awan zunaira - final thesis.pdf - the university of sydney

Copyright and use of this thesis

This thesis must be used in accordance with the provisions of the Copyright Act 1968.

Reproduction of material protected by copyright may be an infringement of copyright and copyright owners may be entitled to take legal action against persons who infringe their copyright.

Section 51 (2) of the Copyright Act permits an authorized officer of a university library or archives to provide a copy (by communication or otherwise) of an unpublished thesis kept in the library or archives, to a person who satisfies the authorized officer that he or she requires the reproduction for the purposes of research or study.

The Copyright Act grants the creator of a work a number of moral rights, specifically the right of attribution, the right against false attribution and the right of integrity.

You may infringe the author’s moral rights if you:

- fail to acknowledge the author of this thesis if you quote sections from the work

- attribute this thesis to another author

- subject this thesis to derogatory treatment which may prejudice the author’s reputation

For further information contact the University’s Copyright Service.

sydney.edu.au/copyright

Role of Calsyntenin-1 in Hepatitis C

Virus Pathogenesis

Zunaira Awan

A Thesis Submitted for the Degree of

Doctor of Philosophy

Storr Liver Centre, Westmead Millennium Institute,

Sydney Medical School, The University of Sydney, Australia.

March 2015

i

Declaration

I hereby declare that all work presented in this thesis describes original research work

undertaken in the Storr Liver Unit, Westmead Millennium Institute, Sydney Medical

School, The University of Sydney under the supervision of Dr Mark Douglas and

Professor Jacob George. To the best of my knowledge these results have not been

previously submitted for any degree, and will not be submitted for any other degree or

qualification. The author performed all studies reported within this thesis, except where

specifically stated.

Signature: .....................................

Zunaira Awan M.Phil

March 30, 2015

ii

Dedication

I dedicate this doctoral journey of knowledge to my most supportive and loving husband

UMER S AKBAR for his steadfast support, patience, encouragement and trust on my

abilities. Additionally, I also dedicate this dissertation to my lovely daughter HAREEM Y

UMER who has been my bundle of joy throughout and taught me how to love at first sight.

iii

Acknowledgments

First and foremost, I must acknowledge my limitless thanks to Allah, the Ever

Magnificent; the Ever Thankful; for His help and blessings. I am very certain that this

work would have never been accomplished without His guidance.

I offer my profound gratitude to my supervisor and mentor, Dr. Mark Douglas, whose

expertise, understanding and cooperation made this research journey a remarkable and

unforgettable experience. I wholeheartedly appreciate his guidance and support at each and

every step of my research work, weather it is editing an international conference

presentation or just a simple lab affair. Another special and humble thanks to my associate

supervisor Professor Jacob George whose continuous encouragement, insightful

discussions and inspiring suggestions made me steadfast throughout my depressing times

in research.

I also owe a deep debt of gratitude to my project collaborators Professor Michael Beard

(The University of Adelaide), Nicholas Eyre (The University of Adelaide) and Associate

Professor Heidi Drummer (The University of Melbourne) for their ideas and practical help

in this project. Another special thanks goes to Dr Enoch Tay for his instant and exciting

discussions on planning and outcome of my experiment. I acknowledge and thank

Australian Government and The University of Sydney for International Postgraduate

Research Scholarship and also Westmead Medical Research Foundation (WMRF) for Top-

Up Grants.

iv

I will forever be grateful to my grandmother Khadija Begum, my mother Rukhsana Awan

and father Ehsan-ul-Haq Awan for their struggle to make me what I am today. It was their

dream and my passion to reach and complete a doctorate degree. Without their blessings

and unmatchable support, I wouldn’t have reached at the place I am today. I am truly

thankful to my sister Hira, brothers Ali and Umer and friends especially Fehmina for their

support and prayers in achieving my goal. Moreover I appreciative all my colleagues

Mahsa, Scott, Mehdi, Mosleh, Adrian, Badr, Bisma, Mustafa, Korri, Linda and everyone at

Storr Liver Centre and Westmead Millennium Institute for their unforgettable help and

company.

A big thanks to my lovely daughter whose innocent laughs and smiles bolstered me to

overcome the difficulties encountered in the pursuit of this research. Last but not least, I

am grateful to my husband for coping with my hectic research schedule, for his continuous

empathy and of course for patiently baby-sitting our daughter during my final thesis

writing. I appreciate all the efforts put by everyone in making this dream come true. The

memories and experiences will remain with me forever. Thank you all for your

cooperation.

Zunaira Awan

v

Publications

1. Awan Z., Tay, E., George, J., Douglas, M. (2012) Role of Calsyntenin-1 in Hepatitis C virus Pathogenesis. SEIB Colloquium 2012, University of Sydney, Australia.

2. Awan Z., Tay, E., George, J., Douglas, M. (2015). The Role Of Calsyntenin-1 in Hepatitis C Virus Replication and its Transmission Through Exosomes." (Manuscript in preparation)

Oral Presentations

1. Awan Z., Tay, E., George, J., Douglas, M. (2013) The Role Of Calsyntenin-1 In

Hepatitis C Virus Replication And Its Transmission Through Exosomes." 9th National Workshop Australian Centre for HIV & Hepatitis Virology Research (ACH2).

2. Awan Z., Tay, E., George, J., Douglas, M. (2013) Role% of% Calsyntenin.1% in%Hepatitis% C% Virus% Pathogenesis." 20th International Symposium on Hepatitis C Virus and Related Viruses (HCV2012).

3. Awan Z., Tay, E., George, J., Douglas, M. (2014) Calsyntenin-1 Is Involved In Hepatitis C Virus Life Cycle. 10th National Workshop Australian Centre for HIV & Hepatitis Virology Research (ACH2).

4. Awan Z., Tay, E., George, J., Douglas, M. (2014) The Role Of Calsyntenin-1 In

Hepatitis C Virus Replication And Its Transmission Through Exosomes." 211st

International Symposium on Hepatitis C Virus and Related Viruses (HCV2012).

vi

Awards

1. The International Postgraduate Research Scholarships (IPRS) funded by the Australian Government (2011!2014)

2. International Postgraduate Award (IPA) funded by the University of Sydney (2011!

2014)

3. Westmead Medical Research Foundation Top up Grant (2011-2015).

4. Oral presentation travel award for 20th International Symposium on Hepatitis C Virus and Related Viruses 6th October-10th October 2013, Melbourne Australia.

5. Oral presentation travel award for 21st International Symposium on Hepatitis C

Virus and Related Viruses, 7th-11th September 2013, Banff, Canada (one of the highest scoring abstracts).

vii

Table of Contents

Declaration ........................................................................................................................................................ i%

Dedication ........................................................................................................................................................ ii%

Acknowledgments ........................................................................................................................................... iii%

Publications ...................................................................................................................................................... v%

Oral Presentations ............................................................................................................................................ v%

Awards ............................................................................................................................................................ vi%

Table of Contents ........................................................................................................................................... vii%

List of Tables ................................................................................................................................................ xiii%

List of Figures ............................................................................................................................................... xiv%

Abbreviations .............................................................................................................................................. xviii%

Abstract .......................................................................................................................................................... xx

viii

CHAPTER 1: GENERAL INTRODUCTION 1

1.1. Hepatitis C virus 1

1.1.1. Epidemiology and Disease Burden 1

1.1.2. HCV Genome 2

1.1.3. HCV Replication Cycle 4

1.1.3.1. Virus Attachment and Entry 5

1.1.3.2. HCV Replication 7

1.1.3.3. HCV Replication Complexes 10

1.1.3.4. Assembly and Egress 12

1.1.4. Treatment of hepatitis C 15

1.1.5. HCV in-vitro Models 17

1.2. Endosomal Trafficking Pathways 19

1.2.1. Early Endosomes 20

1.2.2. Recycling Endosomes 23

1.2.3. Late Endosomes/Multivesicular Bodies (MVBs) 25

1.2.4. Exosomes 26

1.3. HCV and Exosomes 28

1.4. SILAC Screening and Identification of Calsyntenin-1 30

1.5. Calsyntenins 33

1.5.1. Calsyntenin-1 34

1.5.2. Calsyntenin-1 Cleavage 35

1.5.3. Role of Calsyntenin-1 in Endosomal Trafficking in Neurons 36

1.6. Intracellular Transport Mechanisms 38

1.6.1. Cytoskeleton 39

1.6.1.1. Actin Filaments 39

1.6.2. Microtubules 40

1.6.2.1. Kinesin and Dynein Motors 43

1.7. Calsyntenin-1 and Kinesin Light Chain 1 45

1.8. Role of Cytoskeleton in HCV Pathogenesis 47

1.9. Summary 49

1.10. Hypothesis and Aims 50

2. CHAPTER 2: MATERIALS AND METHODS 51

2.1. Materials 51

ix

2.1.1. Chemicals and Reagents 51

2.1.2. Cell Lines 52

2.1.3. Plasmids 53

2.2. Methods 54

2.2.1. Preparation of HCV RNA 54

2.2.2. Transfection 54

2.2.3. RNA extraction 55

2.2.4. cDNA Synthesis 56

2.2.5. Construction of Fluorochrome-tagged constructs 57

2.2.6. Cloning 59

2.2.7. Immunofluorescence Studies 61

2.2.7.1. Live cell imaging 61

2.2.7.2. Immunofluorescence 61

2.2.8. Real Time PCR 64

2.2.8.1. qPCR for Calsyntenin-1 64

2.2.8.2. qPCR for HCV 64

2.2.9. Silencing of Calsyntenin-1 using siRNA 66

2.2.10. Tissue Culture infection dose (TCID50) 66

2.2.11. Protein Extraction 67

2.2.11.1. Protein Extraction from Cells 67

2.2.11.2. Protein extraction from supernatants 67

2.2.11.3. Blood plasma albumin removal and protein extraction 68

2.2.12. Protein Quantification 68

2.2.13. Polyacrylamide Gel Electrophoresis (PAGE) 68

2.2.14. Western Blot Analysis 69

2.2.15. Dual Renilla Luciferase Assay 71

2.2.16. Concentration of HCV Virus (PEG precipitation) 71

2.2.17. Sucrose Density Gradient Analysis 71

2.2.18. Exosome Isolation 72

2.2.19. ImageJ software 72

3. CHAPTER 3: IDENTIFICATION OF CALSYNTENIN-1 AS A HOST FACTOR

INVOLVED IN HCV PATHOGENESIS 73

3.1. Introduction 73

3.2. Background to the project 74

3.3. Experimental outline and results 79

x

3.3.1. Optimisation of virus constructs (Jc1 & JFH1) in Huh7

and Huh7.5 cell lines 79

3.3.1.1. Comparison of replication efficiency of Jc1 and

JFH1 HCV strains in Huh7 and Huh7.5 cell lines 80

3.3.1.2. Calculation of HCV infectivity titres using Jc1

and JFH1 infected Huh7 and Huh7.5 cell lines 81

3.3.1.3. Evaluation of Jc1 and JFH1 initial replication

ability in Huh7 and Huh7.5 cell lines, using a time course 83

3.3.1.4. Selection of the best cell line receptive for Jc1 showing

efficient replication and infectivity 85

3.3.2. Identification of calsyntenin-1 as a host factor up regulated

in HCV infection 87

3.3.3. Silencing the expression of calsyntenin-1 in Huh7 cells using siRNA 92

3.3.4. Effect of decreased calsyntenin-1 expression on HCV infection 94

3.3.5. Calsyntenin-1 is associated with kinesin light chain 1 in Huh7 cells 98

3.3.5.1. Duolink proximity ligation assay 99

3.4. Discussion and Conclusion 102

4. CHAPTER 4: ROLE OF CALSYNTENIN-1 IN THE EARLY

INFECTION OF HCV 106



4.2.1. HCV core protein interacts with early endosomes during

early infection 110

4.2.2. Evaluation of the association of calsyntenin-1 and early

endosomes in Huh7 cells 113

4.2.2.1. Construction of GFP tagged Rab5a (early endosome marker) 113

4.2.2.2. Construction of RFP tagged calsyntenin-1 115

4.2.2.3. Plasmid sequencing analysis 117

4.2.2.4. Live cell imaging 117

4.2.3. Effects of decreased calsyntenin-1 expression on early

endosomes in Huh7 cells 120

4.2.3.1. Early endosome distribution 120

4.2.3.2. Velocity of early endosomes 123

4.2.3.3. Pattern of early endosomes movement 124

4.2.4. Calsyntenin-1 disrupts the function of early endosomes

xi

in hepatocytes 126

4.2.5. Calsyntenin-1 depletion does not affect HCV receptor

mediated entry into hepatocytes 129

4.2.6. HCV pseudoparticle entry assay 131


5. CHAPTER 5: EVALUATION OF THE ROLE OF CALSYNTENIN-1

IN HEPATITIS C VIRUS REPLICATION 137



5.2.1. Loss of calsyntenin-1 expression delays the set up of

HCV replication complexes 143

5.2.2. Association of calsyntenin-1 protein with HCV replication

complexes in HCV infected cells 145

5.2.3. Evaluation of the interaction between calsyntenin-1

and actively replicating HCV replication complexes 147

5.2.4. HCV replication complexes move in association with calsyntenin-1 150

5.2.5. The effect of calsyntenin-1 on velocities of HCV replication complexes 152


6. CHAPTER 6: ROLE OF CALSYNTENIN-1 IN THE SECRETION

OF HCV INFECTED CELLS 158


6.2. Experimental outline and Results 163

6.2.1. Effect of calsyntenin-1 on the production of HCV

infectious particles 163

6.2.2. Protein analysis of HCV infected cells secretion using

sucrose density gradient 164

6.2.3. Evaluation of the role of calsyntenin-1 in the production

of exosomes 166

6.2.4. Exosomes are increased in plasma samples from HCV

infected patients, compared to uninfected 169

6.2.5. Calsyntein-1 is associated with multivesicular bodies and

recycling endosomes in Huh7 cells 170

6.2.6. HCV core protein interacts with MVBs and recycling

xii

endosome mediated secretory pathways within HCV infected Huh7 cells 174

6.2.7. Effect of suppressed calsyntenin-1 on the distribution of recycling

endosomes and MVBs 178


7. Chapter 7: GENERAL DISCUSSION, FUTURE DIRECTIONS AND

CONCLUSIONS 185

7.1. Study Aims 185

7.2. Findings & Significance 185

7.3. Future directions 191

7.4. Conclusion 192

8. Chapter 8: REFERENCES 194

xiii

List of Tables

Table 2.1 Forward and Reverse Primer sequence for Rab5A and calsyntenin-1

coding regions 57

Table 2.2 PCR Reaction Contents 58

Table 2.3 List of Restriction Endonuclease used for Digestion of Live Cell Imaging

Constructs 60

Table 2.4 Primary and secondary antibody dilutions and incubation timings for

Immunofluorescence labelling 63

Table 2.5 Real time PCR Reaction conditions for Calsyntein-1 using SYBER green mix 64

Table 2.6 HCV Real-time qPCR reaction contents using Taqman gene expression assay 65

Table 2.7 List of primary and secondary antibodies used in western blot analysis 70

Table 3.1 Abundant Proteins in HCV-infected cells Supernatant (SILAC Screen) 76

xiv

List of Figures

Figure 1.1 Hepatitis C virus - structure and genome organization 4

Figure 1.2 HCV Entry Process 6

Figure 1.3 Topology of HCV proteins 7

Figure 1.4 Membranous Web 9

Figure 1.5 RNA Replication Model 10

Figure 1.6 Hypothetical Model for Hepatitis C Virus Replication Complex 11

Figure 1.7 HCV RNA Replication and Virus Product 14

Figure 1.8 Open reading frames of different HCV constructs 19

Figure 1.9 Endosomal Pathway 23

Figure 1.10 SILAC (Stable isotope labelling with amino acids in cell culture 32

Figure 1.11 Post-translational processing of calsyntenin-1 36

Figure 1.12 Calsyntenin-1 mediated, kinesin-1 dependent vesicle transport 38

Figure 1.13 Microtubule structure showing the arrangement

of tubulin macromolecules 41

Figure 1.14 Diagrams of microtubule organisation in a variety of cell types 42

Figure 1.15 Kinesin and Dynein move along a microtubule in opposite directions 44

Figure 1.16 Intracellular transport mechanism 45

Figure 1.17 Model explaining the Calsyntenin-1/Kinesin-1 cargo

docking complex 46

Figure 3.1 SILAC Screen 75

Figure 3.2 Replication efficiencies of Jc1 and JFH1 RNA in Huh7

and Huh7.5 hepatoma cell lines 81

Figure 3.3 Comparison of Jc1 and JFH1 viral titres in Huh7 and

Huh7.5 cells using TCID50 based infectivity assay 82

Figure 3.4 HCV RNA expression at early times after infection

xv

with HCV supernatant (Jc1 or JFH1) 84

Figure 3.5 Comparison of HCV RNA (Jc1 & JFH1) replication

efficiencies and viral titres in Huh7 and Huh7.5 cell lines 86

Figure 3.6 Calsyntenin-1 is involved in Hepatitis C Virus infection 88

Figure 3.7 Post-translational processing of calsyntenin-1 90

Figure 3.8 Calsyntenin-1 and Hepatitis C Virus infection 92

Figure 3.9 Silencing of Calsyntenin-1 in Huh 7 cells 93

Figure 3.10 Calsyntenin-1 knockdown leads to reduction in HCV RNA

expression and Infectivity 95

Figure 3.11 Decrease in HCV protein expression in calsyntenin-1

knock down Huh7 cells infected with Jc1 97

Figure 3.12 Calsyntenin-1 is associated with Kinesin light chain 1

in Huh7 hepatoma cell 99

Figure 3.13 Proximity ligation assay (PLA) 101

Figure 4.1 HCV Entry 108

Figure 4.2 Association of HCV core and early endosomes in

HCV (Jc1) infected Cells 111

Figure 4.3 Association of HCV core with early endosomes

two hours after virus receptor mediated entry 112

Figure 4.4 Cloning of early endosome marker (Rab5A) into

pEGFP-N1 plasmid for live cell imaging 114

Figure 4.5 Cloning of Calsyntenin-1 into pDsRed-Monomer-C1

for live cell imaging 116

Figure 4.6 Association of early endosomes with the

C-terminal fragment of Calsyntenin-1 (DsRed-CTF) in live Huh7 cells 118

Figure 4.7 Live cells imaging of full-length calsyntenin-1 (DsRed-FL)

and early endosomes in live Huh7 hepatoma cell line 119

Figure 4.8 Distribution of early endosomes is altered in cells

xvi

silenced for calsyntenin-1, compared to control cells 122

Figure 4.9 Velocities of early endosomes are significantly

reduced after silencing calsyntenin-1 in hepatic cells 124

Figure 4.10 Early endosomes become less motile in the

absence of calsyntenin-1 125

Figure 4.11 Loss of early endosomal ability of recycling transferrin

receptor back to the plasma membrane in the absence of calsyntenin-1 128

Figure 4.12 Effect of silenced calsyntenin-1 on viral entry

and uptake by early endosomes 130

Figure 4.13 HCV receptor mediated entry remains unaffected in

calsyntenin-1 silenced cells (HCV pseudoparticle assay) 132

Figure 4.14 Early endosomes lose their ability to show plus

end directed movement in the absence of calsyntenin-1 135

Figure 5.1 Hepatitis C Virus Replication Cycle in hepatocytes 139

Figure 5.2 HCV Replication complex 140

Figure 5.3 Silencing calsyntenin-1 in Huh7 hepatoma cells delays the formation

of HCV replication complexes 144

Figure 5.4 Association of Calsyntenin-1 and HCV non-structural

NS5A protein in Jc1 infected cells 146

Figure 5.5 Calsyntenin-1 is associated with active HCV RNA

replication sites in the presence of NS5A 148

Figure 5.6 Interaction of calsyntenin-1 with dsRNA, a HCV replication

intermediate in HCV infected cells 149

Figure 5.7 Saltatory movement of HCV replication complexes associated with

calsyntenin-1 in live cells 151

Figure 5.8 siRNA mediated loss of calsyntenin-1 inhibits the MT

dependent Saltatory movement of HCV replication complexes 153

Figure 6.1. Endosome based pathway showing MVB formation and

xvii

release of exosomes 160

Figure 6.2 Effect of calsyntenin-1 on HCV infectious virus production

as determined by TCID50 infectivity assay 164

Figure 6.3 Localization of calsyntenin-1 and HCV core protein in

exosome rich density fraction 166

Figure 6.4 Exosome infectivity is reduced when released from Jc1

infected cells silenced for calsyntenin-1 168

Figure 6.5 HCV infected blood plasma shows an increase in

exosome proteins compared to healthy controls 169

Figure 6.6 Calsyntenin-1 colocalises with multivesicular bodies

(MVB) in Huh7 cells 171

Figure 6.7 Association of recycling endosomes with calsyntenin-1

in Huh7 hepatoma cells 173

Figure 6.8 Association of HCV core with MVB mediated cell

secretory pathway in HCV infected Huh7 cells 175

Figure 6.9 Recycling endosomes are associated with HCV core

secretory pathway in HCV infected Huh7 cells 177

Figure 6.10 Distribution of recycling endosomes and MVBs

is altered in the absence of calsyntenin-1 in HCV infected cells 179

Figure 6.10. Proposed model highlighting the role of calsyntenin-1

in the release of HCV containing exosomes 182

Figure 7.1 Calsyntenin-1 is involved in HCV pathogenesis at various stages 193

xviii

Abbreviations

5’/3’UTR 5’/3’untranslated region

Aβ Amyloid-β

ADAM Disintegrin and metalloproteinase

ADRP Adipocyte differentiation-related protein

ApoB Apolipoprotein B

ApoE Apolipoprotein-E

APP Amyloid precursor protein

ATP Adenosine triphosphate

CTF C-terminal fragment

DAA Direct acting antiviral

DMEM Dulbecco’s Modified Eagle Medium

dsRNA Double stranded RNA

EE Early endosomes

ER Endoplasmic Reticulum

ESCRT Endosomal sorting complex required for

transport

FL Full Length

GFP Green Fluorescent Protein

GTP Guanosine-5'-triphosphate

IRES Internal ribosome entry site

HCC Hepatocellular carcinoma

Huh7 Human hepatocellular carcinoma cell line

JFH1 Japanese fulfillment hepatitis-1

KBS Kinesin binding Segment

KLC1 Kinesin light chain 1

IFN Interferon

xix

LDs Lipid Droplets

LVPs Lipo Viro Particles

MOI Multiplicity of infection

MT Microtubules

MTP Microsomal triglyceride transfer protein

MTOC Microtubule organizing centre

MVB Multivesicular body

NS Non-Structural

NTF

PLA

N-terminal fragment

Proximity ligation assay

PtdIns(3)P Phosphotidylinopcistol-3-phosphate

RC Replication Complexes

RF

RFP

Replicative Form

Red fluorescent protein

RI Replicative Intermediate

RIG-I Retinoic acid-inducible gene I

SRB1 Scavenger Receptor B type 1

SDS Sodium dodecyl sulfate

SGR-JFH1 Subgenomic replicon

SILAC Stable isotope labelling with amino acids

in cell culture

SVR Sustained virological response

TfnR Transferrin Receptor

TGN Trans-Golgi network

TPR Tetratricopeptide repeat

VAP-A Vesicle Associated Protein-A

VLDL Very-low-density lipoprotein

xx

Abstract

Approximately 233,000 Australians and 150 million people worldwide have chronic

infection with hepatitis C virus (HCV) that can lead to hepatic fibrosis, liver failure

and cancer. To date, therapy for HCV infection is improving but still has significant

side effects and is specific to a particular HCV genotype. Drugs targeting host factors

should avoid these problems but a major barrier to their design and development is the

incomplete understanding of the virus replication cycle. Therefore improved insight

into the stages of the HCV life cycle will facilitate the development of novel

antivirals, by targeting host proteins involved in specific stages of the virus life cycle.

To find novel host factors involved in HCV infection, a mass spectrometry based

SILAC (Stable isotope labelling with amino acids in cell culture) screen of the

secreted proteome of HCV infected hepatocytes was conducted which identified a

transmembrane protein calsyntenin-1 as a factor highly secreted by infected cells (44-

fold) as compared to uninfected control.

This SILAC result was further confirmed by increase in calsyntenin-1 protein levels

of HCV infected cells and their supernatant by western blot and densitometry

analysis. HCV RNA and infectivity levels were reduced in silenced calsyntenin-1

HCV infected cells measured by qPCR and infectivity assays (TCID50). The

association of calsyntenin-1 with kinesin light chain 1 (KLC1) was observed using

Deltavision microscopy. Based on these original observations it was hypothesized that

calsyntenin-1 plays a specific role in HCV pathogenesis.

To investigate if calsyntenin-1 is involved in HCV early infection, we studied its

association with early endosomes using live cell imaging on Deltavision microscope

and imageJ analysis. A direct role of calsyntenin-1 was observed in transport of early

xxi

endosomes using GFP tagged early endosome and RFP tagged calsyntenin-1 plasmid

constructs by live cell imaging. Moreover, siRNA mediated knock down of

calsyntenin-1 led to unavailability of early endosomes at the plasma membrane,

reduced their velocity and disrupted their function. This early endosome blockade

restricted HCV entry into hepatocytes resulting in reduction of HCV infection.

Furthermore, HCV Pseudoparticle assay confirmed that calsyntenin-1 is not involved

in receptor mediated HCV entry but at a later stage of virus uptake by early

endosomes.

To further examine the role of calsyntenin-1 in HCV replication, association between

HCV replication complexes and calsyntenin-1 was studied using subgenomic

replicons based transient assay and live cell imaging. Calsyntenin-1 was found to be

required for the establishment of new HCV replication complexes during HCV

replication while its silencing reduced their formation, disrupted their transport and

restricted their distribution within the cell.

To further investigate association of calsyntenin-1 with export of HCV virions, we

studied endosome based secretory pathways. The function of calsyntenin-1 in the

exosome secretion of HCV from infected cells was observed using sucrose density

gradient fractionation and western blot analysis. The siRNA-mediated knockdown of

calsyntenin-1 showed its association with intracellular trafficking of multivesicular

bodies and recycling endosomes by affecting their distribution within HCV infected

cells and also reduced exosome infectivity as determined by Deltavision microscopy

and infectivity assay (TCID50) analysis.

In conclusion, our results suggest that calsyntenin-1 in involved in multiple stages of

HCV replication cycle as an important host factor. The uptake of viral particles into

xxii

early endosomes, the trafficking of replication complexes and the egress of virus

containing exosomes involve kinesin-1 based transport, and this trafficking is

dependent on the membrane adaptor qualities of calsyntenin-1.

Chapter(1:(General(Introduction( ( ( ( ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((

1

CHAPTER 1: GENERAL INTRODUCTION

1.1 Hepatitis C virus

1.1.1 Epidemiology and Disease Burden

Chronic Hepatitis C is one of the most common causes of cirrhosis and liver

transplantation worldwide. It is estimated that up to 3% (180 million people) of

the world’s population are infected with Hepatitis C virus (HCV), 130 million of

whom have chronic infection so are at risk of developing cirrhosis (WHO., 2008).

In Australia, over 233,000 estimated people (~1.2%) are living with chronic

hepatitis C (Razavi et al., 2014). Furthermore, there is a 3-9% risk of developing

cirrhosis after 20 years in community based studies, while risk of liver failure or

hepatocellular carcinoma is as much as 4% per annum (Freeman et al., 2001).

Until recently, therapy for HCV involved treating patients with an

interferon/ribavarin combination that stimulates antiviral immunity. However,

this strategy has significant side effects and shows a success rate (viral

eradication) of less than 50% for HCV genotype 1 infection (Razali et al., 2007).

Despite recent improvements in therapy with the availability of direct acting

antiviral (DAA) drugs, in Australia these drugs still need to be used in

combination with interferon and ribavirin, increase drug side effects and are only

approved for genotype 1. Therefore discovery of new effective antiviral drugs

against HCV is a high research priority.


2

1.1.2 HCV Genome

HCV is the member of genus Hepacivirus of the family Flaviviridae (Maniloff et

al., 1995). It is an enveloped virus with a positive, single-stranded RNA genome

of ~9.6 kb length flanked by 5` and 3` un-translated regions (UTR) (Friebe et al.,

2002). The 5 'UTR has a ribosome binding site (IRES - Internal ribosome entry

site) that starts the translation of a 3010 amino acid polyprotein that is later

cleaved by cellular and viral proteases into 10 active structural and non-structural

(NS) proteins (Liew et al., 2004). These proteins are arbitrarily divided into three

structural (core, E1, and E2) and six non-structural proteins (NS2, NS3, NS4A,

NS4B, NS5A, and NS5B) while p7 is currently unassigned into either category

(Forns & Bukh., 1999) (Figure 1.1).

Core protein is a highly basic, RNA-binding protein, which forms the viral

nucleocapsid. It interacts with numerous cellular proteins and affects host cell

functions such as gene transcription, lipid metabolism, apoptosis and various

signalling pathways; it also induces steatosis (fatty liver) and promotes

development of hepatocellular carcinoma (HCC) (Moriya et al., 1998; Hope et al.,

2002; Tellinghuisen et al., 2005). E1 and E2 are envelope glycoproteins belonging

to the type I transmembrane protein group, with C-terminal hydrophobic anchors.

These two proteins form non-covalent heterodimers representing building blocks

for the viral envelope (Wakita et al., 2005). P7 is a 63-amino acid polypeptide,

which separates structural and non-structural HCV proteins and has been reported

to form hexamers with ion channel activity (Griffin et al., 2003; Pavlovic et al.,

2003).


3

The rest of the HCV genome encodes non-structural proteins NS2-NS5. NS2 (250

amino acids), NS3 (500 amino acids), and NS4A proteins interact to mediate the

processing of the NS region of the polyprotein. NS3 (500 amino acids) is both a

proteolytic cleavage enzyme and a helicase, which facilitates unwinding of the

viral genome for replication. NS4B with NS5A induces specific membrane

alterations to form the membranous web, which serves as a scaffold for the

formation of viral replication complexes (Egger et al., 2002; Gosert et al., 2003).

NS5A interacts with a variety of cellular proteins and affects regulation of cell

growth, interferon signalling, and lipid metabolic pathways (Blight et al., 2000).

NS5b is the RNA-dependent RNA polymerase needed for viral replication

(Houghton., 1996).


4

Figure 1.1 Hepatitis C virus - structure and genome organization. A) Structure

of HCV showing arrangement of HCV structural genes. B) Proteins encoded by

HCV genome, describing HCV structural and non-structural genes and their

known functions (Reproduced from Expert Reviews in Molecular Medicine,

(2003) Cambridge University Press).

1.1.3 HCV Replication Cycle

HCV pathogenesis is a highly dynamic process, with a viral half life in the blood

of just a few hours and clearance of an estimated 1012 virions per day in an

infected individual (Neumann et al., 1998). Different steps of the HCV virus life


5

cycle include attachment, entry, uncoating, RNA replication, virion assembly and

egress, as described below.

1.1.3.1 Virus Attachment and Entry

Virus entry includes the steps from particle binding to the host cell up to the

delivery of the viral genome to its replication site within target hepatocytes

(Figure 1.2). This process relies on specific interactions between virus

components, mainly envelope proteins and multiple cellular factors (Burlone &

Budkowska., 2009). HCV circulates encapsulated within a lipoviral particle

similar to very-low-density lipoprotein (VLDL) particles ((Komurian-Pradel et

al., 2004). These circulating structures are rich in triglyceride, viral RNA, core

protein and VLDL structural components i.e. apolipoprotein-B (apoB) and

apolipoprotein-E (apoE) (Andre et al., 2002). By circulating within this lipoviral

particle the virus evades the immune system (Gastaminza et al., 2010). Lipoviral

particles attach to the hepatocyte by binding to the LDL-receptor, after initially

recognizing glycosaminoglycan on the cell surface (Monazahian et al., 1999;

Morikawa et al., 2007).

The four essential receptors involved in virus binding and entry are CD81,

scavenger receptor B type 1 (SRB1), claudin and occludin. The HCV envelope

glycoprotein coat (especially E2) interacts with CD81 and SRB1 and forms a

complex necessary for a productive infection to occur (Sabahi., 2009). The

necessity for claudin and occludin highlights the importance of the tight junction

in viral entry. Internalisation of the viral particle occurs via clathrin-mediated

endocytosis (Blanchard et al., 2006).


6

Figure 1.2 HCV Entry Process. After receptor mediated entry, hcv enters the

early endosome by clathrin-medated endocytosis (Lanford et al., 2009).

Once inside the cell, the encapsulated viral particle is transported to early

endosomes by largely undetermined mechanisms. Acidification inside the early

endosomes causes conformational rearrangements in viral glycoproteins, which

lead to fusion of viral and endosomal membranes and subsequent uncoating

(Blanchard et al., 2006). The requirement for endosomal acidification has been

confirmed by siRNA studies targeting ATP6V0A1, a host factor involved in this

process, which when silenced results in decreased infection with HCV (Coller et

al., 2009). Thus, transport and acidification of the early endosomes are two

critical steps in the virus life cycle, as they facilitate the release of the viral

genome into the cytoplasm.


7

1.1.3.2 HCV Replication

HCV RNA (positive strand) released into the cytoplasm is translated into the viral

polyprotein. Translation is initiated by an internal ribosome entry site (IRES)

located in the 5’-Untranslated region (UTR) of HCV, which utilises factors of the

host cell translational machinery, including the 40s and 60s ribosomal subunits

and eIF3 (Boehringer et al., 2005). RNA translation occurs at the rough

endoplasmic reticulum (RER) yielding a single polypeptide (~ 3010 amino acids),

which is cleaved by host and viral proteases into ten mature viral polypeptides,

which are arbitrarily divided into structural and non structural proteins (Jones et

al., 2010). All proteins are directly or indirectly (NS3 via NS4A) associated with

the endoplasmic reticulum membrane, where they exert their functions (Figure

1.3) (Rehermann., 2009).

Figure 1.3 Topology of HCV proteins (Bartenschlager et al.,2010)

A structure called ‘the membranous web’ (Figure 1.4) is formed by distinct

membrane alterations, induced by viral proteins (NS4B and NS5A) and consists


8

of numerous small vesicles (diameter 80 to 180mm) embedded in a membranous

matrix (Gosert et al., 2003). It is the site where viral RNA is amplified by the

NS5A RNA-dependent RNA polymerase, in association with other non structural

proteins and host factors, including cyclophilin A (Bartenschlager et al., 2010).

The membranous web facilitates the build up of RNA replication complexes (RC)

and acts as a scaffold for viral RNA replication. It also protects the RNA from

cellular RNAases. The membranous web is induced by NS4B and resembles

“sponge-like inclusions”, as seen by electron microscope in the livers of HCV-

infected chimpanzees (Hijikata et al., 1991).

Replication complexes consist of vesicles measuring 80 to 180 nm in diameter,

embedded in a membrane matrix and appear as dot like structures several microns

in diameter by immunofluorescence microscopy (Lin et al., 1994). The molecular

processes involved in the formation of membranous web and replication complex

are poorly understood. It has been shown by several studies that the membranous

web also contains heterogeneous single membrane vesicles, double membrane

vesicles and multi-membrane vesicles. (Ferraris et al., 2010; Romero-Brey et al .,

2012; Ferraris et al ., 2013). More recently, double membrane vesicles have been

suggested to be the sites of HCV RNA replication and involve an important role

for HCV NS5A (Romero-Brey et al., 2012, Ferraris et al., 2013). This role is

either direct, in association with viral RNA replication, or indirect, via host cell

regulation to favour virus replication. Its key role is probably as a transport

vehicle, which brings newly synthesised RNA from replication sites to lipid

droplets for encapsidation (Miyanari et al., 2007; Evans et al., 2004). However

this motility and efficient HCV replication is dependent on the microtubule


9

network and cytoplasmic dynein molecular motor, along with host factors

including vesicle associated protein-A (VAP-A) and (early endosome marker)

Rab5a (Eyre et al., 2014).

Figure 1.4 Membranous Web (a) Low-power overview of a Huh-7 cell

harbouring a subgenomic HCV replicon. A distinct membrane alteration, named

the membranous web (arrows), is found in the perinuclear region of the cell.

Scale bar represents 1 µm. (b) Higher magnification of a membranous web

(arrows) with small vesicles embedded in a membrane matrix. Scale bar

represents 500 nm (Reproduced from Teis et al., 2009).

RNA replication occurs in a semi-conservative and asymmetric manner (Figure

1.5). The positive stranded HCV genome is copied into negative strand RNA

which base pairs with the input strand to produce a double stranded replicative


10

form (RF). The negative strand RNA then acts as a transcriptional template for the

synthesis of large amounts of nascent plus stranded RNA, via a replicative

intermediate (RI) (Bartenschlager et al., 2010).

Figure 1.5 RNA Replication Model (Reproduced from Bartenschlager et al.,

2010).

1.1.3.3 HCV Replication Complexes

Replication complexes (RCs) are membrane-associated structures consisting of

viral proteins, replicating RNA, cellular membranes and host factors involved in

virus replication (Figure 1.6). There are two reported populations of HCV RCs

(i.e. large and small), which have distinct dynamic features when observed in live

cells using NS5A-GFP constructs. Large structures represent membranous webs

with limited movement, while small dot like structures (possibly small RCs) show

microtubule associated active transport (Wolk et al., 2008). Thus HCV RCs


11

involve intracellular transport mechanisms and depend primarily on the dynamic

organisation of ER and microtubule network (Wolk et al., 2008). The RC

associated membranes are derived from endoplasmic reticulum and contain the

majority of HCV non-structural proteins (NS3, NS4A, NS4B, NS5A, and NS5B).

NS3 is a RNA helicase and also a serine protease requiring NS4A as a cofactor

that plays a key role in the enzymatic activities of replication complexes. NS4B is

responsible for inducing the membranous web. Whereas NS5A is an essential part

of RCs and plays an indispensible role in viral replication through a range of

functions that are only now starting to become clear.

Figure 1.6 Hypothetical Model for Hepatitis C Virus Replication Complex. (1)

Virus genome translation leads to structural (pink) and non-structural (green)

proteins. (2) Non-structural protein NS4B induces viral replication complex

formation by specific membrane alterations. (3) Replication complex consisting of

HCV non-structural proteins, viral RNA and host factors (Reproduced from

Miller and Krijnse-Locker., 2008).


12

NS5A is a proline-rich, hydrophilic phosphoprotein (Macdonald & Harris., 2004)

that has no intrinsic enzymatic activity. Its main function is to act as an adaptor

protein for a variety of host signalling factors, including factors involved in

membrane trafficking and lipoprotein synthesis pathways (He et al., 2006; Alvisi

et al., 2011; Moriishi et al., 2012). The N-terminus of NS5A forms a 30-amino

acid long amphipathic α-helix (Brass et al., 2002). This is conserved across HCV

isolates and its disruption leads to the loss of membrane localization and

replication ability (Brass et al., 2002; Elazar et al., 2013). The α-helix has a polar

cytosolic face which mediates protein interactions involved in RC formation and

function. Its hydrophobic face is inserted in the cytoplasmic side of the ER

membrane (Penin et al., 2004). NS5A is said to act as a transport vehicle, bringing

newly synthesized RNA from RCs to lipid droplets for encapsidation, thus

playing a critical role both in RNA replication and viral assembly (Evans et al.,

2004; Miyanari et al., 2007).

1.1.3.4 Assembly and Egress

After polyprotein translation, HCV core protein which forms the virus capsid, is

located on the cytosolic side of the ER membrane. Thus virus assembly is thought

to start in the cytosol before virus maturation and release via secretary pathways

(Jones et al., 2010). HCV core protein promotes accumulation of lipid droplets

(LDs) (Abid et al., 2005) and in association with NS5A recruits viral RCs to LD-

associated membranes at the virus assembly site (Miyanari et al., 2007). There is

no conclusive data available for events that direct virus genome packaging into

the capsid, except for the transport of viral RNA from RCs to core on LD surface.


13

Currently it is believed that HCV maturation and release involves the VLDL

pathway, which is usually involved in export of triglycerides and cholesterol from

the liver (Gibbons et al., 2004). It has been observed that extracellular virus

particles can be associated with VLDLs and are known as lipo-viro-particles

(LVPs), which display low to very low buoyant densities compared to

intracellular infectious particles (Andre et al., 2002). This difference suggests a

maturation event during egress from the cell (Jones et al., 2010). These LVPs are

composed of triglycerides, viral RNA, core protein and VLDL structural

components i.e. apoB and apoE (Chang et al., 2007). On the other hand, ER

membrane derived RC vesicles also contain apoB and apoE, as well as

microsomal triglyceride transfer protein (MTP), which is required for VLDL

assembly. So there appears to be a link between HCV and VLDL assembly, either

before or during the initial phases in virus assembly (Gastaminza et al., 2008;

Huang et al., 2007) (Figure 1.7).

Another cellular pathway involved in HCV release is the endosome pathway

(Corless et al., 2010). It depends on several endosomal-sorting complex required

for transport (ESCRTs) proteins, which incorporates target proteins into a

multivesicular body (MVB) for degradation. Subsequently, ATP hydrolysis by an

oligomeric protein called Vps4 (an AAA ATPase) dissociates ESCRTs from

MVB for recycling (Babst et al., 2008). More recently, HCV virion release has

been shown to require ESCRT-III and Vps4 (Corless et al., 2010), which are

involved in the biogenesis of the multivesicular body (MVB), a late endosomal

compartment (Phan et al., 2009). Of note, late endosomes have also been

implicated in the budding of several other viruses, including retroviruses (Booth


14

et al., 2006), rhabdoviruses (Craven et al., 1999), filoviruses (Kolesnikova et al.,

2004), arena viruses (Strecker et al., 2003), and hepatitis B virus (Watanabe et al.,

2007). However, little is known about the role of late endosomes in the HCV life

cycle.

Figure 1.7 HCV RNA Replication and Virus Production. 1) Newly synthesized

viral RNA is translated into the viral polyprotein. 2) Non-structural genes

associate with host factors while HCV core is translocated onto the lipid droplet.

3) Replication complex synthesizing + and – strands of RNA. 4) Core protein is

recruited to ER membranes and positive strand HCV RNA is encapsidated by

HCV core. 5) HCV capsid envelopment. 6) VLDL binds to viral particles to form

LVP before or after budding. 7) Egress of viral particles into ER lumen with

VLDL and ApoE (Kohji Moriishi and Yashiharu Matsuura., 2012).


15

1.1.4 Treatment of Hepatitis C

In the last two decades, HCV therapy options have improved tremendously as a

result of advancements in our understanding of the virus life cycle. It is expected

that sustained virological response (SVR) rates will reach >90% for all HCV

genotypes in 2015, with the advent of fixed dose, oral, single daily interferon-free

treatments, with reduced side effects (Jayasekera et al., 2014). Traditionally, HCV

has been treated by PEGylated interferon-α injection in combination with

ribavirin tablets for six to twelve months (Fried et al., 2002). However interferon

therapy involves many challenges and has significant adverse side effects

including depression, infection, anaemia and liver decompensation.

Recently a range of new compounds have been developed, collectively termed

DAAs, which target specific steps in the HCV life cycle. The first generation of

DAAs against HCV was approved in 2011 in Australia and included telaprevir

and boceprevir. They are HCV NS3/4A protease inhibitors and inhibit viral

replication in HCV-infected host cells. They have shown improved SVR (60-70%

vs 45-50%) and for the last few years were standard of care for HCV genotype 1

infections, in combination with pegylated interferon and ribavirin. Pegylated

interferon is the form that has been used since early 2000s, with PEG-moity that

increases serum half life and allows single weekly dosing (instead of every 1-2

days), with more stable serum levels and higher SVR rates (Manns et al., 2014;

Fried et al., 2002).

Simeprevir (NS3/4A protease inhibitor) was approved in Australia in late 2014

and has now replaced telaprevir and boceprevir as “standard of care” for treating


16

HCV genotype 1, in combination with peginterferon and ribavirin. It is given once

daily (instead of three times per day), has fewer side effects, and provides higher

rates of SVR, up to 80% for treatment of naïve patients (Jacobson et al., 2014;

Manns et al., 2012).

Other second and third generation DAAs have now progressed through phase 2-3

clinical trials. These allow combination of all oral and interferon-free therapy,

with SVR rates >90%. Newer DAAs include NS3 protease inhibitors (paretaprevir

and vedroprevir), NS5A inhibitors (daclatasvir, ledipasvir and ombitasvir) and

NS5B polymerase inhibitors, both nucleos(t)ide analogues (sofosbuvir) and non-

nucleos(t)ide inihibitors (tegobuvir, dasabuvir and elbasvir). These new treatment

combinations are shorter duration, with improved SVR rates and less adverse side

effects (Wyles et al., 2014). Although DAAs were initially developed to target

genotype 1, many newer DAAs are effective against most HCV genotypes in vitro

(Wyles et al., 2014).

The nucleotide analogue sofosbuvir, which inhibits the NS5B RNA polymerase,

is now recommended in USA as first line treatment for most HCV genotypes

(Lawatiz et al., 2013). Sofosbuvir has been licensed in Australia but is not

subsidized to date due to its high cost (US$84,000 for a 12 week course). Phase

III studies published in NEJM in April 2014 showed SVR of 94-99% in HCV

genotype 1 patients, using combination oral treatment with ledipasvir and

sofosbuvir for 12 weeks (Afdhal et al., 2014). This is likely to be the next

approved HCV treatment in USA and hopefully in Australia within 1-2 years. The

other most advanced combination is the Abbvie “3D” combination, which


17

includes co-formulated NS3/4A protease inhibitor ABT-450 (paretaprevir) with

ritonavir (ABT-450/r), non-nucleoside polymerase inhibitor ABT-333

(dasabuvir), NS5A inhibitor ABT-267 (ombitasvir) and ribavirin. In phase 3

studies this combination showed similar response rates to sofosbuvir/ledipasvir

(Poordad et al., 2014), but is more complex and most active against genotype 1

(Kowdley et al., 2014). Another oral treatment involving NS5A inhibitor

daclatasvir in combination with NS5B polymerase inhibitor sofosbuvir showed

high SVR rates in previously untreated patients with HCV genotype 1, 2, or 3

infection, and is also close to market now (Sulkowski et al., 2014).

One of the major obstacles in combating HCV infection is the fast virus mutation

rate (in vivo viral mutation rate is 2.5�× 10⁻⁵ mutations per nucleotide per

genome replication) (Riberiro et al., 2012), which results in resistance emerging

rapidly against antivirals targeting viral proteins (Bartenschlager et al., 2013). An

alternative approach is to target host factors essential for the virus life cycle,

which should minimize the risk of viral resistance and provide antiviral activity

against all HCV genotypes. Although drugs targeting cyclophilin A (Pawlotsky,.

2014) and miR-122 (Janssen et al., 2013) have provided a proof of principle for

this approach, many other host targets are still to be identified, following a better

understanding of the virus life cycle.

1.1.5 HCV in-vitro Models

For HCV, development of a permissive and robust cell culture model was a major

challenge. Generation of subgenomic replicons capable of stable replication in

human hepatoma cells was the first discovery (Lohmann et al. 1999). This was


18

followed by establishment of infectious retroviral particles, pseudotype with HCV

glycoproteins, for HCV entry studies (Bartosch et al. 2003; Hsu et al. 2003).

However the major breakthrough came with the discovery of a novel HCV isolate

that can replicate efficiently in Huh7 cells (Kato et al., 2003; Kato et al., 2001).

This genotype 2a clone originated from a Japanese patient with fulminant

hepatitis, and was called JFH1 (Wakita et al., 2005). Importantly, it was the first

strain to reliably produce infectious virus in Huh7 cells, allowing recreation of the

entire HCV life cycle in vitro (Wakita et al., 2005). More recently, the Jc1 strain

was developed, which is a chimeric virus containing the structural genes from

J6CF and non-structural genes from JFH1, both genotype 2a strains. This

chimeric virus replicates more efficiently than JFH1, achieving titres of about 106

infectious units per ml (Pietschmann et al. 2006).

HCV subgenomic replicons (SGR) have developed based on the JFH1 HCV strain

(genotype 2a), which express non-structural proteins NS3 to NS5B and contain a

firefly luciferase gene (Targett-Adams et al., 2005). This replicon was further

developed by Jones et al to develop JFH1 based SGRs that incorporate GFP in the

C-terminal region of NS5A, allowing real time visualization in live cells (Jones et

al., 2007) (Figure 1.8).


19

Figure 1.8 Open reading frames of different HCV constructs. (Top) JFH1,

(Middle) Jc1 and (bottom) SGR-Luc-JFH1(Steinman et al., 2007; Targett-Adams

et al., 2005)

The most widely used host cells for HCV propagation are Huh7 and Huh7.5 cells.

The Huh7 cell line was derived from a patient with hepatocellular carcinoma and

was the first cell line shown to support HCV replication (Lohmann et al. 2003).

The Huh7.5 cell line is a derivative, isolated from Huh7 cells that had been

infected with a HCV subgenomic replicon, then cured using interferon-alpha

(Blight et al. 2002; Murray et al. 2003). They allow HCV to replicate to higher

levels than in Huh7 cells due to a defect in the innate antiviral defence signalling

pathway, after mutational inactivation of retinoic acid-inducible gene I (RIG-I)

(Sumpter et al. 2005).

1.2 Endosomal Trafficking Pathways

In higher eukaryotes, several endocytic trafficking pathways regulate the

internalization of various lipid membranes, receptors and extracellular fluid.


20

These pathways are either clathrin dependent or independent, including

phagocytosis and pinocytosis (Marko et al., 2010). Almost all the internalized

cargo molecules are either recycled back to the plasma membrane or degraded in

late endosomes and lysosomes. The sorting stations where all these diverse

internalized molecules converge and their fates are decided are the early

endosomes (Mayor et al., 1993).

A variety of proteins and lipids mediate internalization and endosomal sorting.

An important group of endocytic regulators are Ras-associated binding (Ras)

proteins, which are small GTP binding proteins that undergo cycling between a

GTP bound active state and a GDP bound inactive state. They are localised to

intracellular membranes in their active form and regulate binding to different Rab

effectors, which carry out various endocytic processes such as vesicle tethering,

budding and motility. Different Rab proteins are associated with particular

endosomes and are responsible for endosome-endosome and endosome-plasma

membrane fusion (Pfeffer, 2001; Zerial and McBride, 2001; Deneka and van der

Sluijs, 2002; Grosshans et al., 2006). Clathrin-mediated internalization involves

four distinct classes of endosomes. These are differentiated on the basis of the

kinetics with which they accumulate endocytic tracers, their appearances, cellular

localization and occurrence of specific markers.

1.2.1 Early Endosomes

Early endosomes form the first highly dynamic compartment that receives

internalized cargo from the plasma membrane and is the major sorting endosome

in the endosomal trafficking pathway. Early endosomes are complex pleomorphic


21

structures including thin tubular extensions (~ 60 nm diameter) and large vesicles

(~ 400 nm diameter) (Gruenberg et al., 1989). These morphological alterations are

functionally important, as recycling cargos cluster in tubular membranes, while

large vesicles contain membrane invaginations leading to degradative

multivesicular bodies (MVBs) (Mellman., 1996). These two distinct

compartments originate from the same early endosomes, but exhibit differences in

their acidification properties. The pH increases to ~ 6.5 in tubular extension

whereas it decreases from 6.2 to ~ 5.5 in the lumen of large multivesicular bodies

(Mayor et al., 1993; Mellman, 1996).

Rab5 and Rab4 are the primary Rab proteins localized to early endosomes and are

responsible for particular early endocytic events (Gorvel et al., 1991; Bucci et al.,

1992; Daro et al., 1996). Other less characterized Rab proteins such as Rab10

(Babbey et al., 2006), Rab14 (Junutula et al., 2004), Rab21 (Simpson et al., 2004)

and Rab22 (Mesa et al., 2001, 2005) are also involved in the early endosomal

pathway.

Rab5 is the most studied and analyzed Rab of the early endocytic pathway. Rab5

regulates cargo entry from the plasma membrane to early endosomes,

phosphotidylinopcistol-3-phosphate (PtdIns(3)P) lipid enrichment of early

endosomes, motility of early endosomes on actin and microtubular tracks and

activates several signalling pathways from early endosomes (Benmerah, 2004;

Schenck et al., 2008). Rabex-5 (guanine nucleotide exchange factor) activates

GDP bound Rab5 to GTP bound at the early endosome and as a result Rabaptin-5

is recruited. Rabaptin-5 binds GTP-Rab5 and maintains Rebex-5 levels by


22

positive feedback, thus stabilizing GTP-bound Rab5 on early endosomes (Marko

et al., 2010). Furthermore, highly maintained levels of active Rab5 are required to

attract other effector proteins to early endosomes to perform specific functions,

including endosome trafficking and sorting (Grosshans et al., 2006). A variety of

vital Rab5 effectors include PtdIns(3)P-kinase/hVPS34/p150 (VPS34), early

endosomal antigen-1 (EEA1), APPL1 and APPL2 (Adaptor protein containing PH

domain, PTB domain and Leucine zipper motif), SNAREs (soluble N-

ethylmaleimide-sensitive factor attachment protein receptors) and Rabenosyn-5

(Marko et al., 2010).

The crucial and most important function of early endosomes is to sort internalized

cargos and direct them to their particular intracellular destinations in a precise and

highly controlled manner. Most endocytosed ligands are degraded, but their

receptors are recycled back to the plasma membrane for additional rounds of

internalization (Dunn et al., 1989). For example, proteins like the transferrin

receptors and low-density lipoprotein (LDL) receptors are recycled back to the

cell surface, whereas low-density lipoprotein itself and epidermal growth factor

receptor (EGFR) are degraded in late endosomes/lysosomes (Herbst et al., 1994).

Ligands dissociate from their receptors in the moderately acidic (pH 6.3 to 6.8)

environment of the early endosome lumen. The tubular part of endosomes with a

bigger membrane area has receptors that are recycled back to the cell surface. On

the other hand, soluble ligands make their way to multivesicular compartments

and ultimately enter late endosomes (Mellman, 1996) (Figure 1.9).


23

Figure 1.9 Endosomal Pathway. Early endosomes are formed as the first

compartment to receive incoming cargo, which is further divided into different

endosomal types such as Rab7 (late endosomes), Rab4 and Rab11 (recycling

endosomes) (Reproduced with permission from Stenmark H., 2009).

1.2.2 Recycling Endosomes

Cells are dependent on the endocytic and exocytic pathways to communicate with

their surroundings. Endocytosed receptors reach peripheral early endosomes,

mediating responses to external stimuli. These molecules then either undergo

degradation in the late endosomal/lysosomal pathway, or are recycled back to the

plasma membrane (Maxfield & McGraw., 2004). Recycling to the plasma

membrane can be mediated by peripheral early endosomes, or by a distinct


24

subpopulation of endosomes, which have higher pH (~ 6.4) and are located

deeper in the cell, around the microtubule-organizing centre (MTOC) (Perret et

al., 2005). These heterogeneous tubular vesicles are called recycling endosomes

and play a dynamic role in trafficking activity, thereby connecting the endocytic

and exocytic pathways (Murray et al., 2005).

The most well studied recycled protein is transferrin receptor, which binds diferric

transferrin at the cell surface. After binding transferrin, the TfnR is endocytosed

through clathrin-coated vesicles to reach early/sorting endosomes. Subsequently,

this complex of transferrin:transferin receptor returns to plasma membrane either

directly by rapid recycling or via recycling endosomes (Grant and Donaldson,

2009).

The most extensively studied Rab family small GTPase marker on recycling

endosomes is Rab11, which regulates protein recycling (Grant and Donaldson,

2009; Stenmark, 2009). Recycling Endosomes are thought to be involved in

interactions with a multiprotein complex called the exocyst, which contains Sec5,

Sec6, Sec8, Sec10, Sec15 and Exo70 proteins. It mediates recruitment of

materials to areas of membrane growth. So recycling endosomes play a vital role

in regulation of many cellular processes that depend on trafficking, including

epithelial cell-cell adhesion, epithelial polarity, cytokinesis and cell fate

determination (Sven., 2006).


25

1.2.3 Late Endosomes/Multivesicular Bodies (MVBs)

As described above (section 1.2.1) the early endosome is a sorting compartment

that determines the fate of endocytosed materials. Proteins can be recycled back to

the plasma membrane, transferred to the trans-Golgi network (TGN) or may be

degraded in lysosomes. As a result of lysosomal sorting, proteins are transported

to late endosomes (or multivesicular bodies), which are represented by a small

GTPase of the Rab family, Rab7. Early endosomes not only fuse with incoming

cargo but also undergo different events of fission, thereby separating, recycling or

degrading cargos (Poteryaev et al., 2010). Endosomal transport is not yet fully

understood, but two models have been proposed. One is that early and late

endosomes are stationary objects and transport occurs using transport carriers.

Vonderheit and Helenius observed in 2005 that budding of the Rab7 domain

occurs from Rab5 positive endosomes (Vonderheit and Helenius., 2005). The

other possibility is that early endosomes become late endosomes in a Rab

conversion model. Studies supporting this model have shown that the Rab7

domain appears on early endosomes and Rab5 positive endosomes are converted

into Rab7 positive endosomes by ATP conversion (Rink et al., 2005).

Multivesicular bodies (MVB) are distinct and dynamic organelles in the endocytic

pathway that harbour vesicles in their lumen. Incorporation and sorting of

materials in these vesicles is a crucial process that involves ESCRT and has been

studied extensively (Piper & Katzmann 2007). The ability to incorporate

transmembrane proteins and lipids to intraluminal vesicles is of utmost

importance, as they can be degraded in lysosomes or released by exocytosis.


26

Mature MVBs are spherical in shape, carrying intraluminal vesicles ~50 nm in

size (Gruenberg & Stanmark 2004). Proteins specific to MVBs are few because

they use these organelles en route to other cellular destinations. Rab proteins

associated with MVBs include Rab5, Rab7, Rab27 and Rab35, while luminal

vesicles present tetraspanins including CD63. The basic and most extensively

studied functions of MVBs are the regulation of cell signalling and release of

exosomes. Ubiquitin is the main signal for sorting proteins into MVBs for

degradation, and is covalently attached to membranous protein cargo. Cargoes are

recognized by different sorting complexes and are delivered to the MVB lumen

(Hanson & Cashikar., 2012).

1.2.4 Exosomes

Different types of cells shed small vesicles that are key players in intercellular

communication. Three types of these vesicles have been identified so far. The first

group are microvesicles, which directly bud from the plasma membrane and range

from 100 nm to 1 µm in diameter. The second group includes apoptotic bodies

produced as a result of apoptosis, measuring 50 to 500 nm in diameter. Exosomes

are the third type of shedding vesicles and are released following exocytosis of

microvesicular bodies or late endosomes (Dragovic et al., 2011; Kalra et al.,

2012). The major difference between all of these vesicles is the shape, as only

exosomes show a specific and characteristic well-rounded morphology, while the

rest are heterogeneous (Conde et al., 2008). Exosomes originate in the

intraluminal vesicles of MVBs and exocytose from the cell by plasma membrane

fusion (Simons et al., 2009). Invagination of the membrane of late endosomes


27

results in the formation of intraluminal vesicles, which begin to accumulate

inside; the resulting structure as a whole is termed a MVB (Mullock et al., 1998).

MVB fusion with the plasma membrane regulates exosome secretion, which is

still not well understood. However it has been shown that intracellular calcium

changes in mast cells, human erythroleukemia cells, cultured cortical neurons and

oligodendrocytes induce exosome release (Faure et al., 2006; Kramer et al.,

2007). Exosomes contain unique protein and lipid content: proteins involved in

membrane trafficking including Rab GTPases, annexins and flotillins; MVB

biogenesis specific proteins, such as integrins and tetraspanins e.g. CD63, CD9,

CD81, CD82; conserved proteins like heat shock cognate 70kDa protein (hsp70)

and CD63; cytoskeleton related proteins including tubulins, myosin, β-actin and

other proteins like major histocompatibility complex (MHC) class I and II

molecules (Simons et al., 2009; Thery et al., 2009; Simpson et al., 2009).

Exosomes play a crucial role in many biological processes including injury and

the immune response, through transfer of antigens, antigen presentation (Thery et

al., 2002; Duijvesz et al., 2011) and shuttling of proteins, mRNA and micro RNAs

between the cells (Valadi et al., 2007). They are also responsible for cell-to-cell

communication and transfer of genetic information between them (Valadi et al.,

2007). Another emerging role of exosomes is in the transfer of pathogen-derived

antigens and virulence factors (Masciopinto et al., 2004) between cells, but their

contribution towards immune control and clearance of infection by the host is still

unclear. From a therapeutic perspective, exosomes may be useful for tumour

vaccines (Tan et al., 2010), and also as effective gene delivery vehicles and tools


28

for regenerative medicine, as they can cross the blood-brain barrier (Alvarez et al.,

2011).

1.3 HCV and Exosomes

Exosomes are cell-derived vesicles, present in almost all biological fluids,

including blood, urine, and cell culture medium (Van der Pol et al., 2012; Keller

S., et al., 2006). They are enclosed in a phospholipid bilayer, measure 30-100 nm

in diameter and are formed by intracellular invaginations of multivesicular body

membranes. The MVB is a late endocytic compartment, which fuses with the

cell's plasma membrane and liberates its internal micro vesicles into the outer

environment, where they are called exosomes. Exosomes are cup-shaped

structures under electron microscopy and generally express markers of their

endosomal origin on the surface, including LAMP1, LAMP2b and ALIX-1

proteins, as well as tetraspanins CD9, CD63 and CD81 (Simpson et al., 2008;

Thery et al., 2009).

The sorting of ubiquitinated proteins on MVBs is mediated by the endosomal

sorting complex required for transport pathway. The first complex that binds the

cargo on endosomes is ESCRT-0, which has an important component, Hrs (Asao

et al., 1997; Komada and Kitamura, 1995). Hrs has also been reported to be

involved in the HCV exosomal pathway, playing an important role in HCV

release. Furthermore, HCV core protein and the envelope protein E1 have been

observed in the intraluminal vesicles of MVBs (Tamai et al., 2012).


29

One study reported the presence of viral RNA in exosomes isolated from plasma

of HCV-infected patients (Masciopinto et al., 2004) but there was no evidence of

exosome-mediated transmission of infection probably because of not using

standard procedure for exosome isolation. Recent studies have proposed that the

exosome secretory pathway could be involved in HCV virus assembly and release

from hepatocytes (Tamai et al., 2012). Exosomes derived from hepatocytes have

been shown to transfer HCV RNA to plasmacytoid dendritic cells, triggering their

activation and interferon-α production (Dreux et al., 2012). A recent study

demonstrated that exosomes can transfer HCV to other hepatocytes and are

partially resistant to antibody neutralization, thus contributing further to the

known immune evasive properties of the virus (Ramakrishna et al., 2012). In

hepatitis B virus infection, cell-to-cell transfer of IFN-α induced antiviral activity

is mediated by exosomes. IFN-α is an approved treatment of chronic HBV

infection with a response rate of 30–40%. The IFN-α induced antiviral response

was transmitted through exosomes, from liver non-parenchymal cells to HBV-

infected hepatocytes (Li et al., 2013). This intercellular transfer of exosomes

bypassed the viral inhibition of interferon-induced gene expression, restoring the

antiviral state in virus-infected cells (Li et al., 2013).

In spite of all the research into the role of exosomes in HCV transmission, there

are some discrepancies, which need to be addressed. Technically it is a challenge

to completely separate viral particles from exosomes, because both have

overlapping densities. The buoyant density of exosomes is 1.10-1.19 g/ml, while

that of HCV virus particles is 1.06 to 1.16 g/ml in blood or infected cell


30

supernatant (Dao et al., 2012). Furthermore, neutralizing antibodies (from patient

sera) directed against HCV surface glycoproteins enhance rather than neutralise

exosomes isolated from cells containing a HCV subgenomic replicon (SGR),

which produce only non-structural proteins. These results suggest the possibility

of different mechanisms for transmission of HCV, either as discrete viral particles

or in exosomes (Cosset et al., 2014). However there are still many unanswered

questions regarding the role of exosomes in HCV transmission.

1.4 SILAC Screening and Identification of Calsyntenin-1

To look for novel cellular proteins involved in HCV replication, preliminary work

in our laboratory compared cell culture media from infected and uninfected cells,

to look for altered proteins. Cell culture media from HCV (JFH1) infected hepatic

(Huh7) cells was compared with media from uninfected Huh 7 cells, using Stable

isotope labelling with amino acids in cell culture (SILAC) based mass

spectrometry screening (CLAIR: Comparison of isotope-labelled amino acid

incorporation rates). This is a reliable technique, which involves incorporation of

labelled amino acids into proteins for mass spectrometry-based quantitative

proteomics. It relies on the metabolic incorporation of amino acids with

substituted stable isotopic nuclei into proteins. Two different cell populations are

grown under identical culture conditions, except that the media for one of them

contains a light or heavy form of a particular amino acid. When the cells grow,

that particular amino acid is incorporated into newly synthesized proteins. After a

number of cell divisions, supernatants are subjected to mass spectrometry, which

is an analytic technique that utilizes the degree of deflection of charged particles,


31

by a magnetic field, to find the relative masses of molecular ions and fragments.

The mass to charge ratio (m/z) of the fragments is recorded by a detector that

quantifies sorted ions in the form of peaks. The metabolic incorporation of amino

acids into proteins results in a mass shift, which is detected by the mass

spectrometer. When both samples are mixed, the ratio of peak intensities in the

mass spectrum reflects the relative protein abundance (Figure 1.10).

In this experiment, HCV-infected and uninfected control cells were labelled with

“Heavy” or “medium” isotopes of arginine (Cambridge Laboratories U-13C6

units–15N4 arginine CNLM-539 or U-13C6 arginine CLM-2265 0.021 g/l) and

lysine (Cambridge Laboratories U-13C6 units-15N2 lysine CNLM-291 or 4,4,5,5-

D4 lysine CNLM-2640 0.0365g/l), respectively. After 48 h, media from infected

and control cells was mixed in equal proportions and proteins were analysed by

mass spectrometry. Incorporation of amino acid isotopes results in a shift in

molecular mass to charge (m/z) ratio. Peak heights were measured, and their ratios

used to determine the relative abundance of proteins from both samples.


32

Figure 1.10 SILAC (Stable isotope labelling with amino acids in cell culture).

Two cell populations are labelled with different isotopes and then incorporation

of specific amino acid into newly synthesized protein is determined using mass

spectrometry. This detects differences in protein abundance between different

samples.

One of the proteins that was found to be most increased in media from infected

cells was calsyntenin-1, with an infected/uninfected ratio of 43.53 (i.e. 44-fold

increase). This was the first time that calsyntenin-1 had been found to be

upregulated in media from HCV-infected cells, but its significance was unclear.


33

Thus, the major aim of this project was to determine the role of calsyntenin-1

in the HCV life cycle. Different stages of the life cycle, including HCV entry,

replication and egress, were studied in detail with respect to the potential role

of calsyntenin-1.

Interestingly, a recent report characterizing the proteome of calsyntenin coated

organelles in neurons showed that these vesicles contain components of the

endosomal trafficking pathway (Steuble et al., 2010). As detailed in section

1.1.3.1, HCV entry involves early endosomes, which undergo acidification to

release virus into the cytoplasm. We therefore hypothesised that calsyntenin-1

may be involved in HCV transport following receptor-mediated entry. However it

may also play roles later in the life cycle, including assembly and egress,

particularly as there was increased secretion of calsyntenin-1 into the supernatant

of infected cells.

1.5 Calsyntenins

Calsyntenins are type I trans-membrane proteins that are members of the cadherin

superfamily (Hintsch et al., 2002; Vogt et al., 2001). They are Ca2+-binding

proteins that localize to postsynaptic membranes in excitatory neurons, where

they modulate calcium-mediated postsynaptic signalling and cell adhesion. In

birds and mammals, there are three types of calsyntenin i.e. Calsyntenin-1,

Calsyntenin-2 and Calsyntenin-3, with a single ortholog in nematodes (CASY-1)

(Vogt et al., 2001; Hintsch et al., 2002; Ikeda et al., 2002). Calsyntenin-2 and

calsyntenin-3 are found in GABAergic neurons (Hintsch et al., 2002).


34

1.5.1 Calsyntenin-1

Calsyntenin-1 (also known as Alcadein-α) is a member (140 - 150 kDa) of the

Alcadein family of molecules, which are expressed in the ER/Golgi and on the

plasma membranes of almost all neurons (Vogt et al., 2001). It is a type 1

membrane spanning protein and is evolutionarily conserved. The calsyntenin-1

gene has been mapped to chromosome 1p36 by genomic sequence analysis

(Hintsch et al., 2002). Calsyntenin-1 protein is abundant in neurons, where it takes

part in transport of vesicles, especially along axons (Ludwig et al., 2009; Hintsch

et al., 2002). It is reported to interact with kinesin light chain 1 (KLC1), through

C-terminal intracellular domain sequences (Araki et al., 2007; Konecna et al.,

2006).

Calsyntenin-1 is a type 1 transmembrane cargo docking protein with a role in

kinesin-1 mediated trafficking (Hintch et al., 2002). There are two calsyntenin-1

splice variants i.e. calsyntenin-1 isoform 1 and calsyntenin-1 isoform 2. Isoform 1

is the key gene product, while isoform 2 has 10 extra amino acids in the N-

terminal extracellular domain. Mature human calsyntenin-1 is a 953 amino acid

(aa) type I transmembrane protein. It contains two cadherin domains (aa 38 - 265)

in its extracellular region (aa 29 - 859) and a 101 aa cytoplasmic tail. Extracellular

cleavage occurs between Met825 and Ala826, releasing a 115 kDa soluble

extracellular domain. Isoforms involve a 78 aa substitution for aa 917 - 981, plus

deletions of aa 72 - 81 and 507 – 525 (Araki et al., 2004). It is reported that the

cytoplasmic domain of calsyntenin-1 contains two tryptophan- and aspartic acid


35

(WD)-rich sequences, separated by an asparagine-proline (NP) motif and an

acidic region (Araki et al., 2007)

1.5.2 Calsyntenin-1 Cleavage

Calsyntein-1 is a type I transmembrane protein which is constitutively cleaved by

disintegrin and metalloproteinase (ADAM) 10 or 17 enzymes. Cleavage at its

trans-membrane domain is a critical step for its activation, modification and for its

proper functioning. This is similar to other membrane bound proteins that undergo

proteolysis, either constitutively or in response to external stimuli (Maruta et al.,

2012).

Cleavage of calsyntenin-1 gives rise to a N-terminal extracellular ectodomain and

C-terminal intracellular fragment (Hata et al., 2009). The C-terminal intracellular

fragment is further digested by c-secretase to produce a N-terminal fragment

(NTF) and C-terminal fragment (CTF), as shown in figure 1.11 (Araki et al.,

2004). However, the role of constitutive cleavage of type I membrane spanning

proteins remains unclear (Maruta et al., 2012).


36

Figure 1.11 Post-translational processing of calsyntenin-1. The calsyntenin-1

protein consists of 981 amino acids and undergoes two sequential constitutive

cleavages. The final cleavage results in a N-terminal peptide and C-terminal

cytoplasmic fragment.

1.5.3 Role of Calsyntenin-1 in Endosomal Trafficking in Neurons

Calsyntenin-1 is expressed predominantly in kidney and brain, while low levels

are present in heart, skeletal muscle, liver, placenta, pancreas and lung (Ludwig et

al., 2009). Previous studies of calsyntenin-1 in neurons have focused on its role in

transporting axonal vesicles containing amyloid precursor protein (APP). An

siRNA mediated loss of calsyntenin-1 interrupted this trafficking, leading to

altered APP processing and up regulation of amyloid-β (Aβ). This is the condition

seen in Alzheimer's disease, which shows accumulation of Aβ within amyloid


37

plaques (Vagnoni et al., 2012). A recent report characterising the proteome of

calsyntenin coated organelles in neurons showed that these vesicles contain

components of the endosomal trafficking pathway i.e. early and recycling

endosomes (Araki et al., 2004).

Different domains of calsyntenin-1 after cleavage events are involved in different

endosome based pathways in neurons. Two types of endosomal populations are

characterised which contain calsyntenin-1 with (1) APP and early-endosomal

markers (Rab5A); and (2) recycling endosomal markers (Rab11) and no APP

(Figure 1.12). It has also been reported that Rab5 positive early endosomes

contain calsyntenin-1 in the cleaved form (CTF), while its full-length form is

present in TGN derived, APP positive carriers (Steuble et al., 2010) (Figure 1.12).

Another recent study highlights the involvement of calsyntenin-1 in endosomal

transport in different neuronal compartments, by showing an in vivo role of

calsyntenin-1 in endosomal dynamics; and their transport from cell body to axons

(Ponomareva et al., 2014). These studies further indicated a role of calsyntenin-1

in endosome-based trafficking; involving early and recycling endosomes.

Therefore, we hypothesised a possible role for this protein in HCV pathogenesis,

involving endosomal pathways.


38

Figure 1.12 Calsyntenin-1 mediated, kinesin-1 dependent vesicle transport.

Calsyntenin-1 is involved in two pathways: 1) APP and Rab5-positive early

endosome pathway. 2) Rab11-positive, APP-negative recycling pathway (Hirano

& Takeichi., 2012).

1.6 Intracellular Transport Mechanisms

Mammalian cells are enclosed by a plasma membrane and have complex

intracellular structures, resulting in slow internal diffusion rates. To overcome this

obstacle, cells have developed active intracellular transport mechanisms, which

direct materials to the appropriate compartments (Kamal & Goldstein., 2000).


39

1.6.1 Cytoskeleton

The cytoskeleton is a network of protein fibres throughout the cytoplasm that

gives cells a definite shape. It is dynamic, constantly destroying fibres, renewing

them, recycling the building blocks and even producing them de novo (Alberts,

Bruce., 2008). It consists of three different types of filaments: a) Microfilaments,

which are composed of actin; b) Intermediate filaments with 70 different types of

building blocks, including keratins or lamins and c) microtubules, made up of

tubulins (Herrmann et al., 2007). The two main transport systems involve either

actin filaments (for short range transport) or microtubules (for long range

transport). Transport of membrane bound vesicles along cellular microtubules is

mediated by the cytoskeletal molecular motors kinesin and cytoplasmic dynein.

Actin filaments are localized near the plasma membrane, while microtubules are

present throughout the cell. Most viruses bypass the actin barrier by entering the

cell via the endocytic route, either by interactions with tubulins or by the

endogenous endocytic pathway (Luby-Phelps, 2000; Dohner and Sodeik, 2005;

Smith & Enquist, 2002).

1.6.1.1 Actin Filaments

Actin filaments promote intercellular communication, maintain cell shape and

movement, assist phagocytosis, and regulate the distribution of organelles within

cells (Pollard et al., 2009). The actin cytoskeleton is highly dynamic and is mainly

controlled by members of the RHO-family GTPases, which regulate several signal


40

transduction pathways, thereby linking the cytoskeleton with membrane receptors

(Schmitz et al., 2000).

Actin filaments (F-actin) dynamically play a vital role in the process of

endocytosis, including membrane invagination involving clathrin coated pits,

vesicle formation and transport of vesicles away from the plasma membrane.

Local disruption of actin filaments paves the way for nascent vesicles to go deep

down into the cytoplasm and to interact with microtubules (Apodaca, 2001).

1.6.2 Microtubules

Microtubules are the most vital component of the cytoskeleton and spread

throughout the cytoplasm. These are polarized cytoskeletal filaments, which

transport (based on their polarity) different cellular cargoes such as membranous

organelles and proteins to their particular subcellular destinations (Gunderson,

2002). They are involved in maintaining cell shape, by coordinating with

microfilaments and intermediate filaments (Vale., 2003), while on the other hand

they also play a vital role in cellular processes like mitosis, secretion, cell motility

and cell polarization.

In eukaryotes, microtubules are formed by the polymerization of alpha and beta

tubulin heterodimers into linear protofilaments (Li et al., 2012). One microtubule

consists of 10 - 15 protofilaments, forming a 24 nm wide hollow cylinder (Figure

1.13). The polar nature of microtubules depends on the association of alpha and

beta heterodimers and displays different polymerization rates at each end. The fast


41

growing plus end comprises beta tubulin, while alpha tubulin is oriented towards

the minus end (Conde & Cáceres., 2009).

Figure 1.13 Microtubule structure, showing the arrangement of tubulin

macromolecules. Microtubules are formed by the polymerization of tubulin

heterodimers. The plus end has alpha-tubulin while beta-tubulin is present at the

minus end of the microtubule structure. (Adapted from

http://www.utm.utoronto.ca/~w3bio315/picts/lectures/lecture11/Microtubule2.jpg

The plasma membrane of most epithelial cells has an apical domain at the cell

apex which are localized to the lumen of their respective organ, while the rest of

the membrane has a basolateral domain. In contrast, hepatocytes have several

apical poles and basolateral domains. Apical poles constitute a network of bile

canaliculi, into which bile is secreted, whereas the basolateral surface faces


42

sinusoidal blood circulation. The maintenance of this polarized nature is due to

tight junctions and is very important for proper liver functioning (Decaens et al.,

2008). HCV particles in the blood enter the hepatocyte via receptors expressed at

the basal surface, in contrast to many other viruses like rhinovirus, respiratory

syncytial virus, influenza, enteroviruses and rotavirus, that infect the polarized

epithelial linings via the apical membrane (Harris et al., 2013). Figure 1.14 shows

microtubule organization in different cell types and directions of motor mediated

trafficking.

Figure 1.14 Diagrams of microtubule organisation in a variety of cell types. (A)

Non-polarised cell (B) polarised cell (C) ciliated cell (D) neurone (E) rod

photoreceptor. + and -, Polarity of microtubules; Nuc, nucleus. Likely directions

of motor-mediated movements are indicated (reproduced with permission from

Goldstein and Yang, 2000).


43

1.6.1.3 Kinesin and Dynein Motors

Mammalian cells contain complex intracellular structures that result in slow

diffusion rates in the cell. That is why cells have developed active intracellular

transport systems for the transport of materials to their appropriate destinations

(Kamal et al., 2000). The most common method is through membrane bound

vesicles carried by molecular motors attached to the cytoskeleton. Kinesin or

cytoplasmic dynein motors are responsible for long-range vesicle transport along

microtubules, while myosin motors mediate short range transport along actin

filaments (Goldstein., 2001). Microtubules are polarised, and typically grow out

from the MTOC (minus end) towards the plus end (Figure 1.15).

The kinesin family of motors typically moves cargo towards the plus end of

microtubules, while cytoplasmic dynein is the main minus-end directed motor

(Goldstein., 2001). Kinesin use microtubules as a “rail” to conduct anterograde

(plus-end directed) transport in neuronal axons, or towards the cell periphery in

non-polarised cells, by utilizing chemical energy from ATP (Hirokawa et al.,

2005). Kinesin motors are a heterotetramer complex composed of two heavy

chains and two light chains (Hirokawa et al., 1989). On the other hand,

cytoplasmic dyneins are minus-end directed motors that use microtubules to drive

retrograde transport in axons and transport towards the nucleus in non-polarised

cells (Brown., 2003) (Figure 1.16).

It is been reported that kinesin light chain 1 (KLC1) binds to the intracellular

cytoplasmic domain of the type 1 membrane spanning protein calsyntenin-1

(Vagnoni et al., 2011). Moreover, calsyntenin-1 mediates trans-Golgi network exit


44

of β-amyloid precursor protein (APP) in neuronal cells (Konecna et al., 2006).

This phenomenon has been extensively studied in neurons because of their

particular requirement for long-range transport along axons.

Figure 1.15 Kinesin and Dynein move along a microtubule in opposite

directions. Kinesin and dynein consist of two parts called light and heavy chains.

Light chains bind cargo while heavy chains carry out ATP hydrolysis (Adopted

from http://creationrevolution.com/walking-molecules-%E2%80%93-simple-cell-

%E2%80%93-part-4/).

Kinesin undergoes conformational changes with the help of ATP to generate

motile force for anterograde transport within the cell. Two members of the kinesin

family interact with early endosomes i.e. kinesin 1 and kinesin 3 (Hirokawa et al.,

2009). Specifically, Kif5b and Kif16b are involved in the trafficking and tubule

formation of early endosomes (Hoepfner et al., 2005, Nath et al., 2007).


45

Figure 1.16 Intracellular transport mechanism involving microtubular motors

kinesin and cytoplasmic dynein, which bind vesicular cargos and mediate plus

and minus end directed movement respectively. (Adopted from

https://wikispaces.psu.edu/display/Biol230WFall09/The+Cytoskeleton).

1.7 Calsyntenin-1 and Kinesin Light Chain 1

In calsyntenin-1 two-conserved L/M-E/D-W-D-D-S motifs in the cytoplasmic

domain, termed KBS1 and KBS2, are responsible for its interaction with KLC1,

via its tetratricopeptide repeat (TPR) domains (Figure 1.17). Mutations in these

motifs abolish binding of calsyntenin-1 to KLC1 in vitro and alter calsyntenin-1

mediated transport in neurons. The interaction of calsyntenin-1 with KLC1 acts as

an adapter to the microtubule based motor for vesicular cargo. Calsyntenin-1 links

TGN derived carriers (endosomes) to kinesin-1 motors and mediates anterograde

transport along axons (Steuble et al., 2010). Phosphorylation of KLC1 ser460 is a


46

mechanism for regulating the binding and trafficking of calsyntenin-1 (Araki et

al., 2007).

Figure 1.17 Model explaining the Calsyntenin-1/Kinesin-1 cargo docking

complex. In vivo the transport complex is composed of four calsyntenin-1

molecules and one kinesin-1 motor, based on 1:2 stoichiometry (Ludwig et al.,

2009).

Furthermore, calsyntenin-1 is not just a passive cargo of kinesin-1, but activates

kinesin-1 without requiring any other host factors (Kawano et al., 2012; Cai et al.,

2007). The function of the N-terminal domain of calsyntenin-1, which contains

two cadherin like structures, is still unknown (Maruta et al., 2012).

Overexpression of calsyntenin-1 and KLC1 induce aberrant membrane stacks at


47

the ER or Golgi, which interrupt Golgi structure and block exit of TGN mediated

calsyntenin-1. In neurons, this disruption leads to impaired exit of TGN derived

amyloid precursor protein (Ludwig et al., 2009).

1.8 Role of Cytoskeleton in HCV Pathogenesis

Viruses hijack the endocytic pathway for their replication and progression, as they

typically encode few genes and depend on host factors for their survival. It has

been extensively shown in different studies that the retrograde and anterograde

movement of viruses in the cell is dependent on microtubules and their associated

motors i.e. kinesin and dynein (Dohner et al., 2005; Dodding and Way, 2011). It

is now well known that microtubules are the key players in the transport of

viruses from the cell periphery to the perinuclear region, but the exact mechanism

adopted by different viruses is still under investigation (Shu-Lin et al., 2014).

It has been reported that MTs play a key role in the early stages of HCV infection,

leading to an established, productive infection. It was shown using the JFH1 cell

culture model that drugs which disrupt microtubules (nocodazole), inhibit tubulin

polymerization (vinblastin), or stabilize microtubules (paclitaxel), hindered early

steps of HCV infection. In contrast, an actin inhibitor (cytochalasin D) showed no

direct effect on HCV (Roohvand et al., 2009). Previous studies have shown an

association of HCV non-structural proteins (NS5A and NS5B) with vesicle-

associated membrane protein-associated protein (VAP) subtype A (VAP-A) and

VAP subtype B (VAP-B), suggesting an important role in the formation of

replication complexes (Gao et al., 2004; Hamamoto et al., 2005). Significantly,


48

both VAP subtypes are also involved in vesicle transport (Lapierre et al., 1999)

and interactions with microtubule networks (Soussan et al., 1999).

Lipid droplets are lipid-containing structures or adiposomes present in lipid

storing cell organelles like adipose tissue and regulate the storage and hydrolysis

of neutral lipids (Martin et al., 2006; Mehta., 2013). It has been shown that HCV

assembly occurs in association with lipid droplets (LDs), which are coated by

HCV core protein (Miyanari et al., 2007). Colocalization of core and Adipocyte

differentiation-related protein (ADRP) by confocal microscopy confirms an

association between core and LDs (Serfaty et al., 2001). It is well established that

LDs move in Huh7 cells in a microtubule dependent manner (Targett-Adams et

al., 2008). The presence of the motor proteins kinesin and dynein has been

confirmed by several co-immunoprecipitation studies with ADRP (LD protein)

and by immunoflourescence (Gross et al., 2006; Bostrom et al., 2005). It is

believed that the formation and growth of LDs is dependent on these motor

proteins and microtubules (Andersson et al., 2006).

HCV replicates in the ER regions close to the nucleus, in close proximity to LDs

(Targett-Adams et al., 2003). HCV core protein induces redistribution of LDs to

the perinuclear region, a process that involves microtubules and cytoplasmic

dynein (Boulant et al., 2008). The interaction between lipid droplets and

endosome trafficking is attributed to the presence of GTPase Rab5 and Rab11 on

the LD surface (Schmitz et al., 1985).


49

1.9 Summary

The Hepatitis C Virus (HCV) RNA genome of 9.6 kb encodes only 10 proteins,

so is highly dependent on host hepatocyte factors to facilitate replication. In this

project we initially aimed to identify the host factors involved in the egress of

viral particles. By screening the supernatant of HCV-infected hepatocytes using

SILAC based proteomics, we identified the transmembrane protein calsyntenin-1

as a factor predominantly secreted by infected cells.

Using a HCV cell culture model we systematically analysed the role of

calsyntenin-1 at various stages of the HCV life cycle, including entry, replication

and egress. We show that calsyntenin-1 mediates the export of a subpopulation of

viral particles, secreted through exosomes, and is also involved at several stages

of HCV replication cycle. Calsyntenin-1 is involved in early stages of the viral

replication cycle, namely the uptake of virus into early endosomes, and also the

function of the replication complex. It mediates these functions through its

interaction with KLC1, facilitating transport along the microtubule network. The

involvement of calsyntenin-1 in multiple stages of HCV replication demonstrates

its importance to the virus. This makes calsyntenin-1 a potential host target for

inhibiting HCV replication, which could guide the development of new antiviral

compounds, for use in combination with existing DAAs.


50

1.10 Hypothesis and Aims

Our hypothesis is that “Calsyntenin-1 is involved in the transport of HCV during

HCV early infection; replication and egress via exosomes, by acting as an adaptor

to kinesin light chain 1”.

In this thesis, this hypothesis will be tested in the following specific aims:

1. To evaluate how calsyntenin-1 is involved in HCV pathogenesis

2. To study the effect of calsyntenin-1 on HCV early infection, by evaluating its

association with early endosomes and kinesin light chain-1.

3. To investigate the association of calsyntenin-1 with the establishment and

transport of HCV replication complexes.

4. To examine the role of calsyntenin-1 in HCV assembly and egress.

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Chapter(2:(Materials(&(Methods(

51

CHAPTER 2: MATERIALS & METHODS

2.1 Materials

2.1.1 Chemicals and Reagents

Mouse monoclonal antibodies against HCV core 1b (C7-50) (ab2740), KLC1

(ab23586), EEA1 (ab70521) and Rab11A (ab170134) were purchased from

Abcam. J2 antibody for dsRNA (J2-1406) was purchased from Scions, Hungary.

HCV anti-mouse monoclonal core antibody (C65185M) was purchased from

Meridian life sciences, USA. HCV rabbit anti-core (308) antibody and sheep

polyclonal antibody against HCV NS5A were gifts from Dr. John McLauchlan

and Professor Mark Harris (University of Leeds, UK), respectively. Antibodies

against CD63 (CBL553), Calsyntenin-1 (3176-1), and Transferrin receptor (13-

6800) were purchased from Millipore, Epitomics, and Invitrogen, respectively.

DAPI (4', 6-diamidino-2- phenylindole), Alexa 488-conjugated Donkey-anti-

Rabbit secondary antibody, Alexa 594-conjugated Donkey-anti-sheep secondary

antibody and Prolong GOLD mounting medium was purchased from Invitrogen.

Horseradish peroxidase (HRP) conjugated secondary antibodies and Duolink In

situ Detection Reagents were purchased from Sigma-Aldrich. Chambered cover-

glass slides for live cell imaging were purchased from Lab-TekTM II

Bovine serum albumin (BSA) was purchased from Sigma-Aldrich. 100% (w/v)

Foetal calf serum (FCS) and Opti-MEM media were purchased from Gibco BRL.

Dulbecco`s Modified Eagle Medium (DMEM) and phosphate buffered saline

(PBS) were purchased from Lonza.


52

Taq DNA Polymerase (recombinant), Lipofectamine® RNAiMAX (13778100),

Superscript III First Strand cDNA Synthesis kit, RNAiMAXTM transfection

reagent, Taq Polymerase, deoxynucleotides, 10,000X SYBR green, DTT and

Trizol®LS Reagents were purchased from Invitrogen. T7 RiboMAXTM Express

Large Scale RNA production System was purchased from Promega. Primers were

purchased from Geneworks and TaqMan® primer probes were purchased from

Applied Biosystems. MasterAmp PCR optimization kit was purchased from

Epicentre Biotechnologies. Calsyntenin-1 siRNA was purchased from OriGene

(SR307847).

Tetramethylethylenediamine (TEMED), ammonium persulphate (APS), Triton X-

100 were purchased from Sigma-Aldrich. DCTM protein assay kit, 30%

acrylamide and nitrocellulose paper were purchased from Bio-Rad. PageRulerTM

Plus pre-stained protein ladder, SuperSignal West pico-chemiluminescent

substrate and SuperSignal West femto- chemiluminescent substrate were

purchased from Thermo Scientific. Polyvinylinede fluoride membrane was

purchased from Millipore.

2.1.2 Cell Lines

Huh 7 is a human hepatocellular carcinoma cell line of epithelial-like tumorigenic

cells that was originally isolated from a liver tumor in a 57-year-old Japanese

male in 1982 (Nakabayashi et al. 1982). Huh 7 and Huh 7.5 cell lines were kind

gifts from Dr John McLauchlan (MRC Virology Unit, Glasgow, UK) and

Associate Prof. Michael Beard (Hepatitis C Virus Pathogenesis Laboratory,

Adelaide, Australia), respectively. The Huh 7 cell line was derived from a patient


53

with hepatocellular carcinoma and was the first cell line shown to support HCV

replication (Lohmann et al. 2003). The Huh 7.5 cell line is a derivative, isolated

from Huh7 cells that had been infected with a HCV subgenomic replicon, then

cured using interferon-alpha (Blight et al. 2002; Murray et al. 2003). These cell

lines were incubated in normal culture condition (37 °C, 5% CO2).

2.1.3 Plasmids

Sub-genomic replicons based on JFH1 i.e. pSGR-luc-JFH1, pSGR-luc-JFH1-

GND for transient replication assay and pSGR-EGFP-Luc-JFH1 for live cell

imaging were kindly provided by Dr John McLauchlan (MRC Virology Unit,

Glasgow, UK) and pEGFP-N1 and pDsRed-Monomer-C1 plasmids were

purchased from OriGene. Jc1 is a GT2a/2a chimera consisting of J6CF- and

JFH1-derived sequences was a gift from Dr. Thomas Pietschmann (TWINCORE,

Germany).


54

2.2 Methods

2.2.1 Preparation of HCV RNA

Plasmids for HCV sub genomic replicons (pSGR-luc-JFH1 & pSGR-luc-JFH1-

GND) were transfected (2 µl) into 10 µl XL10-Gold®Ultracompetent Cells

(Stratagene) and cloned as described below in section 2.2.6. The plasmids were

linearized at the end of the HCV genome after 3` UTR with the restriction

enzyme XbaI (Promega) while JC1 was linearized using MluI (Biolabs) overnight

at 37 °C according to manufacturers instructions.

The 4 terminal nucleotides produced by linearization were removed by treatment

with 1 µl mungbean nuclease (New England Biolabs) for 45 min at 30 °C,

resulting in the correct 3’-end of the HCV DNA. Mungbean nuclease was

inactivated with the addition of 0.1 % w/v SDS and the DNA purified by

phenol/chloroform extraction and ethanol precipitation before being resuspended

in RNase free water. After precipitation and purification of plasmid DNAs, HCV

RNA was transcribed in vitro using the T7 RiboMAXTM Express RNAi System

(Promega). RNA was then quantified using a NanoDrop ND1000

spectrophotometer and RNA integrity was checked by agarose gel

electrophoresis.

2.2.2 Transfection

Huh 7 cells were cultured in T150 flasks until they were 50%-80% confluent.

Cells were then dissociated with trypsin (0.25% for 3 min) to get a single cell


55

suspension and washed twice in 40 ml PBS. 2 ×107 cells per electroporation were

re-suspended in 800 µl PBS and were then transferred to 4 mm electroporation

cuvettes. Ten µg purified viral RNA was added to each cuvette and gently mixed.

Electroporation was performed with a single pulse at 0.34 kV, 974 µF.

Electroporated cells were transferred to T25 flasks and mixed with 5 ml complete

media (DMEM+ 10% FCS). Cells were then incubated at 37 °C for 3 days and

viral protein expression was checked by fluorescence microscopy using an

antibody against HCV NS5A (Gift from Professor Mark Harris, University of

Leeds, UK) (Section 2.2.7.2).

Transfection of pSGR-EGFP-Luc-JFH1, pEGFP-Rab5a and pDsRed-CLSTN-1

plasmids into cultured cell lines for live cell imaging was performed using

FuGENE HD Transfection Reagent (Promega), according to manufacturer’s

instructions. In brief, cells were cultured in 4-chambered cover-glass slides (Lab-

Tek II) for one day before transfection. One µg DNA plasmid and 3 µl FuGENE

HD were mixed with 100 µl of Opti-MEM, generally with a DNA:FuGENE ratio

of 1:3. After 15 minutes of incubation at room temperature the transfection

mixture (40 µl) was added to each chamber containing 1 ml media and cells were

incubated in normal culture condition (37 °C, 5% CO2). Cells were then observed

live on Deltavision microscope for different time points as needed.

2.2.3 RNA extraction

Total RNA was extracted from cell culture monolayers using the Qiagen RNeasy

Kit, according to the manufacturer’s instructions. All buffers were ready to use.


56

In brief, cells in six well plates were lysed in 350 µl of RNeasy Lysis buffer and

transferred to a new RNase free tube. Next, 350 µl of 70% ethanol was added to

each cell lysate and mixed thoroughly. Total 700 µl of sample solution was

applied to a RNeasy spin column with collection tube and centrifuged for 30

seconds at 10,000 RPM. The flow-through was discarded and 700µl wash buffer

RW1 was added to each spin column and centrifuged for 30 seconds at 10,000

RPM. After transferring the spin column to a clean tube 500 µl of second wash

buffer RPE was applied to each column and the tubes centrifuged as above. This

step was repeated; RNA was eluted from the spin column with 50µl of RNase

free water and centrifuged for 1 minute at 10,000 RPM into a clean, RNase free

tube. Eluted RNA was quantified using a NanoDrop ND1000 spectrophotometer

and stored at -80 °C for subsequent experiments. Extraction of RNA from

supernatants was performed using trizol® LS reagent (Invitrogen) following the

manufacturer’s instructions.

2.2.4 cDNA Synthesis

cDNA was reverse transcribed from total RNA using M-MLV reverse

transcriptase (Promega) according to the manufacturer’s instructions. In brief, 0.5

µg RNA and 250 ng/µl random hexamer prmiers (Invitrogen) were added to a

sterile RNase free microcentrifuge tube in a total volume of ≤ 15 µl water. The

mixture was incubated at 70 °C for 5 minutes to melt the mRNA secondary

structure. The tubes were immediately cooled on ice for at least 1 minute. A

reaction mixture containing 1× M-MLV reaction buffer (Promega), 0.5 µM each

dNTPs (Invitrogen), 40 units RNase Ribonuclease (RNase) Inhibitor (Invitrogen)


57

and 200 units M-MLV RT was prepared and added to primer/template tube.

Samples were mixed gently and incubated for 60 minutes at 37 °C. The

synthesized cDNA was stored at -20°C for further experiments.

2.2.5 Construction of Fluorochrome-tagged constructs

Primer sequences for amplification of Rab5a and various domains of the

calsyntenin-1 gene are listed in the table 2.1 below. Oligonucleotide primers,

incorporating EcoRI, BamHI and/or XhoI restriction endonuclease sites, were

designed using Primer3 software (Rozen and Skaletsky, 2000) (http://www-

genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi.

Table 2.1: Forward and Reverse Primer Sequences for Rab5A and

Calsyntenin-1 Coding Regions.

Genes Insertion Primer sequence

Full Length Rab5F Xho1 5` TTTTTGCATGCGGCTAGTCGAGGCGCA 3`

Rab5R BamH1 5`

AAAAAGGATCCAGTTACTACAACACTGATTCCT

3`

Full Length

Calsyntenin-1

XhoCAF Xho1 5’ TTTTTCTCGAGGCGCGAGTTAACAAGCAC 3`

EcoCTR EcoR1 5`AAAAAGGAATTCGTAGCTGAGGGTGGAGTC 3`

Calsyntenin-1

C-Terminal

fragment

XhoCTF Xho1 5’ TTTTTCTCGAGGAACACCACCGCTCCTTTGTTG

3’

EcoCTR

EcoR1

5`AAAAAGGAATTCGTAGCTGAGGGTGGAGTC 3`


58

PCR amplification was performed using the Hybrid PCR Sprint Thermal Cycler

(Thermo Scientific), high fidelity KOD Hot start DNA polymerase (Novagene)

and MasterAmp PCR optimization kit (Epicentre Biotechnologies). PCR reaction

components are listed in Table 2.2.

Table 2.2 PCR Reaction Contents

Components Volume Final

Concentration Rab5a Calsyntenin-1

2X Buffer D for KOD Hot Start DNA Polymerase

including dNTPs

10 µl 10 ul 1 X

Forward Primer

(10µM)

1 µl 1 µl 0.5 µM

Reverse Primer

(10µM)

1 µl 1 µl 0.5 µM

Template cDNA 1 µl 5 µl

KOD Hot Start DNA Polymerase

(1U/µl)

0.4 µl 0.4 µl 0.02 U/ µl

Total Reaction volume 20 µl 20 µl


59

PCR reaction conditions for the amplification of Rab5a comprised initial

denaturation at 95 °C for 3 minutes, followed by 30 cycles of 95 °C for 30

seconds, 55 °C for 30 seconds and 72 °C for 3 minutes, with final extension of 72

°C for 10 minutes. On the other hand, Calsyntenin-1 PCR reaction conditions

included initial denaturation at 95 °C for 3 minutes, followed by 40 cycles of 95

°C for 30 seconds, 59 °C for 30 seconds and 72 °C for 3 minutes, with final

extension of 72 °C for 10 minutes. PCR products were separated by agarose gel

electrophoresis and DNA bands were visualized under ultraviolet light on a Gel

Documentation system (FisherBiotec).

2.2.6 Cloning

Amplified purified PCR product from the Rab5a, full length calsyntenin-1 and

calsyntenin-1 CTF amplification, pDsRed-Monomer-C1 plasmid and pEGFP-N1

were digested with corresponding restriction endonucleases (Table 2.3), gel

purified by phenol/chloroform extraction and ethanol precipitation before being

resuspended in RNase free water, and PCR products were inserted by ligation

using T4 DNA ligase Kit (New England Biolabs) according to manufacturer’s

instructions. For cloning into plasmid, 2 ul of the each ligated product was added

to 10 ul XL10-Gold®Ultracompetent Cells (Stratagene) and incubated on ice (4

oC) for 10 minutes. Heat shock was given to the cells by placing them in a

waterbath at 42 oC for 1 minute, the cells were put back on ice for 1-2 minutes,

then spread on LB-agar plates containing ampicillin (100 µg/ml) or kanamycin

(30 µg/ml) and incubated overnight at 37 °C. After 16 hours, bacterial colonies

were selected and prepared for DNA plasmid extraction.


60

Table 2.3 List of Restriction Endonuclease used for Digestion of Live Cell

Imaging Constructs.

DNA plasmid extraction was performed using QIAprep Spin Miniprep Kit

(QIAGEN) according to manufacturer’s instructions. Gene specific PCR was

performed to check for the presence of the gene of interest in isolated plasmids.

One colony from bacteria containing suitable plasmids was selected and maxi

prep for DNA plasmid extraction was performed using Plasmid Maxi Kit

(Qiagen) according to the manufacturer’s instructions. It provides a sufficient

quantity of the plasmid for future use.

Correct sequence of the inserted genes was confirmed by sequencing. A total 12

µl mix of 1 µg of selected plasmids and 9.6 µM of the primers was sent to

Australian Genome Research Facility to perform the sequencing. Four sequencing

Template Endonucleases

pDsRed-Monomer-C1

plasmid

Xho1 & EcoR1

pEGFP-N1 Xho1 & BamH1

Rab5a Xho1 & BamH1

Full length calsyntenin-1 Xho1 & EcoR1

CTF -calsyntenin-1 Xho1 & EcoR1


61

reactions were run for each gene with forward and reverse primers and then

consensus sequence was obtained. This consensus DNA sequence was matched

with the original sequences of the gene by nucleotide-BLAST (Basic Local

Alignment Search Tool) software online (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.2.7 Immunofluorescence Studies

2.2.7.1 Live cell imaging

To perform live cell imaging, pEGFP-Rab5a, pDsRed-FLC and pDsRed-CTF

expression constructs and HCV construct pSGR-EGFP-Luc-JFH1 were

transfected into Huh 7 cells using FuGENE HD Transfection Reagent (Promega),

according to manufacturer’s instructions. In brief, 1 × 105 cells/well were cultured

in DMEM using chambered coverglass (Lab-TekTM II) plates for one day before

transfection. 1 µg DNA plasmid and 3 µl FuGENE HD were mixed with 100 µl of

Opti-MEM, generally with a DNA:FuGENE ratio of 1:3. After 15 minutes

incubation at room temperature the transfection mixture (30-50 µl) was added to

each well containing 1 ml media and cells were incubated in normal culture

condition (37 °C, 5% CO2). Cells were then imaged live at various time points

post-transfection, as detailed in the results section for each experiment. Velocity

was measured using inbuilt imaging software.

2.2.7.2 Immunofluorescence

To perform Immunofluorescence labelling, cells were cultured on glass sterilized

coverslips fitted in 24-well plates overnight, at a population of 1 × 105 cells/well.

The next day DMEM media was removed and cells were washed with phosphate


62

buffer saline. Cells were then fixed with methanol (-20 °C for 20 minutes) or 4%

paraformaldehyde (25 oC for 10 minutes) and permeabilised using 0.1% Triton X-

100. The blocking step was performed using PBS with 10% FCS for 1 hour. Cells

were stained with primary antibodies diluted in blocking buffer and incubated for

1 hour at room temperature or at 4°C overnight in a humidity chamber. Cells were

washed 3 times with PBS + 1% FCS, for 5 min each time, then cells were labelled

with fluorophore–conjugated secondary antibodies and DAPI (4',6-diamidino-2-

phenylindole) for nuclear staining (1/1000 for 5-10min). After 1-hour incubation

in the dark, coverslips were washed (PBS + 1% FCS) 3 times for 10 minutes and

mounted on microscopy slides using Prolong GOLD mounting medium

(Invitrogen). Pictures were taken using 60 × and 100 ×objectives on a Deltavision

Microscope (Applied Precision, Olympus IX 71). Primary and secondary

antibodies used for Immunofluorescence staining are listed in Table 2.4. Working

dilution for all secondary antibodies was 1:2000 in 1 % FCS/PBS and incubated

for 1 hour at room temperature (25 °C).

Proximity ligation assay was performed for colocalization studies of different

proteins using the Duolink Insitu assay (Olink Bioscience), according to the

manufacturer’s instructions.


63

Table 2.4: Primary and Secondary Antibody Dilutions and Incubation Timings

for Immunofluorescence labelling.

Primary Antibody Working dilution Secondary

antibody

Anti HCV Core 1:200 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor

488/594 anti

Mouse IgG

Anti HCV-NS5a 1:10000 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 594

anti

Mouse IgG

Anti- Rab11a 1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 488

anti Mouse IgG

Anti-Calsyntenin-1 1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 488

anti Rabbit IgG

Anti-EEA-1 1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 488

anti Rabbit IgG

Anti-Transferrin

Receptor

1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 488

anti Mouse IgG

Anti-CD63 1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 594

anti Mouse IgG

Anti-Kinesin Light

Chain 1

1:100 in 10%

FBS/PBS,

overnight 4°C

Alexa Fluor 594

anti Mouse IgG


64

2.2.8 Real Time PCR

2.2.8.1 qPCR for Calsyntenin-1

Real-time quantitative polymerase chain reaction (qPCR) for CLSTN-1

expression was performed using the Rotor-Gene 6000 (Corbett Research, Sydney,

NSW, Australia) and SYBR Green (Invitrogen). For each real-time qPCR

reaction conditions and all reagents are listed in Table 2.5. The primer sequences

were as follows:

qpcrForward: 5’ CAGGATTGAGTATGAGCCGG 3’

qPCRreverse: 5’ GAGTAGGTGTCTCGGTCGCAG 3’

Table 2.5 Real time PCR Reaction conditions for Calsyntein-1 using SYBR

green mix.


Concentration

Platinum SYBR Green

qPCR Master Mix

(Invitrogen)

5 µl 1X

Forward Primer (10 uM) 0.3 µl 0.3 µM

Reverse Primer (10 uM) 0.3 µl 0.3 µM

Diluted cDNA Template 0.5 µl

dH2O 3.9 µl

Total Reaction Volume 10 µl


65

2.2.8.2 qPCR for HCV

A Taqman probe (Applied Biosystems) was used for virus RNA copies within the

cells. RNA levels were normalized to 18S ribosomal RNA that gave comparable

results. Taqman gene expression assay details used for real-time qPCR are listed

in Table 2.6.

Table 2.6 HCV Real-time qPCR reaction contents using Taqman gene

expression assay.


Concentration

Master AMPTM 2X PCR

PreMix D (Epicentre)

5 µl 1 X

Taqman Gene expression

assay

0.2 µl 0.2 X

Taq DNA Polymerase

Recombinant 5U/ul

(Invitrogen)

0.2 µl 1 U

Diluted cDNA Template 0.5 µl

18s rRNA 0.2 µl

dH2O 3.9 µl

Total Reaction Volume 10 µl

Real-time qPCR reaction conditions comprised initial denaturation at 95 °C for

10 minutes, followed by 45 cycles of 95 °C for 15 seconds and 60 °C for 45

seconds. qPCR results were analyzed using Rotor-gene 6000 Corbett software.


66

The fold change of each gene was calculated using the Delta-delta Cycle

threshold (ΔΔCt) data analysis method.

2.2.9 Silencing of Calsyntenin-1 using siRNA

Calsyntenin-1 expression was silenced using Calsyntenin-1 siRNA from OriGene.

50uM of siRNA (scrambled control and calsyntenin-1 separately) was mixed with

85ul of Opt-MEM per reaction. Fore each siRNA reaction, 1.4 µl of

Lipofectamine® RNAiMAX was added to 85 µl of Opt-MEM. The mixture was

incubated at room temperature for 30 minutes before adding to the cells. Cells

were incubated for 48 hours (37 °C, 5% CO2) before further experiments.

2.2.10 Tissue Culture Infectious Dose (TCID50 Infectivity Assay)

Uninfected Huh 7 cells were placed in a 96-well plate at a population of 1 × 104

cells per well in DMEM media and incubated overnight. The next day

supernatant from Jc1 infected Huh 7 cells (passaged twice) was added in 1:5 serial

dilutions to 200 µl media in each well and returned to the incubator for 72 hours.

Cells were then fixed with methanol for 20 minutes at -20 °C and blocked with

PBS + 2% FCS for 15 minutes. To prevent endogenous peroxidase interference,

cells were incubated with 0.3% H2O2 in PBS for 20 minutes. Cells then were

stained for HCV with anti NS5A antibody at a 1:10,000 dilution (in PBS) for 1

hour and washed twice with PBS for 5 minutes. Secondary HRP-conjugated anti-

sheep antibody, at a dilution of 1:1000, was added to the cells for 1 hour and

infected cells were identified using the ImmPACT DAB Peroxidase Substrate

(Vector laboratories). Cells were examined with an Olympus CK2 inverted


67

microscope at 20 × magnification and a well was counted as positive if there was

at least one infectious focus identified. The TCID50/ml was calculated using the

the method as described in the Spearman and Kaerber method (Carrere-Kremer et

al., 2004).

2.2.11 Protein Extraction

2.2.11.1 Protein Extraction from Cells

Cellular protein was extracted from cell culture monolayers using RIPA (Radio-

Immunoprecipitation Assay) buffer (Sigma). First, DMEM media was removed

from six well plates and cells were washed in ice cold PBS. Cells in each well

were scraped and 600 µl of cell suspension in PBS transferred to Eppendorf tubes

that were then centrifuged to pellet the cells. RIPA buffer containing a mix of

phosphatase inhibitor cocktail 2 (Sigma), Complete protease inhibitor cocktail

(Roche), Phenylmethanesulfonyl fluoride (PMSF) and sodium fluoride was added

to the cell pellet in each tube. Cell pellets were resuspended in lysis buffer by

pipetting, and incubated on ice for 30 minutes. The lysates were then centrifuged

at 14,000 RPM for 10 minutes at 4 °C, and supernatant containing extracted

protein was transferred to a clean tube. Protein samples were then aliquoted and

stored at -80 °C for future experiments. Protein extraction from supernatants was

performed using Trichloroacetic acid (Sigma).

2.2.11.2 Protein Extraction from Supernatants (Extracellular)

To extract protein from supernatants, 1 volume of trichloroacetic acid (TCA)

stock was added to 4 volumes of supernatant, incubated for 10 min at 4 °C,


68

centrifuged at 14,000 RPM for 5 min, then supernatant was removed, leaving the

protein pellet intact. The protein pellet was washed twice with 200 µl cold

acetone then dried by placing tube in 95 °C heat block for 5-10 min to drive off

acetone. For SDS-PAGE, 2× or 4× sample buffer was added (with or without β-

ME) and the sample heated for 10 min at 95 °C before loading sample onto a

polyacrylamide gel.

2.2.11.3 Blood Plasma Albumin Removal and Protein Extraction

Ethics approval was obtained from the Human Research Ethics Committees of

Sydney West Area Health Service and the University of Sydney

(HREC2002/12/4_9(1564). All subjects gave written informed consent, blood

samples were collected from uninfected and HCV infected patients and then

centrifuged at 4500 RPM for 10 min. Supernatant was used to remove albumin

before extracting protein using ArumTM Affi-GelR blue mini kits and columns

(Bio-Rad laboratories) according to manufacturer’s instructions. Protein

extraction was performed using TCA precipitation as described above in section

2.2.11.2.

2.2.12 Protein Quantification

Protein concentrations were determined using the Bio-Rad DC assay kit with

purified bovine serum albumin (Sigma) as a standard. Briefly, 20 µl of reagent S

was added to 1ml of reagent A. Then 5 µl of standard and samples were

transferred to a clean microtiter plate and 25 µl of reagent A+S was added to each

well. Next 200 µl reagent B was combined with each well content and after 15


69

minutes incubation at room temperature the absorbance was read at 750 nm using

a Wallac Victor1420 Multilable counter microplate reader.

2.2.13 Polyacrylamide Gel Electrophoresis (PAGE)

10% separating gel and 5% stacking gel were cast in a Bio-Rad Mini-

PROTEAN® Tetra Cell gel tank. 20-50 µg protein samples were prepared in

1×SDS (Sodium Dodecyl sulphate) PAGE sample buffer (62.5 mM Tris-HCl pH

6.8, 2.5 % SDS, 0.002 % Bromophenol Blue, 0.7135 M (5%) β-mercaptoethanol,

10 % glycerol) by heating to 95 °C for 5 minutes, loaded onto gel and run at 100

V for 2 hours in SDS running buffer. PageRulerTM Plus Prestained protein Ladder

(Thermo Scientific) was used as protein marker. Resolved protein was transferred

to a Nitrocellulose (Bio-Rad) or Polyvinylinede fluoride (Millipore) membrane in

transfer buffer overnight at 35V.

2.2.14 Western Blot Analysis

Following protein transfer, membranes were blocked with 5% skim milk

(Diploma) in TBST buffer (20 mM Tris-HCl, pH 7.4, 500mM NaCl, 0. 1%

Tween) for 1 hour with gentle agitation. Incubation with primary antibodies in 5%

skim milk/TBST was performed overnight at 4 °C. Membranes were then washed

three times with TBST and incubated with the appropriate horseradish

peroxidase-conjugated secondary antibodies for 1 hour at room temperature, with

gentle agitation, and rinsed three times as above. Probed membranes were

visualized using SuperSignal West Pico Chemiluminescence kit (Thermo

Scientific) and exposed to Kodak BioMax Film for different exposure times.


70

Primary and secondary antibodies used in western blot analysis are listed in Table

2.7. All secondary antibodies were used in 1:10000 dilution in 5% skim

milk/TBST and incubated for 1 hour at room temperature (25 °C).

Table 2.7 List of primary and secondary antibodies used in western blot

analysis

Primary Antibody Working Dilution Secondary Antibody

β-actin (Sigma) 1:10000 in 5% skim milk/TBST, 1

hour RT

Anti Mouse-IgG (Sigma)

Calsyntenin-1 (Epitomics)

1:1000 in 5% skim milk/TBST, 24-48 hours incubation

Anti Rabbit-IgG (Sigma)

Early Endosome Antigen 1 (Abcam)

1:1000 in 5% skim milk/TBST, 24

hours incubation

Anti Rabbit-IgG (Sigma)

Transferrin (Invitrogen)

1:500 in 5% skim milk/TBST, overnight incubation

Anti Mouse-IgG

(Sigma)

CD63 (Millipore) 1:1000 in 5% skim milk/TBST, 24-48 hours incubation

Anti Mouse-IgG

(Sigma)

HCV Core (Abcam)

1:1000 in 5% skim milk/TBST, 24-48 hours incubation

Anti Mouse-IgG

(Sigma)


71

2.2.15 Dual Renilla Luciferase Assay

Luciferase activity was quantified using Luciferase Assay System (Promega) in

transfected cells, according to manufacturer’s instructions. Briefly cells were

harvested at different time points post-transfection and lysed in 100 µl of lysis

buffer for each well. Cell lysates were transferred to clean tubes and centrifuged

to remove cell debris. Clear supernatant (20 µl) was mixed with 100 µl luciferase

reagent and emitted light was measured using a Wallac Victor1420 Multilable

counter microplate reader.

2.2.16 Concentration of HCV Virus (PEG precipitation)

Supernatant from HCV (Jc1 strain) infected cells was collected from T150 tissue

culture flasks (200 ml) and filtered through a 0.45 µm MillEX-HV

(MILLIPORE), to remove cellular debris. Filtered supernatant was then mixed

with the appropriate volume of 40% (W/V) polyethylene glycol (PEG 8000)

(Promega) to give a final concentration of 8% (W/V) and incubated overnight at 4

°C with gentle agitation. Tubes were then centrifuged at 8000 g for 20 minutes at

4 °C. The supernatant was discarded and the pellet resuspended in 2 ml complete

media or TNE (Tris and NaEDTA) buffer, for sucrose density gradient analysis.

Samples were then used to perform TCID50 or RNA extraction from extracellular

HCV virions.

2.2.17 Sucrose Density Gradient Analysis

Concentrated virus from the supernatant of HCV infected cells was subjected to

sucrose gradient density. Samples were overlaid on top of a stepwise density


72

gradient of sucrose, prepared from 60% to 10% (w/w) sucrose, and centrifuged at

35,000 RPM for 16 hours using a SW-41 Rotor and Beckman Optima XL-100K

Ultracentrifuge. 10 fractions were collected sequentially from the bottom of the

tubes and analysed further.

2.2.18 Exosome Isolation

HCV (Jc1) infected Huh7 cells were silenced for calsyntenin-1 (using siRNA) for

48 h and serum free supernatants were collected. Exosomes were isolated from

serum free supernatants using ExoQuick-TC kit (System Biosciences) according

to manufacturers instructions.

2.2.19 ImageJ software

Image was opened in imageJ, split into RGB (Red, Green, Blue) channels,

threshold was adjusted and area of interest was selected. Then used the plugin

“measure” in analyze drop down menu that gave a table of measurements for our

required area of the cytoplasm. Then percentage of cell area containing early

endosomes was measure by formula;

Percentage area = d/(a-c) × 100

where a = area of total cytoplasm in the cell, c = area of nucleus and d = area of

cytoplasm showing early endosomes (Boulant et al., 2008).

Chapter(3:(Identification(Of(Calsyntenin61(As(A(Host(Factor(Involved(In(HCV(Pathogenesis.((

! 73!

CHAPTER 3: IDENTIFICATION OF CALSYNTENIN-

1 AS A HOST FACTOR INVOLVED IN HCV

PATHOGENESIS.

3.1 Introduction

Approximately 233,000 Australians and 150 million people worldwide have

chronic infection with hepatitis C virus (HCV), which can lead to hepatic fibrosis,

liver failure and cancer (WHO, 2014; Razavi et al. 2014). Until recently, therapy

for HCV involved treating patients with an interferon/ribavarin combination that

stimulates antiviral immunity. However, this strategy has significant side effects

and shows a success rate (viral eradication) of less than 50% for HCV genotype 1

infection (Razali et al., 2007). Despite recent improvements in therapy with the

availability of direct acting antivirals (DAAs), in Australia early DAAs still need

to be used in combination with interferon and ribavirin, increase overall drug side

effects and are only approved for HCV genotype 1. The HCV genome encodes

only ten proteins, so the virus relies heavily on host factors to aid its replication

within the cell (Li et al., 2009). Drugs targeting host factors should avoid these

problems, but a major barrier to their design and development is our incomplete

understanding of the virus replication cycle. Therefore improved insight into the

stages of the HCV life cycle will facilitate the development of novel antivirals, by

targeting host proteins involved in specific stages of the virus life cycle.


! 74!

3.2 Background to the Project

To characterise the differences in the secretomes of HCV infected and uninfected

cells, we used stable isotopic labeling with amino acids in cell culture (SILAC).

SILAC is a mass spectrometry based technique that involves incorporation of a

label into proteins for mass spectrometry based quantitative proteomics. Two

different cell populations are grown in identical culture media except that one of

them contains a light or heavy form of a particular amino acid. When cells grow,

that particular amino acid is incorporated into newly synthesized proteins. After a

number of cell divisions, supernatants are subjected to mass spectroscopy and

peaks are obtained. The differential labelling of amino acids incorporated into

proteins results in a mass shift, which is detected by the mass spectrometer

(Chapter 1, Figure 1.10).

For our experiment we used the JFH1 HCV cell culture model, which is a

genotype 2a strain capable of reproducing the entire HCV life cycle in vitro and

which ONLY grows efficiently in Huh7 cells (or derivatives) (Wakita et al.,

2005). In our experiment, JFH1 infected and uninfected control Huh7 cells were

grown to the same confluency in 10 cm dishes, in media labelled with either

“Heavy” or “Medium” isotopes of arginine (Cambridge Laboratories U-13C6

units–15N4 arginine CNLM-539 or U-13C6 arginine CLM-2265 0.021 g/l) and

lysine (Cambridge Laboratories U-13C6 units-15N2 lysine CNLM-291 or 4,4,5,5-

D4 lysine CNLM-2640 0.0365 g/l), respectively. After 48 hours of incubation,

proteins were extracted and analysed by mass spectrometry. Levels of

“housekeeping” proteins albumin and alpha-2-macroglobulin were comparable


! 75!

between samples, confirming that equal cell numbers were analysed. Expression

of several proteins increased or decreased significantly (> 2-fold) in JFH1 infected

cells. Among them, calsyntenin-1 showed the largest increase, with an

infected/uninfected ratio of 43.53 in the supernatant from HCV infected cells

(Figure 3.1) and the abundant protein values are shown in table 3.1 (Tay et al.,

unpublished).

Figure 3.1 SILAC Screen. Quantitative proteomic comparison using stable isotopic

labeling with amino acids in cell culture (SILAC), showing up-regulation of proteins

in HCV infected media compared to control. The asterisk * indicates the largest

increase (44-fold) in calsyntenin-1 protein in the supernatant of HCV infected cells

(Tay et al., unpublished).

0

10

20

30

40

50

Huh7

HCV infected Huh7

Identified Proteins

Rel

ativ

e A

bund

ance

*


! 76!

!Table 3.1 Abundant Proteins in HCV-infected cells Supernatant (SILAC Screen)

No.

Name of Protein

Huh 7

(M/H)

HCV-infected (H/M)

1 Stathmin 0.111598 8.960699

2 Fatty acid synthase 0.143507 6.968284

3 Myosin light chain 6B 0.178100 5.614822

4 Calsyntenin-1 0.022970 43.535510

5 Keratin, type I cytoskeletal 18 0.116395 8.591463

6 Keratin, type I cytoskeletal 19 0.214083 4.671096

7 Pyruvate kinase isozymes M1/M2 0.1950501 5.126888

8 Growth/differentiation factor 15 0.120521 8.297337

9 Alpha-enolase 0.255944 3.907111

Although calsyntenin-1 has not previously been studied in the context of HCV, a

literature search revealed that it was among >30 essential host factors identified in

a small interfering RNA (siRNA) screen (Li et al., 2009). This study involved a

two-part genome wide siRNA screen using infectious JFH1 virus and the

Huh7.5.1 human hepatoma cell line to identify cellular genes essential for HCV

infection and replication. Part one of the study identified specific factors linked to

early HCV infection while part two revealed proteins involved later in the

replication cycle. In part one of the study, knock down of the calsyntenin-1 gene

inhibited HCV infection. More specifically, it reduced the number of HCV core

expressing cells after incubation with infectious virus. This suggests that

calsyntenin-1 is involved in early infection (probably entry step) of the HCV.


! 77!

Calsyntenin-1 is a membrane-bound adaptor protein for the microtubule based

motor kinesin 1 in neurons (Steuble et al., 2010). Calsyntenin-1 binds specifically

to kinesin light chain 1 (KLC1), facilitating the trafficking of vesicular cargo

along the microtubule network (Vagnoni et al. 2011). Identification of

calsyntenin-1 in our proteomic screen, as well as in the published siRNA screen

of essential host factors for the HCV life cycle, suggested an important role in

hepatocytes and justified further investigation.

Live cell imaging of virions and microtubules provides direct evidence that many

types of viruses move along microtubules (Dohner et al, 2005). This interaction

can occur at various stages of the virus life cycle, including entry, replication and

egress (Dodding and Way 2011). A recent study emphasizes the in vivo role of

calsyntenin-1 in neuronal endosomal dynamics, during their transport from cell

body to axons (Ponomareva et al., 2014). In neurons, calsyntenin-1 also mediates

anterograde endosomal movement, through the trans-golgi network (TGN) and

finally out of the cell (Ludwig et al., 2009). Importantly, HCV is thought to use

the early endosomal and exosome route for entry and egress in hepatocytes

(Coller et al., 2012; Dreux et al., 2012), suggesting a possible link and a

mechanism for our observations.

Based on its proven role in endosomal transport in neurons, calsyntenin-1 is a

likely candidate to mediate transport of HCV within infected hepatocytes, and

may also be involved in its egress from the cell. We used the highly infectious

chimeric HCV strain Jc1 for subsequent experiments because of its high

infectivity. This chapter examines the role of calsyntenin-1 in HCV dynamics,


! 78!

using a siRNA silencing strategy. It also investigates the interaction between

calsyntenin-1 and KLC1 in hepatocytes, as this has only been studied previously

in neurons.


! 79!

3.3 Experimental Outline And Results

3.3.1 Optimization of virus constructs (Jc1 & JFH1) in Huh7 and Huh7.5

cell lines.

An important first step in the present study was to determine the best HCV culture

model and hepatocyte cell line for our experiments, to provide a better

understanding of the virus life cycle. The most commonly used HCV cell culture

models are JFH1 and Jc1. JFH1 is a genotype 2a clone originated from a Japanese

patient with fulminant hepatitis that can replicate efficiently in Huh7 cells (Kato

et al., 2001; 2003). Importantly, it was the first strain to reliably produce

infectious virus in Huh7 cells, allowing reproduction of the entire HCV life cycle

in vitro (Wakita et al., 2005). More recently, the Jc1 strain was developed, which

is a chimeric virus containing the structural genes from J6CF and non-structural

genes from JFH1, both genotype 2a strains (Pietschmann et al., 2006). This

chimeric virus replicates more efficiently than JFH1, achieving titres of about 106

infectious units per ml (Pietschmann et al. 2006).

The Huh7 cell line was derived from a patient with hepatocellar carcinoma and

was the first cell line shown to support HCV replication (Lohmann et al. 2003).

The Huh 7.5 cell line is a derivative, isolated from Huh7 cells that had been

infected with a HCV subgenomic replicon, then cured using interferon-alpha.

They usually allow HCV to replicate to higher levels than in Huh7 cells, due to a

defect in the innate antiviral defence signalling pathway, following mutational

inactivation of retinoic acid-inducible gene I (RIG-I) (Sumpter et al. 2005).


! 80!

However, the Huh7 line is highly heterogeneous, with permissiveness to HCV

infection varying widely among different clones from laboratories around the

world. The reason is unclear, but seems to involve varying activity of innate

immune signaling, in particular RIG-I (Gale Jr. and Foy., 2005).

Until recently, our group had used the standard JFH1/Huh7 cell model, but for

this study we wanted to achieve the highest virus titres possible, to maximise

infection for immunofluorescence studies. Therefore, to find the best combination

of virus and cells for this project, a comparison study of these cell lines and virus

constructs was performed, in different combinations as follows.

3.3.1.1 Comparison of replication efficiency of Jc1 and JFH1 HCV strains in

Huh 7 and Huh 7.5 cell lines.

To compare the replication efficiency of Jc1 and JFH1 RNA, we synthesized

HCV RNA from DNA plasmids containing Jc1 (40pFK-JFH1J6C-846) and JFH1

(pJFH1) genomes, as detailed in Materials and Methods section 2.1.3. HCV RNA

(Jc1 or JFH1) was electroporated into Huh7 or Huh7.5 cell lines as described in

methods section 2.2.2. They were maintained in normal cell culture conditions

until 80% of cells were infected (usually 10-14 days). After 2 weeks, total RNA

was extracted from infected cells and HCV RNA levels were quantified by real-

time quantitative PCR analysis (qPCR).

HCV RNA quantification using specific Taqman primers/ probe showed

approximately 2-fold increase in Jc1 RNA expression compared to JFH1 RNA in

both cell lines (Figure 3.2). We also observed that Jc1 RNA expression was


! 81!

significantly higher (p-value = 0.017) in Huh7 cells as compared to Huh7.5 cell

line. This shows that our Huh7 cell line clone is more permissive for Jc1 RNA

replication than Huh 7.5 cells (Figure 3.2).

Figure 3.2 Replication efficiencies of Jc1 and JFH1 RNA in Huh7 and Huh7.5

hepatoma cell lines. Naïve cells (Huh7 & Huh7.5) were electroporated with HCV

RNA and then maintained in cell culture for 1-2 weeks until they reached 80%

confluency. Total RNA was then extracted, normalized to 18S and analysed by

qPCR. n=3, Error bars indicate Standard Error of the Mean (SEM), p-value* =

0.017.

3.3.1.2 Calculation of HCV infectivity titres using Jc1 and JFH1 infected Huh

7 and Huh 7.5 cell lines.

To assess infectivity efficiency of both HCV constructs, naïve Huh7 and Huh7.5

cells were infected with supernatant from HCV (Jc1 & JFH1) infected Huh7 and

Huh7.5 cells. After 72 h, cells were fixed with methanol, immuno-labelled with

anti-NS5A antibody and infectious foci were counted. Viral titre calculations were

Huh7 Huh7.50

10

20

30

40JFH1Jc1

*

HCV

RN

A/1

8S


! 82!

carried out using TCID50 infectivity assay, as described in section 2.2.10. We

observed that Jc1 showed higher infectivity than JFH1, and was more infectious

in Huh7 cells than Huh7.5 (Figure 3.3). This suggests that use of Jc1 virus

construct in Huh7 cells is much more efficient than JFH1.

Figure 3.3 Comparison of Jc1 and JFH1 viral titres in Huh7 and Huh7.5 cells

using TCID50 based infectivity assay. Supernatants from HCV (Jc1 or JFH1)

infected cells (Huh7 or Huh7.5) were used to infect naïve Huh7 or Huh7.5 cells in

serial dilutions (1:5). After 72 h, immunolabelling for NS5A was performed,

infectious foci were counted and viral titre values were calculated using TCID50

calculator (Section 2.2.10). n=3, Error bars indicate Standard Error of the Mean

(SEM).

Huh7 Huh7.50

20000

40000

60000

80000

Jc1JFH1

TCID

50/m

l


! 83!

3.3.1.3 Evaluation of Jc1 and JFH1 initial replication ability in Huh7 and

Huh7.5 cell lines, using a time course.

To evaluate the initial infection efficiency, naïve Huh7 and Huh7.5 cells were

infected with supernatant from HCV (Jc1 or JFH1) infected Huh7 and Huh7.5

cells respectively, or from uninfected negative controls. After 24 h and 72 h, total

RNA was extracted from cells and quantified using qPCR as detailed in Methods

section 2.2.8. Our experiment showed significantly higher HCV RNA levels at 24

h and 72 h, with Jc1 than JFH1, in either Huh7 cells (Figure 3.4A) or Huh7.5 cells

(Figure 3.4B).

Together, the data in Figures 3.3 and 3.4 show that, compared with JFH1, not only

does Jc1 infect a higher percentage of cells, but a larger amount of HCV RNA is

produced. Once again, in our hands Huh7 cells supported higher levels of HCV

replication than Huh7.5 cells. However, it was not clear from these experiments

whether this was because Huh7 cells produced higher titer virus than Huh7.5

cells, or whether they were more easily infected. To clarify this, cross over

infection studies were performed, as follows.


! 84!

Figure 3.4 HCV RNA expression at early times after infection with HCV

supernatant (Jc1 or JFH1). Naïve Huh7 or Huh7.5 cells were infected with

supernatant, collected from HCV (Jc1 or JFH1) infected Huh7 and Huh7.5 cells

respectively. After 24 and 72 hours of infection, total RNA was extracted and

HCV RNA levels were quantified by HCV specific qPCR analysis. (A) Jc1 and

JFH1 RNA expression in Huh7 cells. (B) Expression of Jc1 and JFH1 RNA in

Huh7.5 cell line. p value * <0.05 and *** <0.0001. NC; Negative Control, n=3,

Error bars indicate Standard Error of the Mean (SEM).

A

B

Huh7 cells

NC 24 72 NC 24 720.0

0.5

1.0

1.5

2.0

2.5 ******

Infection Time (h)

Jc1JFH1

HCV

RN

A/1

8S

Huh7.5 cells

NC 24 72 NC 24 720.0

0.5

1.0

1.5

2.0 ***

*

Infection time (h)

Jc1JFH1

HCV

RNA/

18S


! 85!

3.3.1.4 Selection of the best cell line receptive for Jc1 showing efficient

replication and infectivity.

To clarify the most productive and receptive cell line for highly infectious Jc1

propagation in our experiments, we electroporated both Huh7 and Huh7.5 cells

with Jc1 RNA in parallel, then after (10 days) we took the supernatant and used it

to infect naïve Huh7 and Huh7.5 cells, in a crossover study. After 72 h, total cell

RNA was extracted and HCV RNA quantified using qPCR. At the same time,

infected cells grown in parallel were fixed, NS5A immunolabelling was

performed, infectious foci were counted and viral titres were calculated by

TCID50, as detailed in chapter 2 (section 2.2.10).

In naïve Huh7 cells, we observed significantly higher (p value <0.0001) HCV

replication efficiency following infection with virus particles produced by Huh7

cells, compared to Huh7.5 derived virus (Figure 3.5A). On the other hand, Jc1

virus particles from Huh7 cells showed slightly higher infectivity in Huh7.5 rather

Huh7 cells (Figure 3.5B). Virus from Huh7.5 cells was less infectious in both cell

lines.

In summary, Huh7 cells appeared to support higher intracellular levels of HCV

RNA (Figure 3.5A), and to produce higher virus titres (Figure 3.5B). However,

Huh7.5 cells appeared slightly more permissive to infection, as a higher

proportion of them became infected than Huh7 cells (Figure 3.5B), regardless of

which cell line the virus was produced in. Therefore we decided to use Jc1 virus

and the Huh7 cell line for our experiments, as this combination produced the


! 86!

highest virus titres, and the cells that did become infected supported higher levels

of virus replication.

Figure 3.5 Comparison of HCV RNA (Jc1 & JFH1) replication efficiencies and

viral titres in Huh7 and Huh7.5 cell lines. Naïve Huh7 cells and Huh7.5 cells

were infected with supernatant from either Jc1 infected Huh7 or Huh7.5 cells, in

various combinations. (A) After 72 hours, total RNA was extracted and quantified

using qPCR. (***p-value <0.0001). n=3, Error bars indicate Standard Error of

the Mean (SEM). (B) For viral titres, NS5A immunolabelling was performed after

72 hours of infection and infectious foci were counted (n=1). Viral titre values

were calculated using TCID50 calculator (Section 2.2.10).

A

B

Huh7 to Huh7.5

Huh7 to Huh7

Huh7.5 to Huh7.5

Huh7.5 to Huh70

20000

40000

60000

80000

100000

TCID

50/m

l

Huh7 to Huh7.5

Huh7 to Huh7

Huh7.5 to Huh7.5

Huh7.5 to Huh70.0

0.5

1.0

1.5

2.0

***HC

V RN

A/18

S


! 87!

3.3.2 Identification of Calsyntenin-1 as a host factor up regulated in HCV

infection

To confirm the results from our SILAC screen (Figure 3.1), conditioned media

and cell lysates from Jc1 infected Huh7 cells (72 h) and uninfected Huh7 control

cells were analysed for calsyntenin-1 by SDS PAGE and western blot, using C-

terminal specific antibody (Epitomics Cat #3176-1). This antibody was raised

against a synthetic peptide corresponding to the C-terminal intracellular domain

of calsyntenin-1, which undergoes cleavage in cells to produces two fragments,

the soluble N-terminal fragment (NTF) and the C-terminal fragment (CTF), the

membrane bound stump (Figure 3.7). Therefore as well as full length calsyntenin-

1 (150 kDa), the two cleaved fragments of calsyntenin-1 were also detected by

our antibody i.e. N-terminal fragment i.e NTF (115 kD) and C-terminal fragment

(CTF) (33 kD) (Figure 3.7). We used rabbit monoclonal antibody for western blot

but appearance of more than one band could be because of alternative splicing.

In cell lysates from HCV infected cells, compared to uninfected controls, we

observed a decrease in full-length calsyntenin-1, but an increase in its cleaved

fragments (Figure 3.7). In contrast, full-length calsyntenin-1 (150 kD), but not its

cleavage products, was detected in supernatant from HCV infected cells, but no

calsyntenin-1 was detected in media from uninfected controls (Figure 3.6 A).

Importantly, for this experiment we used the Jc1 strain of HCV, instead of the

JFH1 strain we used for our initial SILAC screen (Figure 3.1). This therefore

confirms our initial findings, i.e. increased detection of calsyntenin-1 in the

supernatant of HCV infected cells, using both a different technique (western blot)


! 88!

and different virus strain (Jc1). There appeared to be an overall increase in

intracellular calsyntenin-1, particularly of its cleaved fragments.

Figure 3.6 Calsyntenin-1 is involved in Hepatitis C Virus infection. Huh7 cells were

infected with HCV (Jc1) containing supernatant for 72 hours, total protein was

extracted and western blot analysis was performed. (A) Full western blot using c-

terminal specific calsyntenin-1 antibody detected 150 kD, 115 kD and 33 kD bands in

cell lysates, corresponding to full length calsyntenin-1, NTF and CTF respectively.

However in supernatants from Jc1 infected Huh7 cells only the full length 150 kD

band was detected and complement 3 protein was the loading control. ß-actin was

used as a housekeeping control. n=3. (B) & (C) Graphs showing calsyntenin-1 band

intensities in cell lysate (115 k D) and supernatant (150 kD) respectively. Error bars

indicate Standard Error of the Mean (SEM).

A"Cell Lysates

Control HCV Infected 0.0

0.5

1.0

1.5

2.0

2.5

Band

Inte

nsiti

es

B"

Supernatants

Control HCV Supernatant0

20

40

60

80

100

Ban

d In

tens

ities

C"

ß-actin

150 kD

115 kD

33 kD

Huh7 HCV infected!

Cell l

ysate

Su

pern

atant Calsyntenin-1

150 kD

C3


! 89!

As outlined in more detail in the Introduction (Chapter 1, section1.5.2),

calsyntein-1 is a type I transmembrane protein which is constitutively cleaved by

disintegrin and metalloproteinase (ADAM) 10 or 17 enzymes. Cleavage at the

trans-membrane domain is a critical event during its activation, modification and

proper functioning. This is similar to other membrane bound proteins that undergo

proteolysis, either constitutively or in response to external stimuli (Maruta et al.,

2012). Cleavage of calsyntenin-1 gives rise to a N-terminal extracellular

ectodomain and C-terminal intracellular peptide (Hata et al., 2009). The C-

terminal intracellular peptide is further digested by c-secretase to produce a N-

terminal fragment (NTF) and C-terminal fragment (CTF), as shown in figure 3.7

(Araki et al., 2004). However, the role of constitutive cleavage of type I

membrane spanning proteins remains unclear (Maruta et al., 2012).


! 90!

Figure 3.7 Post-translational processing of calsyntenin-1. Calsyntenin-1 protein

consists of 981 amino acids and undergoes two sequential constitutive cleavages.

The final cleavage results in a N-terminal peptide and C-terminal cytoplasmic

fragment. Our calsyntenin-1 antibody (Epitomics cat # 3176-1) was a synthetic

peptide corresponding to C- terminal intracellular peptide. Asterisk * shows the

detected protein bands which we observed in section 3.3.2.

To confirm increased amounts of calsyntenin-1 protein in HCV infected cells and

to examine its intracellular distribution, HCV infected and Huh7 cells were

immuno-labelled with the same calsyntenin-1 antibody and imaging was

performed by fluorescence microscopy (Deltavision). As shown in Figure 3.8A,

there was an increased amount of calsyntenin-1 in HCV infected cells, compared

to controls (n=10). Furthermore, calsyntenin-1 was more widely distributed in


! 91!

HCV infected cells; rather Huh7 suggesting altered trafficking of calsyntenin-1

associated vesicles during HCV infection.

To investigate the in vivo secretion of calsyntenin-1 into HCV infected patients’

blood, total protein was extracted from plasma and western blot analysis was

performed. The plasma samples obtained from HCV infected patients (n=3) and

uninfected people (n=3) showed variable results (Figure 3.8B). Serum levels of

calsyntenin-1 varied considerably among patients within in each group, with no

clear difference in levels between groups. This suggests that regulation of

calsyntenin-1 in human blood in vivo is more complex than in our simple in vitro

model. Furthermore, calsyntenin-1 in blood plasma may not solely be coming

from the liver, but also from other body organs, or may be degraded.


! 92!

Figure 3.8 Calsyntenin-1 and Hepatitis C Virus infection. (A) Immunolabelling for

calsyntenin-1 in control and Jc1 infected Huh7 cells, showing increased expression in

HCV infected cells (n=10). (B) Western blot showing full-length calsyntenin-1 (150

kD) in blood plasma samples from HCV infected and uninfected control patients

(n=3) using complement 3 protein as control (110 kD).

3.3.3 Silencing the Expression of Calsyntenin-1 in Huh 7 Cells Using siRNA

To investigate the effect of decreased calsyntenin-1 expression on HCV infection,

we used siRNA to silence calsyntenin-1 within cells. We used siRNA because

there is no chemical inhibitor available for calsyntenin-1. Calsyntenin-1 siRNA

(50 µM) was used to silence calsyntenin-1 expression in Huh7 cells, as described

A

B

Control HCV-Infected

Calsyntenin-1 (150 kD)

C3 (110 kD

Control HCV-infected


! 93!

in methods (section 2.2.9). Levels of calsyntenin-1 mRNA were quantified by

qPCR and confirmed 80-90% reduction in cells treated with siRNA, compared to

scrambled controls (Figure 3.9A). Immunolabelling for calsyntenin-1 also

confirmed reduced expression in silenced cells, compared to controls (Figure

3.9B).

Figure 3.9 Silencing of Calsyntenin-1 in Huh 7 cells. Huh 7 cells were silenced

using 50 µM siRNA. After 48 hours, calsyntenin-1 expression was examined by qPCR

and immunofluorescence microscopy. (A) Graph confirming ~ 90 % reduction in

calsyntenin-1 mRNA levels in cells treated with 50 µM siRNA (n=3) (B)

Immunolabelling for calsyntenin-1 (green) in Huh7 cells (>10 cells/treatment) treated

with scrambled RNA (control) or Calsyntenin-1 siRNA. Scale bar 20 µm, 100 ×

magnification.

Control siRNA Calsyntenin-1

Calsyntenin51

A B

Control 50uM0

100000

200000

300000

400000

500000

siRNA Concentration

Calsy

nten

in-1

mRN

A le

vels


! 94!

3.3.4. Effect of decreased calsyntenin-1 expression on HCV infection

To examine the effects of calsyntenin-1 knock down on HCV infection, Huh7

cells were treated with calsyntenin-1 siRNA for 48 hours (scrambled siRNA for

control), and then infected with supernatant from HCV (Jc1) infected cells for 24-

48 hours. RNA was extracted and qPCR was performed for HCV RNA. This

showed almost 90% significant (p-value <0.05) reduction in HCV infection in the

absence of calsyntenin-1 (Figure 3.10A).

To confirm a reduction in the number of infected cells, Jc1 supernatant was added

to the silenced calsyntenin-1 Huh7 cells in a 96 well plate, in 1:5 serial dilutions,

and cells were incubated for 72 hours. Immuno-staining for HCV NS5A protein

and TCID50 calculations were performed as detailed in Chapter 2, section 2.2.10.

There was a significant 60 % reduction (p-value < 0.05) in infectious foci in

calsyntenin-1 silenced cells, compared to control cells treated with scrambled

RNA control (Figure 3.10B).


! 95!

Figure 3.10 Calsyntenin-1 knockdown leads to reduction in HCV RNA expression

and infectivity. Huh7 cells were silenced for calsyntenin-1 for 48 hours and then

infected with Jc1 supernatant. After 48 hours, HCV infection was assessed using

qPCR and TCID50 based infectivity assay. (A) HCV RNA expression was significantly

decreased compared to control (p-value* <0.05) (n=3). (B) The number of HCV

infected cells was also reduced in silenced cells, using NS5A antibody and TCID50

calculation (p-value* <0.05), n=3, Error bars indicate Standard Error of the

Mean (SEM).

To confirm reduction in the total amount of HCV protein, western blotting and

immunofluorescence studies were also performed. Huh7 cells were infected with

Jc1 supernatant and then incubated for 24 hours. Total protein was extracted from

A

B

Control Calsyntenin-1 siRNA0

50000

100000

150000

200000*

TCID

50/m

l


500

1000

1500

HC

V R

NA

/18S

*


! 96!

cell lysates and HCV core protein was detected by western blot. In parallel,

infected cells were fixed, labelled using HCV core antibody and examined by

immunofluorescence microscopy. These studies confirmed that in the absence of

calsyntenin-1 there was a decreased amount of HCV core protein 24 hours after

infection (Figure 3.11A). Immunofluorescence confirmed a dramatic reduction in

the number of infected cells following calsyntenin-1 knockdown, suggesting a

role for calsyntenin-1 at early stages of HCV infection. Interestingly, the few cells

that became infected appeared to have normal levels of HCV core expression,

suggesting that perhaps these cells were not transfected effectively with siRNA

(Figure 3.11B). HCV core labelling was not very clear in immunofluorescence

studies so we choose proximity ligation assay (as detailed in 3.3.5.1) to show the

association of calsyntenin-1 and HCV core to confirm this hypothesis. HCV-

infected Huh 7 cells and control uninfected Huh 7 cells were fixed with 4% PFA

and proximity ligation assay was performed (section 2.2.7.2). We found an

association between HCV Core and calsyntenin-1 showing their interaction within

HCV infected cells (Figure 3.11C).


! 97!

Figure 3.11 Decrease in HCV protein expression in calsyntenin-1 knock down

Huh7 cells infected with Jc1. (A) Western blot showing decreased HCV core in

Calsyntenin-1 silenced Huh 7 cells 24 hours after HCV infection, compared to control

cells. (B) Immunolabelling showing reduction in the ability of HCV to infect

calsyntenin-1 silenced Huh7 cells (>5 fields/treatment). (C) Association of

calsyntenin-1 with HCV core in HCV-infected Huh7 cells (>10 cells

counted/treatment) as shown by proximity ligation assay (as detailed in section

3.3.5.1).

Core (Control) Core (CLSTN-1 siRNA)

A

B

Control Calsyntenin-1 siRNA

HCV Core

Calsyntenin*1,

B-actin

C

PLA Control PLA for HCV Core & Calsyntenin-1

21 kD

115 kD


! 98!

3.3.5. Calsyntenin-1 is associated with Kinesin light chain 1 in Huh7 cells

Calsyntenin-1 is a membrane bound protein that acts as an adapter molecule,

linking vesicular cargo to the molecular motor kinesin 1, through interactions with

KLC1 (Konecna, et al., 2006). In neurons it is involved in the anterograde

transport of vesicles along microtubules by kinesin (Ludwig et al., 2009). Recent

evidence also points towards a role for calsyntenin-1 in the trafficking of early

endosomes in neurons (Steuble et al., 2010).

Early endosomes have been shown to play an important role in the early post-

entry stages of HCV infection (Lai et al., 2010), with acidification inducing

breakdown of the viral envelope, releasing the genome into the cytoplasm for

viral replication. Knock down of early endosome associated proteins with siRNA

resulted in failure of the virus to establish infection (Lai et al., 2010). Therefore

we hypothesized that calsyntenin-1 plays a role in the transport of early

endosomes within the hepatocyte, through its interaction with KLC1, and is

involved in the early stages of HCV infection.

To examine this possibility, co-localisation studies for KLC1 and calsyntenin-1 in

Huh7 cells were performed using immunofluorescence. Calsyntenin-1 colocalised

with KLC1 throughout the cell (Fig. 3.12) which is consistent with our hypothesis

that calsyntenin-1 acts as an adapter protein for kinesin 1 motor-based transport in

hepatocytes, as it does in neurons.


! 99!

Figure 3.12 Calsyntenin-1 is associated with Kinesin light chain 1 in Huh7

hepatoma cells. Huh7 cells were fixed with 4% PFA and immunostaining was

performed using (a) anti-calsyntenin-1 antibody with Alexa-488 conjugated

secondary (b) anti-KLC1 antibody with Alexa 594 conjugated secondary (c) merged

images and (d) Subtraction image showing regions of colocalisation. Scale bar 20

µm. More than 10 cells were counted for colocalisation analysis.

!

3.3.5.1 Duolink Proximity Ligation Assay (PLA)

To confirm that calsyntenin-1 and KLC1 were interacting closely in Huh7 cells,

and not just in the same intracellular region, proximity ligation assay (PLA) was

performed, as described in methods section 2.2.7.2. PLA is a technique that

directly detects protein- protein interactions and modifications, with high

specificity and sensitivity. Two primary antibodies raised in different species

a. Calsyntenin-1 b. KLC1

c. Merged d. Colocalized regions

Figure'3a:'Calsyntenin*1,is,associated,to,Kinesin,light,chain*1,in,hepatocytes.'Immunostaining'of'Huh7'cells'with'(a)'an;<Calsyntein<1'with'Alexa<488'secondary'and'(b)'an;<KLC1'with'Alexa'594'secondary'an;bodies'and'(c)'a'merge'of'(a)'&'(b)'and'(d) Colocalized region.

a. Control

Control CLSTN1 & KLC10

5

10

15

20

Pro

xim

ity

sig

na

ls *

b. CLSTN1 + KLC1

Figure 3b: Proximity ligation assay (PLA) showing colocalization of KLC1 with CLSTN-1. (a) Control (no KLC1), (b) KLC1 & CLSTN-1 and (c) Graph showing number of interactions between both.

c


! 100!

recognize the target protein or proteins. Species-specific secondary antibodies,

called PLA probes, each with a unique short DNA strand attached to it, bind to the

primary antibodies. When secondary antibodies are in close proximity, the DNA

strands interact through a subsequent addition of oligonucleotides. The enzymatic

ligation ligates these oligos and then rolling circle amplification by DNA

polymerase takes place. Several fold amplification of DNA occurs and addition of

fluorescent probes highlights the newly formed product. This high concentration

of fluorescence is easily visible by fluorescent microscope (Figure 3.13B).

As shown in the figure 3.13B, in cells labelled with antibodies against

calsyntenin-1 and KLC1, multiple bright spots were seen by immunofluorescence,

which were not present in the negative antibody control. This confirms that

calsyntenin-1 and KLC1 were indeed in very close proximity, consistent with a

direct interaction. This data supports a role for calsyntenin-1 in mediating kinesin-

based transport of vesicular cargo in hepatocytes, similar to its role in neurons.


! 101!

Figure 3.13 Proximity ligation assay (PLA). Huh7 cells were fixed with 4% PFA,

immunolabelled for calsyntenin-1 and KLC1 using specific PLA probes and imaged

under a Deltavision microscope. The image shows association of KLC1 with

calsyntenin-1 in Huh 7 cells (>10 cells/treatment). (a) Control (only calsyntenin-1

antibody), (b) KLC1 & calsyntenin-1 antibody and (c) Graph showing significantly

higher number of interactions. Scale bar 15 µm. n=3 (D) PLA method as explained

by Duolink (Reproduced from

http://www.abnova.com/products/products_detail.asp?catalog_id=DP0002).

Error bars indicate Standard Error of the Mean (SEM).

D

Control Calsyntenin1 & KLC10

5

10

15

20

*

Prox

imity

sign

als

A. Control B. Calsyntenin-1 + KLC1

C


! 102!

3.4 Discussion and Conclusion

In this chapter we have described our analysis of the secreted proteome of HCV

infected hepatocytes, identification of a highly secreted factor i.e. calsyntenin-1

and its association with the microtubule motor kinesin. Full-length calsyntenin-1

was present in conditioned media from HCV infected cells, suggesting its role in

the HCV replication cycle. Previously calsyntenin-1 has been extensively studied

in neurons (Steuble et al., 2010; Ludwig et al, 2009), where it is highly expressed,

but no published data are available for its role in hepatocytes.

The first aim was to optimise our in vitro HCV cell culture model for this project.

Therefore we compared Jc1 and JFH1 virus constructs for their replication

efficiencies and infectivity in Huh7 and Huh7.5 cell lines. We observed higher

HCV RNA expression in Jc1 infected Huh7 cells compared to JFH1 infected

cells. Jc1 is a GT2a/2a chimera containing sequences coding for J6CF structural

proteins and JFH1 non-structural proteins, joined at the NS2/NS3 junction

(Pietschmann et al., 2006). The higher infectious titres with Jc1 suggest an

important role for structural proteins, which are responsible for virus assembly

and release (Pietschmann et al., 2006). Surprisingly, in our hands, Huh7 cells

produced slightly higher virus titres than Huh7.5 cell line, regardless of which cell

type was being infected, which differs from some published studies (Zhong et al.,

2005: Lindenbach et al., 2005). This may be due to the heterogeneous

permissiveness of different Huh7 clones for HCV infection, due to mutation in

retinoic acid-inducible gene I (RIG-I), essential for resistance to HCV (Gale and

Foy., 2005).


! 103!

We found increased amounts of calsyntenin-1 protein in conditioned media from

JFH1 infected cells using a SILAC screen. This result was confirmed in Jc1

infected cell lysates and supernatant by western blot, which showed an increase in

full-length calsyntenin-1. However an important point to consider is calsyntenin-1

cleavage events. As figure 3.7 shows, after cleavage of calsyntenin-1, the two

final products are the N-terminal fragment (NTF) and C-terminal fragment (CTF).

In our western blot analysis of lysates from Jc1 infected Huh7 cells, we observed

three bands for calsyntenin-1: i.e. full-length calsyntenin-1, NTF and CTF. The

NTF and CTF bands showed increased amounts in HCV infected cells while full-

length calsyntenin-1 was decreased. This suggests increased cleavage of full-

length calsyntenin-1 in HCV infected cells. There are few studies showing the

coexistence of all three forms of calsyntenin-1 in neurons and pituitary membrane

using C-terminal antibodies i.e R71 and R82 respectively (Vogt et al., 2001;

Rindler et al., 2008).

In contrast, we observed increased amounts of full-length calsyntenin-1 protein in

supernatant from HCV infected cells, which was not detectable in media from

uninfected control cells. The fact that only full-length calyntenin-1 was present

suggests it was attached to membranes, rather than in a free soluble form. Full-

length calsyntenin-1 (150 kDa) contains a trans-membrane domain, but following

cleavage a 115 kDa N-terminal soluble fragment is released, leaving a 33 kDa

trans-membrane stump (Vogt et al., 2011). The presence of increased amounts of

membrane-bound calsyntenin-1 in the supernatant of infected cells suggests an

important role in HCV egress, most likely involving membranous vesicles.


! 104!

Our study clearly shows that calsyntenin-1 and kinesin light chain 1 (KLC1) are

associated with each other in Huh7 cells. High levels of colocalization in

immunofluorescence studies demonstrated this initially. Subsequent proximity

ligation assays confirmed their close association, and suggests direct interaction.

The interaction of calsysntenin-1 with KLC1 is as an adapter, linking vesicular

cargo to the microtubule based motor kinesin 1 (Ludwig et al, 2009). Two binding

motifs, known as KLC1 binding segment 1 and 2 (KBS1 and KBS2) are located

in the cytoplasmic fragment (CTF) of calsyntein-1, and interact with

tetratricopeptide repeats (TPR) in KLC1. These motifs KBS1 and KBS2 consist

of short peptide sequences KENEMDWDDS and ATRQLEWDDS, respectively.

The consensus sequence of these motifs has been formulated as L/M–E/D–W–D–

D–S (Konecna et al., 2006).

Calsyntenin-1 participates in endosomal transport by virtue of its role as a

membrane bound adapter protein to kinesin light chain1 (KLC1) (Steuble et al.,

2010), thus facilitating the transport of these organelles along microtubules.

Microtubules are polarized cytoskeletal filaments that allow polarised transport of

different cellular cargoes, such as membranous organelles and proteins, to their

particular subcellular destinations (Gunderson, 2002). A wide variety of studies

have indicated that the retrograde and anterograde movement of viruses in the cell

is dependent on microtubules and their associated motors i.e. kinesin and dynein

(Dohner et al., 2005; Dodding and Way, 2011). The kinesin family of motors

typically moves cargo towards the plus end of microtubules, while cytoplasmic

dynein is the main minus-end directed motor (Goldstein, 2001).


! 105!

Viruses hijack the endosomal pathway for their replication and progression

because they contain few genes and depend on host factors for their survival. The

endosomal pathway is involved in both HCV viral entry and egress (Lai et al.,

2010), so calsyntenin-1 may play a role in both processes. The decrease in HCV

infection observed when we knocked down calsyntenin-1 protein indicates that it

is necessary for efficient viral entry/early infection. When calsyntenin-1 was

silenced and cells were infected with HCV, they contained less HCV core protein

and only a small number of them became infected, as shown by

immunofluorescence studies.

In conclusion, our findings suggest an essential role for calsyntenin-1 in kinesin-

mediated transport of HCV in hepatocytes at early stages of infection, following

receptor-mediated entry, and perhaps also at later stages of the HCV replication

cycle.

!!!!!!!Chapter!4:!Role!Of!Calsyntenin41!In!The!Early!Infection!Of!Hepatitis!C!Virus! !

106

CHAPTER 4: ROLE OF CALSYNTENIN-1 IN THE

EARLY INFECTION OF HEPATITIS C VIRUS.

4.1 Introduction

Chapter three demonstrated an increased amount of calsyntenin-1 in HCV

infected cells and in culture supernatant from infected cells, compared to

uninfected cells. It also demonstrated an association between calsyntenin-1 and

kinesin light chain 1, which was a novel finding for hepatocytes. Calsyntenin-1

plays a key role in early endosome trafficking in neurons and HCV also interacts

with early endosomal pathways, suggesting a possible role for calsyntenin-1 in

early HCV infection. Previously, one study identified calsyntenin-1 to be

involved in early HCV infection but no further evaluation was conducted (Li et

al., 2009). We have therefore studied the role of calsyntenin-1 in HCV

replication and hepatocyte biology in detail, and propose that it is a key player in

kinesin mediated HCV trafficking in hepatocytes.

HCV is the sole member of genus Hepacivirus of the family Flaviviridae

(Maniloff, 1995). It is an enveloped virus with a positive, single-stranded RNA

genome of ~9.6 kb length flanked by 5` and 3` un-translated regions (Choo et

al., 1991). The 5 'UTR has a ribosome binding site (IRES - Internal ribosome

entry site) that starts the translation of a 3010 amino acid protein that is later

cleaved by cellular and viral proteases into 10 active structural and non-

structural proteins. These proteins are arbitrarily divided into three structural

(core, E1, and E2) and six non-structural proteins (NS2, NS3, NS4A, NS4B,


107

NS5A, and NS5B) while p7 is currently unassigned into either category

(Lindenbach & Rice, 2005; Otto & Puglisi, 2004).

HCV circulates as a lipoviral particle comprising lipoproteins (ApoA & ApoE),

which help it to evade the immune system (Komurian-Pradel et al., 2004). HCV

encodes two envelope glycoproteins i.e. E1 and E2, which mediate attachment to

the cell. HCV entry is a multi step process involving first recognition and then

attachment of the lipoviral particle with glycosaminoglycans on the cell surface

(Monazahian et al., 1999; Morikawa et al., 2007). Subsequently, HCV is

internalized by orchestral engagement of a complex set of receptors and proteins

including the tetraspanin CD81, scavenger receptor B-1 (SR-BI), and the tight

junction proteins claudin (CLDN) and occludin (OCDN), then is finally

internalized by clathrin mediated endocytosis (Coller et al., 2009). Immediately

after internalization, the encapsulated viral particle is taken up by early

endosomes (Figure 4.1), where pH dependent envelope and endosome fusion

results in release of the viral genomic contents into the cytoplasm (Blanchard et

al., 2006; Koutsoudakis et al., 2006; Meertens et al., 2006).

The early endosome is the first highly dynamic compartment that receives

internalized incoming cargo from the plasma membrane and is the major sorting

endosome in the endosomal trafficking pathway (Gruenberg et al., 1989). Rab5

is the most studied and characterised GTPase of the early endocytic pathway. It

regulates cargo entry from the plasma membrane to early endosomes, motility of

early endosomes on actin and microtubular tracks and activates several


108

signalling and trafficking pathways involving early endosomes (Miaczynska et

al., 2004; Schenck et al., 2008).

Figure 4.1 HCV Entry. The HCV virion is internalised through the clathrin-

mediated pathway and then taken up by early endosomes. The endosome

subsequently releases the HCV genome as a result of low pH mediated

membrane fusion. This released RNA then goes to ER to initiate virus protein

translation within the host cell (Reproduced from

http://fyeahmedlab.tumblr.com/post/37090103139/volextus-hepatitis-c-virus-

life-cycle-this).

The crucial and most important function of the early endosomes is to sort

internalized cargo to its particular intracellular destinations, in a precise and

highly controlled manner. Most of the endocytosed ligands are degraded but

their receptors are recycled back to the plasma membrane for additional rounds

of internalization (Dunn et al., 1989). For example, proteins like transferrin


109

receptor and low-density lipoprotein receptor are recycled back to the cell

surface. In contrast, low-density lipoprotein itself and epidermal growth factor

receptor (EGFR) are trafficked to late endosomes/lysosomes for degradation

(Dautry-Varsat et al., 1983; Herbst et al., 1994).

Calsyntenin-1 is a type 1 membrane bound protein, abundant in neurones, that

interacts directly with kinesin light chain 1 via its C-terminal domain and takes

part in the transport of amyloid precursor protein (APP). Disruption of

Calsyntenin-1 associated axonal trafficking of APP is a pathogenic mechanism

leading to Alzheimer’s disease (Vagnoni et al., 2012). It is an established fact

that calsyntenin-1 docks Kinesin-1 to diverse endosomal carriers and contributes

to several developmental processes in neurons including axonal growth, path

finding and also affects cell polarity in the adult nervous system (Steuble et al.,

2010). Characterization of the proteome of calsyntenin coated organelles in

neurones shows that they contain components of the endosomal trafficking

pathway i.e. early and recycling endosomes (Steuble et al., 2010). Calsyntenin-1

plays a key role in endosomal dynamics, affecting its distinct subpopulations and

is required for transport of rab5 endosomes, as revealed by a recent in vivo study

(Ponomareva et al., 2014).

This chapter will focus on calsyntenin-1 dynamics during HCV early

infection/entry, in particular its interactions with early endosomes. Furthermore,

evaluation of the effect of calsyntenin-1 knockdown on HCV endocytosis,

endosomal trafficking, cellular localization, endosomal functioning, velocity and

transport within hepatocytes will be assessed.


110

4.2 Experimental Outline And Results

4.2.1 HCV core protein interacts with early endosomes during early

infection

To determine the association between HCV core and early endosomes, we

labelled HCV-infected cells for HCV core and early endosome antigen (EEA1),

using specific antibodies. Early endosomes are the first compartments that take

the internalized cargo and sort out its fate. In the case of HCV, they take up

HCV virions (containing core) and release its genome after acidification, as

mentioned above. We observed colocalization of HCV core protein with early

endosomes after 48-72 h of infection as shown in figure 4.2. This confirms the

association of HCV core with early endosomes for various pathogenesis related

activities within hepatocytes.


111

Figure 4.2 Association of HCV core and early endosomes in HCV (Jc1)

infected Cells. Jc1 infected Huh7 cells (24-48 h p.i) were labelled for

calsyntenin-1 (green) and HCV core (red), nuclei were stained with DAPI and

the cells examined by immunofluorescence under 60� × magnification. A)

Distribution of HCV core with early endosomes in HCV infected cells. Scale bar

15 µm. B) Magnified (3-fold) image of highlighted region in A showing HCV

Core (C) Early endosomes. D) Merged image. E) Colocalized regions only

(yellow).

To look for an association between early endosomes and the HCV particle soon

after it enters the cell, Huh7 cells were infected with concentrated Jc1 virus on

ice. After 1 h, cell media was replaced and cells were then incubated for 30

minutes, 60 minutes, 90 minutes and 2 hours. At each time point cells were fixed

using 4% paraformaldehyde (PFA), labelled for HCV core and early endosomes,

A. Core & EEA1 B. HCV Core

D. A Merge

B. EEA1

E. Colocalisation


112

and then studied under Deltavision microscope at 60�× magnification. Incoming

virus could not be detected at early time points, but as shown in Figure 4.2 it was

clearly visualised after 2 hours. At that time we observed core and early

endosomes to be in close proximity, with some overlap. This suggests close

association of incoming virus with early endosomes just 2 hours after its

receptor-mediated entry.

Figure 4.3 Association of HCV core with early endosomes two hours after

virus receptor mediated entry. Huh7 cells were infected with concentrated Jc1

virus on ice for one hour, replaced with new cell media and shifted to 37 °C.

After two hours, cells were fixed with 4 % PFA and immunolabelled for HCV

core and early endosomes (EEA1). (A) Image showing close proximity between

incoming virus (HCV core) in red and early endosomes in green. Nucleus is

stained blue using DAPI. (B) Merged image and (C) Colocalized regions only

(yellow). Arrows indicate the area of colocalization where incoming virus enters

early endosomes soon after its entry into the cell. Scale bar 15 µm.

Early endosomes

HCV core

Colocalization Colocalized regions

A

B C


113

4.2.2 Evaluation Of The Association Of Calsyntenin-1 And Early

Endosomes In Huh7 Cells

To look for the role of calsyntenin-1 in early endosome trafficking by live cell

imaging, we cloned early an endosome marker (Rab5A) into the pEGFP-N1

plasmid containing enhanced green fluorescent protein (EGFP). Calsyntenin-1

was cloned into DsRed-monomer-C1, containing tetrameric Discosoma sp. Red

fluorescent protein.

4.2.2.1 Construction of Green fluorescent protein tagged Rab5a (Early

endosome marker)

Amplification of the gene for early endosome marker Rab5A was performed as

described in chapter 2 section 2.2.5. The amplified PCR product was run on an

agarose gel, which confirmed the correct size for the Rab5A gene (687 bp)

(Figure 4.4A). This amplified product was cloned into pEGFP-N1 vector using

restriction digestion as explained in methods section 2.2.5. Cloned plasmids

were checked for the presence of our insert using restriction digestion (Figure

4.4B), then the correct and proper clones were confirmed by sequencing.


114

Figure 4.4 Cloning of early endosome marker (Rab5A) into pEGFP-N1 plasmid

for live cell imaging. Total RNA was extracted from Huh7 cells and then cDNA

was synthesised as described in section 2.2.4. cDNA was used as a template to

amplify the Rab5A open reading frame and cloned into a pEGFP-N1 plasmid,

containing enhanced green fluorescent protein (EGFP) tag, using restriction

enzyme sites i.e. Xho1 and BamH1 which were engineered in our amplified

product using primers and were already present in pEGFP-N1 plasmid. (A)

Agarose gel shows amplified Rab5a gene size of 687 bp using Huh7 cDNA as

template. Lane 1: 1kb ladder; Lane 1-4: Amplified product. (B) Cloned plasmids

amplification confirms the presence of Rab5A insert in three plasmids. Lane 1:

1kb Ladder, Lane2-3 Negative controls (Uncut plasmid), Lane 5,8,13: isolated

plasmids with Rab5A at the proper size.

1 2 3 4 5 6 7 8 9 10 11 12 13

B

687bp A

Rab5A

1 2 3 4 5


115

4.2.2.2. Construction of Red fluorescent protein tagged Calsyntenin-1

Total RNA was extracted from Huh7 cells and cDNA was synthesised as

detailed in section 2.2.5 while brain cDNA was used to amplify full-length

calsyntenin-1 (NTF and CTF). Full length calsyntenin-1 and C-terminal

fragment (CTF) open reading frames were amplified using hot start DNA

polymerase (Figure 4.5A) and the amplified products were then cloned into a

DsRed-monomer-C1 plasmid separately using restriction digestion as described

in the methods section 2.2.6. It was difficult to amplify full-length calsyntenin-1

from Huh7 cells because of its low expression, so a brain cDNA library was

used, where it is highly expressed.

DNA plasmids were then extracted as described in section 2.2.6 and investigated

for the presence of the required genes by PCR gene amplification (Figure 4.5 B)

and plasmid restriction digestion (Figure 4.5 C), which confirmed successful

cloning into some of the plasmids. NTF plasmid number 7 & 8 and CTF plasmid

number 8 & 9 with confirmed presence of insert were sequenced and then used

for live cell imaging.


116

Figure 4.5 Cloning of Calsyntenin-1 into pDsRed-Monomer-C1 for live cell

imaging. Full-length calsyntenin-1 was amplified from brain cDNA while CTF

from Huh7 cDNA (section 2.2.4). Since the pDsRed-monomer-C1 plasmid and our

amplified products already had restriction enzyme sites, the amplified products

were cloned into plasmid separately using Xho1 and EcoR1 restriction enzymes.

(A) PCR amplified bands of both fragments of calsyntenin-1. Lane 1 & 4: 10 kb

ladder, Lane 2: Full-length (FL) calsyntenin-1 (2.8kb) Lane 3: C-terminal

fragment (CTF) (0.44kb). (B) PCR plasmid gene amplification (Top panel) and

restriction digestion (Bottom panel) of cloned plasmid for full-length calsyntenin-

1 gene (2.8 kb). (C) Gene amplification (Top panel) and restriction digestion

(lower panel) of cloned plasmid for calsyntenin-1 CTF with a band size of 0.44

kb. Lane 7: 1 kb Ladder, lanes 2-6,8,9; isolated plasmids.

1 2

1 432

FL2.8 kb

CTF0.44 kb

A

B

1 2 3 4 5 6 7 8 9 10

1 2 3 4 5 6 7 8 9

C

CTF

FL


117

4.2.2.3 Plasmid Sequencing Analysis

All plasmid constructs containing cloned genes were sequenced for

confirmation. Sequence analysis of the plasmid DNA of constructed vectors was

performed to confirm the cloned Rab5A and calsyntenin-1 (Full-Length and

CTF) in pEGFP-N1 and pDsRed-monomer-C1, respectively. The consensus

sequences of the inserted nucleotide sequences of both genes and their proteins

were compared with the original NCBI submitted isolates of the respective

genes. A BLAST online software comparison yielded 100% match in the

sequences for all plasmids. This confirmed the proper and correct sequence for

our clones.

4.2.2.4 Live Cell Imaging

To evaluate the role of calsyntenin-1 in trafficking of early endosomes, we

overexpressed our GFP tagged Rab5A (early endosome marker) and RFP tagged

calsyntenin-1 clones in live cells. Huh7 cells were transfected with calsyntenin-1

containing RFP plasmids (FL (Amino acid 29-981) and CTF (Amino acid 826-

981) separately) along with the Rab5A containing GFP plasmid. After 24 h,

localization studies were performed using Deltavision microscope at 100X

magnification. The purpose of using two types of calsyntenin-1 clones was to

determine which part of calsyntenin-1 is associated with early endosomal

movement, as there was no previous evidence of their association in

hepatocytes. Both of the calsyntenin-1 gene products (Full-length and CTF)

were found to colocalise with Rab5A, but colocalisation was more apparent with

the CTF (Figure 4.6) than full-length calsyntenin-1 (Figure 4.7), due to its


118

brighter fluorescence. This observation suggests the close association of the C-

terminal fragment of calsyntenin-1 with motile early endosomes within Huh7

hepatoma cells. This is a novel finding, as it has previously only been described

in neurons (Steuble et al., 2010), with no previous evidence of such an

association in hepatocytes.

Figure 4.6 Association of early endosomes with the C-terminal fragment of

Calsyntenin-1 (DsRed-CTF) in live Huh7 cells. Huh7 cells were transfected with

fluorescent tagged constructs of early endosome marker Rab5A and C-terminal

fragment of calsyntenin-1. After 24 hours, live cell imaging was performed using

Deltavision microscope at 100 X magnification. (A) GFP tagged early endosomal

marker Rab5A (B) Ds-Red tagged C-terminal fragment of calsyntenin-1. (C)

Merged image. D) Colocalized regions in yellow. Scale bar 15 µm. Cells counted

were >10.

A.pEGFP(Rab5A- B.pDsRed(CTF-

C.-Merged- D.-Colocaliza=on-regions-


119

Figure 4.7 Live cells imaging of full-length calsyntenin-1 (DsRed-FL) and early

endosomes in live Huh7 hepatoma cell line. Huh7 cells were transfected with

GFP tagged Rab5A (early endosome marker) and RFP tagged full-length

calsyntenin-1 clone. After 24 hours of transfection, live cell imaging was

performed on Deltavision microscope using 100× magnification. (A) GFP tagged

early endosomal marker Rab5A (pEGFP-Rab5A). (B) Ds-Red tagged full-length

calsyntenin-1 (DsRed-FL) (C) Merged image (D) Colocalized regions in white.

Scale bar 15 µm. Cells counted were >10.

A. pDsRed-FL

D. Colocalization C. Merged

B. pEGFP-Rab5A


120

4.2.3 Effects of Decreased Calsyntenin-1 Expression on Early Endosomes in

Huh7 Cells

4.2.3.1 Early Endosome Distribution

It is well established that early endosomes play a vital role in the early infection of

HCV. Calsyntenin-1 is involved in early endosomal movement in neurons and

affects their trafficking (Ponomareva et al., 2014). However, to date all published

studies on calsyntenin-1 have been in neurons, rather than other cell types. As

shown in Figure 4.6, we observed colocalisation between calsyntenin-1 and early

endosomes in Huh7 hepatoma cells (a hepatocyte model), so we were keen to

examine the role of calsyntenin-1 in endosome trafficking within hepatocytes.

Calsyntenin-1 was silenced in Huh7 cells for 48 h, cells were fixed, early

endosomes were labelled using anti-EEA-1 antibody and their cytoplasmic

distribution was analysed using the analyze particle plugin of Image J software (as

described in section 2.2.20). We observed that early endosomes were widely

dispersed throughout the cell in control cells transfected with scrambled RNA, but

in cells treated with calsyntenin-1 siRNA they were confined to the peri-nuclear

region (Figure 4.8 A & B).

As a result of this distribution change, early endosomes were only partially

available at the plasma membrane to carry internalized cargo. To quantify the

change in distribution, the percentage of the total cell area containing early

endosomes was calculated in both control and silenced cells. This was performed

using the Analyze plugin of the ImageJ software package (Figure 4.8C), the


121

values obtained from 20 cells were averaged and summarised as bar graphs

(Figure 4.8D). For measuring early endosome distribution within calsyntenin-1

silenced and control cells, the area occupying early endosomes, the cell nuclei and

the whole cell were outlined manually. The limits of cells were visualized by

differential interference microscopy (DIC) and the percentage of the total area

containing early endosomes was calculated using the following formula:

Percentage area = d/(a-c) × 100

where a = area of total cytoplasm in the cell, c = area of nucleus and d = area of

cytoplasm showing early endosomes (Boulant et al., 2008).

To determine whether silencing calsyntenin-1 had any effect on the total amount

of EEA1 protein in the cells, cells were silenced and analysed by western blot

analysis. This showed no change in the total quantity of EEA1 protein in the

calsyntenin-1 silenced cells (Figure 4.8E). So in summary, silencing calsyntenin-1

dramatically affected the distribution of the early endosome protein (EEA1)

within the cell, but had no effect on the total amount of EEA1. This supports our

hypothesis that calsyntenin-1 is involved in the trafficking of early endosomes

within the hepatic Huh7 cell line.


122

Figure 4.8 Distribution of early endosomes is altered in cells silenced for

calsyntenin-1, compared to control cells. (A) Immunolabelling of early

endosomes (EEA1) in scrambled Huh 7 control. (B) EEA1 antibody labelled cells

treated with calsyntenin-1 siRNA. (C) Method for calculating the percentage of

cytoplasm occupied by early endosomes in Image J (Analyze particle plugin), using

the formula Percentage area = d/(a-c) × 100. (a = area of total cytoplasm in the cell,

c = area of nucleus, d = area of cytoplasm showing early endosomes) (D) Graph

shows significant reduction (p-value*** <0.0001) in cytoplasmic early endosomal

percentage in the absence of calsyntenin-1 as compared to scrambled control. (E)

Western Blot analysis of early endosomes in scrambled control and silenced

calsyntenin-1 cells with beta actin control. Scale bar 15 µm. Calsyntenin-1

(CLSTN-1).

Control CLSTN1 siRNA0

20

40

60

80

100

CLSTN1 siRNAControl

%a

ge

of c

yto

pla

sm

A B

C D

E

EEA1!

Β""ac%n!

Control siRNA CLSTN-1 Control siRNA CLSTN-1


123

4.2.3.2 Velocity Of Early Endosomes

We have observed previously that (1) calsyntenin-1 colocalises with early

endosomes (Figure 4.6 & 4.7) and (2) silencing the calsyntenin-1 gene affects the

intracellular distribution of early endosomes (Figure 4.8). We therefore

hypothesized that if we silence calsyntenin-1, there should be a decrease in the

movement velocities of early endosomes.

To test this hypothesis, Huh-7 cells were silenced for calsyntenin-1 with siRNA,

transfected with pEGFP-Rab5A plasmid (Early endosome marker) and then

examined by live cell imaging using a Deltavision microscope. Velocities of at

least 10 early endosomes per cell (total 10 cells counted) were measured using

Deltavision software. Velocities were measured for peripheral early endosomes

(near the cell membrane) as well as for early endosomes in the peri-nuclear

region, in equal proportions. Interestingly there was a significant 57% reduction

(p-value <0.0001) in the velocities of peripheral as well as peri-nuclear early

endosomes in calsyntenin-1 siRNA treated cells, compared to controls (Figure

4.9).

This supports our hypothesis that calsyntenin-1 plays a vital role in the movement

of early endosomes within hepatic cells, which are a vital part of cellular

machinery for the HCV replication cycle.


124

Figure 4.9 Velocities of early endosomes are significantly reduced after silencing

calsyntenin-1 in hepatic cells. (A) Velocities of peri-nuclear early endosomes. (B)

Velocities of peripheral early endosomes. Grey bars show siRNA calsyntenin-1

treatment. p-value*** <0.0001. Black and grey bars represent control and silenced

Calsyntenin-1 cells, respectively. Error bars show standard error of the mean (SEM).

Cells counted were >10/treatment. Calsyntenin-1 (CLSTN-1).

4.2.3.3 Pattern of Early Endosome Movement

To further assess the pattern of early endosome movement from previous

experiments (section 4.3.2), we used the same images for scrambled control and

silenced calsyntenin-1 cells and analysed them using a particle analysis

(MTrack2) plugin of ImageJ software. The total number of early endosome

movement events was also reduced within calsyntenin-1 silenced cells. Figure

4.10A and 4.10B show the motility of early endosomes in control and

calsyntenin-1 silenced Huh7 cells. Fewer movement events were observed in the

absence of calsyntenin-1 than in controls. This further shows the importance of

A B

Peri-nuclear


20

40

60

80

Vel

ociti

es (n

m/s

ec)

Peripheral


50

100

150

200

250

Vel

ociti

es (n

m/s

ec)

*** ***


125

calsyntenin-1 in mediating early endosome trafficking, as movement is restricted

in its absence.

Figure 4.10 Early endosomes become less motile in the absence of calsyntenin-1.

Early endosome movement trajectories were traced for early endosomes in live cell

imaging, using a pEGFP-Rab5A construct, with the help of particle analysis

(MTrack2) plugin of ImageJ software (A) EEA1 traced paths and pEGFP-Rab5A live

imaging in scrambled control Huh7 cells. (B) EEA1 pathways and pEGFP-Rab5A

live cell imaging in silenced calsyntenin-1 Huh7 cells. (Lines show the movement

pattern of early endosomes). N = 3. Scale bar 15 µm.

Control

A

B

scr paths.png

Control

siRNA Calsyntenin-1

siRNA Calsyntenin-1


126

4.2.4 Calsyntenin-1 disrupts the function of early endosomes in hepatocytes

A primary function of the early endosome is to sort out internalized cargo to

different intracellular destinations (Jovic et al., 2010). Transferrin (Tfn) is one of

the receptors that is recycled by early endosomes back to the plasma membrane.

Our aim was to look for a change in the functioning of early endosomes in the

absence of calsyntenin-1, by looking for changes in the distribution and/or amount

of this receptor in siRNA treated cells, using immunolabelling and western blot

techniques. We therefore transfected Huh7 cells with calsyntenin-1 siRNA or

scrambled control for 48 h, fixed with 4% PFA and then labelled with transferrin

receptor antibody and early endosome antigen 1 (EEA1). Immunofluorescent

imaging and colocalization analysis were performed on Deltavision microscope.

We observed a change in the distribution of both early endosomes and transferrin

receptor, as shown in figure 4.11B. In control cells, transferrin receptor was

distributed throughout the cell, particularly near the plasma membrane. However

in calsyntenin-1 silenced cells, this distribution was altered and confined to the

perinuclear region of the cell. A similar distribution was observed with early

endosomes in scrambled control and silenced cells. This finding suggests that

early endosomes are no longer cabaple of recycling transferrin back to the plasma

membrane once calsyntenin-1 is silenced. Their reduced colocalization (~50%) in

silenced cells compared to controls further supports that early endosomes become

unavailable at the cell surface to recycle transferrin receptor (Figure 4.11 A & B).

Western blot did not show any significant difference in the total amount of

transferrin receptor protein between silenced and control cells, which shows that


127

calsyntenin-1 is only affecting the distribution and trafficking of this protein

(Figure 4.11C). Our data overall confirms that calsyntenin-1 does not only affect

the distribution, transport and velocity of early endosomes, but also disrupts its

function.


128

Figure 4.11 Loss of early endosomal ability of recycling transferrin receptor

back to the plasma membrane in the absence of calsyntenin-1. Huh7 cells were

treated with calsyntenin-1 siRNA for 48 hours, immuno-labelled for the

transferrin receptor and the early endosome marker EEA1, using specific

antibodies, then examined by fluorescence microscopy. (A) Immunolabelling of

early endosomes (EEA1) and transferrin receptor in scrambled control, showing

their distribution throughout the cell, particularly near the plasma membrane.

Scale bar 15 µm. (B) Immunolabelling of early endosomes (EEA1) and transferrin

receptor in Huh7 cells silenced for calsyntenin-1, showing peri-nuclear

distribution. (C) Western blot analysis confirms reduced amounts of calsyntenin-1

but no change in the transferrin receptor. The cellular gene beta actin was used

as a housekeeping control. n=3.

C

β-actin

Transferrin receptor

Calsyntenin-1

Control Calsyntenin-1 siRNA

A. Control

B. Calsyntenin-1 siRNA

Transferrin EEA1

EEA1 Transferrin Colocalized


129

4.2.5 Calsyntenin-1 Depletion Does Not Affect Hepatitis C Virus Receptor

Mediated Entry into Hepatocytes.

We have already shown that silencing calsyntenin-1 affects the early stages of

HCV replication cycle, by showing lower HCV RNA expression and less viral

infection (Figure 3.6). Virus binding and entry involves receptor binding and

clathrin mediated endocytosis, but NOT early endosomes, which are the next step

involved in virus uncoating and entry to the cytoplasm. Therefore in this section

we wanted to show that calsyntenin-1 silencing did NOT affect virus entry or

internalization per se, in line with our hypothesis of calsyntenin-1 acting on early

endosomes.

To directly look for the effect of loss of calsyntenin-1 expression on endocytosis

of the hepatitis C virus, incoming virus was visualized by fluorescence

microscopy, using antibodies against HCV core. Briefly, Huh7 cells were silenced

for calsyntenin-1 expression for 48 h, as in previous experiments. Concentrated

Jc1 virus (as detailed in section 2.2.16) was added to the cells on ice for one hour

to allow virus binding, then shifted to 37 oC to allow virus internalisation. Infected

cells were fixed at different time points i.e. 0 min, 30 min, 60 min, 90 min and

120 minutes after moving to 37 oC. Immunolabelling was performed for HCV

core and early endosomes (EEA1) at each time point.


130

Figure 4.12 Effect of silenced calsyntenin-1 on viral entry and uptake by early

endosomes. Huh7 cells were silenced for calsyntenin-1 and then infected with

concentrated Jc1 virus on ice. After 1 h, cells were washed with PBS and shifted

to 37 oC. Cell fixation was done using 4% PFA followed by Immunolabelling for

early endosomes (red) and incoming virus (green) after 0, 30, 60, 90 and 120

minutes of incubation. Immunolabelled EEA1 and HCV core in (A) scrambled

control cells and (B) in silenced control. Scale bar 15 µm.

Negative Control After 0 min. After 30 min. After 60 min. Scrambled EEA1 Core

Calsyntenin-1 siRNA EEA1 Core

After 1.5 h After 2 h

Scrambled EEA1 Core

Calsyntenin-1 siRNA EEA1 Core

A

B

A

B


131

Unfortunately, it was not possible to image incoming virus reliably, because of

the small amount of virus protein and the low signal:noise ratio (Figure 4.12),

compared to infected cells where much larger amounts of virus protein is

produced.

We therefore decided to study the effect of silencing calsyntenin-1 on virus entry

using the estabilished HCV pseudoparticle model (Drummer et al., 2003). This

specialised model was not available in our laboratory, so we designed an

experiment and collaborated with Dr Heidi Drummer at the University of

Melbourne, who routinely uses this model for HCV entry studies.

4.2.6 HCV Pseudoparticle Entry Assay

To evaluate the effect of calsyntenin-1 on HCV entry, the H77c pp (HCV

genotype 1a (H77c) derived pseudo-particles) assay was used, as described by

Drummer et al, 2003. These HIV-1 derived pseudo-particles are coated in full-

length HCV E1 and E2 glycoproteins from HCV genotype 1a strain (H77), and

contain a firefly luciferase reporter (Drummer et al., 2003). For our experiment,

Huh7 cells were seeded at 250 000 cells/well in a 48 well plate for 1 day and then

silenced for calsyntenin-1. After 24 h, silenced cells were washed and further

transfected with HCV genotype 1a (H77c) derived pseudo-particles, or empty

pseudoparticles. After 3 days post infection, H77c pp infectivity was measured in

relative luciferase units (RLUs).

We observed that calsyntenin-1 knock down did not inhibit HCV pseudo particle

entry, as luciferase reporter activity was unchanged in calsyntenin-1 silenced


132

cells, compared to control (Figure 4.13). Thus there was no effect on HCV entry,

consistent with our hypothesis that calsyntenin-1 is involved in trafficking of

HCV through early endosomes, which occurs after receptor-mediated entry.

Figure 4.13 HCV receptor mediated entry remains unaffected in calsyntenin-1

silenced cells (HCV pseudoparticle assay). Huh7 cells were treated with

calsyntenin-1 siRNA for 48 hours, or scrambled RNA as control, then infected

with HCV pseudoparticles (H77c pp). Empty pseudoparticles were used as an

additional control. After 3 days, cells were lysed and luciferase activity was

measured. CLSTN1=Calsyntenin-1, Error bars indicate Standard Error of the

Mean (SEM), n=2.

Untreate

d

no siRNA

Scram

bled 20

uM

Scram

bled 20

0 uM

CLSTN1 20 u

M

CLSTN1 200

uM

Untreate

d

no siRNA

Scram

bled 20

uM

Scram

bled 20

0 uM

CLSTN1 20 u

M

CLSTN1 200

uM0

1000000

2000000

3000000 H77cpp

empty-pp

Treatment

Rel

ativ

e Lu

cife

rase

Uni

ts


133


In Chapter three we demonstrated that calsyntenin-1 is involved in HCV infection

through knockdown studies. In subsequent chapters we aimed to clarify the

specific roles that calsyntenin-1 plays at different stages of viral infection.

Previous studies of calsyntenin-1 in neurons alerted us to its vital role in the

trafficking of endosomes within cells. Early endosomes have also been

demonstrated as key players in HCV entry. Together, these facts prompted us to

look at the early steps of HCV infection involving early endosomes and their

association with calsyntenin-1.

Live cell imaging is a very effective tool for observing direct association between

proteins within cells. Overexpression of our cloned constructs pEGFP-Rab5a and

DsRed-FL or DsRed-CTF using live cell imaging showed a high degree of

association between early endosomes and calsyntenin-1. This finding is consistent

with a recent live cell imaging based in vivo analysis of their association with

axon branching within neurons (Ponomareva et al., 2014). Calsyntenin-1 consists

of two domains i.e. N-terminal domain and C-terminal cytoplasmic domain. The

interaction between calsyntenin-1 and kinesin light chain-1 is mediated via its

intracellular domain, thus serving as a molecular adapter to vesicular cargo

(Konecna et al., 2006; Araki et al., 2007; Ludwig et al., 2009; Vagnoni et al.,

2011, 2012) as discussed in chapter 3. Consistent with these finding, we observed

more colocalization between pEGFP-Rab5a and DsRed-CTF (intracellular

domain) as compared to DsRed-FL (Figure 4.5 and 4.6 respectively). This is the


134

first report on their association in hepatocytes, or indeed in cells other than

neurons.

The connections between viral envelope glycoproteins and cellular receptors are

responsible for virus entry through the plasma membrane (Meertans et al., 2006).

Receptor mediated internalization occurs by the clathrin mediated pathway

followed by early endosomal uptake. Viral envelope and endosome membrane

fusion then occurs, triggered by low pH within endosomes (Pelkmans &

Helenius., 2003). In the case of HCV, following clathrin-mediated internalization,

the virus envelope fuses with the endosome at low pH, release the genomic

contents from the endosome. In this study we observed that calsytnenin-1 is

involved in a post receptor mediated HCV entry step, namely the uptake into

endosomes, affecting their trafficking with the cell. This phenomenon was

confirmed by a pseudoparticle entry assay, where siRNA mediated knockdown of

calsyntenin-1 had no effect on the infectivity of HCV pseudoparticles (H77c pp)

containing HCV glycoproteins (E1 and E2). This supports the idea that

calsyntenin-1 is not interacting with surface receptors and HCV envelope directly,

but affects HCV core trafficking at a post endosomal stage.

Early endosomes need to be at the periphery of the cell, ready to take up newly

entered viral particles. Our data show that early endosomes in calsytnenin-1

silenced cells are more condensed around the nucleus and occupy a smaller

proportion of the cytoplasm. This is consistent with the identity of calsyntenin-1

as an adaptor for KLC1, which is a plus-end microtubule motor. This means when

calsyntenin-1 is silenced, early endosomes accumulate near the nucleus (minus


135

end), lacking the ability to reach the plasma membrane by plus end directed

movement (Figure 4.14). It is well known that many other viruses depend on

microtubule motors (kinesin and dynein) for their intracellular transport (Dodding

& Way., 2011).

Figure 4.14 Early endosomes lose their ability to show plus end directed

movement in the absence of calsyntenin-1. Control cell shows even distribution

of early endosomes in the cell while calsyntenin-1 silenced cells shows restricted

kinesin-1 mediated, plus end directed movement. This results in peri-nuclear

accumulation of early endosomes.

The functional deficit in early endosomal function was confirmed by

colocalisation studies using transferrin receptor. Cells, silenced for calsyntenin-1

showed decreased overlap of transferrin receptor with early endosome markers,


136

indicating the internalised receptor was not being taken up by early endosomes.

Moreover, lack of calsyntenin-1 causes early endosomes to be restricted to the

peri-nuclear region and move slower. Condensed, less motile early endosomes

would be less like to encounter internalised viral particles, resulting in a decreased

rate of infection, as we have shown.

In conclusion, we provide evidence for a direct role of calsyntenin-1 in kinesin-

mediated transport of early endosomes in hepatocytes. Calsyntenin-1 siRNA

mediated knock down leads to unavailability of early endosomes at the plasma

membrane, reduces their velocity and disrupts their function. As a result, HCV

enters hepatocytes less efficiently, leading to reduced rates of infection.

Chapter(5:(Evaluation(Of(The(Role(Of(Calsyntenin81(In(HCV(Replication(

! 137!

CHAPTER 5: EVALUATION OF THE ROLE OF

CALSYNTENIN-1 IN HEPATITIS C VIRUS

REPLICATION.

5.1 Introduction

Chapter four identified calsyntenin-1 as an essential host factor involved in early

endosome mediated transport of HCV, during early viral infection in hepatocytes.

These studies were performed using various cell-imaging techniques and

calsyntenin-1 siRNA mediated silencing. We found an association of calsyntenin-

1 with early endosomes and kinesin light chain 1, suggesting a role in kinesin

mediated intracellular transport along microtubules. After decapsidation of the

viral nucleocapsid in early endosomes, HCV positive-strand RNA is released into

the cell cytoplasm, where it acts as an RNA template for synthesis of the HCV

polyprotein.

Previous studies on the role of early endosomes in HCV infection suggest that

they contribute to formation of HCV replication complexes (RCs) (Stone et al.,

2007) and that these complexes require functional microtubule network to

replicate viral RNA (Lai et al., 2008). We therefore hypothesised that, by

affecting trafficking of early endosomes, calsyntenin-1 may also play a role in

establishing HCV replication. In Chapter five we will test this hypothesis.

After its release into the cytoplasm, HCV RNA reaches the endoplasmic

reticulum (ER), where it is translated by ribosomes into a single viral polyprotein


! 138!

(~ 3010 amino acids). This polyprotein is cleaved by host and viral proteases into

ten mature structural and non structural viral proteins (Jones & McLauchlan.,

2010). Expression of the HCV viral polyprotein, or the non-structural protein

NS4B alone, induces the formation of a multi-vesiculated structure called the

“membranous web”, through distinct ER membrane alterations (Berger et al.,

2009). This site contains numerous small double membrane vesicles, ranging in

size from ~150nm in diameter, embedded in the membranous matrix, which form

the replication complexes (Romero-Brey et al., 2012; Gosert et al., 2003). This is

the site where viral RNA is amplified by NS5B RNA-dependent RNA

polymerase, in association with other non structural proteins and host factors,

including cyclophilin A (Figure 5.1) (Bartenschlager et al., 2010). However, the

molecular processes involving membranous web and replication complex

formation are still poorly understood.


! 139!

Figure 5.1 Hepatitis C Virus Replication Cycle in hepatocytes. After receptor

mediated entry, endosome fusion and uncoating, the viral genome undergoes

translation and replication. The encircled area represents the replication

process, occurring at special sites on the endoplasmic reticulum called the

membranous web. This is the site where HCV RNA translation occurs, resulting

in viral proteins. HCV non-structural viral proteins, with the help of various host

factors, then carry out different steps of HCV replication (Adopted from Paulina

Godzik., 2012).

Replication complexes (RC) are membrane-associated structures containing viral

proteins, replicating RNA, cellular membranes and host factors involved in virus

replication (Figure 5.2). RC formation involve several cellular host proteins and

pathways including fatty acid and cholesterol synthesis pathways, Rab4, Rab5,

vesicle-associated proteins (VAP) and early endosomes (Berger et al., 2009).


! 140!

Their movement within the cell is dependent on the association of HCV NS3 and

NS5a proteins with actin filaments and microtubules (Lai et al., 2008).

Figure 5.2 HCV replication complex. (1) Virus genome encodes viral structural

and non-structural proteins. (2) Different non-structural proteins (Particularly

NS4B & NS5A) are responsible for ER membrane alterations. (3) HCV

replication complex containing non-structural proteins, viral RNA and a variety

of host factors (Miller S., 2008).

Two types of replication complexes have been reported, classified according to

their size and movement: i.e. small dot like motile structures and relatively larger

static complexes. When observed by NS5A-GFP live cell analysis, the small

structures exhibited rapid, microtubule-associated transport, while the larger

structures showed limited or no intracellular movement (Wolk et al., 2008). Thus

intracellular trafficking dynamics, including the organisation of ER and

microtubule network, plays a vital role in the proper functioning of HCV RCs.


! 141!

Within these vesicular structures HCV RNA replication occurs, in a semi-

conservative and asymmetric manner (Quinkert et al., 2005). The positive

stranded HCV RNA is copied into a negative strand, which often base pairs with

the parent strand to produce a double stranded replicative form (RF)

(Bartenschlager et al., 2010). When examined by fluorescence based

hybridization methods, this replicative double stranded RNA appears as discrete

foci, associated with HCV core and NS5A (Target-Adams et al., 2008).

To date, an essential role for HCV NS5A in HCV replication has been well

established. Its role is either direct, in association with viral RNA replication, or

indirect, by modulating host cell pathways in favour of the virus (Wolk et al.,

2008). NS5A is a proline-rich, hydrophilic phosphoprotein that has no intrinsic

enzymatic activity, but which acts as an adaptor protein for a variety of host

factors involving signalling, membrane trafficking and lipoprotein synthesis

pathways (Vogt et al., 2013). A key role is as a transport vehicle, bringing newly

synthesised HCV RNA from replication sites to lipid droplets for encapsidation

(Miyanari et al., 2007; Evans et al., 2004). Indeed, motility of NS5A and efficient

HCV replication are dependent on the microtubule network, the molecular motor

cytoplasmic dynein and several host factors including vesicle associated protein-A

(VAP-A) and (early endosome marker) Rab5a (Eyre et al., 2014).

We have shown (in Chapter 3) that calsyntenin-1 acts as a kinesin light chain 1

(KLC1) adaptor protein. In neurons, this calsyntenin-1 bound kinesin-1 mediated

transport has been shown to drive cargo transportation via microtubule mediated

cellular endosomal pathways (Steuble et al., 2010). Therefore the main aim of


! 142!

this chapter is to determine the role of calsyntenin-1 in HCV replication,

including replication complex formation and motility, through its proposed

association with NS5A and replicating HCV RNA.


! 143!

5.2 Experimental Outline and Results

5.2.1 Loss of calsyntenin-1 expression delays the set up of HCV replication

complexes.

To examine the effect of silencing calsyntenin-1 on HCV replication, a sub

genomic replicon assay was used, based on the JFH1 HCV strain (genotype 2a),

which expresses non-structural proteins NS3 to NS5B (Kato et al., 2003). This

system bypasses all the steps of viral entry and viral particle uptake into early

endosomes, as replicon RNA is delivered directly in to the cell for replication. In

this transient replicon model, a firefly luciferase reporter was substituted for the

neomycin (G418) resistance gene, to provide a readout of virus replication (Figure

5.3A) (Targett-Adams & McLauchlan., 2005).

For these experiments, RNA was transcribed from the HCV subgenomic replicon

pSGR-luc-JFH1 and its replication defective mutant pSGR-luc-JFH1-GND, used

as a control. Huh7 cells were treated with siRNA against calsyntenin-1 (or

scrambled control RNA) for 48 h, then transfected with replicon RNA by

electroporation. Luciferase activity of cell extracts was assayed at 10, 12, 14, 16,

18, 20, 22, 24, 48, 72 and 96 hours. We demonstrated that there was a deficit in

the replication of HCV RNA in calsyntenin-1 silenced cells compared with

scrambled controls (Figure 5.3B). In scrambled control Huh7 cells, SGR

luciferase activity increased up to 48 hours. However in calsyntenin-1 silenced

cells, luciferase activity was significantly delayed/decreased (p<0.0001) compared

to controls. By contrast, the GND mutant had minimal activity due to the mutation

in the polymerase active site and hence served as a negative control.


! 144!

!

!!!!!!!!!

!!!!!!!!Figure 5.3 Silencing calsyntenin-1 in Huh7 hepatoma cells delays the

formation of HCV replication complexes. RNA transcribed separately from

pSGR-luc-JFH1 and its replication defective GND control was electroporated

into scrambled control and calsyntenin-1 silenced Huh7 cells. Luciferase

activities (Relative Light Units = RLU) were assayed in cell extracts at 10 h and

then every 2 h up to 24 h, then at 48 h, 72 h and 96 h. (A) Summary of the pSGR-

luc-JFH1 and pSGR-luc-JFH1-GND HCV subgenomic replicons (Target-adams

P & McLauchlan J., 2005). (B) RNA synthesis luciferase values for Huh7 control

(!) and calsyntenin-1 silenced Huh7 cells (") electroporated with RNAs

transcribed from pSGR-Luc-JFH1 (solid line) and pSGR-Luc-JFH1/GND (dotted

line). N=2, (p-value <0.0001).

In this model, the increase in luciferase reporter activity usually starts 12 to 14

hours post electroporation and coincides with the set up of HCV replication

A

B

!

10 h

12 h

14 h

16 h

18 h

20 h

22 h

24 h

48 h

72 h

96 h

0

500

1000

SGR ControlCalsyntenin-1 siRNA SGRGND ControlCalsyntenin-1 siRNA GND

Time (h)

Lucif

erase

Acti

vity (

RLU

)


! 145!

complexes (Jones et al., 2007). Our observation suggests that the absence of

calsyntenin-1 reduced HCV replication, by delaying the set up of replication

complexes (Figure 5.3B).

5.2.2 Association of Calsyntenin-1 Protein with HCV Replication

Complexes in HCV (Jc1) Infected Cells.

To look for a direct association of calsyntenin-1 with the HCV replication

complex protein NS5A, we performed image analysis. This interaction was

visualized using antibody specific immunofluorescence. HCV infected Huh7 cells

and control cells were fixed using 4% PFA and then labelled for NS5A and

calsyntenin-1 using specific antibodies. Cells were then imaged using Deltavision

microscope and colocalisation analysis was performed using Deltavision software.

The results showed clear co-localisation of NS5A with calsyntenin-1 in HCV

infected cells (Figure 5.4D). Proximity ligation assay was used to show direct

interaction of NS5A and calsyntenin-1 in HCV infected Huh7 cells. This assay

provides a simple method to simultaneously visualize and locate protein-protein

interactions (within 5-10 nm) within cells with exceptional specificity and

sensitivity (Söderberg et al., 2006). The interaction between two proteins becomes

visible as distinct spots under fluorescence microscopy. Figure 5.4 F shows a

large number of spots in HCV-infected cell but none in Huh7 uninfected control.

This suggests a specific association between calsyntenin-1 (cytoplasmic fragment)

and the HCV replication complex protein NS5A. This suggests that the

cytoplasmic fragment of calsyntenin-1, which is associated with the early

endosome pathway, may facilitate HCV replication.


! 146!

Figure 5.4 Association of Calsyntenin-1 and HCV non-structural NS5A protein

in Jc1 infected cells. Huh7 hepatoma cells were electroporated with HCV RNA

transcribed from the Jc1 plasmid then passaged twice. These infected cells were

then fixed with 4% PFA and labelled for (A) HCV NS5A (B) Calsyntenin-1 (C)

merged image (D) Colocalisation between NS5A & calsyntenin-1. (E) Uninfected

Control (F) Proximity ligation assay showing spots, indicating interaction

between NS5A and Calsyntenin-1 within a distance of 5-10 nm. More than 10

cells were visualized, Scale bar 15 µm.

E!

B. Calsyntenin-1

C. Merge

A. NS5A

D. Colocalization

E F E. Control F. HCV infected


! 147!

5.2.3 Evaluation of the Interaction between Calsyntenin-1 and Actively

Replicating HCV Replication Complexes

To confirm association of calsyntenin-1 with active HCV RNA replicating sites,

rather than random NS5A protein in the cell, we performed fluorescent labeling

for dsRNA, NS5A and calsyntenin-1 in HCV infected cells. Monoclonal

Antibody J2 dsRNA antibody was used to label dsRNA that was greater than or

equal to 40bp in replication complexes (Section 2.1.1). In infected cells, HCV

dsRNA is a replicative intermediate and appear as discrete foci within replication

complexes, surrounded by NS5A protein (Target-Adams et al., 2008).

As shown in Figure 5.5 A, discrete labeling of NS5A and dsRNA was clearly seen

in HCV infected cells, but not in the uninfected Huh7 controls. Higher

magnification and 3D reconstruction (Fig 5.5 B) shows a close association

between NS5A, dsRNA and calsyntenin-1. There appears to be a network of

calsyntenin-1 (blue) in which NS5A (red) and dsRNA foci (green) are embedded

(Figure 5.5 B). The presence of dsRNA confirms the location of active replication

complexes, which are also rich in NS5A and associated with calsyntenin-1.


! 148!

Figure 5.5 Calsyntenin-1 is associated with active HCV RNA replication sites

in the presence of NS5A. Huh 7 hepatoma cells were infected with supernatant

from HCV (Jc1) infected cells for 48-72 hours, then fixed for immunolabelling

using 4 % PFA. Triple colour labeling for calsyntenin-1 (blue), NS5A (Red) and

dsRNA (green) was performed using specific antibodies and cells were imaged by

Deltavision microscopy. (A) Top panel: Huh7 uninfected cells as control. Scale

bar 15µm. Bottom panel: HCV infected Huh7 cells. Scale bar 15µm (B) 3D

reconstruction was performed using Deltavision software. Arrows indicate

regions of colocalization between NS5A, dsRNA and calsyntenin-1. Scale bar

5µm.

Uni

nfec

ted

HC

V In

fect

ed

CLSTN&1 NS5A dsRNA

CLSTN&1 NS5A dsRNA

Calsyntenin&14NS5A dsRNA

A

B


! 149!

To look for close association of calsyntenin-1 with HCV replicative intermediate

dsRNA, colocalisation studies and proximity ligation assay was performed

(Figure 5.6). As shown in figure 5.6 A and B, calsyntenin-1 has a high degree of

association/ colocalization with dsRNA in HCV infected cells. Proximity ligation

assay (Figure 5.6 C) confirmed very close association between calsyntenin-1 and

dsRNA, as positive spots indicate that the proteins of interest are in close

proximity. Together, these data suggest that calsyntenin-1 may be playing a role

in trafficking of active HCV replication complexes within infected cells.

Uninfected Huh7 cells were used as PLA control.

Figure 5.6 Interaction of calsyntenin-1 with dsRNA, a HCV replication

intermediate in HCV infected cells. Huh7 cells were infected with Jc1

supernatant and then fixed using 4% PFA. Then they were labelled for (A)

calsyntenin-1 (blue) & dsRNA (green), (B) Shows co-localization of both proteins

suggesting their interaction. Scale bar 5 µm (C) Proximity ligation assay (PLA)

showing close proximity between two proteins. Scale bar 15 µm.

A!

B. Colocalization C. PLA A. Calsyntenin-1 dsRNA


! 150!

5.2.4 HCV Replication Complexes Move in Association with Calsyntenin-1.

As calsyntenin-1 mediates trafficking of cellular vesicles, our aim was to evaluate

movement of HCV RCs using live cell imaging. For this purpose we used a HCV

replicon (pSGR-luc-GFP-JFH1) containing an NS5a-GFP fusion, to image the

replication complexes in real time (Jones et al., 2007). Previous studies have

shown that NS5A containing a green fluorescent protein (GFP) tag in its C-

terminal domain successfully incorporates into functional HCV replication

complexes, making them visible under a fluorescence microscope (Moradpour et

al., 2004).

In a previous study, GFP tagged (pSGR-Luc-GFP-JFH1) small replication

complexes showed rapid, microtubule-associated transport (Wolk et al., 2008).

We used the same replicon (pSGR-Luc-GFP-JFH1) and observed a strong

interaction between GFP tagged replication complexes and calsyntenin-1 red

entities. Huh7 cells were silenced for calsyntenin-1 (and scrambled control) for

48 hours and then transfected with pSGR-Luc-GFP-JFH1 using Lipofectamine®

RNAiMAX (Invitrogen). After 24 hours, cells were shifted to the live cell

imaging chamber of the Deltavision microscope and observed under 60 ×

magnification. So this indicates involvement of calsyntenin-1 in HCV replication

through interaction with replication complexes (Figure 5.7).


! 151!

Figure 5.7 Saltatory movement of HCV replication complexes associated with

calsyntenin-1 in live cells. Huh7 hepatoma cells were transfected with pSGR-Luc-

GFP-JFH1 and pDSRed-CTF calsyntenin-1. After 24 hours, cells were imaged live

under a Deltavision microscope for 2-3 minutes under 60 × magnification. (A) GFP

tagged NS5A (pSGR-Luc-GFP-JFH1), showing HCV replication complexes (B) Ds-

Red tagged CTF calsyntenin-1 (C) merged image, and (D) colocalized regions. “N”

indicates cell nucleus. Scale bar is 15µm.

N

N N

N

N N

N N

A. pSGR-luc-GFP-JFH1 B. pDsRed-CTF Calsyntenin-1

C. A merge D. Colocalization


! 152!

5.2.5 The Effect of Calsyntenin-1 on Velocities of HCV Replication

Complexes

To evaluate the effect of calsyntenin-1 on HCV replication complex dynamics,

Huh7 cells were silenced for calsyntenin-1 and then transfected with the HCV

construct pSGR-luc-GFP-JFH1, which contains GFP-tagged NS5A (Jones et al.,

2007). After 24 hours, live cell imaging was performed on a Deltavision

microscope. At least 10 cells per treatment group (Calsyntenin-1 siRNA and

scrambled RNA controls) were observed for 1-3 minutes. GFP-tagged replication

complexes showed less long-range movement in silenced calsyntenin-1 cells as

compared to control (Figure 5.8 A & B).

Velocities of at least ten small replication complexes/cell were quantified in

control as well as silenced calsyntenin-1 cells using Deltavision microscope

software according to manufacturers manual. During a 1-2 min observation period

of live cell analysis, few GFP positive structures showed saltatory movement

events. Their peak average velocities ranged from 0.6 µm/s to 1.3 µm/s in

scrambled control cells. On the other hand, in calsyntenin-1 silenced cells overall

reduced replication complexes movement was observed, with average velocities

ranging from 0.16 µm/s to 0.54 µm/s. The usual movement speed for microtubule

motor kinesin is 0.02 to 2 µm/sec (Kapitein et al., 2005). Figure 5.8 C

demonstrates a highly significant reduction in the velocity of RCs in the absence

of calsyntenin-1, compared to scrambled controls (p value <0.0001). This

reduction suggests disruption of kinesin-mediated microtubule transport, due to

the loss of calsyntenin-1.


! 153!

!

!

!

!

!

!

!

!

!

!

!

!

!

Figure 5.8 siRNA mediated loss of calsyntenin-1 inhibits the MT dependent

saltatory movement of HCV replication complexes. Huh 7 cells were silenced for 48

hours using calsyntenin-1 siRNA (or scrambled control RNA) then transfected with

the HCV replicon pSGR-Luc-GFP-JFH1. After 24 hour, Deltavision live cell

microscopy was performed. The distribution of GFP- tagged NS5A (replication

complexes) was assessed in (A) Huh7 scrambled control; (B) Calsyntenin-1 silenced

cells. Scale bar is 15µm. N is for nucleus. (C) Scatter graph for velocities (µm/s) of

replication complexes in at least ten cells per treatment group. (***p-value

<0.0001).

C

Control CLSTN-1 siRNA0.0

0.5

1.0

1.5***

Vel

ocity

(µm

/s )

A.!Control! B.!siRNA!Calsyntenin>1!

N!N!


! 154!


This chapter demonstrates that calsyntenin-1 is an important host factor

facilitating HCV replication, by acting as an adaptor to kinesin-1 for microtubule

associated trafficking. After virus entry and uptake by the early endosome, release

of the HCV RNA genome from the viral capsid is mediated by acidification of the

early endosome, after which the RNA is translated at the ER to form one

polypeptide which is cleaved by viral and host proteases (Blight et al., 2000).

After a threshold level of specific non-structural proteins (namely NS4B and

NS5A) is reached, formation of the membranous web is induced. This site houses

many HCV replication complexes, which carry out active HCV RNA replication

with the help of various host factors (Wolk et al., 2008). The replication complex

is the site of NS5B, the viral polymerase that replicates the HCV RNA genome,

which is then either translated into new virus proteins, or transported and

packaged into a viral capsid for export.

Microtubules are well documented to move HCV replication complexes, as

treatment with the microtubule stabiliser colchicine resulted in inhibition of

replication complex movement (Lai et al., 2008). Other studies have demonstrated

that the location of viral RNA replication is important, as it needs to be in close

proximity to the site of either translation or packaging (Söderberg et al., 2006).

Thus, the dynamic nature of the replication complex is of great importance to the

HCV replication cycle.

Our earlier data (Chapter 3) shows association of calsyntenin-1 with kinesin-1

mediated transport and with early endosomes. We also showed association of the


! 155!

HCV nonstructural protein NS5A with early endosome markers Rab5A and

EEA1.

Moreover, recent studies have further validated the role of the endosomal pathway

in HCV infection and its importance for viral replication (Eyre et al., 2014). One

study reported a significant decrease in HCV RNA synthesis when Rab5 was

silenced (Stone et al., 2007). On the other hand, calsyntenin-1 has been

extensively studied in neurons, where it is involved in endosomal pathways

(Steuble et al., 2010).

In this chapter, we found the adaptor protein calsyntenin-1 was associated with

NS5A, a key player in the formation of HCV replication complexes. Importantly

live cell colocalisation analysis suggested their interaction during productive

replication. To determine the effect of loss of calsyntenin-1 on formation of

replication complexes within hepatocytes, we transfected Huh7 cells with a

luciferase tagged HCV replicon and measured viral replication over a time course.

There was almost 50% reduction in replication seen in cells silenced for

calsyntenin-1 up to 48 hours, compared to controls, suggesting a negative effect

on initiation HCV replication following loss of calsyntenin-1. This result is

similar to a study that shows that microtubule inhibition blocked the ability of

HCV replication complexes to replicate RNA (Bost et al., 2003). This suggests

that calsyntenin-1 acts as an adaptor for NS5A trafficking, so reducing

calsyntenin-1 affects the ability of NS5A to form HCV replication complexes,

reducing virus replication.


! 156!

An important step in studying the role of calsyntenin-1 in HCV replication was to

identify the RNA replicating complexes, as other NS5A positive structures are

also found in infected cells. To do this, we labelled cells with specific antibody

against dsRNA, as a confirmatory test. HCV dsRNA is a replication intermediate,

formed as a result of negative strand RNA base pairing with the parent positive

strand RNA template. Our results clearly showed colocalization of calsyntenin-1

not only with NS5A, but also with dsRNA foci at the same time.

The impact of our protein of interest calsyntenin-1 on the dynamics of replication

complexes was studied by live cell imaging. In HCV infected cells, we observed

populations of both small and large replication complexes. The larger structures

were almost non motile, while smaller structures showed rapid saltatory

movements, as seen previously (Wolk et al., 2008). When calsyntenin-1 was

silenced, there was an obvious change in the distribution and movement of

replication complexes, which were accumulated/halted within cells and not able to

move around freely. This was similar to the findings in a previous study, using

live cell imaging of the same HCV replicon, when cells were treated with the

microtubule depolymerizing agent nocodazole (Wolk et al., 2008). In this study,

the redistribution persisted while the drug remained in the cell media, but once it

was removed saltatory movement of the replication complexes reappeared (Wolk

et al., 2008). Unfortunately there is no reversible inhibitor of calsyntenin-1

available, so we were not able to replicate these experiments in our model.

We propose that calsyntenin-1 regulates trafficking of HCV replication

complexes, so we evaluated effects on movement velocity. We therefore


! 157!

quantified the velocities of HCV replication complexes in live cells, using a

replicon containing GFP-tagged NS5A (pSGR-luc-GFP-JFH1). In HCV-infected

cells, RC velocities were comparable to those typically associated with

microtubule transport (Wolk et al., 2008) ranging from 0.6 µm/s to 1.3 µm/s.

However, after silencing calsyntenin-1 there was a highly significant (p value

<0.0001) reduction in the average velocity of replication complexes when

compared to the scrambled control. This demonstrates the important role of our

protein of interest in the movement of replication complexes, providing a key link

between RNA replication and translation/packaging of the viral genome.

In summary, this chapter has shown that the kinesin light chain 1 adaptor protein

calsyntenin-1 is involved in HCV replication. It is required for the formation of

new HCV replication complexes, and silencing of calsyntenin-1 had a negative

impact on established HCV replication complexes, disrupting their transport and

distribution within the cell. These observations suggest that calsyntenin-1 acts as

an adapter for microtubule-associated transport of NS5A, to establish and

maintain efficient viral replication.

Chapter(6:(Role(of(Calsyntenin31(in(the(Secretion(of(HCV(Infected(Cells.((

158

CHAPTER 6: ROLE OF CALSYNTENIN-1 IN THE

SECRETION OF HCV INFECTED CELLS.

6.1. Introduction

In Chapter Five, we discussed HCV replication dynamics, highlighting the key

role which calsyntenin-1 plays in association with replication complexes. After

replication, HCV genomic RNA along with other viral and host factors are

transported to lipid droplets (LDs) where HCV virion assembly takes place, with

the help of HCV core protein (Coller et al., 2012). Core protein regulates LD

accumulation and recruits replication complexes to assembly sites but the

underlying precise mechanism is still unknown. In addition, several non-structural

proteins including p7, NS2, NS3 and NS5A also take part in HCV assembly events

(Boulant et al., 2008), but their precise roles are unclear.

Following assembly of HCV virions, the processes involved in virus export are

still under study. HCV hijacks the very low-density lipoprotein (VLDL) secretion

pathway for the production of infectious particles. This pathway is usually

involved in export of triglycerides and cholesterol from liver to peripheral tissues

(Ye J., 2007). In infected individuals, circulating HCV particles are associated

with lipoproteins in VLDL-like particles called lipoviral particles (LVPs)

(Gastaminza et al., 2010). In this way, the viral genome and capsid remain hidden

in the hydrophobic core of the LVP, evading the host immune system (Gastaminza

et al., 2010). These circulating structures are rich in triglyceride, viral RNA, core


159

protein, cholesterol ester and VLDL structural components i.e. apolipoprotein-B

(apoB) and apolipoprotein-E (apoE) (Andre et al., 2002; Merz et al., 2011). A lot

of evidence suggests that the VLDL pathway is required for the formation of

infectious virus, however, the formation of the infectious viral particles and the

process of egress still remain unclear.

Another cellular pathway involved in HCV release is the host endosomal pathway,

containing components of late endosome derived multivesicular bodies (Coreless

et al., 2010) and recycling endosomes (Coller et al., 2012). Within late endosomes,

when intraluminal vesicles (ILVs) are formed by inward invaginations of

endosomal membrane, the whole endosome structure becomes a multivesicular

body (MVB) (Fevrier et al., 2004). This inward budding process is analogous to

viral envelopment during assembly and release (McDonald & Martin-Serrano,

2009). Cargo sorting into MVBs is coordinated by several factors, collectively

called endosomal-sorting complexes required for transport (ESCRT). Specific

ESCRT proteins such as ESCRT- III, VPS4, TSG101, and Alix contribute to HCV

release but the detailed mechanism is still unknown (Ariumi et al., 2011; Corless et

al., 2010). The fate of MVBs is either to fuse with lysosomes for degrading cargo

or with plasma membrane to release intraluminal vesicles called exosomes (Van

Niel G et al., 2006). An important cellular factor called hepatocyte receptor

tyrosine kinase substrate (Hrs) is the part of ESCRT-0, which is the first complex

to bind cargo on endosomes (Tamai et al., 2012). Dendritic cells require Hrs for

secretion and antigen presentation on exosomes (Tamai et al., 2012).

Exosomes are extracellular nanovesicles (30-100nm) derived from MVBs and


160

secreted from a variety of cell types (Urbanelli et al., 2013). In recent years, a

number of studies have shown that exosomes mediate indirect cell-to-cell

communication and transfer macromolecules, functional proteins and RNA

between cells (Bukong et al., 2014). For HCV, exosomes have been identified in

media from HCV infected cells and in plasma of HCV infected patients

(Gastaminza et al., 2010; Masciopinto et al., 2004). Recently they were shown to

transfer HCV RNA to co-cultured plasmacytoid dendritic cells (pDCs), which

prompted the production of type I interferon (IFN) (Dreux et al., 2003).

Figure 6.1. Endosome based pathway showing MVB formation and release of

exosomes. Early endosomes mature into late endosomes or MVBs and

communicate with Golgi apparatus through bidirectional vesicle transport.

Intraluminal vesicles (ILVs) formed by invaginations of late endosome membranes

are released into the extracellular space in the form of exosomes (Adopted from

Borges et al., 2013).

ILVs


161

An additional pathway identified in the release of HCV particles is the recycling

endosomal pathway, which is regulated by the Rab family GTPase Rab11A

(Coller et al., 2012). These GTPases are the main regulators of intracellular vesicle

trafficking and Rab11A is specific for recycling endosomes. Cargoes are sorted in

secretory vesicles, called Rab11A positive recycling endosomes, on their journey

to the plasma membrane for exocytosis (Folsch H., 2005). An RNAi screen for

host factors involved in HCV pathogenesis identified Rab11A as an important

factor involved in exocytosis (Lai et al., 2010). An immunofluorescence based

study (Coller et al., 2010) visualized HCV core interaction with Rab11A. Further,

they silenced Rab11A and found decreased trafficking of HCV core from Golgi to

the plasma membrane.

In neurons, calsyntenin-1 is involved in the transport of post trans-golgi network

(TGN) cargo in association with kinesin light chain 1 (Ludwig et al., 2010). This

anterograde transport of TGN cargo to the plasma membrane is mediated by

recycling endosomes (Steuble et al., 2010). On the other hand, calsyntein-1 has

also been found in exosomes released from colon carcinoma and prostate cancer

cells (Tauro et al., 2012; Beheshti et al., 2012).

This chapter examines the association of calsyntenin-1 with export of HCV

virions, involving endosome based cellular pathways. The function of calsyntenin-

1 in the HCV secretome, trafficking of multivesicular bodies and subsequent

release of exosomes will be studied. Coordination of HCV core and calsyntenin-1

with the recycling pathway via recycling endosomes will also be evaluated.


162

Finally, the effect of siRNA knockdown of calsyntenin-1 on the distribution of

MVBs, exosome infectivity and recycling endosomes will also be assessed.


163

6.2 Experimental Outline and Results

6.2.1 Effect of Calsyntenin-1 on the Production of HCV Infectious Particles

To determine the effect of calsyntenin-1 on the production of infectious particles,

we performed infectivity assays using TCID50. TCID50 is defined as tissue culture

infectious dose of a pathogen such as virus that will produce a cytopathic effect in

50% of the cultures inoculated. We used variations of this infectious assay, using

serial dilutions and the same algorithm, to determine titre. Huh7 cells were

infected with supernatant (MOI = 3) from HCV (Jc1) infected cells for 48-72

hours and then silenced for calsyntenin-1 using siRNA. After 48 hours of

silencing, supernatant was collected and used to infect naïve Huh7 cells in serial

dilutions, then incubated at 37 °C for 72 hours. Cells were then labelled for NS5A

using specific antibody and infectious foci were counted using an Olympus CK2

inverted microscope at 20 × magnification. TCID50 was calculated according to a

published algorithm (Carrere-Kremer et al., 2004).

As shown in Figure 6.2, there was no change observed in total HCV particle

infectivity in virus from cells silenced for calsyntenin-1 compared to control cells

treated with scramble RNA (Figure 6.2).


164

Figure 6.2 Effect of calsyntenin-1 on HCV infectious virus production as

determined by TCID50 infectivity assay. HCV infected Huh7 cells were silenced

for calsyntenin-1 for 48 h. Supernatant was used to infect naïve Huh7 cells for 72

hours, NS5A immunolabelling was performed and infectious foci were counted.

Error bars indicate SEM.

6.2.2 Protein Analysis of HCV Infected Cells’ Secretion Using Sucrose

Density Gradient Fractionation.

To study the dynamics of HCV infected cells’ secretion and its relation with

calsyntenin-1 we did sucrose density gradient fractionation on cell culture

supernatants. Technically it is a challenge to completely separate viral particles

from exosomes, because both have overlapping densities. The buoyant density of

exosomes is 1.10-1.19 g/ml, while that of HCV virus particles is 1.06 to 1.16 g/ml

in blood or infected cell supernatant (Dao et al., 2012). Supernatant was collected

Control siRNA CLSTN-1 0

50000

100000

150000

200000

TCID

50/m

l


165

from Jc1 infected Huh7 cells and virus was concentrated using PEG concentration,

as explained in the Methods chapter (section 2.2.16). Concentrated virus was

subjected to 60% to 10% sucrose density gradient as explained previously.

Individual fractions were analysed for the presence of proteins of our interest such

as calsyntenin-1 and HCV core, to look for possible interactions.

For HCV, exosomes have been identified in media from HCV infected cells and in

plasma of HCV infected patients (Gastaminza et al., 2010; Masciopinto et al.,

2004). Therefore we also examined fractions for the presence of exosome marker

CD63, using western blot and specific antibody. Interestingly, same fraction was

positive for calsyntenin-1, exosome marker CD63 and HCV core proteins (Figure

6.3). This observation suggests a possible role for calsyntenin-1 in release of HCV

through the exosomal secretory pathway. There was not complete overlap, as

fractions either side were relatively enhanced for calsyntenin-1 and core (in

different fractions).


166

Figure 6.3 Localization of calsyntenin-1 and HCV core protein in exosome rich

density fraction. Concentrated HCV virus was subjected to sucrose density

gradient ultracentrifugation and fractions 1-5 were analysed for protein content

by western blot. Top panel: calsyntenin-1 protein bands. Middle panel: exosome

marker CD63 protein. Bottom panel: HCV core protein. The highlighted area

shows the presence of all bands in one common fraction.

6.2.3 Evaluation of the Role of Calsyntenin-1 in the Production Of Exosomes

To study the effect of calsyntenin-1 on exosome production, we used the

Exoquick-TC (System biosciences) kit to isolate exosomes from serum free

supernatants of uninfected Huh7 cells and HCV (Jc1) infected Huh7 cells. HCV

infected Huh7 cells were maintained in serum free media for 24 h and the serum


167

free supernatants were collected. Fetal bovine serum (FBS) used as a growth

supplement in cell culture media is reported to contain high amounts of cow

exosomes (Hata et al., 2010). So to avoid any contamination from FBS we used

serum free media for exosome isolation.

To look for the effect of silenced calsyntenin-1 on exosome infectivity, a TCID50

infectivity assay was performed. Isolated exosomes were used to infect naïve

Huh7 cells for 72 hours and then NS5A positive infectious foci were counted.

Interestingly, we found a significant reduction in the infectivity of exosomes

isolated from media of HCV infected cells silenced for calsyntenin-1 as compared

to control cells, treated with scrambled RNA (Figure 6.4A). As previously we

didn’t find any change in the infectivity of total infectious virus produced from

silenced calsyntenin-1 cells infected with HCV (Figure 6.2). We have also shown

that exosomes are minor pathway for HCV export as compared to total virus. But

silencing cansyntenin-1 has reduced exosome infectivity (Figure 6.4B).


168

Figure 6.4 Exosome infectivity is reduced when released from Jc1 infected cells

silenced for calsyntenin-1. (A) Jc1 infected Huh7 cells were transfected with

scrambled RNA or calsyntenin-1 siRNA and their serum free media were used to

extract exosomes using Exoquick-TC kit (System biosciences). These extracted

exosomes were then used to infect naïve Huh7 cells for 72 h. NS5A labelling was

performed and infectious foci were counted in both treatments. n=3, (p-value***

= 0.0006) (B) Comparison of infectivity of total virus and exosomes in control and

silenced calsyntenin-1 cells. n=3.


50000

100000

150000

200000VirusExosome

TC

ID5

0/m

l

A

B

Control Calsyntenin-1 siRNA 0

2000

4000

6000

8000 ***

TC

ID50

/ml


169

6.2.4 Exosomes are increased in Plasma Samples from HCV Infected

Patients, Compared to Uninfected Controls.

To test for the presence of exosomes in plasma from HCV infected patients, we

obtained plasma samples from HCV infected patients and uninfected healthy

individuals. Total protein was extracted (section 2.2.11) and the samples were

analysed for the presence of exosome marker CD63 by western blot. We observed

an increase in CD63 protein in plasma from HCV infected patients, compared to

healthy controls (Figure 6.5).

Figure 6.5 HCV infected blood plasma shows an increase in exosome proteins

compared to healthy controls. Protein analysis was performed using blood plasma

samples from HCV infected patients and also from healthy individuals (n=3). (A)

Western blot analysis showing an increase in the expression of an exosome marker

protein (CD63) in blood plasma samples from HCV infected patients (n=3).

Complement 3 protein (C3) was used as supernatant protein control. (B) Graph

showing CD63 band intensity in both control and HCV infected patients. (p-

value** = 0.0013).

A

B

Control HCV infected0

5000

10000

15000

20000**

Band

Inten

sities

CD63

C3

Control HCV infected


170

6.2.5 Calsyntenin-1 is Associated with Multivesicular Bodies (MVBs) and

Recycling Endosomes in Huh7 Cells

To evaluate the interaction between calsyntenin-1 and multivesicular bodies (also

known as late endosomes), we performed immunofluorescence analysis. The

tetraspanin protein CD63 was used as MVB marker within cells because it is

present within them and carry out MVB trafficking via exocytic pathway

(Kobayashi et al., 2000). Huh7 cells were immune-labelled for calsyntenin-1 and

the MVB marker CD63, visualised under the Deltavision microscope and

colocalisation analysis was performed. We observed association of MVBs with

calsyntenin-1, suggesting a potential role in cellular MVB trafficking (Figure 6.6).

A.Rab11a

& core


171

Figure 6.6 Calsyntenin-1 colocalises with multivescicular bodies (MVB) in

Huh7 cells. Huh7 cells were fixed with 4% PFA and then labelled for calsyntenin-

1 (green) and MBVs (red), nuclei were stained with DAPI and the cells examined

by immuno fluorescence under 60 × magnification. (A) Association of MVBs with

calsyntenin-1 in Huh7 cells (B) anti-CD63 antibody with Alexa-594 conjugated

secondary (C) anti-calsyntenin-1 antibody with Alexa-488 conjugated secondary (D)

Colocalization regions and (E) Magnified image shows association between

calsyntenin-1 and MVBs. Scale bar 15 µm.

C. Calsyntenin-1 D.Colocalization

B. CD63

E

A. CD63 & Calsyntenin-1


172

To look for an association of calsyntenin-1 with recycling endosomes, we labelled

Huh7 cells with calsyntenin-1 antibody and antibody against a recycling endosome

marker (Rab11A). A close colocalisation between calsyntenin-1 and recycling

endosomes was observed en route to plasma membrane (Figure 6.7) that suggests

trafficking of recycling endosomes in association with calsyntenin-1.


173

Figure 6.7 Association of recycling endosomes with calsyntenin-1 in Huh7

hepatoma cells. Huh7 cells were labelled for calsyntenin-1 (green) and recycling

endosome (red), nuclei were stained with DAPI and the cells examined by immuno

fluorescence under 60 × magnification. (A) Association of recycling endosomes

with calsyntenin-1 in Huh7 cells (B) anti-Rab11A antibody with Alexa-594

conjugated secondary (C) anti-Calsyntenin-1 antibody with Alexa-488 conjugated

secondary (D) Colocalization regions and (E) Magnified image shows association

between calsyntenin-1 and recycling endosomes. Scale bar 15 µm.

B.Rab11A

D. Colocalization C.Calsyntenin-1

A. Calsyntenin-1 & Rab11A

E


174

6.2.6 HCV Core Protein interacts with MVBs and Recycling Endosome

Mediated Secretory Pathways within HCV Infected Huh7 Cells.

To study the localization of HCV core within MVBs, Jc1 infected Huh7 cells (48-

72 h) were labelled for MVB marker CD63 and HCV core. Colocalization study

was performed using the Deltavision microscope as previously. We observed a

unique kind of association between the two, which were localised around the

plasma membrane. This suggests the release of HCV core out of the cell via the

exosome secretory pathway, via CD63 positive MVBs (Figure 6.8). The

distribution of CD63 positive foci around plasma membrane looks totally

different than uninfected cells (Figure 6.6B).


175

Figure 6.8 Association of HCV core with MVB mediated cell secretory pathway

in HCV infected Huh7 cells. HCV infected Huh7 cells were labelled for

calsyntenin-1 (green) and multivesicular bodies (red), nuclei were stained with

DAPI and the cells examined by immunofluorescence under 60 × magnification.

(A) Distribution of recycling endosomes and HCV core in HCV infected cells (B)

anti-CD63 antibody with Alexa-594 conjugated secondary (C) anti-HCV core

antibody with Alexa-488 conjugated secondary (D) Colocalization regions and (E)

Magnified image of the selected area. Scale bar 15 µm.

D.Colocalization C.HCV Core

B. CD63 A.CD63 & HCV Core

E


176

To further assess the connection between HCV core and recycling endosomes

within HCV infected cells, HCV infected cells were imaged under deltavision

microscope after labelling with HCV core and recycling endosome marker

Rab11A antibodies. We observed colocalisation of recycling endosomes with

HCV core (figure 6.9) suggesting interaction of HCV egress pathway with

recycling endosomal pathway as reported previously (Coller et al., 2010).


177

Figure 6.9 Recycling endosomes are associated with HCV core secretory

pathway in HCV infected Huh7 cells. HCV infected Huh7 cells were fixed with

4% PFA and then labelled for calsyntenin-1 (green) and recycling endosome

(red), nuclei were stained with DAPI and the cells examined by

immunofluorescence under 60 × magnification. (A) Distribution of recycling

endosomes and HCV core in HCV infected cells (B) anti-HCV core antibody with

Alexa-488 conjugated secondary (C) anti-Rab11A antibody with Alexa-594

conjugated secondary (D) Colocalisation regions and (E) Magnified image of the

selected area. Scale bar 15 µm.

A. Core & Rab11A

D. Colocalization C. Rab11A

B. HCV Core

E


178

6.2.7 Effect of Suppressed Calsyntenin-1 on the Distribution of Recycling

Endosomes and MVBs.

To assess if silenced calsyntenin-1 has any effect on the distribution of recycling

endosomes (Rab11A) and MVBs, Huh7 cells were silenced for calsyntenin-1.

After 48 h, they were infected with HCV supernatant for 48-72 hours and then

immunolabelled for recycling endosomes (Rab11A) or MVBs (CD63) and imaged

under the Deltavision microscope.

We saw a change in distribution of both recycling endosomes and MVBs within

silenced infected cells as compared to controls. Both recycling endosomes and

MVBs were observed to cluster around the perinuclear region (Figure 6.10). We

observed this for more than 10 cells for both recycling endosomes and MVBs in

three different experiments. This suggests that calsyntenin-1 silencing is affecting

the transport of both these endosomes within HCV-infected cells, hence having a

significant effect on HCV egress.


179

Figure 6.10 Distribution of recycling endosomes and MVBs is altered in the

absence of calsyntenin-1 in HCV infected cells. Huh7 hepatoma cells were

silenced for calsyntenin-1 for 48 hours, infected with HCV supernatant and then

fixed with 4% PFA. Representative immunolabelling of cells was performed using

anti-Rab11A in (A) scrambled control infected cells (B) in silenced calsyntenin-1

HCV infected cells. MVB distribution was visualized using anti-CD63 in (C)

Scrambled HCV infected control cells and (D) silenced calsyntenin-1 infected

cells. Scale bar 15 µm.

A. Rab11A

C. CD63

Control siRNA calsyntenin-1

B

D


180


Our initial SILAC screen (Figure 3.1) identified calsyntenin-1 as highly increased

in the supernatant of HCV (JFH1) infected Huh7 cells. This was confirmed in

western blot of HCV infected supernatant and cell lysates. This dramatic up

regulation made us interested to examine its role in different stages of the HCV

life cycle. In earlier chapters, we demonstrated a role for calsyntenin-1 in

trafficking of HCV during early infection (Chapter 4) and subsequent replication

(Chapter 5). In this chapter we specifically examined the role of calsyntenin-1 in

HCV secretion.

To investigate the possibility that calsyntenin-1 is involved in the release of

infectious virus particles, we silenced it in HCV infected cells and performed

infectivity assays on the supernatant. To our surprise, there was no obvious effect

(Figure 6.2). The conventional VLDL pathway is involved in the secretion of

infectious HCV particles, which form larger VLDL like particles known as

‘lipoviral particles’. Our observation that there was no change in infectivity of

secreted viral particles after silencing calsyntenin-1 suggested it was not involved

in the typical HCV egress pathway. However, there remained the possibility that

calsyntenin-1 contributed to other HCV secretory pathways.

We performed sucrose density gradient fractionation of media from HCV infected

cells, and found calsyntenin-1 and HCV core in the same fraction. This evidence

suggests the simultaneous release of HCV with calsyntenin-1, probably in a

secreted vesicle. Recently, it has been shown that HCV can also be secreted via

multi-vesicular bodies (MVBs), endosomal sorting complex required for transport


181

(ESCRT) and hepatocyte receptor tyrosine kinase substrate (Hrs), which together

are involved in MVB biogenesis and secretion of exosomes (Lai et al., 2014).

Consistent with this, transmission of HCV via exosomes has been demonstrated,

both in vitro and in vivo (Gastaminza et al., 2010; Masciopinto et al., 2004).

Within MVBs, intraluminal vesicles (ILVs) are formed by inward invaginations of

endosomal membranes (Fevrier et al., 2004). Further protein analysis of our

density fraction showed the presence of an exosome marker (CD63) in the same

fraction, suggesting that the secreted vesicles containing HCV core and

calsyntenin-1 were exosomes. We therefore propose a model where in HCV

infected hepatocytes, the transmembrane protein calsyntenin-1 is embedded within

exosomes undergoing egress, and stays attached to the exosome once it has been

secreted (Figure 6.10).

Moreover we have also shown that siRNA induced loss of calsyntenin-1

significantly reduced the infectivity of exosomes released from HCV infected

cells. This further supports the model where calsyntenin-1 facilitates HCV particle

egress out of the cell, in close association with exosomes. The presence of

calsyntenin-1 has been reported in exosomes of cancer cells, indicating its

participation in the spread of colon and prostate cancer (Tauro et al., 2012;

Beheshti et al., 2012). Our observations may also suggest a role of calsyntenin-1

in development of liver cancer, a major complication of chronic hepatitis C.


182

Figure 6.10. Proposed model highlighting the role of calsyntenin-1 in the release

of HCV containing exosomes. Calsyntenin-1 is involved in the transportation of

MVBs containing CD63 and HCV core within the cell, by kinesin mediated

microtubule (MT) associated transport. As a result exosomes are released from the

cell that contain CD63, calsyntenin-1 and HCV core. MT: Microtubules, MVB:

Multivesicular Bodies, ILV: Intraluminal vesicles.

The clinical significance of exosomes was evaluated by analysis of plasma

samples from HCV infected patients for exosome markers. Similar to previous

studies (Gastaminza et al., 2010; Masciopinto et al., 2004), we found increased

amount of an exosome protein (CD63) in plasma samples of HCV infected

patients, compared to healthy controls. It has recently been reported that

circulating HCV exosomes from HCV infected patients are capable of infecting

primary human hepatocytes through cell-to-cell, receptor independent

transmission (Bukong et al., 2014).


183

In addition to extracellular studies, we also conducted intracellular

immunofluorescence analysis, to look for MVBs that release exosomes. We found

close association of calsyntenin-1 with multivesicular bodies within Huh7 cells.

Furthermore, these MVB were in close proximity with HCV core protein. It has

previously been reported that HCV core interacts with host factors involved in

MVB biogenesis, especially the ECSRT complex (Ariumi et al., 2011; Corless et

al., 2010). Finally, siRNA mediated knockdown of calsyntenin-1 restricted the

distribution of MVB within HCV infected Huh7 cells, suggesting a loss of their

trafficking capability. These observations together identify a key role of

calsyntenin-1 mediated trafficking of MVB within cells, in association with HCV

core, for the release of HCV particles from the cell in exosomes.

A possible role for calsyntenin-1 in facilitating cell secretion is suggested through

its association with recycling endosomes in neurons (Steuble et al., 2010).

Furthermore, HCV core traverses the cellular recycling pathway on its journey

from the trans-golgi network (TGN), en route to the plasma membrane, through

interaction with recycling endosomes (Lai et al., 2010). Therefore, to investigate

the possibility of calsyntenin-1 mediated recycling of HCV core, we performed

imaging analysis. RCs are identified by the presence of Rab family GTPase

Rab11A and are involved in recycling various proteins, in an anterograde manner.

Our study observed localization of calsyntenin-1 with Rab11A positive structures

in Huh7 cells using Deltavision microscopy.

We found change in the distribution of recycling endosomes and MVBs in HCV

infected Huh7 cells silenced for calsyntenin-1, suggesting a movement


184

discrepancy without calsyntenin-1. In addition, these recycling endosomes were

also seen colocalised with HCV core near the plasma membrane in HCV infected

Huh7 cells (Figure 6.9). Therefore we propose that there is a role for calsyntenin-

1 in mediating trafficking of the recycling endosomes containing HCV core

protein, a hypothesis that warrants investigation in future studies.

In conclusion, this chapter suggests that calsyntenin-1 is involved in the secretion

of HCV from infected cells, accompanied by exosomes. It mediates intracellular

trafficking of MVBs and release of infectious exosomes. Furthermore, it aids

recycling of viral proteins within HCV infected cells, by regulating the movement

of recycling endosomes.

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Chapter!7:!General!Discussion!

! 185!

CHAPTER 7: GENERAL DISCUSSION

7.1 Study Aims

A SILAC screen to characterize different host factors involved in HCV secretion

identified calsyntenin-1 to be highly increased. This protein is a type I trans

membrane protein involved in kinesin 1 mediated intracellular transport in

neurons. On further investigation we found that siRNA mediated silencing of

calsyntenin-1 in HCV infected cells, reduced viral infection. These observations

laid the foundation of this project to investigate for the first time the specific

function of calsyntenin-1 in HCV infected hepatocytes at different stages of the

viral replication cycle including HCV entry, replication and egress.

7.2 Findings and Significance

The results of our project demonstrated the role of calsyntenin-1 for the first time

in hepatocytes, involving HCV pathogenesis. Although calsyntenin-1 has not

previously been studied in the context of HCV, a literature search revealed that it

was among >30 essential host factors identified in a small interfering RNA

(siRNA) screen (Li et al., 2009). Calsyntenin-1 is a membrane-bound adaptor

protein for the microtubule based motor kinesin 1 in neurons (Steuble et al.,

2010). It binds specifically to kinesin light chain 1 (KLC1), facilitating the

trafficking of vesicular cargo along the microtubule network (Vagnoni, et al.

2011).


! 186!

Chapter 3 demonstrates increased calsyntenin-1 protein levels in HCV infected

cells and culture supernatant, suggesting its involvement in HCV pathogenesis.

The association of calsyntenin-1 with KLC1 was also observed in hepatocytes for

the first time, suggesting its role in kinesin-1 mediated transport. When

calsyntenin-1 silenced Huh7 cells were infected with HCV, they contained less

HCV core protein and only a small proportion of them became infected, as shown

by immunofluorescence studies. In light of this result, we decided to study the

kinesin-1 mediated role of calsyntenin-1 in viral pathogenesis. We know that

retrograde and anterograde movement of viruses in the cell are dependent on

microtubules and their associated motors i.e. kinesin and dynein (Dohner et al.,

2005; Dodding & Way, 2011). The kinesin family of motors typically moves

cargo towards the plus end of microtubules, while cytoplasmic dynein is the main

minus-end directed motor (Goldstein, 2001). Based on these observations, we

went further to step by step evaluate specific roles of calsyntenin-1 associated,

kinesin-1 mediated transport at different stages of the HCV replication cycle.

In Chapter 4 we looked for an association between calsyntenin-1 and early HCV

infection. We know from various reports that after receptor-mediated entry of

HCV into the hepatocytes, it is taken up by early endosomes, which are the first

compartment to receive and sort internalised cargo (Meertans et al., 2006;

Pelkmans & Helenius 2003). Previous studies in neurons have also shown the role

of calsyntenin-1 in early endosome transport via its association with KLC1

(Steuble et al., 2010). In our HCV entry experiment, HCV core and early

endosomes were colocalised as early as 2 h after HCV entry, while an association

between calsyntenin-1 and early endosomes was also observed in Huh7 hepatoma


! 187!

cells using live cell imaging. The effect of silenced calsyntenin-1 on trafficking

of early endosomes was further evaluated. We showed that depletion of

calsyntenin-1 in Huh7 cells altered the distribution of early endosomes and they

were thus no longer available at the plasma membrane to pick up internalised

cargo. This deficit was accompanied by reduction in early endosome velocity,

altered movement pattern and disruption of its function in silenced calsyntenin-1

cells. Collectively, this malfunction was suggestive of the disruption of plus end

directed movement of early endosomes along microtubules, using kinesin-1

mediated transport. Unfortunately, we were unable to show the effect of silenced

calsyntenin-1 on HCV entry by immunofluorescence. This is likely due to the

small amount of viral protein present on incoming virus particles and a low

signal:noise ratio. However, entry experiments using a HCV pseudoparticle assay

demonstrated that there was no change in HCV binding and entry in calsyntenin-

1 silenced cells. This supports our hypothesis that calsyntenin-1 is involved in

early HCV infection at steps subsequent to receptor-mediated entry. Altogether,

our data indicate a specific role for calsyntenin-1 in the trafficking of early

endosomes, which in turn affect the entry of HCV into the hepatocytes.

In Chapter 5, the role of calsyntenin-1 in HCV replication was investigated.

Following its release from early endosomes, translation of the HCV genome into

viral proteins at the ER, and subsequent RNA replication, proceed with the help of

host and viral factors (Bartenschlager et al., 2010). This process requires

establishment of special viral RNA replicating structures, called replication

complexes, at specific sites (membranous web) on the endoplasmic reticulum

(Berger et al., 2009). One of the most important viral replication complex proteins


! 188!

involved at this step is NS5A, which we found moved in association with

calsyntenin-1 in our live cell imaging experiments. NS5A has no intrinsic

enzymatic activity, but acts as an adapter protein for a variety of host factors

involved in cell signaling and membrane trafficking (Vogt et al., 2013). It

transports newly synthesised HCV RNA from replication sites to lipid droplets for

encapsidation (Miyanari et al., 2007; Evans et al., 2004). Similarly, a close

association was also seen between calsyntenin-1 and the HCV RNA replication

intermediate (dsRNA), highlighting interaction between actively replicating viral

RNA, intracellular transport and calsyntenin-1.

To further monitor HCV replication kinetics over time, we transfected control or

calsyntenin-1 silenced Huh7 cells with a sub genomic replicon containing a

luciferase reporter (pSGR-luc-JFH1). Our results showed >80% decrease in HCV

replication owing to late onset of HCV replication complex formation, suggesting

discrepancy in essential NS5A transport in the absence of calsyntenin-1. To

directly study NS5A transport, we used a HCV replicon (pSGR-luc-GFP-JFH1)

containing an NS5A-GFP fusion and imaged the replication complexes in real

time (Jones et al., 2007). Previous studies have shown that NS5A containing a

green fluorescent protein (GFP) tag in its C-terminal domain successfully

incorporates into functional HCV replication complexes, making them visible

under a fluorescence microscope (Moradpour et al., 2004). A significant reduction

in the velocity and distribution of these replication complexes was also seen

within calsyntenin-1 silenced cells. Motility of NS5A and efficient HCV

replication are dependent on the microtubule network and several host factors

including vesicle associated protein-A (VAP-A) and (early endosome marker)


! 189!

Rab5a (Eyre et al., 2014). On the whole, our results suggest that calsyntenin-1

acts as an adapter for microtubule-associated transport of NS5A, to establish and

maintain efficient viral replication.

The final chapter (Chapter 6) of this thesis examines the role of calsyntenin-1 in

HCV secretion through endosomal pathways. Increased secretion of calsyntenin-1

from HCV-infected cells in the SILAC screen prompted us to investigate the level

of calsyntenin-1 in HCV infected cell lysates and supernatants. To our surprise,

when we silenced calsyntenin-1 in HCV infected cells and measured the

infectivity of total virus released, it remained unaffected. Hence, calsyntenin-1

release is not dependent on the conventional VLDL-based HCV secretion

pathway. Keeping in mind the endosome trafficking role of calsyntenin-1 at other

stages of viral infection, we investigated endosome based secretory pathways

involved in HCV egress. Recently, it has been shown that HCV can also be

secreted via multi-vesicular bodies (MVBs), endosomal sorting complex required

for transport (ESCRT) and hepatocyte receptor tyrosine kinase substrate (Hrs),

which together are involved in MVB biogenesis and secretion of exosomes (Lai et

al., 2014). Exosomes are released from the cell through the fusion of

multivesicular bodies (MVBs) with the plasma membrane. Several recent studies

showed that exosomes mediate indirect cell-to-cell communication and transfer

macromolecules, functional proteins and RNA between cells (Bukong et al.,

2014). For HCV, exosomes have been identified in media from HCV infected

cells and in plasma of HCV infected patients (Gastaminza et al., 2010;

Masciopinto et al., 2004). Another study has reported that circulating HCV

exosomes from HCV infected patients are capable of infecting primary human


! 190!

hepatocytes through cell-to-cell, receptor independent transmission (Bukong et

al., 2014).

To evaluate the involvement of calsyntenin-1 in the HCV exosome secretory

pathway, we concentrated virus from the supernatant of HCV infected cells and

performed sucrose density gradient fractionation. Different fractions were then

analysed for calsyntenin-1, HCV core and exosome marker (CD63) proteins,

which were commonly all present in the one fraction. This suggests that the

release of HCV virions takes place in association with exosomes and calsyntenin-

1. To further examine this association, we silenced HCV infected cells for

calsyntenin-1 and isolated exosomes from their serum free supernatants. We

observed that the infectivity of exosomes was reduced in the absence of

calsyntenin-1 as compared to control cells treated with scrambled RNA. Thus, the

calsyntenin-1 protein may be involved in exosome-mediated release of HCV

particles from infected cells.

From intracellular studies, we know that within late endosomes, inward

invaginations of the endosomal membrane results in intraluminal vesicles (ILVs)

which form the multivesicular body (MVB) (Fevrier et al., 2004). These MVBs

then fuse with the plasma membrane to release the ILVs from the cell, which are

then called exosomes (Van Niel G et al., 2006). We have demonstrated the

association of MVBs with calsyntenin-1 and HCV core within HCV infected

cells, suggesting a possible role in viral pathogenesis. This was further confirmed

by demonstrating altered MVB distribution in HCV infected cells after siRNA

mediated loss of calsyntenin-1. This observation suggests the adapter protein


! 191!

calsyntenin-1 is involved in kinesin-1 mediated transport of MVBs within cells

and finally release of exosomes after fusion with plasma membrane.

Finally, previous reports propose a possible role for calsyntenin-1 in facilitating

cell secretion, through its association with recycling endosomes in neurons

(Steuble et al., 2012). Similarly, HCV core also interacts with recycling

endosomes of the cellular recycling pathway on its journey from the trans-golgi

network (TGN), en route to the plasma membrane (Lai et al., 2010). Interestingly,

we observed colocalization of calsyntenin-1 with both recycling endosomes and

HCV core, which indicates a role for recycling endosomes, in association with

calsyntenin-1, for trafficking HCV core within virus infected cells. Further loss

of calsyntenin-1 in HCV infected cells restricted the distribution or recycling

endosomes, suggesting a vital role for calsyntenin-1 in the HCV virus recycling

pathway, an hypothesis that warrants further elucidation.

7.3 Future Directions

The results in this thesis suggest an in vitro role of calsyntenin-1 in HCV

pathogenesis at all stages of the virus life cycle. Future aims include

1. To evaluate the in vivo role of calsyntenin-1 in HCV infected mouse

models or primary cells.

2. To examine the kinetics of HCV exosome release in HCV infected clinical

samples thus identifying its role in disease spread.

3. To investigate the role of calsynteinin-1 in pathogenesis of other viruses.


! 192!

7.4 Conclusion

Throughout the course of this thesis I have addressed all the specific aims and

have confirmed the original hypothesis (Figure 7.1). In summary, I have shown

that HCV infection up regulates the release of calsyntenin-1 through exosomes.

The other specific aims were achieved as follows;

(1) Role of calsyntenin-1 in HCV early infection was evaluated by observing its

association with early endosome trafficking after receptor mediated virus entry.

(2) Interaction between HCV replication and calsyntenin-1 was assessed through

its association with HCV replication complexes and its effect on their replication

efficiency and trafficking ability within HCV infected cells.

(3) Process of HCV egress was examined and a role of calsyntenin-1 was

demonstrated in HCV endosome based secretory pathways including recycling

endosomes, multivesicular bodies and exosomes.

Overall, our interpretations show the insights of HCV replication cycle dynamics

and the importance of cellular trafficking pathways. It opens the door to several

new and exciting avenues of HCV replication cycle investigation. Using

calsyntenin-1 as a target for HCV therapeutic approach would be challenging. It

depends on using a specific liver delivery system to avoid side effects on other

body organs, particularly the nervous system. However insights gained from this

thesis improve our understanding of HCV-associated pathogenesis, and have

implications not only for HCV, but potentially also for other viruses that interact

with cellular endosomal pathways.


! 193!

Figure 7.1 Calsyntenin-1 is involved in HCV pathogenesis at various stages. It

interacts with (1) HCV early infection through early endosomes (Rab5a) & Core,

(2) HCV Replication by association with HCV NS5A and dsRNA, (3) HCV egress

through exosome release and (4) recycling pathway via recycling endosomes

(Rab11A).

Nucleus'

Late'endosome'(MVB)'CD63'

EEaA1/

Rab5a'

SorAng

'endoso

me' Rab11a%

''''Early'InfecAon'

Exosome''Release'

RECYCLING'

CalsynteninJ1'

CD63%

core'

core'

Rab5A'core'

Recycling''

endosomes'

RC'

RC'

RC'

RC'

NS5A/dsRNA'

''ReplicaAon'2'

1'

3'

4'

ER'

Chapter(8:(References(

! 194!

CHAPTER 8: REFERENCES

Abid, K., V. Pazienza, A. de Gottardi, L. Rubbia-Brandt, B. Conne, P. Pugnale, C. Rossi, A. Mangia & F. Negro (2005) An in vitro model of hepatitis C virus G3a-associated triglycerides accumulation. Journal of Hepatology, 42, 744-751.

Afdhal, N., Reddy, K.R., Nelson, D.R., Lawitz, E., Gordon, S.C., Schiff, E.,

Nahass, R., Ghalib, R., Gitlin, N., Herring, R., et al. (2014). Ledipasvir and sofosbuvir for previously treated HCV genotype 1 infection. The New England journal of medicine, 370, 1483-1493.

Alberts, Bruce., (2008). Molecular Biology of the Cell (5th ed.). New York:

Garland Science. ISBN 978-0-8153-4105-5. Alvarez-Erviti, L. Seow, Y., Yin, H., Betts, C., Lakhal, S & Wood, M. (2011)

Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat. Biotechnol. 29, 341–345

Alvisi G, Madan V, Bartenschlager R (2011) Hepatitis C virus and host cell

lipids: an intimate connection. RNA Biol 8, 258–269. Andersson L., Boström P., Ericson J., Rutberg M., Magnusson B., Marchesan D.,

Ruiz M., Asp L., Huang P., Frohman M. A. et al. (2006). PLD1 and ERK2 regulate cytosolic lipid droplet formation. J. Cell Sci. 119, 2246–2257.

Andre ́, P., Komurian-Pradel, F., Deforges, S., Perret, M., Berland, J. L., Sodoyer,

M., Pol, S., Bre ́chot, C., Paranhos-Baccala`, G., and Lotteau, V. (2002) J. Virol. 76, 6919 – 6928.

Apodaca, G., (2001) Endocytic traffic in polarized epithelial cells: role of the

actin and microtubule cytoskeleton. Traffic, 2, 149-159. Araki Y, Kawano T, Taru H, Saito Y, Wada S, Miyamoto K, Kobayashi H,

Ishikawa HO, Ohsugi Y, Yamamoto T. (2007) The novel cargo Alcadein induces vesicle association of kinesin-1 motor components and activates axonal transport. EMBO J. 26, 1475–1486.

Araki Y, Miyagi N, Kato N, Yoshida T & Wada S (2004) Coordinated

metabolism of Alcadein and amyloid beta-protein precursor regulates FE65-dependent gene transactivation. J Biol Chem 279: 24343–24354.

Araki, Y., Tomita, S., Yamaguchi, H., Miyagi, N., Sumioka, A., Kirino, Y., and

Suzuki, T. (2003). Novel cadherin-related membrane proteins,


! 195!

Alcadeins, enhance the X11-like protein-mediated stabilization of amyloid beta-protein precursor metabolism. J. Biol. Chem. 278, 49448-49458.

Ariumi Y., Kuroki M., Maki M., Ikeda M., Dansako H., Wakita T. (2011). The

ESCRT system is required for hepatitis C virus production. PLoS ONE, 6, e1451710.

Asao, H., Sasaki, Y., Arita, T., Tanaka, N., Endo, K., Kasai, H., Takeshita, T.,

Endo, Y., Fujita, T. and Sugamura, K. (1997). Hrs is associated with STAM, a signal-transducing adaptor molecule. J. Biol. Che, 272, 32785- 32791.

Babbey CM, Ahktar N, Wang E, Chen CC, Grant BD, Dunn KW. (2006) Rab10

regulates membrane transport through early endosomes of polarized Madin-Darby canine kidney cells. Mol Biol Cell, 17, 3156– 3175.

Babst M, Katzmann DJ, Snyder WB, Wendland B, Emr SD. (200b) Endosome-

associated complex, ESCRT-II, recruits transport machinery for protein sorting at the multivesicular body. Dev Cell, 3, 283–289.

Bartenschlager R, Cosset FL, Lohmann V. (2010) Hepatitis C virus replication

cycle. J Hepatol, 53, 583–585. Bartenschlager R, Lohmann V, Penin F. (2013) The molecular and structural basis

of advanced antiviral therapy for hepatitis C virus infection. Nat Rev Microbiol, 11, 482–496.

Bartosch B, Dubuisson J et al (2003) Infectious hepatitis C virus pseudo-particles

containing functional E1–E2 envelope protein complexes. J Exp Med, 197(5), 633–642.

Beheshti H E, Pham S, Adomat H, Li N and Guns T. (2012) Exosomes as

Biomarker Enriched Microvesicles: Characterization of Exosomal Proteins Derived from a Panel of Prostate Cell Lines with Distinct AR Phenotypes. Mol Cell Proteomics. 11(10), 863–885.

Benmerah A. (2004) Endocytosis: signaling from endocytic membranes to the

nucleus. Curr Biol, 14, R314– 316. Berger KL, Cooper JD, Heaton NS, Yoon R, Oakland TE, Jordan TX, Mateu G,

Grakoui A, Randall G. (2009) Roles for endocytic trafficking and phosphatidylinositol 4-kinase III alpha in hepatitis C virus replication. Proc Natl Acad Sci U S A. 106(18), 7577–82.

Blanchard, E., S. Belouzard, L. Goueslain, T. Wakita, J. Dubuisson, C.

Wychowski & Y. Rouille (2006) Hepatitis C virus entry depends on clathrin-mediated endocytosis. Journal of Virology, 80, 6964-72.


! 196!

Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV

RNA replication in cell culture. Science, 290, 1972–1974. Blight, K. J., McKeating, J. A., & Rice, C. M. (2002). Highly Permissive Cell

Lines for Subgenomic and Genomic Hepatitis C Virus RNA Replication. Journal of Virology, 76(24), 13001–13014.

Boehringer, D, Thermann, R (2005) Structure of the hepatitis C Virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES. Structure 13, 1695-1706.

Borges, F.T., Reis, L.A., & Schor, N.. (2013). Extracellular vesicles: structure,

function, and potential clinical uses in renal diseases.Brazilian Journal of Medical and Biological Research, 46(10), 824-830.

Bost, A. G., D. Venable, L. Liu, and B. A. Heinz. (2003) Cytoskeletal requirements

for hepatitis C virus (HCV) RNA synthesis in the HCV replicon cell culture system. J. Virol, 77, 4401-4408.

Bostrom, P., Rutberg, M., Ericsson, J., Holmdahl, P., Andersson, L., Frohman, M.

A., Boren, J. and Olofsson, S. O. (2005). Cytosolic lipid droplets increase in size by microtubule-dependent complex formation. Arterioscler. Thromb. Vasc. Biol, 25, 1945- 1951.

Boulant S, Douglas MW, Moody L, Budkowska A, Targett-Adams P, et al.

(2008) Hepatitis C virus core protein induces lipid droplet redistribution in a microtubule- and dynein-dependent manner. Traffic, 9,1268–1282.

Brass V, Bieck E, Montserret R, Wolk B, Hellings JA, (2002) An amino- terminal

amphipathic alpha-helix mediates membrane association of the hepatitis C virus nonstructural protein 5A. J Biol Chem, 277, 8130–8139.

Brown, A. (2003) Axonal transport of membranous and nonmembranous cargoes:

a unified perspective. J. Cell Biol, 160, 817-821. Bucci C, Parton RG, Mather IH, Stunnenberg H, Simons K, Hoflack B, Zerial M.

(1992) The small GTPase rab5 functions as a regulatory factor in the early endocytic pathway. Cell, 70, 715–728.

Bukong, T. N., Momen-Heravi, F., Kodys, K., Bala, S., & Szabo, G. (2014).

Exosomes from Hepatitis C Infected Patients Transmit HCV Infection and Contain Replication Competent Viral RNA in Complex with Ago2-miR122-HSP90. PLoS Pathogens, 10(10), e1004424.

Burlone, M.E., Budkowska A. (2009) Hepatitis C virus cell entry: role of

lipoproteins and cellular receptors. J Gen Virol. 90, 1055–1070.


! 197!

Cai D, Hoppe AD, Swanson JA, Verhey KJ. (2007) Kinesin-1 structural organization and conformational changes revealed by FRET stoichiometry in live cells. J Cell Biol, 176, 51–63.

Carrere-Kremer, S., Montpellier-Pala, C., Cocquerel, L., Wychowski, C., Penin, F. & Dubuisson, J. (2002). Subcellular localization and topology of the p7 polypeptide of hepatitis C virus. J Virol, 76, 3720–3730.

Chang, K.-S., Jiang, J., Cai, Z., & Luo, G. (2007). Human Apolipoprotein E Is

Required for Infectivity and Production of Hepatitis C Virus in Cell Culture .Journal of Virology, 81(24), 13783–13793.

Choo, Q. L., Richman, K. H., Han, J. H., Berger, K., Lee, C., Dong, C., ... Barr, P.

J. (1991). Genetic organization and diversity of the hepatitis C virus. Proceedings of the National Academy of Sciences of the United States of America, 88(6), 2451–5.

Coller, K. E., Berger, K. L., Heaton, N. S., Cooper, J. D., Yoon, R., & Randall, G.

(2009). RNA Interference and Single Particle Tracking Analysis of Hepatitis C Virus Endocytosis. PLoS Pathogens, 5(12), e1000702.

Coller, K. E., Heaton, N. S., Berger, K. L., Cooper, J. D., Saunders, J. L., and

Randall, G. (2012) Molecular determinants and dynamics of hepatitis C virus secretion. PLoS Pathog, 8, e1002466.

Conde C & Cáceres A. (2009). Microtubule assembly, organization and dynamics

in axons and dendrites. Nature Reviews Neuroscience, 10, 319-332. Corless, L., C. M. Crump, S. D. Griffin, and M. Harris. 2010. Vps4 and the

ESCRT-III complex are required for the release of infectious hepatitis C virus particles. J. Gen. Virol, 91, 362–372.

Cosset, F.L., and Dreux, M. (2014). HCV transmission by hepatic exosomes

establishes a productive infection. Journal of hepatology, 60, 674-675. Craven R C, Harty R N, Paragas J, Palese P, Wills J W. (1999) Late domain

function identified in the vesicular stomatitis virus M protein by use of rhabdovirus-retrovirus chimeras. J Virol. 73, 3359–3365.

Dao T., Granier, VL., Zeisel, ., Guerin, M.B., Mancip, M., Granio, J.,

(2012) Characterization of hepatitis C virus particle subpopulations reveals multiple usage of the scavenger receptor BI for entry steps. J Biol Chem, 287, 31242–31257.

Daro E, van der Sluijs P, Galli T, Mellman I. (1996) Rab4 and cellubrevin define different early endosome populations on the pathway of transferrin receptor recycling. Proc Natl Acad Sci USA, 93, 9559– 9564.


! 198!

Dautry-Varsat, A., Ciechanover, A. and Lodish, H. F. (1983). pH and the recycling of transferrin during receptor-mediated endocytosis. Proc. Nat. Acad. Sci. USA, 80, 2258-2262.

Decaens, C., Durand, M., Grosse, B., and Cassio, D. (2008) Which in vitro

models could be best used to study hepatocyte polarity? Biol Cell 100: 387–398.Harris, H.J., Clerte, C., Farquhar, M.J., Goodall, M., Hu, K., Rassam, P., Dosset, P., Wilson, G.K., Balfe, P., Ijzendoorn, S.C., et al. (2013). Hepatoma polarization limits CD81 and hepatitis C virus dynamics. Cellular microbiology, 15, 430-445.

Deneka M, van der Sluijs P. (2002) ‘Rab’ing up endosomal membrane transport.

Nat Cell Biol, 4, E33–35. Dodding, M.P., and Way, M. (2011). Coupling viruses to dynein and kinesin-1.

The EMBO journal, 30, 3527-3539. Dohner K, and Sodeik B. (2005) The role of the cytoskeleton during viral

infection. Current Top.Microbiol. Immunol, 285, 67–108. Dragovic, R.A.; Gardiner, C.; Brooks, A.S.; Tannetta, D.S.; Ferguson, D.J.;

Hole, P.; Carr, B.; Redman, C.W.; Harris, A.L.; Dobson, P.J.; Harrison, P.; Sargent, I.L. (2011) Sizing and phenotyping of cellular vesicles using Nanoparticle Tracking Analysis. Nanomedicine, 7, 780–788.

Dreux, M., Garaigorta, U., Boyd, B., Décembre, E., Chung, J., Whitten-Bauer, C.,

… Chisari, F. V. (2012). Short range exosomal transfer of viral RNA from infected cells to plasmacytoid dendritic cells triggers innate immunity. Cell Host & Microbe, 12(4), 558–570.

Drummer, H.E., Maerz, A., and Poumbourios, P. (2003). Cell surface expression

of functional hepatitis C virus E1 and E2 glycoproteins. FEBS Letters, 546, 385-390.

Duijvesz D, Luider T, Bangma CH, Jenster G (2011) Exosomes as biomarker

treasure chests for prostate cancer. Eur Urol, 59(5), 823–831. Dunn KW, McGraw TE, Maxfield FR. (1989) Iterative fractionation of recycling

receptors from lysosomally destined ligands in an early sorting endosome. J Cell Biol, 109, 3303–3314.

Egger, D., B. Wo ̈lk, R. Gosert, L. Bianchi, H. E. Blum, D. Moradpour, and K.

Bienz. (2002) Expression of hepatitis C virus proteins induces distinct membrane alterations including a candidate viral replication complex. J. Virol, 76, 5974–5984.


! 199!

Elazar M, Cheong KH, Liu P, Greenberg HB, Rice CM (2003) Amphipathic helix-dependent localization of NS5A mediates hepatitis C virus RNA replication. J Virol, 77, 6055–6061.

Evans MJ, Rice CM, Goff SP (2004) Phosphorylation of hepatitis C virus

nonstructural protein 5A modulates its protein interactions and viral RNA replication. Proc Natl Acad Sci U S A, 101, 13038–13043.

Eyre, N.S., Fiches, G.N., Aloia, A.L., Helbig, K.J., McCartney, E.M., McErlean,

C.S., Li, K., Aggarwal, A., Turville, S.G., and Beard, M.R. (2014). Dynamic imaging of the hepatitis C virus NS5A protein during a productive infection. Journal of virology, 88, 3636-3652.

Faure, J.; Lachenal, G.; Court, M.; Hirrlinger, J.; Chatellard-Causse, C.; Blot,

B.; Grange, J.; Schoehn, G.; Goldberg, Y.; Boyer, V.; Kirchhoff, F.; Raposo, G.; Garin, J.; Sadoul, R. (2006) Exosomes are released by cultured cortical neurones. Mol. Cell. Neurosci, 31, 642–648.

Ferraris, P., E. Beaumont, R. Uzbekov, D. Brand, J. Gaillard, E. Blanchard, and P.

Roingeard. 2013. Sequential biogenesis of host cell membrane rearrangements induced by hepatitis C virus infection. Cellular and molecular life sciences, 70, 1297-1306.

Ferraris, P., E. Blanchard, and P. Roingeard. (2010) Ultrastructural and

biochemical analyses of hepatitis C virus-associated host cell membranes. J Gen Virol, 91, 2230-2237.

Février, B., Raposo, G. (2004) Exosomes: endosomal-derived vesicles shipping

extracellular messages, Curr. Opin. Cell Biol, 16, 415–421. Folsch H. (2005) The building blocks for basolateral vesicles in polarized

epithelial cells. Trends Cell Biol, 15, 222–228. Forns, X., & Bukh, J., (1999) The Molecular Biology of Hepatitis C. Clinics in

Liver Disease, 3(4), 693-714. Freeman, A.J., Dore GJ, Law MG. (2001) Estimating progression to cirrhosis in

chronic hepatitis C virus infection. Hepatology, 34, 809-16. Friebe, P., & Bartenschlager, R. (2002) Genetic Analysis of Sequences in the 3′

Nontranslated Region of Hepatitis C Virus That Are Important for RNA Replication. J. Virol, 76, 5326–5338.

Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Goncales FL, Jr., et

al. (2002) Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med. 347(13), 975-82.


! 200!

Gale M Jr & Foy. EM, (2005) Evasion of intracellular host defence by hepatitis C virus. Nature, 436, 939–945.

Gao, L., H. Aizaki, J. W. He, and M. M. Lai. (2004) Interactions between viral

nonstructural proteins and host protein hVAP-33 mediate the formation of hepatitis C virus RNA replication complex on lipid raft. J. Virol, 78, 3480-3488.

Gastaminza P, Dryden KA, Boyd B, Wood MR, Law M, et al. (2010)

Ultrastructural and biophysical characterization of hepatitis C virus particles produced in cell culture. Journal of virology, 84, 10999–11009.

Gastaminza, P., Cheng, G., Wieland, S., Zhong, J., Liao, W., & Chisari, F. V.

(2008). Cellular Determinants of Hepatitis C Virus Assembly, Maturation, Degradation, and Secretion . Journal of Virology, 82(5), 2120–2129.

Gibbons, G.F., Wiggins, D., Brown, A.M., and Hebbachi, A.M. 2004. Synthesis

and function of hepatic very-low-density lipoprotein. Biochem. Soc. Trans, 32, 59–64.

Goldstein LS, Yang Z. (2000) Microtubule-based transport systems in neurons:

the roles of kinesins and dyneins. Annu Rev Neurosci, 23, 39–71. Goldstein, L.S. (2001) Molecular motors: from one motor many tails to one motor

many tales. Trends Cell Biol, 11, 477–482. Gorvel JP, Chavrier P, Zerial M, Gruenberg J. (1991) Rab5 controls early

endosome fusion in vitro. Cell, 64, 915–925. Gosert, R., D. Egger, V. Lohmann, R. Bartenschlager, H. E. Blum, K. Bienz, and

D. Moradpour. (2003) Identification of the hepatitis C virus RNA replication complex in Huh-7 cells harboring subgenomic replicons. J. Virol, 77, 5487–5492.

Grant B. D. & Donaldson J. G. (2009) Pathways and mechanisms of endocytic

recycling. Nat. Rev. Mol. Cell Biol, 10, 597–608. Griffin, S.D., riffin SD, Beales LP, Clarke DS, Worsfold O, Evans SD, Jaeger J,

Harris MP, Rowlands DJ. (2003) The p7 protein of hepatitis C virus forms an ion channel that is blocked by the antiviral drug, Amantadine. FEBS Lett, 535, 34-8.

Gross, D. N., H. Miyoshi, T. Hosaka, H. H. Zhang, E. C. Pino, S. Souza, M. Obin,

A. S. Greenberg, and P. F. Pilch. (2006) Dynamics of lipid droplet-associated proteins during hormonally stimulated lipolysis in engineered adipocytes: stabilization and lipid droplet binding of


! 201!

adipocyte differentiation-related protein/adipophilin. Mol. Endocrinol. 20, 459–466.

Grosshans BL, Ortiz D, Novick P. (2006) Rabs and their effectors: achieving

specificity in membrane traffic. Proc Natl Acad Sci USA, 103, 11821–11827.

Gruenberg J, Griffiths G, Howell KE. (1989) Characterization of the early

endosome and putative endocytic carrier vesicles in vivo and with an assay of vesicle fusion in vitro. The Journal of Cell Biology, 108, 1301–1316.

Gruenberg J, Stenmark H. (2004) The biogenesis of multivesicular

endosomes. Nature reviews Molecular cell biology, 4, 317–23. Gundersen, G. G. (2002). Evolutionary conservation of microtubule-capture

mechanisms. Nat. Rev. Mol. Cell Biol, 3, 296–304. Hamamoto, I., Y. Nishimura, T. Okamoto, H. Aizaki, M. Liu, Y. Mori, T. Abe, T.

Suzuki, M. M. Lai, T. Miyamura, K. Moriishi, and Y. Matsuura. (2005) Human VAP-B is involved in hepatitis C virus replication through interaction with NS5A and NS5B. J. Virol, 79, 13473-13482.

Hanson, P.I., and Cashikar, A. (2012) Multivesicular body morphogenesis.

Annual review of cell and developmental biology, 28, 337-362. Harris, H.J., Clerte, C., Farquhar, M.J., Goodall, M., Hu, K., Rassam, P., Dosset,

P., Wilson, G.K., Balfe, P., Ijzendoorn, S.C., et al. (2013). Hepatoma polarization limits CD81 and hepatitis C virus dynamics. Cellular microbiology, 15, 430-445.

Hata S, Fujishige S, Araki Y, Kato N, Araseki M, et al. (2009) Alcadein cleavages

by amyloid beta-precursor protein (APP) alpha- and gamma-secretases generate small peptides, p3-Alcs, indicating Alzheimer disease-related gamma- secretase dysfunction. J Biol Chem, 284, 36024–36033.

Hata, T., Murakami, K., Nakatani, H., Yamamoto, Y., Matsuda, T., and Aoki, N.

(2010). Isolation of bovine milk-derived microvesicles carrying mRNAs and microRNAs. Biochemical and biophysical research communications, 396, 528-533.

He Y, Staschke KA, Tan SL (2006) HCV NS5A: A Multifunctional Regulator of

Cellular Pathways and Virus Replication. In: Tan SL, editor. Hepatitis C Viruses: Genomes and Molecular Biology. Norfolk, UK.

Herbst JJ, Opresko LK, Walsh BJ, Lauffenburger DA, Wiley HS. (1994)

Regulation of postendocytic trafficking of the epidermal growth factor receptor through endosomal retention. J Biol Chem, 269, 12865–


! 202!

12873. Herrmann, H., Bar, H., Kreplak, L., Strelkov, S. V. and Aebi, U. (2007).

Intermediate filaments: from cell architecture to nanomechanics. Nat. Rev. Mol. Cell Biol. 8, 562-573.

Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Shimotohno K. (1991) Gene

mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proc Natl Acad Sci U S A, 88(13), 5547–5551.

Hintsch G., Zurlinden A., Meskenaite V., Steuble M., Fink-Widmer K., Kinter J., Sonderegger P. (2002) The calsyntenins - a family of postsynaptic membrane proteins with distinct neuronal expression patterns. Mol. Cell. Neurosci, 21, 393-409.

Hirano S, Takeichi M. (2012) Cadherins in brain morphogenesis and

wiring. Physiol Rev, 92(2), 597–634. Hirokawa N, Pfister KK, Yorifugi H, Wagner MC, Brady ST, Bloom GS. (1989)

Submolecular domains of bovine brain kinesin identified by electron microscopy and monoclonal antibody decoration. Cell. 56, 867–878.

Hirokawa, N., Takemura, R. (2005) Molecular motors and mechanisms of

directional transport in neurons. Nat Rev Neurosci, 6, 201–21. Hoepfner, S., Severin, F., Cabezas, A., Habermann, B., Runge, A.,Gillooly, D., St

enmark, H. nd Zerial, M. (2005). Modulation of receptor recycling and degradation by the endosomal kinesin KIF16B. Cell, 121, 437-450.

Hope RG, Murphy DJ, McLauchlan J. (2002) The domains required to direct core

proteins of hepatitis C virus and GB virus-B to lipid droplets share common features with plant oleosin proteins. J Biol Chem, 277, 4261-70.

Houghton, M. (1996) Hepatitis C viruses. 1035, 1058, Lippincott-Raven,

Philadelphia. Hsu M, Zhang J, Flint M, Logvinoff C, Cheng-Mayer C, Rice CM, McKeating

JA. (2003) Hepatitis C virus glycoproteins mediate pH-dependent cell entry of pseudotyped retroviral particles. Proc Natl Acad Sci USA, 100(12), 7271–7276.

Huang H., Chen Y., Ye J. (2007) Inhibition of hepatitis C virus replication by

peroxidation of arachidonate and restoration by vitamin E. Proc. Natl. Acad. Sci. USA, 104, 18666–18670.

Ikeda DD, Duan Y, Matsuki M, Kunitomo H, Hutter H, Hedgecock EM, Iino Y


! 203!

(2008). "CASY-1, an ortholog of calsyntenins/alcadeins, is essential for learning in Caenorhabditis elegans". Proc. Natl. Acad. Sci. U.S.A, 105 (13), 5260–5.

Jacobson IM, Dore GJ, Foster GR, Fried MW, Radu M, Rafalsky VV, et al.

(2014) Simeprevir with pegylated interferon alfa 2a plus ribavirin in treatment-naive patients with chronic hepatitis C virus genotype 1 infection (QUEST-1): a phase 3, randomised, double-blind, placebo-controlled trial. The Lancet, 384(9941), 403-13.

Janice A. Fischer, Suk Ho Eun, and Benjamin T. Doolan. (2006) Endocytosis,

Endosome Trafficking, and the Regulation ofDrosophila Development. Annual Review of Cell and Developmental Biology, 22, 181-206.

Janssen HL, Reesink HW, Lawitz EJ, Zeuzem S, Rodriguez-Torres M, Patel K et

al.. Treatment of HCV infection by targeting microRNA. N Engl J Med. 2013; 368(18):1685-94.

Jayasekera CR, Barry M, Roberts LR, Nguyen MH. (2014) Treating hepatitis C in

lower-income countries. N Engl J Med, 370, 1869-1871. Jones D. M., Gretton S. N., McLauchlan J., Targett-Adams P. (2007) Mobility

analysis of an NS5A-GFP fusion protein in cells actively replicating hepatitis C virus subgenomic RNA. J. Gen. Virol, 88, 470–475.

Jones, D.M., & McLauchlan, J. (2010) Hepatitis C virus: assembly and release of

virus particles. J. Biol. Chem, 285(30), 22733-22739. Junutula JR, De Maziere AM, Peden AA, Ervin KE, Advani RJ, van Dijk SM,

Klumperman J, Scheller RH. (2004) Rab14 is involved in membrane trafficking between the Golgi complex and endosomes. Mol Biol Cell, 15, 2218–2229.

Kalra, H.; Simpson, R.J.; Ji, H.; Aikawa, E.; Altevogt, P.; Askenase, P.; Bond,

V.C.; Borras, F.E.; Breakefield, X.; Budnik, V.; Buzas, E.; Camussi, G.; Clayton, A.; Cocucci, E.; Falcon-Perez, J.M.; Gabrielsson, S.; Gho, Y.S.; Gupta, D.; Harsha, H.C.; Hendrix, A.; Hill, A.F.; Inal, J.M.; Jenster, G.; Kramer-Albers, E.M.; Lim, S.K.; Llorente, A.; Lotvall, J.; Marcilla, A.; Mincheva-Nilsson, L.; Nazarenko, I.; Nieuwland, R.; Nolte-'t Hoen, E.N.; Pandey, A.; Patel, T.; Piper, M.G.; Pluchino, S.; Prasad, T.S.; Rajendran, L.; Raposo, G.; Record, M.; Reid, G.E.; Sanchez-Madrid, F.; Schiffelers, R.M.; Siljander, P.; Stensballe, A.; Stoorvogel, W.; Taylor, D.; Thery, C.; Valadi, H.; van Balkom, B.W.; Vazquez, J.; Vidal, M.; Wauben, M.H.; Yanez-Mo, M.; Zoeller, M.; Mathivanan, S. Vesiclepedia. (2012) A compendium for extracellular vesicles with continuous community annotation. PLoS Biol, 10, e1001450.


! 204!

Kamal, A., & L.S. Goldstein, (2000) Connecting vesicle transport to the

cytoskeleton. Curr. Opin. Cell Biol, 12:503–508. Kapitein LC, Peterman EJ, Kwok BH, Kim JH, Kapoor TM, Schmidt CF. The

bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks.Nature. 2005;435:114–118.

Kato N, & Sugiyama K. (2003) Establishment of a hepatitis C virus subgenomic

replicon derived from human hepatocytes infected in vitro. Biochem Biophys Res Commun, 306(3), 756–766.

Kato T, & Furusaka A. (2001) Sequence analysis of hepatitis C virus isolated

from a fulminant hepatitis patient. J Med Virol, 64(3), 334–339. Kato, N. (2001) Molecular virology of hepatitis C virus. Acta. Me. Okayama,

55(3), 133-159. Kawano T, Araseki M, Araki Y, Kinjo M, Yamamoto T, et al. (2012) A small

peptide sequence is sufficient for initiating Kinesin-1 activation through part of the tetratricopeptide repeat region of KLC1. Traffic, 13, 834–848.

Keller, S., Sanderson, M. P., Stoeck, A. and Altevogt, P. (2006). Exosomes: From

biogenesis and secretion to biological function. Immunology Letters, 107, 102-108.

Kobayashi, T., Vischer, U. M., Rosnoblet, C., Lebrand, C., Lindsay, M., Parton,

R. G., Kruithof, E. K. and Gruenberg, J. (2000) The tetraspanin CD63/lamp3 cycles between endocytic and secretory compartments in human endothelial cells. Mol. Biol. Cell, 11, 1829-1843.

Kohji Moriishi and Yashiharu Matsuura. (2012) Exploitation of lipid components

by viral and host proteins for hepatitis C virus infection. Front. Microbiol, 3, 54.

Kolesnikova L., Berghöfer B., Bamberg S., Becker S. (2004) Multivesicular

bodies as a platform for formation of the Marburg virus envelope. J Virol, 78, 12277–12287.

Komada M, Kitamura N. (1995) Growth factor-induced tyrosine phosphorylation

of Hrs, a novel 115-kilodalton protein with a structurally conserved putative zinc finger domain. Mol Cell Biol, 15(11), 6213–21.

Komurian-Pradel F, Rajoharison A, Berland J-L, Khouri V, Perret M, et al.

(2004) Antigenic relevance of F protein in chronic hepatitis C virus infection. Hepatology, 40, 900–909.


! 205!

Konecna A, Frischknecht R, Kinter J, Ludwig A, Steuble M, Meskenaite V, Indermuhle M, Engel M, Cen C, Mateos JM. (2006) Calsyntenin-1 docks vesicular cargo to kinesin-1. Mol Biol Cell, 17, 3651–3663.

Koutsoudakis G, Kaul A, Steinmann E, Kallis S, Lohmann V. (2006)

Characterization of the early steps of hepatitis C virus infection by using luciferase reporter viruses. J Virol, 80, 5308–5320.

Kowdley KV, Gordon SC, Reddy KR, et al. (2014) Ledipasvir and sofosbuvir for

8 or 12 weeks for chronic HCV without cirrhosis. N Engl J Med, 370, 1879.

Kramer-Albers, E.M.; Bretz, N.; Tenzer, S.; Winterstein, C.; Mobius, W.;

Berger, H.; Nave, K.A.; Schild, H.; Trotter, J. (2007) Oligodendrocytes secrete exosomes containing major myelin and stress-protective proteins: Trophic support for axons? Proteomics Clin. Appl, 1, 1446–1461.

Lai JC, Chan WW, Kien F, Nicholls JM, Peiris JS, Garcia JM. (2010) Formation

of virus-like particles from human cell lines exclusively expressing Influenza neuraminidase. J Gen Virol, 91, 2322-30.

Lai, C.K., Jeng, K.S., Machida, K., and Lai, M.M. (2008). Association of hepatitis

C virus replication complexes with microtubules and actin filaments is dependent on the interaction of NS3 and NS5A. Journal of virology, 82, 8838-8848.

Lai, C.K., Saxena, V., Tseng, C.H., Jeng, K.S., Kohara, M., and Lai, M.M.

(2014). Nonstructural protein 5A is incorporated into hepatitis C virus low-density particle through interaction with core protein and microtubules during intracellular transport. PloS One, 9, e99022.

Lanford, R. E., Evans, M. J., Lohmann, V., Lindenbach, B., Gale, M.,

Rehermann, B., … Lemon, S. M. (2009). The Accelerating Pace of HCV Research: a Summary of the 15th International Symposium on Hepatitis C Virus and Related Viruses. Gastroenterology, 136(1), 9–16.

Lanford RE, Hildebrandt,Eriksen ES, Petri A, Persson R, Lindow M, Munk ME,

Kauppinen S, Orum H. (2010) Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science, 327, 198–201.

Lapierre, L. A., P. L. Tuma, J. Navarre, J. R. Goldenring, and J. M.

Anderson. (1999) VAP-33 localizes to both an intracellular vesicle population and with occludin at the tight junction. J. Cell Sci, 112, 3723-3732.


! 206!

Li, J., Liu, K., Liu, Y., Xu, Y., Zhang, F., Yang, H., Liu, J., Pan, T., Chen, J., Wu,

M., et al. (2013). Exosomes mediate the cell-to-cell transmission of IFN-alpha-induced antiviral activity. Nature immunology 14, 793-803.

Li J, Shariff A, Wiking M, Lundberg E, Rohde GK, Murphy RF.

(2012) Estimating microtubule distributions from 2D immunofluorescence microscopy images reveals differences among human cultured cell lines. PLoS ONE, 7(11), e50292.

Li Q, Brass AL, Ng A, Hu Z, Xavier RJ, Liang TJ, et al. (2009) A genome-wide

genetic screen for host factors required for hepatitis c virus propagation. Proc Natl Acad Sci U S A, 106(38), 16410–5.

Liew M, Erali M, Page S, Hillyard D, Wittwer C. (2004) Hepatitis C Genotyping

by Denaturing High-Performance Liquid Chromatography. J Clin Microbial, 42 (1), 158-163.

Lin C, Lindenbach BD, Prágai BM, McCourt DW, Rice CM. (1994) Processing in

the hepatitis C virus E2-NS2 region: identification of p7 and two distinct E2-specific products with different C termini. J Virol, 68(8), 5063–5073.

Lindenbach, B. D., & Rice, C. M. (2005). Unravelling hepatitis C virus replication

from genome to function. Nature, 436(7053), 933–8. Lohmann, S. Hoffmann, U. Herian, F. Penin, R. Bartenschlager. (2003) Viral and

cellular determinants of hepatitis C virus RNA replication in cell culture. J. Virol, 77 (5), 3007–3019.

Lohmann, V., Körner, F., Koch, J. O., Herian, U., Theilmann, L. &

Bartenschlager, R. (1999). Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science, 285, 110-113.

Luby-Phelps. (2000) Cytoarchitecture and physical properties of cytoplasm:

volume, viscosity, diffusion, intracellular surface area. Int. Rev. Cytol, 192, 189–221.

Ludwig, A., Blume, J., Diep, T.M., Yuan, J., Mateos, J.M., Leuthauser, K.,

Steuble, M., Streit, P., and Sonderegger, P. (2009). Calsyntenins mediate TGN exit of APP in a kinesin-1-dependent manner. Traffic, 10, 572-589.

Macdonald A, Harris M (2004) Hepatitis C virus NS5A: tales of a promiscuous

protein. J Gen Virol, 85, 2485–2502. Maniloff, J. (1995) Identification and classification of viruses that have not been

propagated. Arch. Virol, 140, 1515–1520.


! 207!

Manns M, Marcellin P, Poordad F, de Araujo ESA, Buti M, Horsmans Y, et al.

(2014) Simeprevir with pegylated interferon alfa 2a or 2b plus ribavirin in treatment-naive patients with chronic hepatitis C virus genotype 1 infection (QUEST-2): a randomised, double-blind, placebo-controlled phase 3 trial. The Lancet. 384(9941), 414-26.

Marko Jovic, Mahak Sharma, Juliati Rahajeng, and Steve Caplan. (2010) The

early endosome: a busy sorting station for proteins at the crossroads. Histol Histopathol, 25(1), 99–112.

Martin, Sally; Parton, Robert G. (2006). Lipid droplets: a unified view of a

dynamic organelle. Nature Reviews Molecular Cell Biology, 7 (5), 373–378.

Maruta, C., Saito, Y., Hata, S., Gotoh, N., Suzuki, T., and Yamamoto, T. (2012)

Constitutive cleavage of the single-pass transmembrane protein alcadeinalpha prevents aberrant peripheral retention of Kinesin-1. PloS one, 7, e43058.

Masciopinto, F., Giovani, C., Campagnoli, S., Galli-Stampino, L., Colombatto, P.,

Brunetto, M. (2004) Association of hepatitis C virus envelope proteins with exosomes. Eur J Immunol. 34, 2834–2842.

Maxfield, F. R. and McGraw,T. E. (2004). Endocytic recycling. Nat. Rev. Mol.

Cell. Biol, 5, 121-132. Mayor S, Presley JF, Maxfield FR. (1993) Sorting of membrane components from

endosomes and subsequent recycling to the cell surface occurs by a bulk flow process. J Cell Biol, 121, 1257–1269.

McDonald, B. & Martin-Serrano, J. (2009). No strings attached: the ESCRT

machinery in viral budding and cytokinesis. J Cell Sci, 122, 2167–2177. Meertens L, Bertaux C, Dragic T (2006) Hepatitis C virus entry requires a critical

postinternalization step and delivery to early endosomes via clathrin- coated vesicles. J Virol, 80, 11571–11578.

Mehta S. (2013) Mobilization and Cellular Uptake of Stored Fats

(Triacylglycerols) with Animation.Animations, Biochemistryanimations, Biochemistry Notes, Notes.

Mellman I. (1996) Endocytosis and molecular sorting. Annu. Rev. Cell Dev

Biol, 12, 575–625. Merz, A., Long, G., Hiet, M.S., Brugger, B., Chlanda, P., Andre, P., Wieland, F.,

Krijnse-Locker, J., and Bartenschlager, R. (2011). Biochemical and


! 208!

morphological properties of hepatitis C virus particles and determination of their lipidome. The Journal of biological chemistry, 286, 3018-3032.

Mesa R, Salomon C, Roggero M, Stahl PD, Mayorga LS. (2001) Rab22a affects

the morphology and function of the endocytic pathway. J Cell Sci, 114, 4041–4049.

Miaczynska, M., Christoforidis, S., Giner, A., Shevchenko, A., Uttenweiler-

Joseph, S., Habermann, B., Wilm, M., Parton, R. G. and Zerial, M. (2004). APPL proteins link Rab5 to nuclear signal transduction via an endosomal compartment. Cell, 116, 445-456.

Miller, S., and Krijnse-Locker, J. (2008). Modification of intracellular membrane

structures for virus replication. Nat Rev Microbiol, 6, 363-374. Miyanari Y, Atsuzawa K, Usuda N, Watashi K & Hishiki T. (2007) The lipid

droplet is an important organelle for hepatitis C virus production. Nat Cell Biol, 9, 1089–1097.

Monazahian M, Bohme I, Bonk S, Koch A, Scholz C, Grethe S, Thomssen R.

1999. Low density lipoprotein receptor as a candidate receptor for hepatitis C virus. J. Med. Virol, 57, 223–229.

Moradpour, D., Evans, M. J., Gosert, R., Yuan, Z., Blum, H. E., Goff, S. P.,

Lindenbach, B. D. & Rice, C. M. (2004). Insertion of green fluorescent protein into nonstructural protein 5A allows direct visualization of functional hepatitis C virus replication complexes. J Virol, 78, 7400–7409.

Moriishi K, Matsuura Y (2012) Exploitation of lipid components by viral and host

proteins for hepatitis C virus infection. Front Microbiol, 3: 54. Morikawa K, Zhao Z, Date T, Miyamoto M, Murayama A, et al. (2007) The roles

of CD81 and glycosaminoglycans in the adsorption and uptake of infectious HCV particles. J Med Virol, 79, 714–723

Moriya K., Fujie H., Shintani Y., Yotsuyanagi H., Tsutsumi T., Ishibashi K.,

Matsuuras Y., Kimura S., Miyamura T., Koike K. (1998) The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat Med, 4, 1065-7.

Mullock, B.M., Bright, N.A., Fearon, C.W., Gray, S.R., Luzio, J.P. (1998)

Fusion of lysosomes with late endosomes produces a hybrid organelle of intermediate density and is NSF dependent. J. Cell. Biol, 140, 591–601.


! 209!

Murray, R. Z., Kay, J. G., Sangermani, D. G. and Stow,J. L. (2005). A role for the phagosome in cytokinesecretion. Science, 310, 1492-1495.

Nath, S., Bananis, E., Sarkar, S., Stockert, R. J., Sperry, A. O.,Murray, J.

W. and Wolkoff, A. W. (2007) Kif5B and Kifc1 interact and are required for motility and fission of early endocytic vesicles in mouse liver. Mol. Biol. Cell, 18, 1839-1849.

Neumann A. U., Lam N. P., Dahari H., Gretch D. R., Wiley T. E., Layden T. J., et

al. (1998). Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy. Science, 282, 103–107.

Otto, G. a, & Puglisi, J. D. (2004). The pathway of HCV IRES-mediated

translation initiation. Cell, 119(3), 369–80. Paulina Godzik (2012). Tissue-Based Model of HCV Replication as a

Replacement for Animal Models in Drug Testing, Biomedical Tissue Culture, Dr. Luca Ceccherini-Nelli (Ed.), ISBN, 978-953-51-0788-0.

Pavlović, D., Neville, D. C. A., Argaud, O., Blumberg, B., Dwek, R. A., Fischer,

W. B., & Zitzmann, N. (2003). The hepatitis C virus p7 protein forms an ion channel that is inhibited by long-alkyl-chain iminosugar derivatives. Proceedings of the National Academy of Sciences of the United States of America, 100(10), 6104–6108.

Pawlotsky, J.M. (2014). New hepatitis C therapies: the toolbox, strategies, and

challenges. Gastroenterology,146, 1176-1192. Pelkmans, L., & A. Helenius. (2003) Insider information: what viruses tell us

about endocytosis. Curr. Opin. Cell Biol, 15, 414–422. Penin F, Brass V, Appel N, Ramboarina S, Montserret R (2004) Structure and

function of the membrane anchor domain of hepatitis C virus nonstructural protein 5A. J Biol Chem, 279, 40835–40843.

Perret, E., Lakkaraju, A., Deborde, S., Schreiner, R. and Rodriguez-Boulan, E. (2005). Evolving endosomes:how many varieties and why? Curr. Opin. Cell Biol, 17, 423-434.

Pfeffer SR. (2001) Rab GTPases: specifying and deciphering organelle identity

and function. Trends Cell Biol, 11, 487–491. Phan, T., R. K. Beran, C. Peters, I. C. Lorenz, and B. D. Lindenbach. (2009)

Hepatitis C virus NS2 protein contributes to virus particle assembly via opposing epistatic interactions with the E1-E2 glycoprotein and NS3-NS4A enzyme complexes. J. Virol, 83, 8379-8395.

Pietschmann, T., Kaul, A., Koutsoudakis, G., Shavinskaya, A., Kallis, S.,


! 210!

Steinmann, E., Abid, K., Negro, F., Dreux, M., Cosset, F.L., et al. (2006). Construction and characterization of infectious intragenotypic and intergenotypic hepatitis C virus chimeras. Proceedings of the National Academy of Sciences of the United States of America, 103, 7408-7413.

Piper RC & Katzmann DJ. (2007) Biogenesis and function of multivesicular

bodies. Annu. Rev. Cell Dev. Biol, 23:519–47. Pollard TD, Cooper JA. (2009) Actin, a central player in cell shape and

movement. Science, 326, 1208–1212. Ponomareva, O.Y., Holmen, I.C., Sperry, A.J., Eliceiri, K.W., and Halloran, M.C.

(2014). Calsyntenin-1 regulates axon branching and endosomal trafficking during sensory neuron development in vivo. The Journal of neuroscience, 34, 9235-9248.

Poordad F, Hezode C, Trinh R, Kowdley KV, Zeuzem S, Agarwal K. (2014)

ABT-450/r-ombitasvir and dasabuvir with ribavirin for hepatitis C with cirrhosis. N Engl J Med, 370(21), 1973-82.

Poteryaev, D., Datta, S., Ackema, K., Zerial, M., and Spang, A. (2010).

Identification of the switch in early-to-late endosome transition. Cell, 141, 497-508.

Quinkert, D., R. Bartenschlager, and V. Lohmann. (2005) Quantitative analysis of

the hepatitis C virus replication complex. J. Virol. 79, 13594–13605. Ramakrishnaiah V, Thumann C, Fofana I, Habersetzer F, Pan Q, et al. .

(2013) Exosome-mediated transmission of hepatitis C virus between human hepatoma Huh7.5 cells. Proc Natl Acad Sci USA, 110(32), 13109–13113.

Razali K, Thein HH, Bell J, Cooper-Stanbury M, Dolan K, Dore G et al.

Modelling the hepatitis C virus epidemic in Australia. Drug Alcohol Depend 2007. 91(2-3): p. 228-35.

Razavi H, Waked I, Sarrazin C, Myers RP, Idilman R, Calinas F, et al. (2014) The

present and future disease burden of hepatitis C virus (HCV) infection with today's treatment paradigm. J Viral Hepat, 21, 34–59.

Rehermann, B. (2009) Hepatitis C virus versus innate and adaptive immune

responses: a tale of coevolution and coexistence. J Clin Invest, 119, 1745–1754.

Ribeiro, R., Hui Li, Shuyi Wang, Mark B. Stoddard, Gerald H. Learn, Bette T.

Korber, Tanmoy Bhattacharya, Jeremie Guedj, Erica H. Parrish, Beatrice H. Hahn, George M. Shaw, Alan S. Perelson. (2012)


! 211!

Quantifying the Diversification of Hepatitis C Virus (HCV) during Primary Infection: Estimates of the In Vivo Mutation Rate. PLoS Pathog. 8(8), e1002881.

Rindler, M.J., Xu, C.F., Gumper, I., Cen, C., Sonderegger, P., and Neubert, T.A.

(2008). Calsyntenins are secretory granule proteins in anterior pituitary gland and pancreatic islet alpha cells. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 56, 381-388.

Rink J, Ghigo E, Kalaidzidis Y, Zerial M (2005) Rab conversion as a mechanism

of progression from early to late endosomes. Cell, 122, 735–749. Romero-Brey, I., A. Merz, A. Chiramel, J. Y. Lee, P. Chlanda, U. Haselman, R.

Santarella-Mellwig, A. Habermann, S. Hoppe, S. Kallis, P. Walther, C. Antony, J. Krijnse-Locker, and R. Bartenschlager. (2012) Three-dimensional architecture and biogenesis of membrane structures associated with hepatitis C virus replication. PLoS Pathog, 8, e1003056.

Roohvand, F., Maillard, P., Lavergne, J.P., Boulant, S., Walic, M., Andreo, U.,

Goueslain, L., Helle, F., Mallet, A., McLauchlan, J., et al. (2009) Initiation of hepatitis C virus infection requires the dynamic microtubule network: role of the viral nucleocapsid protein. J Biol Chem, 284, 13778-13791.

Rozen S, Skaletsky H. (2000) Primer3 on the WWW for general users and for

biologist programmers. Methods Mol Biol, 132, 365-386. Sabahi, A. (2009) Hepatitis C virus entry: the early steps in the viral replication

cycle. Virol. J, 6, 117. Schenck A, Goto-Silva L, Collinet C, Rhinn M, Giner A, Habermann B, Brand M,

Zerial M. (2008) The endosomal protein Appl1 mediates Akt substrate specificity and cell survival in vertebrate development. Cell, 133, 486–497.

Schmitz AA, Govek EE, Bottner B, Van Aelst L. (2000) Rho GTPases: signaling,

migration, and invasion. Exp Cell Res. 261, 1–12. Schmitz G, Robenek H, Lohmann U, Assmann G. (1985) Interaction of high

density lipoproteins with cholesteryl esterladen macrophages: biochemical and morphological characterization of cell surface receptor binding, endocytosis and resecretion of high density lipoproteins by macrophages. EMBO J, 4, 613–622.

Serfaty L, Andreani T, Giral P, Carbonell N, Chazouillères O, Poupon R. (2001)

Hepatitis C virus induced hypobetalipoproteinemia: a possible


! 212!

mechanism for steatosis in chronic hepatitis C. J Hepatol, 34(3, 428–434.

Shu-Lin Liu, Li-Juan Zhang, Zhi-Gang Wang, Zhi-Ling Zhang, Qiu-Mei Wu, En-

Ze Sun,Yun-Bo Shi, and Dai-Wen Pang. (2014) Globally Visualizing the Microtubule-Dependent Transport Behaviors of Influenza Virus in Live Cells. Analytical Chemistry, 86 (8), 3902-3908.

Simons, M. & Raposo, G. (2009) Exosomes--vesicular carriers for intercellular

communication. Curr. Opin Cell. Biol, 21, 575–581. Simpson J, S.S. Jensen, J.W.E. Lim. (2008) Proteomic profiling of exosomes:

current per- spectives, Proteomics, 8, 4083–4099. Smith, GA & Enquist L.W. (2002) Break ins and break outs: viral interactions

with the cytoskeleton of mammalian cells. Annu. Rev. Cell. Dev. Biol, 18, 135–161.

Söderberg, Ola; Gullberg, Mats; Jarvius, Malin; Ridderstråle, Karin; Leuchowius,

Karl-Johan; Jarvius, Jonas; Wester, Kenneth; Hydbring, Per. (2006) Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nature Methods, 3 (12), 995–1000.

Soussan, L., D. Burakov, M. P. Daniels, M. Toister-Achituv, A. Porat, Y. Yarden,

and Z. Elazar. (1999) ERG30, a VAP-33-related protein, functions in protein transport mediated by COPI vesicles. J. Cell Biol, 146, 301-311.

Stenmark H, Vitale G, Ullrich O, Zerial M. (1995) Rabaptin-5 is a direct effector

of the small GTPase Rab5 in endocytic membrane fusion. Cell, 83, 423–432.

Steuble M, Diep TM, Schätzle P, Ludwig A, Tagaya M, Kunz B, Sonderegger P.

(2012) Calsyntenin-1 shelters APP from proteolytic processing during anterograde axonal transport. Biol Open, 1, 761–774.

Steuble, M., Gerrits, B., Ludwig, A., Mateos, J.M., Diep, T.M., Tagaya, M.,

Stephan, A., Schatzle, P., Kunz, B., Streit, P., et al. (2010). Molecular characterization of a trafficking organelle: dissecting the axonal paths of calsyntenin-1 transport vesicles. Proteomics, 10, 3775-3788.

Stone M, Jia S, Heo WD, Meyer T, Konan KV. (2007) Participation of rab5, an

early endosome protein, in hepatitis C virus RNA replication machinery. J Virol. 81(9), 4551–63.

Strecker, T., R. Eichler, J. Meulen, W. Weissenhorn, H. Dieter Klenk, W. Garten,

and O. Lenz. 2003. Lassa virus Z protein is a matrix protein and sufficient for the release of virus-like particles. J. Virol, 77, 10700-10705.


! 213!

Sulkowski M, Gardiner D, Rodriguez-Torres M, Reddy RK, Tarek Hassanein,

Jacobson I, Lawitz E, Lok A, Hinestrosa F, Paul J. Thuluvath, et al. N Engl J Med. 2014 January 16; 370(3): 211–221.

Sumpter R Jr., Loo YM, Foy E, Li K, Yoneyama M, et al. (2005) Regulating

intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J Virol,!79, 2689–2699.

Sven C. D. (2006) Recycling endosomes. Journal of Cell Science, 119, 1679-

1681. Tamai, K., Shiina, M., Tanaka, N., Nakano, T., Yamamoto, A., Kondo, Y.,

Kakazu, E., Inoue, J., Fukushima, K., Sano, K. (2012) Regulation of hepatitis C virus secretion by the Hrs-dependent exosomal pathway. Virology, 422, 377-385.

Tan, S. S., Yin, Y., Lee, T., Lai, R. C., Yeo, R. W. Y., Zhang, B., … Lim, S. K.

(2013). Therapeutic MSC exosomes are derived from lipid raft microdomains in the plasma membrane. Journal of Extracellular Vesicles, 2,

Targett-Adams P, Chambers D, Gledhill S, Hope RG, Coy JF, Girod A,

McLauchlan J. (2003) Live cell analysis and targeting of the lipid droplet-binding adipocyte differentiation-related protein. J Biol Chem, 278(18), 15998–16007.

Targett-Adams, P. & McLauchlan, J. (2005) Development and characterization of

a transient-replication assay for the genotype 2a hepatitis C virus subgenomic replicon. J Gen Virol, 86, 3075–3080.

Targett-Adams, P., Boulant, S., and McLauchlan, J. (2008). Visualization of

double-stranded RNA in cells supporting hepatitis C virus RNA replication. Journal of virology, 82, 2182-2195.

Tauro BJ Greening DW, Mathias RA, Mathivanan S, Ji H,Simpson RJ. (2013)

Two distinct populations of exosomes are released from LIM1863 colon carcinoma cell-derived organoids. Mol Cell Proteomics, 12(3), 587-98.

Teis D, Saksena S, Emr SD. (2009) Snapshot: The Escrt Machinery. Cell, 137(1),

182-182. Tellinghuisen, T.L., & Rice, C.M. (2002) Interaction between hepatitis C virus

proteins and host cell factors. Curr Opin Microbiol. 5, 419-27.


! 214!

Théry C, Ostrowski, M. & Segura, E (2009) Membrane Vesicles as Conveyors of

Immune Responses. Nature Publishing Group, 581–593. Théry C, Zitvogel L, Amigorena S (2002) Exosomes: Composition, biogenesis

and function. Nat Rev Immunol, 2(8), 569–579. Thery, C.; Ostrowski, M.; Segura, E. (2009) Membrane vesicles as conveyors

of immune responses. Nat. Rev. Immunol, 9, 581–593. Vagnoni, A., Perkinton, M.S., Gray, E.H., Francis, P.T., Noble, W., and Miller,

C.C. (2012). Calsyntenin-1 mediates axonal transport of the amyloid precursor protein and regulates Abeta production. Human molecular genetics, 21, 2845-2854.

Vagnoni, A., Rodriguez, L., Manser, C., De Vos, K. J., & Miller, C. C. J. (2011).

Phosphorylation of kinesin light chain 1 at serine 460 modulates binding and trafficking of calsyntenin-1. Journal of Cell Science, 124(7), 1032–1042.

Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. (2007)

Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol, 9, 654–659.

Vale R.D. (2003). The molecular motor toolbox for intracellular transport. Cell,

112 (4), 467–80. Van der Pol E, Böing, AN, Harrison P, Sturk A, Nieuwland R. (2012)

Classification, functions, and clinical relevance of extracellular vesicles. Pharmacol. Rev, 64 (3), 676–705.

Van Der Pol E., Van Gemert M.J., Sturk A., Nieuwland R., Van Leeuwen T.G.

(2012) Single vs. swarm detection of microparticles and exosomes by flow cytometry. J. Thromb. Haemost, 10(5), 919–930.

Van Niel G, Porto-Carreiro I, Simoes S, Raposo G. (2006) Exosomes: a common

pathway for a specialized function, J. Biochem, 140, 13–21. Vogt DA, Camus G, Herker E, Webster BR, Tsou CL, Greene WC, Yen TS, Ott

M. (2013) Lipid droplet-binding protein TIP47 regulates hepatitis C Virus RNA replication through interaction with the viral NS5A protein. PLoS Pathog, 9, e1003302.

Vogt L., Schrimpf S. P., Meskenaite V., Frischknecht R., Kinter J., Leone D. P.,

Ziegler U., Sonderegger P. (2001) Calsyntenin-1, a proteolytically processed postsynaptic membrane protein with a cytoplasmic calcium-binding domain. Mol Cell Neurosci, 17, 151-66.


! 215!

Vonderheit, A. Helenius. (2005) Rab7 associates with early endosomes to mediate

sorting and transport of Semliki forest virus to late endosomes. PLoS Biol, 3, 233.

Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K,

Habermann A, Krausslich HG, Mizokami M, Bartenschlager R, Liang TJ. (2005) Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med, 11, 791–6.

Watanabe T, Sorensen EM, Naito A, Schott M, Kim S, Ahlquist P. (2007)

Involvement of host cellular multivesicular body functions in hepatitis B virus budding. Proc Natl Acad Sci USA. 104, 10205–10210.

WHO. World Health Organization: Initiative for Vaccine Research (IVR);

Hepatitis C page. 2008 [cited 2008 19 November]; Available from: http://www.who.int/vaccine_research/diseases/viral_cancers/en/index2.html.

Wolk, B., Buchele, B., Moradpour, D., and Rice, C.M. (2008). A dynamic view of

hepatitis C virus replication complexes. Journal of virology, 82, 10519-10531.

World Health Organisation (WHO) (2014). Hepatitis C Fact Sheet. Available

from:http://www.who.int/mediacentre/factsheets/fs164/en/index.html. Accessed 15 July 2014.

Wyles DL, Pockros PJ, Yang JC. (2014). Retreatment of patients who failed prior

sofosbuvir-based regimens with all oral fixed-dose combination ledipasvir/sofosbuvir plus ribavirin for 12 weeks. [Abstract 235.] 65th Annual Meeting of the American Association for the Study of Liver Diseases (AASLD). Boston, MA

Ye J. (2007) Reliance of host cholesterol metabolic pathways for the life cycle of

hepatitis C virus. PLoS Pathog, 3, 1017–1022. Zerial M, McBride H. (2001) Rab proteins as membrane organizers. Nat Rev Mol

Cell Biol, 2, 107–117. Zhong J, Gastaminza P, Cheng G, Kapadia S, Kato T, Burton DR, Wieland SF,

Uprichard SL, Wakita T, Chisari FV. (2005) Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci USA,102, 9294–9299.

awan zunaira - final thesis.pdf - the university of sydney

Documents