthermore,

FIGURE 5. Effects of LeTx on Biochemical profile. The effects of LeTx on liver function and serum chemistry for WT (A and C) and PAFr�/� mice (B and D) areshown. Liver toxicity was assayed by changes in serum aspartate (SGOT), alanine transaminase (SGPT), and alkaline phosphate (AP) levels. Serum chemistry testsincluded blood urine nitrogen (BUN) and total protein (TPR). Mice were injected intravenously with 120 �g of PA and 50 �g of LF or with 60 �g of PA and 25 �gof LF. *, p � 0.05. The legend applies to all panels. Statistical analyses were done using the Kruskal-Wallis test, and post hoc analyses were done using the Dunnmultiple comparison test.

FIGURE 6. Evans blue extravasation. Vascular permeability was measured inWT mice by Evans blue extravasation. WT mice treated with LeTx had higherabsorbance readings compared with PBS-treated WT mice (p � 0.05). WTmice treated with WEB 2086 prior to LeTx injection had lower absorbancereadings. n � 4 – 6 mice. Statistical analyses were done using the Kruskal-Wallis test, and post hoc analyses were done using the Dunn multiple com-parison test.

Platelet-activating Factor and Anthrax

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7137

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

LeTx-challenged mice also exhibited splenic contracture,which is likely a physiologic response to volume loss in thiscontext.

The basis by which LeTx enhances vascular permeability ispoorly understood. Incubation of endothelial cells with LeTxresulted in apoptosis and altered function in some studies (38,39). Furthermore, LeTx-induced macrophage death has beenreported to augment apoptotic death of endothelial cells (40).We found that some (e.g., hemoconcentration and increasedserum blood urine nitrogen levels) but not all of the changesindicative of vascular permeability in WT mice were partiallyameliorated by the administration of PAF antagonists and inPAFr�/� mice. These effects on vascular permeability wereconfirmed with Evans blue studies. Overall, we interpret thesefindings as suggestive that PAF contributes to, but is notentirely responsible for, the changes in vascular permeabilityinduced by LeTx. PAF is well known to alter endothelial func-tion, and these effects may be related to direct effects (41) ormacrophage and endothelial cell activation (42, 43).

Extensive apoptosis following LeTx was present in a varietyof organs and cell types, including endothelial cells. In contrast,apoptosis was dramatically reduced in PAFr�/� mice. The pat-tern of LeTx-induced macrophage death has been related topolymorphisms in Nalp1b and the macrophage activation state(33). Typically, macrophages from sensitive BALB/c miceundergo lysis and not apoptosis in response to LeTx (35, 44),although apoptosis may occur in the context of sublytic levels of

FIGURE 7. Histology of WT and PAFr�/� mice following LeTx injection. A, normal spleen architecture with large numbers of red blood cells was present inthe red pulp in mice treated with PBS. B, spleens from mice challenged with LeTx exhibited normal splenic architecture, but loss of red blood cells within thered pulp consistent with splenic contraction. The original magnification for A and B was 10�. C, at 24 h following LeTx (120 �g of PA and 50 �g of LF) challenge,WT (panel i) but not PAFr�/� mice (panel ii) exhibited centrilobular hepatic necrosis following LeTx challenge. The original magnification was 40�. At 24 hfollowing LeTx injection, WT (panel iii) and PAFr�/� mice exhibited apoptotic cells (boxes) within the spleen. The original magnification was 20�. Arrows pointto apoptotic cells (fragmented nucleus).

FIGURE 8. Cleaved caspase 3 studies of WT and PAFr�/� mice followingLeTx injection. WT and PAFr�/� mice were injected intravenously with LeTx(120 �g of PA and 50 �g of LF). Bone marrow (A) and lung (C) of PAFr�/� didnot exhibit positive cells for cleaved caspase 3. Examination of bone marrow(B) and lung (D) of WT mice revealed numerous positive cells for cleavedcaspase 3. Magnification was 40�.

Platelet-activating Factor and Anthrax

7138 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 10 • MARCH 7, 2014

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

toxin (45). Endothelial cell apoptosis has also been described inHUVEC cells by some but not all investigators (38, 39, 46).Interestingly, PAF was shown to promote apoptosis in a varietyof cell types including neurons, corneal cells, and tumors (47–50). Additional study will be needed to determine the role ofPAF in LeTx-induced apoptosis.

PAF can induce many of the cellular pathways involved ininflammation and shock, including superoxide production,lymphocyte and neutrophil migration, mast and basophildegranulation, and NF-�B activation (reviewed in Refs. 51 and52). However, the role of cytokine storm in LeTx-induced dam-age is not clear (53). We observed little LeTx-mediated induc-

tion of inflammatory cytokines in our mouse studies at 2 or24 h, with minimal differences between WT and PAFr�/� mice.

We found that LeTx challenge produced substantial centri-lobular hepatic necrosis (as evidence by an increase in serumtransaminase levels and histologic studies), which was PAFreceptor-dependent. Hepatic necrosis in response to LeTx waspreviously described in mice (53) and was also reported in theautopsy series of human anthrax cases associated with the Sver-dlovsk epidemic (54). In murine studies, necrosis did not cor-relate with inflammatory cytokine changes, nor was it depen-dent on the presence of FASL, but it did correlate with evidenceof tissue hypoxia (53). The presence of widespread centrilobu-lar hepatocellular necrosis in our studies is consistent with vas-cular insufficiency, although centrilobular necrosis may alsooccur in the context of a variety of intoxications. PAF has beenreported to play a role in hepatic necrosis induced by both tox-ins (acetaminophen and ethanol) and ischemia (55–57). In ani-mal studies, PAF infusions have been shown to increase hepaticglycogenolysis (58, 59) and induce vasoconstriction resulting inliver hypoxia (60). Both these effects have been linked to PAF-induced prostaglandin synthesis (58, 60).

In summary, our results implicate PAF in the toxic effects ofB. anthracis LeTx, especially as it relates to alterations in vas-cular permeability and hepatotoxicity. PAF appears to play arole downstream of macrophage death specifically in BALB/cmice. Extrapolations of findings from mice to humans must bedone cautiously and judiciously, especially because humanmacrophages/monoctyes are more displayed decreased suscep-tibility to experimental infection. Our findings suggest the pos-sibility that PAF antagonists may be helpful as an adjunctivetherapy for anthrax. Given the high mortality associated withanthrax-associated shock despite antimicrobial therapy andsupportive therapy, additional study of PAF antagonists iswarranted.

Acknowledgment—We thank Dr. David Neufeld for preparation ofprimary mouse hepatocytes.

REFERENCES1. Centers for Disease Control (2001) Update. Investigation of bioterrorism-

related anthrax and interim guidelines for exposure management and an-timicrobial therapy. MMWR Morb. Mortal. Wkly. Rep. 50, 909 –919

2. Moayeri, M., and Leppla, S. H. (2009) Cellular and systemic effects ofanthrax lethal toxin and edema toxin. Mol. Aspects Med. 30, 439 – 455

3. Friedlander, A. M. (1986) Macrophages are sensitive to anthrax lethaltoxin through an acid-dependent process. J. Biol. Chem. 261, 7123–7126

4. Chopra, A. P., Boone, S. A., Liang, X., and Duesbery, N. S. (2003) Anthraxlethal factor proteolysis and inactivation of MAPK kinase. J. Biol. Chem.278, 9402–9406

5. Brossier, F., Lévy, M., Landier, A., Lafaye, P., and Mock, M. (2004) Func-tional analysis of Bacillus anthracis protective antigen by using neutraliz-ing monoclonal antibodies. Infect. Immun. 72, 6313– 6317

6. Migone, T. S., Subramanian, G. M., Zhong, J., Healey, L. M., Corey, A.,Devalaraja, M., Lo, L., Ullrich, S., Zimmerman, J., Chen, A., Lewis, M.,Meister, G., Gillum, K., Sanford, D., Mott, J., and Bolmer, S. D. (2009)Raxibacumab for the treatment of inhalational anthrax. N. Engl. J. Med.361, 135–144

7. Rivera, J., Nakouzi, A., Abboud, N., Revskaya, E., Goldman, D., Collier,R. J., Dadachova, E., and Casadevall, A. (2006) A monoclonal antibody toBacillus anthracis protective antigen defines a neutralizing epitope in do-

FIGURE 9. Differences in cytokine and chemokine expression induced byLeTx challenge in WT and PAFr�/� mice. Cytokine and chemokine levels inlung were measured using mouse cytokine protein array 24 h post-LeTx (120�g of PA and 50 �g of LF) challenge. A, graph shows intensity of expression forindividual cytokines/chemokines relative to an internal standard. B, arrayblots show reactivity for corresponding cytokines/chemokines. C, ELISAexperiments revealed induction of MCP-1 in the lungs of WT and PAFr�/�

mice following LeTx injection. n � 6; PBS: n � 3. Bars denote mean cytokine/chemokine levels, and error bars denote standard deviations. *, p � 0.05 forcomparison to PBS-injected animals. Statistical analysis was done using aMann-Whitney test.

Platelet-activating Factor and Anthrax

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7139

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

main 1. Infect. Immun. 74, 4149 – 41568. Benveniste, J., Henson, P. M., and Cochrane, C. G. (1972) Leukocyte-de-

pendent histamine release from rabbit platelets. The role of IgE, basophils,and a platelet-activating factor. J. Exp. Med. 136, 1356 –1377

9. Lopez Diez, F., Nieto, M. L., Fernandez-Gallardo, S., Gijon, M. A., andSanchez Crespo, M. (1989) Occupancy of platelet receptors for platelet-activating factor in patients with septicemia. J. Clin. Invest. 83, 1733–1740

10. Sörensen, J., Kald, B., Tagesson, C., and Lindahl, M. (1994) Platelet-acti-vating factor and phospholipase A2 in patients with septic shock andtrauma. Intensive Care Med. 20, 555–561

11. Criscuoli, M., and Subissi, A. (1987) PAF-acether-induced death in mice.Involvement of arachidonate metabolites and �-adrenoceptors. Br. J.Pharmacol. 90, 203–209

12. Graham, R. M., Stephens, C. J., Silvester, W., Leong, L. L., Sturm, M. J., andTaylor, R. R. (1994) Plasma degradation of platelet-activating factor inseverely ill patients with clinical sepsis. Crit. Care Med. 22, 204 –212

13. Partrick, D. A., Moore, E. E., Moore, F. A., Biffl, W. L., and Barnett, C. C.(1997) Reduced PAF-acetylhydrolase activity is associated with postinjurymultiple organ failure. Shock 7, 170 –174

14. Vadas, P., Gold, M., Perelman, B., Liss, G. M., Lack, G., Blyth, T., Simons,F. E., Simons, K. J., Cass, D., and Yeung, J. (2008) Platelet-activating factor,PAF acetylhydrolase, and severe anaphylaxis. N. Engl. J. Med. 358, 28 –35

15. Mathiak, G., Szewczyk, D., Abdullah, F., Ovadia, P., and Rabinovici, R.(1997) Platelet-activating factor (PAF) in experimental and clinical sepsis.Shock 7, 391– 404

16. Vincent, J. L., Spapen, H., Bakker, J., Webster, N. R., and Curtis, L. (2000)Phase II multicenter clinical study of the platelet-activating factor recep-tor antagonist BB-882 in the treatment of sepsis. Crit. Care Med. 28,638 – 642

17. Radin, J. N., Orihuela, C. J., Murti, G., Guglielmo, C., Murray, P. J., andTuomanen, E. I. (2005) �-Arrestin 1 participates in platelet-activatingfactor receptor-mediated endocytosis of Streptococcus pneumoniae. In-fect. Immun. 73, 7827–7835

18. DeLorme, M. P., and Moss, O. R. (2002) Pulmonary function assessmentby whole-body plethysmography in restrained versus unrestrained mice.J. Pharmacol. Toxicol. Methods 47, 1–10

19. Glaab, T., Taube, C., Braun, A., and Mitzner, W. (2007) Invasive andnoninvasive methods for studying pulmonary function in mice. Respir Res8, 63

20. Hoymann, H. G. (2007) Invasive and noninvasive lung function measure-ments in rodents. J. Pharmacol. Toxicol. Methods 55, 16 –26

21. Neufeld, D. S. (1997) Isolation of rat liver hepatocytes. Methods Mol. Biol.75, 145–151

22. Goldman, D. L., Zeng, W., Rivera, J., Nakouzzi, A., and Casadevall, A.(2008) Human serum contains a protease that protects against cytotoxicactivity of Bacillus anthracis lethal toxin in vitro. Clin. Vaccine Immunol.15, 970 –973

23. Hanna, P. C., Acosta, D., and Collier, R. J. (1993) On the role of macro-phages in anthrax. Proc. Natl. Acad. Sci. U.S.A. 90, 10198 –10201

24. Stafforini, D. M., Elstad, M. R., McIntyre, T. M., Zimmerman, G. A., andPrescott, S. M. (1990) Human macrophages secret platelet-activating fac-tor acetylhydrolase. J. Biol. Chem. 265, 9682–9687

25. Chang, S. W., Feddersen, C. O., Henson, P. M., and Voelkel, N. F. (1987)Platelet-activating factor mediates hemodynamic changes and lung injuryin endotoxin-treated rats. J. Clin. Invest. 79, 1498 –1509

26. Del Sorbo, L., Arese, M., Giraudo, E., Tizzani, M., Biancone, L., Bussolino,F., and Camussi, G. (2001) Tat-induced platelet-activating factor synthesiscontributes to the angiogenic effect of HIV-1 Tat. Eur. J. Immunol. 31,376 –383

27. Doebber, T. W., Wu, M. S., Robbins, J. C., Choy, B. M., Chang, M. N., andShen, T. Y. (1985) Platelet activating factor (PAF) involvement in endo-toxin-induced hypotension in rats. Studies with PAF-receptor antagonistkadsurenone. Biochem. Biophys. Res. Commun. 127, 799 – 808

28. Terashita, Z., Imura, Y., Nishikawa, K., and Sumida, S. (1985) Is plateletactivating factor (PAF) a mediator of endotoxin shock? Eur. J. Pharmacol.109, 257–261

29. von Moltke, J., Trinidad, N. J., Moayeri, M., Kintzer, A. F., Wang, S. B., vanRooijen, N., Brown, C. R., Krantz, B. A., Leppla, S. H., Gronert, K., and

Vance, R. E. (2012) Rapid induction of inflammatory lipid mediators by theinflammasome in vivo. Nature 490, 107–111

30. Claus, R. A., Russwurm, S., Dohrn, B., Bauer, M., and Lösche, W. (2005)Plasma platelet-activating factor acetylhydrolase activity in critically illpatients. Crit. Care Med. 33, 1416 –1419

31. Yang, J., Xu, J., Chen, X., Zhang, Y., Jiang, X., Guo, X., and Zhao, G. (2010)Decrease of plasma platelet-activating factor acetylhydrolase activity inlipopolysaccharide induced mongolian gerbil sepsis model. PLoS One 5,e9190

32. Terra, J. K., Cote, C. K., France, B., Jenkins, A. L., Bozue, J. A., Welkos, S. L.,LeVine, S. M., and Bradley, K. A. (2010) Cutting edge. Resistance to Ba-cillus anthracis infection mediated by a lethal toxin sensitive allele ofNalp1b/Nlrp1b. J. Immunol. 184, 17–20

33. Boyden, E. D., and Dietrich, W. F. (2006) Nalp1b controls mouse macro-phage susceptibility to anthrax lethal toxin. Nat. Genet. 38, 240 –244

34. Fink, S. L., Bergsbaken, T., and Cookson, B. T. (2008) Anthrax lethal toxinand Salmonella elicit the common cell death pathway of caspase-1-depen-dent pyroptosis via distinct mechanisms. Proc. Natl. Acad. Sci. U.S.A. 105,4312– 4317

35. Muehlbauer, S. M., Evering, T. H., Bonuccelli, G., Squires, R. C., Ashton,A. W., Porcelli, S. A., Lisanti, M. P., and Brojatsch, J. (2007) Anthrax lethaltoxin kills macrophages in a strain-specific manner by apoptosis orcaspase-1-mediated necrosis. Cell Cycle 6, 758 –766

36. Cui, X., Moayeri, M., Li, Y., Li, X., Haley, M., Fitz, Y., Correa-Araujo, R.,Banks, S. M., Leppla, S. H., and Eichacker, P. Q. (2004) Lethality duringcontinuous anthrax lethal toxin infusion is associated with circulatoryshock but not inflammatory cytokine or nitric oxide release in rats. Am. J.Physiol. Regul. Integr. Comp. Physiol. 286, R699 –R709

37. Kuo, S. R., Willingham, M. C., Bour, S. H., Andreas, E. A., Park, S. K.,Jackson, C., Duesbery, N. S., Leppla, S. H., Tang, W. J., and Frankel, A. E.(2008) Anthrax toxin-induced shock in rats is associated with pulmonaryedema and hemorrhage. Microb. Pathog. 44, 467– 472

38. Kirby, J. E. (2004) Anthrax lethal toxin induces human endothelial cellapoptosis. Infect. Immun. 72, 430 – 439

39. Warfel, J. M., Steele, A. D., and D’Agnillo, F. (2005) Anthrax lethal toxininduces endothelial barrier dysfunction. Am. J. Pathol. 166, 1871–1881

40. Pandey, J., and Warburton, D. (2004) Knock-on effect of anthrax lethaltoxin on macrophages potentiates cytotoxicity to endothelial cells. Mi-crobes Infect. 6, 835– 843

41. Victorino, G. P., Newton, C. R., and Curran, B. (2004) Modulation ofmicrovascular hydraulic permeability by platelet-activating factor.J. Trauma 56, 379 –384

42. Montrucchio, G., Lupia, E., De Martino, A., Silvestro, L., Savu, S. R., Ca-cace, G., De Filippi, P. G., Emanuelli, G., and Camussi, G. (1996) Plasminpromotes an endothelium-dependent adhesion of neutrophils. Involve-ment of platelet activating factor and P-selectin. Circulation 93,2152–2160

43. Silvestro, L., Ruikun, C., Sommer, F., Duc, T. M., Biancone, L., Montruc-chio, G., and Camussi, G. (1994) Platelet-activating factor-induced endo-thelial cell expression of adhesion molecules and modulation of surfaceglycocalyx, evaluated by electron spectroscopy chemical analysis. Semin.Thromb. Hemost. 20, 214 –222

44. Muehlbauer, S. M., Lima, H., Jr., Goldman, D. L., Jacobson, L. S., Rivera, J.,Goldberg, M. F., Palladino, M. A., Casadevall, A., and Brojatsch, J. (2010)Proteasome inhibitors prevent caspase-1-mediated disease in rodentschallenged with anthrax lethal toxin. Am. J. Pathol. 177, 735–743

45. Salles, I. I., Tucker, A. E., Voth, D. E., and Ballard, J. D. (2003) Toxin-induced resistance in Bacillus anthracis lethal toxin-treated macrophages.Proc. Natl. Acad. Sci. U.S.A. 100, 12426 –12431

46. Huang, D., Ding, Y., Luo, W. M., Bender, S., Qian, C. N., Kort, E., Zhang,Z. F., VandenBeldt, K., Duesbery, N. S., Resau, J. H., and Teh, B. T. (2008)Inhibition of MAPK kinase signaling pathways suppressed renal cell car-cinoma growth and angiogenesis in vivo. Cancer Res. 68, 81– 88

47. Bachi, A. L., Dos Santos, L. C., Nonogaki, S., Jancar, S., and Jasiulionis,M. G. (2012) Apoptotic cells contribute to melanoma progression and thiseffect is partially mediated by the platelet-activating factor receptor. Me-diators Inflamm. 2012, 610371

48. Claud, E. C., Lu, J., Wang, X. Q., Abe, M., Petrof, E. O., Sun, J., Nelson, D. J.,

Platelet-activating Factor and Anthrax

7140 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 10 • MARCH 7, 2014

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

Marks, J., and Jilling, T. (2008) Platelet-activating factor-induced chloridechannel activation is associated with intracellular acidosis and apoptosisof intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 294,G1191–G1200

49. Ma, X., and Bazan, H. E. (2001) Platelet-activating factor (PAF) enhancesapoptosis induced by ultraviolet radiation in corneal epithelial cellsthrough cytochrome c-caspase activation. Curr. Eye Res. 23, 326 –335

50. Ryan, S. D., Harris, C. S., Carswell, C. L., Baenziger, J. E., and Bennett, S. A.(2008) Heterogeneity in the sn-1 carbon chain of platelet-activating factorglycerophospholipids determines pro- or anti-apoptotic signaling in pri-mary neurons. J. Lipid Res. 49, 2250 –2258

51. Stafforini, D. M., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M.(2003) Platelet-activating factor, a pleiotrophic mediator of physiologicaland pathological processes. Crit. Rev. Clin. Lab. Sci. 40, 643– 672

52. Zimmerman, G. A., McIntyre, T. M., Prescott, S. M., and Stafforini, D. M.(2002) The platelet-activating factor signaling system and its regulators insyndromes of inflammation and thrombosis. Crit. Care Med. 30,S294 –301

53. Moayeri, M., Haines, D., Young, H. A., and Leppla, S. H. (2003) Bacillusanthracis lethal toxin induces TNF-�-independent hypoxia-mediatedtoxicity in mice. J. Clin. Invest. 112, 670 – 682

54. Grinberg, L. M., Abramova, F. A., Yampolskaya, O. V., Walker, D. H., andSmith, J. H. (2001) Quantitative pathology of inhalational anthrax I. Quan-titative microscopic findings. Mod. Pathol. 14, 482– 495

55. Grypioti, A. D., Theocharis, S. E., Demopoulos, C. A., Papadopoulou-

Daifoti, Z., Basayiannis, A. C., and Mykoniatis, M. G. (2006) Effect ofplatelet-activating factor (PAF) receptor antagonist (BN52021) on acet-aminophen-induced acute liver injury and regeneration in rats. Liver Int.26, 97–105

56. Murohisa, G., Kobayashi, Y., Kawasaki, T., Nakamura, S., and Nakamura,H. (2002) Involvement of platelet-activating factor in hepatic apoptosisand necrosis in chronic ethanol-fed rats given endotoxin. Liver 22,394 – 403

57. Serizawa, A., Nakamura, S., Suzuki, Baba, S., and Nakano, M. (1996) In-volvement of platelet-activating factor in cytokine production and neu-trophil activation after hepatic ischemia-reperfusion. Hepatology 23,1656 –1663

58. Kimura, K., Moriyama, M., Nishisako, M., Kannan, Y., Shiota, M.,Sakurada, K., Musashi, M., and Sugano, T. (1998) Modulation of plateletactivating factor-induced glycogenolysis in the perfused rat liver after ad-ministration of endotoxin in vivo. J. Biochem. 123, 142–149

59. Kuiper, J., De Rijke, Y. B., Zijlstra, F. J., Van Waas, M. P., and Van Berkel,T. J. (1988) The induction of glycogenolysis in the perfused liver by plateletactivating factor is mediated by prostaglandin D2 from Kupffer cells.Biochem. Biophys. Res. Commun. 157, 1288 –1295

60. Altin, J. G., Dieter, P., and Bygrave, F. L. (1987) Evidence that Ca2� fluxesand respiratory, glycogenolytic and vasoconstrictive effects induced by theaction of platelet-activating factor and L-�-lysophosphatidylcholine in theperfused rat liver are mediated by products of the cyclo-oxygenase path-way. Biochem. J. 245, 145–150

Platelet-activating Factor and Anthrax

MARCH 7, 2014 • VOLUME 289 • NUMBER 10 JOURNAL OF BIOLOGICAL CHEMISTRY 7141

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from

and David L. GoldmanJohanna Rivera, Rani S. Sellers, Wangyong Zeng, Nico van Rooijen, Arturo Casadevall

Toxin-associated Damage LethalBacillus anthracisPlatelet-activating Factor Contributes to

doi: 10.1074/jbc.M113.524900 originally published online January 29, 20142014, 289:7131-7141.J. Biol. Chem. 

  10.1074/jbc.M113.524900Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/289/10/7131.full.html#ref-list-1

This article cites 60 references, 20 of which can be accessed free at

by guest on February 15, 2016http://w

ww

.jbc.org/D

ownloaded from