autophagy inhibition promotes defective neosynthesized proteins storage in alis, and induces...

Autophagy inhibition promotes defectiveneosynthesized proteins storage in ALIS,

and induces redirection toward proteasomeprocessing and MHCI-restricted presentationTill Wenger,1,2,† Seigo Terawaki,1,2,† Voahirana Camosseto,1,2 Ronza Abdelrassoul,1,2 Anna Mies,1,2 Nadia Catalan,1,2

Nuno Claudio,1,2 Giovanna Clavarino,1,2 Aude de Gassart,1,2 Francesca de Angelis Rigotti,1,2 Evelina Gatti1,2,4,*and Philippe Pierre1,2,4,*

1Centre d’Immunologie de Marseille-Luminy; Université de la Méditerranée; Marseille, France; 2INSERM; Marseille, France; CNRS; Marseille, France

†Till Wenger and Seigo Terawaki contributed equally to this work.

4Evelina Gatti and Philippe Pierre contributed equally to this work.

Keywords: NBR1, SQSTM1, ATG5, antigen presentation, DRiPs

A significant portion of newly synthesized protein fails to fold properly and is quickly degraded. These defectiveribosomal products (DRiPs) are substrates for the ubiquitin-proteasome system (UPS) and give rise to a large fraction ofpeptides presented by major histocompatibility complex class I molecules (MHCI). Here, we showed that DRiPs are alsoautophagy substrates, which accumulate upon autophagy inhibition in aggresome-like-induced structures (ALIS).Aggregation is critically depending on p62/SQSTM1, but occurs in the absence of activation of the NRF2 signaling axisand transcriptional regulation of p62/SQSTM1. We demonstrated that autophagy-targeted DRiPs can become UPSsubstrates and give rise to MHCI presented peptides upon autophagy inhibition. We further demonstrated thatautophagy targeting of DRiPs is controlled by NBR1, but not p62/SQSTM1, CHIP or BAG-1. Active autophagy thereforedirectly modulates MHCI presentation by constantly degrading endogenous defective neosynthesized antigens, whichare submitted to at least two distinct quality control mechanisms.

Introduction

Cell activation is expected to increase rates of protein synthesisand the redistribution of cellular resources to new tasks.Organized protein degradation is therefore vital for maintainingcellular function and allowing rapid adaptation to new conditions.In addition, obsolete, damaged and misfolded proteins canbecome toxic for the cell and have to be disposed of.1 A largefraction of up to 30% of neosynthesized proteins is rapidlydegraded (RDPs), with an average half-life of 10 min.2 Since alarge proportion of these neosynthetized proteins can becomeinsoluble if their degradation is inhibited, it is assumed that theydid not reach their functional conformational state and havetherefore failed to pass protein quality control.3 Identification ofthese defective proteins (DRiPs) is mostly mediated throughpolyubiquitination, prior degradation by the proteasome (theubiquitin/proteasome system or UPS).4 The decision betweenfolding and degradation of nascent polypeptides requires theaction of molecular chaperones such as Hsp70/Hsc70 family

members.5 If correct folding cannot be achieved, malconformedproteins ubiquitination can be mediated by Hsc70-interactingubiquitin ligases such as CHIP (carboxy terminus of Hsp70-interacting protein)6 and co-chaperones of the BAG (Bcl-2-associated athanogene) family.7 Interestingly, UPS-mediateddegradation of DRiPs/RDP generates the bulk of peptidespresented by the major histocompatibility class I (MHCI) toCD8+ T cells and enables surveillance of cellular translationproducts by the immune system. Thus, DRiPs/RDP represent akey source of MHCI presented peptides8 and allow the rapiddetection of cellular and foreign (viral) antigens, minutes aftertheir translation and independently of the half-life of the fullyfunctional protein.9

Another endogenous protein degradation mechanism isautophagy. This term summarizes different degradation pathways,such as macroautophagy, microautophagy and chaperone-mediated autophagy, all of which result in the transfer of cytosolicmaterial for degradation in lysosomes.10 During macroautophagy(hereafter termed autophagy), cytosolic material is sequestered in

*Correspondence to: Philippe Pierre or Evelina Gatti; Email: [email protected] or [email protected]: 09/09/11; Revised: 11/17/11; Accepted: 11/18/11http://dx.doi.org/10.4161/auto.8.3.18806

BASIC RESEARCH PAPER

Autophagy 8:3, 1–14; March 2012; G 2012 Landes Bioscience

www.landesbioscience.com Autophagy 1

http://dx.doi.org/10.4161/auto.8.3.18806

double-membrane structures, forming autophagosomes. Uponfusion with lysosomes, autophagosomal content is degraded. Thisprocess can serve for bulk degradation, but also uses specificubiquitin-dependent sorting mechanisms to target definedsubstrates.11 Polyubiquitinylated proteins can be addressed toautophagosomes through recognition by specific adaptor proteins,which also interact with autophagosome receptors of the LC3/ATG8 family.12 These adaptor proteins include NBR1 (neighborof BRCA1 gene 1) and p62/SQSTM1 (sequestrosome 1), whichcollaborate with autophagy-linked FYVE protein (ALFY)13 tomediate the degradation of aggregated proteins. Furthermore,nuclear dot protein 52 (NDP52) has been reported to mediateautophagy of polyubiquitin-coated bacteria.14

The proteasome and autophagy degradation pathways arelinked with each other and share polyubiquitinylation as acommon targeting signal for substrate recognition.15 Autophagyinhibition has been described to reduce proteasomal degrada-tion,16 while proteasome inhibition can induce autophagy as acompensatory mechanism.17 Inhibition of either system caninduce accumulation and aggregation of insoluble polyubiquiti-nylated proteins,18 while accumulation of toxic protein aggregatessuch as mutant huntingtin has been shown to trigger autophagyand thereby induce aggregate clearance.19 Although proteasome isessential for the generation of most endogenous MHCI restrictedantigenic peptides, autophagy has been shown to trigger bothunconventional MHCI presentation of specific viral peptides andMHCII-restricted presentation of endogenous peptides inmacrophages and dendritic cells.20-23

We found that a fraction of DRiPs are selected substrates forautophagy. Upon autophagy inhibition, DRiPs accumulate inp62/SQSTM1-positive aggresome-like induced structures(ALIS),24 are degraded by the proteasome, and enter in theclassical MHCI antigen processing and presentation pathway. As aconsequence, decreased autophagic degradation of defectiveneosynthesized model antigens upon autophagy inhibition leadto a specific increase in MHCI presentation. We further identifiedthe adaptor protein NBR1 as responsible for model antigenDRiPs targeting to autophagy, whereas p62/SQSTM1 was onlyfound necessary for protein aggregation, demonstrating that thebalance between these two adaptor proteins might be crucial forprotein homeostasis and the control of endogenous antigenpresentation. Our findings have important implications for themolecular classification of the different p62-containing aggregates,as well as understanding on how antigen presentation isimpacted by the different protein quality control mechanismsand the subsequent addressing of DRiPs to different routesof degradation.

Results

Autophagy adaptors and DRiPs accumulate in ALIS. Induciblepolyubiquitin aggregates have first been observed in LPS-activateddendritic cells, and were termed DALIS (for DC ALIS). Later,similar polyubiquitin-containing aggregates have been observed inHeLa cells (among others) upon exposure to different stress, suchas autophagy inhibition.24-26 We confirmed that pharmacological

inhibition of autophagy, with a 4h 3-methyladenine (3-MA)treatment, induced aggregates of polyubiquitinated proteins.These aggregates contained the autophagy adaptors p62 andNBR1 (Fig. 1A), resisted detergent extraction before fixation(Fig. 2A), formed independently of microtubule function(Fig. S1), and were thus considered bona fide ALIS. Interestingly,proteasome inhibition by epoxomycin caused aggregation ofpolyubiquitin, p62 (Fig. 1B) and NBR1 (data not shown), as wellas treatment with high concentrations of puromycin. Puromycincan be mistaken by ribosomes for charged aminoacyl-tRNAs andis thus incorporated into nascent polypeptide chains, causingpremature chain termination. This leads to massive induction ofmisfolded proteins (puro-DRiPs27), which tend to aggregate.However, DALIS originally were defined as translation-dependentpolyubiquitinated protein aggregates devoid of Hsc70.28

Strikingly, epoxomycin- or puromycin-induced aggregates werestrongly enriched for Hsc70, while 3-MA-induced ALIS were not(Fig. 1B). These similarities suggest that high concentration ofpuromycin might not only induce aggregation through proteinmisfolding but also in combination with proteasome saturation.Also, our findings might indicate that autophagy and proteasomeclient proteins are handled by different processing machineries,and therefore HSC70 co-aggregates with its client proteinssubsequent to proteasome inhibition, but not upon autophagyinhibition. Finally, we could also observe polyubiquitin and p62positive, Hsc70 low, ALIS induction upon autophagy inhibitionby RNA silencing of the key autophagy gene atg5 (Fig. 1C andFig. S4). These findings demonstrated that pharmacological orsiRNA mediated autophagy inhibition induces ALIS, and wepropose that epoxomycin- and puromycin-induced Hsc70-enriched aggregates are biochemically distinct from ALIS, butnevertheless can contain p62 and NBR1. Thus, the sole use ofbiochemical methods to detect insoluble ubiquitin accumulation29

might not be suitable to quantify ALIS, since aggregate type andcomposition are not addressed.

One of the key features of DALIS is their exquisite sensitivity toprotein synthesis inhibition,24 a consequence of the largecontribution of ubiquitin-conjugated DRiPs to their formation.While the role of ubiquitin in the UPS-mediated degradation ofDRiPs is evident, the role of ubiquitination in autophagytargeting, as well as the role of autophagy in the degradation ofpolyubiquitin conjugates is unclear. NBR1 and p62 mediatedtargeting of ubiquitinated proteins to autophagy has beendemonstrated,30 but other reports attributed polyubiquitinaccumulation in autophagy deficient cells to be a secondary effectof an Nrf2-mediated stress response.31 We therefore askedwhether in a system of short-term autophagy inhibition, theturnover of polyubiquitinated protein, and especially DRiPs, wasaffected. First, we investigated whether DRiPs could be targetedto ALIS and contribute significantly to the pool of aggregatedproteins formed upon autophagy inhibition. We induced DRiPsusing low concentration of puromycin (puro-DRiPs27) andfollowed their fate by microscopy in 3-MA treated cells usinganti-puromycin mAb.32 The puromycin concentration andtreatment times in these experiments were far below the thresholdof aggregate induction by puromycin itself (Fig. S2A and S2B),

2 Autophagy Volume 8 Issue 3

Figure 1. ALIS form upon autophagy inhibition, and differ from proteasome inhibition induced aggregates. (A) HeLa cells were treated for 4 h with 3-MA(5mM) or left untreated (control) and stained for polyubiquitinated proteins (FK1 antibody, polyUbi, green), NBR1 (red) and p62 (blue) prior to analysisby confocal microscopy. (B) HeLa cells were treated for 4h with 3-MA (5 mM), Puromycin (5 mg/ml) or Epoxomycin (5 mM). Cells were stained forubiquitinated protein (FK2 antibody, polyUbi, blue), Hsc70 (green), and p62 (red). Arrowheads indicate ALIS in the overlay and the corresponding areain the Hsc70 staining, respectively. Pearson’s coefficient (R) is given for the colocalization of p62 and Hsc70. (C) HeLa cells were transfected withsiRNA against ATG5 (siATG5) or control siRNA (siCo) and stained for ubiquitinated protein (FK2 antibody, polyUbi, blue), HSC70 (green), and p62 (red).Bar, 10 mm.


and Triton X-100 permeabilization before fixation was employedto remove remaining free puromycin and allow for the detectionof puro-DRiPs in ALIS. We could detect neosynthesized puro-DRiPs in aggregates as early as 5 min after the pulse (Fig. 2A).Thus, DRiPs contribute directly to the formation of ALIS andcould represent a pool of previously unsuspected autophagysubstrates. It should be noted that puro-DRiPs targeting to 3-MAinduced aggregates did not recruit HSC70 into those structures,in contrast again to aggregates induced by high-dose puromycin

treatment (Fig. S2C). This demonstrates that low-dose puromy-cin treatment is suitable to induce and follow DRiPs withoutaltering the cellular machinery handling them. To follow thebiochemical fate of puro-DRiPs upon autophagy or proteasomeinhibition, we exposed cells to a short (10 min) pulse of 0,5 mg/mlpuromycin and chased for 2 h in the presence or absence ofinhibitors. As expected, proteasome inhibition strongly reduceddegradation of puromycin-containing protein, increasing thequantity of recovered protein by 120% (Fig. 2B). Interestingly,

Figure 2. Puromycin DRiPs are autophagy substrates. (A) HeLa cells were treated for 4 h with 3-MA (4 h 3-MA), and puromycin (0,1 mg/ml) was added forthe last 5 min (4 h 3MA + 5 min Puro). Cells were Triton X-100 permeabilized prior to fixation, and stained for ubiquitinylated protein (FK2 antibody,polyUbi, red), p62 (blue), and puromycin-containing proteins (Puro, green). Bar, 10mm. (B) Hela cells received a short pulse of puromycin (10 min,0.1 mg/ml), were washed and chased in the absence of puromycin in the presence or absence of proteasome inhibitor or 3-MA for the indicated times.Puromycin containing protein was resolved by SDS-PAGE and detected using anti-puromycin antibodies (left) and quantified using ImageJ (right), mean± SEM from three independent experiments are shown, p values (Student’s t test) were **p. 0.03. (C) Hela cells were stained for ubiquitinylated protein(FK1 antibody, polyUbi, green) and LC3 (red). Bar, 10 mm. (D) HeLa cells were left untreated, or treated for 30 min with puromycin (0.1 mg/ml), and stainedfor LC3 (red), p62 (blue), and puromycin-containing proteins (Puro, green). Bar, 10 mm.


albeit more modestly, autophagy inhibition by 3-MA alsodecreased puromycin-labeled protein degradation (Fig. 2B),leading to a recovery increase of more than 30%. Autophagytargeting of polyubiquitinated protein was further corroboratedby immunofluorescence analysis demonstrating localization ofpolyubiquitin in LC3 positive autophagosomes at steady-state(Fig. 2C). Finally, we could demonstrate that puromycin markedprotein upon low-dose treatment (0,1 mg/ml) colocalized withp62 in autophagosomes (Fig. 2D). This suggests that while themajority of puro-DRiPs are proteasome substrates, a fraction ofthose can be subject to autophagy-mediated degradation shortlyafter synthesis and as a likely consequence, accumulate activelytogether with NBR1 and p62 in ALIS upon autophagy inhibition.

Different affinities of p62 and NBR1 have been reported fordifferent polyubiquitin chains.33 Using K48- and K63-polyubi-quitin specific antibodies, we could detect both linkagesabundantly in ALIS (Fig. 3A), excluding strong specificity ofeither as an ALIS targeting signal. This is in line with a previousreport demonstrating the cellular accumulation of all types ofpolyubiquitin species upon long-term genetic autophagy abla-tion.31 In the same report, consequent to autophagy inhibition,the transcriptional activation of the NRF2-dependent antioxyda-tive stress response pathways and of associated transcripts affectingubiquitin metabolism was proposed to be the major cause ofpolyubiquitin chains aggregation. However, strongly contrastingwith this hypothesis, we could not gather any evidence of NRF2pathway activation upon short-term autophagy inhibition.Neither 3-MA treatment for 4h nor efficient siRNA mediatedsilencing of ATG5 in HeLa cells, induced the transcription of nrf2and of its well-characterized target genes ho1, nqo1, mrp2, gclm,and p62 itself,34 whose expressions were even moderately reducedupon 3-MA treatment (Fig. 3B). Complementary to theseobservations, transcription inhibition with actinomycin did notinterfere with ALIS formation in response to 3-MA (Fig. 3C),confirming that ALIS formation is not the consequence of anindirect transcriptional response (e.g., p62 mRNA upregulation).Short-term autophagy inhibition induces therefore directly DRiPstargeting to ALIS, independently of NRF2 signaling and,probably, through the aggregative properties of nondegradedautophagy client proteins, p62 and NBR1.

ALIS are dynamic structures and turn over in a UPS-dependent manner. We next investigated the conditions of ALISturnover and the molecular mechanisms which govern aggregateclearance. We followed ALIS fate in HeLa cells, followingtreatment with, and subsequent removal of, 3-MA. Autophagyinhibition with 3-MA (2h) was sufficient to induce aggregates(Fig. 4A). Upon drug removal, ALIS were lost within 4h, showingthat aggregation is fully reversible. Blocking delivery of DRiPsto ALIS with the translation inhibitor cycloheximide (CHX)induced rapid aggregate clearance, even in the presence of 3-MA(Fig. 4A), confirming that the flow of newly synthesized proteinsis required to form aggregates upon autophagy inhibition, buttheir removal is autophagy independent. We could monitorDRiPs turnover in ALIS using puromycin-pulse labeling andchase in combination with different pharmacological inhibitors. A15 min pulse, followed by a 1h chase in the presence of 3-MA,

allowed the detection of puro-DRiPs in ALIS. As expected a 5h-chase resulted in an almost total puro-DRiPs clearance from ALIS,but conversely to 3-MA treatment, proteasome inhibition byepoxomycin during the chase prevented efficiently this clearance(Fig. 4B). This indicates a residency time of DRiPs in ALISinferior to 4h, demonstrates turnover of ALIS independently ofautophagy, and suggests the involvement of the proteasome-ubiquitin system in the clearance of aggregated proteins. Weconfirmed that autophagy inhibition itself was indeed reversibleduring our experimental procedure by expressing a mCherry-eGFP-LC3 fusion protein in HeLa cells. mCherry-eGFP-LC3allows autophagy flux quantification by monitoring red/greenfluorescence intensity ratio, which is strongly influenced by eGFPquenching upon autolysosome acidification.26 Whereas untreatedcells contained mostly red and some double positive vesicles,3-MA treatment reduced the overall number of autophagosomesand led to aberrant targeting of LC3 to large, nonacidic structures,possibly ALIS (Fig. 4C). Upon removal of 3-MA, either in theabsence or in the presence of epoxomycin, the number anddistribution of LC3-positive vesicles appeared normal again. Wetherefore concluded that 3-MA treatment reversibly inhibitsautophagy, allowing normalization upon drug removal and also inthe presence of proteasome inhibitors. Thus, autophagy inhibitionby 3-MA leads to the reversible aggregation of DRiPs in ALIS,which are turned over within few hours by the UPSindependently of autophagic activity.

DRiPs retargeting to proteasomal degradation upon auto-phagy inhibition. DRiPs are key substrates for MHC I-restrictedpresentation, thus offering a quantitative assessment of the impactof autophagy on DRiPs degradation. We generated a model cellline (iHeLa) expressing the mouse H-2Kb heavy chain, the reversetetracycline-controlled transactivator (rtTA), and the cytosoliceGFP-SL8 (SIINFEKL) model antigen under the control of adoxycycline/rtTA-inducible promoter. Induction of eGFP-SL8expression led to H-2Kb restricted SL8 peptide presentation,which could be quantified using direct eGFP fluorescencemeasurement and the 25D1.16 antibody specific for H-2Kb/SL8, respectively (Fig. 5A). As expected, SL8 presentation iniHela was strictly dependent on proteasomal degradation andneosynthesis. Protein synthesis inhibition by CHX blocked anyfurther increase in antigen expression as well as 25D1.16 staining,and proteasome inhibition with MG-132 abolished antigenpresentation completely (Fig. 5B). Therefore, we consideredantigen presentation in this system to be dependent on DRiPsproduction and subsequent proteasomal degradation.Interestingly, proteasome inhibition increased the accumulationof fluorescent, properly conformed GFP-SL8 by nearly 40%,suggesting that a subset of newly synthesized proteasome-degraded GFP might not be irreversibly misfolded and canbecome fluorescent if provided with enough time to fold.35

Conversely, autophagy inhibition only weakly increased fluor-escent GFP-SL8 levels, while it enhanced antigen presentation byalmost 40% (Fig. 5C). The effect of autophagy inhibition onantigen presentation was completely blocked by simultaneousprotein synthesis inhibition (Fig. 5C), as well as upon simultan-eous proteasome inhibition (data not shown). The effect of


autophagy induction on antigen presentation could not reliably beassessed using this system. Even though rapamycin treatmentmoderately decreased antigen presentation levels, antigen expres-sion also was affected, and translation was severely reduced(Fig. S3). These findings suggest again a direct processing ofDRiPs by autophagy, which are redirected to the UPS pathwayupon 3-MA treatment. Autophagy inhibition did not influenceoverall surface levels of loaded H-2Kb, nor did it increase generalprotein translation (data not shown). Similar effects on antigenexpression and presentation were obtained using siRNA specificfor ATG5 and Beclin 1 to inhibit autophagy (Fig. 5D). Lysosomeinhibition by bafilomycin, however, decreased H-2Kb andendogenous MHCI, indicating detrimental effects on proteintrafficking under these conditions (data not shown). ATG5 andBeclin 1 silencing increased SL8 presentation by more than 40%and 20%, respectively, while GFP levels were only modestlyincreased (up to 15%) (Fig. 5D). This demonstrates that regard-less of the mode of autophagy inhibition, antigen can be diverted

from autophagic to proteasomal processing, promoting theirsubsequent MHCI presentation.

Hsc70, CHIP and BAG co-chaperones modulate differentlyDRiPs presentation. We then wanted to further validate theiHeLa model system and evaluate the potential of RNAiapproaches to unravel the function of specific proteins in MHCI-restricted presentation, and to precisely define the degradationpathways of GFP-SL8 in iHela cells. Ubiquitination of misfoldedHsc70 clients involves the E3 ligase CHIP,6 and is modulated byco-chaperones of the Bcl-2-associated athanogene (BAG) family,although the precise role of Hsc70 and these associated moleculesin DRiPs processing and subsequent MHCI-restricted presenta-tion has not been extensively addressed.36,37 BAG proteins havebeen reported to facilitate the degradation of Hsp70/Hsc70substrates by the proteasome or through autophagy,7,29,38-41 andare therefore likely to also participate in the quality controlmechanisms regulating GFP-SL8 DRiPs folding and degradation.We silenced different mRNAs coding for Hsc7042 and associated

Figure 3. ALIS contain different linkage type polyubiquitin, and form independently of NRF2 signaling and general transcription. (A) HeLa cells weretreated for 4 h with 3-MA and stained for the indicated ubiquitin linkage type (K48 and K62 polyUbi, green) and p62 (red). (B) HeLa cells were treated ornot for 4h with 3-MA (top), or transfected with siRNA against ATG5 (siATG5) or nontargeting siRNA (siCo), and qPCR for the indicated genes was carried(mean ± SEM from three independent experiments). (C) HeLa cells were treated or not for 4 h with 3-MA in the presence or absence of Actinomycin D.Cells were stained for ubiquitinated protein (FK2 antibody, polyUbi, green) and p62 (red). Bar, 10 mm.


Figure 4. ALIS are dynamic structures forming upon autophagy inhibition and turning over by the proteasome. (A) HeLa cells were treated for 2 h or 6 hwith 3-MA (2 h 3-MA / 6 h 3-MA), washed and left for further 4 h without drug (2 h 3-MA / 4 h chase), or were treated for 2 h with 3-MA and for the next 4 h,cycloheximide (CHX) was added (2 h 3-MA / 4 h 3-MA + CHX). Cells were Triton X-100 permeabilized prior to fixation, and stained for ALIS (p62 and FK2polyubiquitin antibody) and nuclei (TOPRO-3). Cells were scored for the presence of ALIS (p62 and polyubiquitin double positive structures outside thenucleus), mean and SEM of three independent experiments (right). (B) HeLa cells were treated for a total of 2 h or 6 h with 3-MA and received a 15 min-pulse of 0.1 mg/ml puromycin after the first hour (2 h 3MA/puro-pulse after 1 h and 6 h 3-MA / puro-pulse after 1 h, respectively), or were treated for 2 hwith 3-MA (receiving a 15 min-puro-pulse after 1 h), washed and then treated for the remaining 4 h with Epoxomycin (2 h 3-MA / 4 h chase Epox / puro-pulse after 1 h). Cells were Triton X-100 permeabilized, fixed and stained for polyubiquitinylated protein (FK2 antibody, polyUbi, green), p62 (red), andpuromycin-containing proteins (Puro, blue). Treatment schemes are represented at the bottom of the images. (C) Hela cells expressing mCherry-GFP-LC3were left untreated (control), or treated with 3-MA for 2 h (2 h 3-MA), or treated with 3-MA for 2 h followed by a 4 h chase in the presence (2 h 3-MA +chase Epox) or absence (2 h 3-MA + chase) of epoxomycin. Autophagosome formation and acidification was monitored by confocal microscopy of eGFPand mCherry fluorescence. Treatment schemes are represented at the bottom of the images. All images are representative for at least three independentexperiments. Bar, 10 mm.


Figure 5. Autophagy targeted DRiPs can be re-targeted to the proteasome upon autophagy inhibition, increasing MHCI presentation. Hsc70, BAG-3 andBAG-6 are important for GFP DRiPs processing. (A) iHela model cell line: schematic representation of the constitutive expression cassettes for H-2Kb andrtTA, and the inducible model antigen expression cassette, consisting of the TRE promoter and eGFP-SL8 (left). FACS analysis of GFP-SL8 expression andSL8 presentation on H-2Kb (25D1.16) in iHeLa cells upon doxycycline treatment for 16 h (right). (B) iHeLa cells were induced with doxycycline for 6 h andtreated (arrow) with MG132 or cycloheximide (CHX), and analyzed for GFP-SL8 expression (left) and Kb/SL8 complexes appearance with the 25-D1.16antibody staining (right) at the indicated time. (C) iHeLa cells were induced for 6 h, treated with 3-MA alone or in combination with CHX (arrow), andanalyzed for GFP-SL8 expression (left) and Kb/SL8 complexes appearance with the 25-D1.16 antibody staining (right) at the indicated time. In (B and C),representative result from at least four independent experiments is shown. (D) iHeLa cells were transfected either with control siRNA (si co), or siRNAsdirected against Atg5 (siATG5) or Beclin 1 (siBeclin 1). Forty-eight hours after transfection of indicated siRNA, cells were induced for 16 h and analyzedKb/SL8 surface appearance (left) and for GFP-SL8 expression (right). Mean ± SEM from at least four independent experiments are shown, p values(Student’s t test) were **p, 0.001, *p, 0.03. (E) iHeLa cells were transfected either with control siRNA (si co) or siRNAs directed against Hsc70 (siHSC70).Forty-eight hours after transfection, cells were induced for 16 h and analyzed Kb/SL8 surface appearance (left) and for GFP-SL8 expression (right). Mean ±SEM from at least four independent experiments are shown, p values (Student’s t test) were *p, 0.03. (F) iHeLa cells were transfected either with controlsiRNA (si co), or siRNAs directed against CHIP (siCHIP), BAG-1 (siBAG-1), BAG-3 (siBAG-3) or BAG-6 (siBAG-6). Forty-eight hours after transfection ofindicated siRNA, cells were induced for 16 h and analyzed Kb/SL8 surface appearance (left) and for GFP-SL8 expression (right). Mean ± SEM from at leastfour independent experiments are shown, p values (Student’s t test) were *p , 0.03.


BAG co-chaperones.29,43 Upon efficient Hsc70 depletion(Fig. S4), GFP-SL8 induction was slightly increased (Fig. 5E),while H-2Kb/SL8 levels were strongly reduced. H-2Kb expressionand cell survival were not affected (data not shown) during thecourse of the experiments, excluding general detrimental effects ofHsc70 loss and confirming the major role played by Hsc70 forproteasome targeted DRiPs processing and subsequent antigenpresentation. Similar experiments were performed to address therole of CHIP, BAG-1, BAG-3 and BAG-6 in DRiPs processingand antigen presentation. Surprisingly, depletion of CHIP orBAG-1 had no effect on the level of SL8 presentation, suggestingthat these two previously characterized enhancers of proteasomedegradation29,40 interact with a different set of misfolded Hsc70clients than GFP-SL8 DRiPs (Fig. 5F). BAG-3 depletionhowever resulted in increased GFP-SL8 antigen expression andH-2Kb/SL8 antigen presentation, in agreement with a putativerole of BAG-3 in triggering degradation of DRiPs and otherinsoluble substrates through autophagy.39 Conversely BAG-6silencing resulted in weakly, but significantly decreased antigenpresentation (Fig. 5F), a phenotype compatible with a role inaddressing DRiPs to proteasomal degradation as recentlysuggested by Minami et al.41

Misfolded GFP-SL8 represents both an autophagy andproteasome substrate. Autophagy inhibition by 3-MA treatmentfor 4h in iHela cells augmented SL8 antigen presentation byalmost 25% and GFP-SL8 fluorescence levels by 10% (Fig. 6A).To confirm that GFP-SL8 DRiPs can be bona fide autophagysubstrates, besides being subject to proteasome degradation, wequantified GFP-SL8 levels upon autophagy and proteasomeinhibition in both total and Triton X-100 soluble fractions.Conversely to proteasome inhibition, which strongly inducedboth insoluble (78% increase) and soluble (22% increase) GFPaccumulation, autophagy inhibition only impacted significantlyon total (22% increase) GFP levels, but not on detergent-solublefractions (Fig. 5B). Thus, a fraction GFP-SL8 DRiPs areautophagy substrates and their degradation is likely influencedby their folding state (aggregation prone), which in GFP’s caseis reflected by a decrease in its fluorescence potential andaccumulation in detergent insoluble fractions. Supporting thisconclusion, GFP-SL8 could be abundantly detected by confocalmicroscopy in Triton X-100 resistant ALIS, using both an anti-GFP antibody, and an antibody raised against the C-terminal SL8tag, thus confirming the primary sequence integrity of theantigenic construct (Fig. 6C). However, GFP fluorescenceremained undetectable in the ubiquitinylated aggregates suggest-ing that the antigenic protein was intact, but inadequately folded.Thus, autophagy degrades a considerable fraction of severelymisfolded newly synthesized proteins, which accumulate in ALISupon autophagy inhibition and can subsequently be degradedby the proteasome to generate MHCI-presented peptides.Furthermore, since autophagy inhibition increased proteasomedependent antigen presentation, we could rule negative effectson the proteasome by autophagy inhibition in this experimentalsystem.16

NBR1 but not p62 participates in GFP DRiPs addressing toautophagy. Using siRNA, we then examined, which of the

LC3/ATG8 interacting proteins were participating to DRiPsrecruitment to autophagy. NBR1 and p62/SQSTM1, which serveas a bridge between ubiquitin and LC3/ATG8 family members,have been reported to shuttle ubiquitinylated proteins toautophagosomes.12 We therefore silenced p62 and NBR1 iniHeLa cells (Fig. S4) and followed Kb/SL8 appearance.Knockdown of NBR1 enhanced Kb/SL8 surface appearance andGFP-SL8 fluorescence almost to the same level that did ATG5silencing (Fig. 7A). In agreement with this observation, loss ofp62 did not cause aggregation, and even prevented it upon 3-MAtreatment (Fig. 7B). NBR1 silencing, on the contrary, inducedpolyubiquitinated protein accumulation in ALIS, similarly topharmacological- or ATG5 silencing-mediated inhibition. Thus,although p62 is the driving force leading to aggregation,31 NBR1is likely to be the adaptor primarily responsible for targeting GFPDRiPs to autophagy.

Proteasome re-targeting of DRiPs does not depend onaggregation. Finally, we wanted to determine if p62 knockdownwas dominantly repressing ALIS formation upon ATG5 deple-tion, and if the macro-aggregation of autophagic DRiPs in ALISwas absolutely required for proteasome addressing. Therefore, weperformed double knockdown for ATG5 and p62, and for NBR1and p62. Silencing of p62 did not decrease the effect of eitherATG5 or NBR1 knockdown (Fig. 7C). However, it efficientlyprevented the large ALIS formation induced by ATG5 or NBR1siRNA (Fig. 7D). This demonstrated that even though p62 drivespolyubiquitinated protein in visually detectable aggregates, thisextreme phenomenon is not an absolute prerequisite for re-targeting autophagic DRiPs to the proteasome and theirsubsequent MHC-I restricted presentation. This confirms thataccumulation of DRiPs in insoluble fractions is not necessarilyfollowed by macro-aggregate formation, which is clearly indicativeof active protein synthesis and of autophagy inhibition, but islikely to also reflect abundant expression of p62.31

Discussion

Aggregation of polyubiquitinated proteins has been observed indifferent cell types upon exposure to various stressingagents.24-26,44 All aggregates of polyubiquitinated proteins arenot equivalent biochemically, and clear definition of the foldingstate of the aggregated proteins as well as their formationmechanisms is required to understand their cell protective ordetrimental functions.45 A subset of cytosolic aggregates, whichhave been termed ALIS,24 containing autophagy adaptors andpolyubiquitinated proteins have been observed following autop-hagy inhibition.26,33,46-48 ALIS are particularly sensitive to proteinsynthesis inhibition and are clearly different from the recentlycharacterized insoluble protein deposit (IPOD) and ‘juxta-nuclearquality control’ compartment (JUNQ), notably in their insens-itivity to microtubule depolymerizing drugs24 and the nature ofaggregated proteins found in the deposits. We also found thatproteasome inhibition induced aggregates are strongly enrichedfor Hsc70, in contrast to ALIS, demonstrating that purelybiochemical methods quantitating ubiquitin and p62 solubilityare not sufficient to differentiate substrate origin and mechanisms


of aggregation.29 In this report, we demonstrated that newlysynthesized defective proteins are not only substrates forproteasomal degradation, but are also autophagy substrates.Using conditional expression of a model antigen, we showed thatautophagy inhibition re-routes autophagic DRiPs toward ALISand the proteasome. We identified NBR1 as a key adaptor proteinresponsible for targeting GFP DRiPs to autophagy. ALIS are thusnot a dead-end for DRiPs and represent an intermediateaddressing step prior delayed proteasome degradation andsubsequent MHCI-restricted presentation. Although ALIS forma-tion is p62/SQSTM1 dependent, p62 does not interfere with theaddressing of DRiPs toward autophagosome and is not requiredfor their re-routing toward the UPS pathway upon autophagyinhibition. This set of data also suggests that p62 does not

primarily deal with neosynthetized defective proteins or does notfunction as an autophagy adaptor as recently proposed.31,49

We have extended our current understanding of ALISformation by demonstrating that a fraction of puro-DRiPs arenormally degraded in autophagosomes and are rapidly aggregatedwith NBR1 and p62 upon autophagy inhibition. Ubiquitinationhas been shown to target cargo to autophagy,11,12,33 but the preciseubiquitin linkage type, which serves as targeting signal remainsunknown. UPS degradation of pre-existing intact proteins, such asp53 or Ikb, and directly ubiquitin-fused protein might differ frombulk degradation of neosynthesized misfolded proteins.Interestingly, we have shown that CHIP or BAG-1 depletiondoes not impact GFP-DRiPs fate, although these two moleculeshave been shown to play a major role in quality control of

Figure 6. GFP-SL8 DRiPs are autophagy substrates, and full-length but misfolded GFP-SL8 accumulates in ALIS. (A) iHela cells were induced withdoxycyclin (1 mg/ml) for 12 h and treated for further 4 h with 3-MA. Cells were analyzed Kb/SL8 surface appearance (left) and for GFP-SL8 expression(right). Mean ± SEM from seven independent experiments are shown, p values (Student’s t test) were **p , 0.01. (B) iHela cells were induced withdoxycyclin (1 mg/ml) for 12 h and treated for further 4 h with MG132 or 3-MA. GFP levels were assessed by protein gel blot in both the Triton X-100soluble extracts (25 mg protein) and in total protein (5 � 104 cells) (left). GFP levels were quantified using ImageJ (right, expressed as relative units,normalized to the respective actin control), p values (Student’s t test) were **p, 0.03. (C) iHeLa cells induced for 16 h prior to treatment with 3-MA (4 h)were permeabilized to remove soluble GFP-SL8, and then fixed. Cells were subsequently analyzed for GFP direct fluorescence, and stained for GFP-SL8(SL8) and p62 (left), or additionally for total GFP protein localization by anti-GFP antibody staining (right). Scale bar, 10 mm.


multiple severely misfolded client proteins, such as CFTRDF508,polyglutamine-expanded huntingtin, ataxin-1 and ataxin-350 andcontrol antigen presentation in cells infected with adenoviruses.29

Accumulation of prototypical proteasome substrates has also beenreported under condition of autophagy inhibition.16 This hasbeen interpreted as a block in UPS flux, mostly due to p62accumulation and active retention of ubiquitin-linked proteins.Thus different quality control pathways specialized in differenttype of substrates are at work in parallel and could be influenceddifferently by p62 accumulation and protein neosynthesis(Fig. S5).

Using MHCI restricted antigen presentation as a quantitativereadout, we did not detect any impact of autophagy inhibition onDRiPs proteasomal degradation. MHCI presentation was on thecontrary increased in these conditions, likely due to a general raisein proteasome substrate availability. This observation also impliesthat DRiPs are degraded by both the UPS and autophagy at thesame time and that a substrate conversion upon inhibition of oneof the two degradative pathways can be implemented (Fig. S5).The impact on MHCI presentation of inducing autophagy byrapamycin treatment or starvation could not be assessed, sinceboth decreased translation, making it impossible to reliably

determine an effect on antigen presentation. In the case of thepuro-DRiPs used in this study, we could demonstrate rapidaccumulation in ALIS upon autophagy inhibition, followed byrelatively rapid but not immediate proteasome degradation. K63polyubiquitin linkage was shown to have the highest affinity forp62 and suggested to serve as an autophagic degradation signal formisfolded proteins.33 However, multiple polyubiquitin chaintopologies have been shown to accumulate upon genetic ablationof autophagy,31 thus leading to the conclusion that there is noprevalence of K63 polyubiquitin linkage as an autophagicdegradation signal. We confirmed accumulation of both K48-and K63- linked polyubiquitin chains in ALIS, although we couldrule out a contribution of de novo transcription of p62 and othernrf2 target genes in this process.31 This is most likely due to keydifferences between the experimental system used in this reportand ours, namely the kinetics of autophagy inhibition and proteinaggregation. While we investigated the effects of autophagyinhibition over a few hours up to two days, Nrf2 mediated stressresponses were observed after several days to weeks of autophagyablation.31 Our report therefore demonstrates that short-termautophagy inhibition alone is sufficient to induce ALIS and affectDRiPs turnover. Given the change of DRiPs fate from autophagic

Figure 7. NBR1 is required for DRiPs targeting to autophagy, while p62 is required for aggregation. (A) iHeLa cells were transfected either with controlsiRNA (si co), or siRNAs directed against NBR1 (siNBR1), p62 (sip62) or ATG5 (siATG5). Forty-eight hours after transfection of indicated siRNA, cells wereinduced for 16 h and analyzed Kb/SL8 surface appearance (left) and for GFP-SL8 expression (right). Mean ± SEM from at least four independentexperiments are shown, p values (Student’s t test) were *p , 0.03, **p , 0.001. (B) Cells were transfected with indicated siRNA as above, and treated ornot with 3-MA for 4 h. Aggregates were visualized by polyubiquitin (FK2 antibody, polyUbi, green) and p62 (red) staining. (C) iHeLa cells were transfectedeither with control siRNA (si co), or siRNAs directed against ATG5 (siATG5) or NBR1 (siNBR1), alone or in combination with siRNA against p62. Forty-eighthours after transfection of indicated siRNA, cells were induced for 16 h and analyzed Kb/SL8 surface appearance (left) and for GFP-SL8 expression (right).Mean ± SEM from at least four independent experiments are shown. (D) Cells were transfected with indicated siRNA as above, and treated or not with3-MA for 4 h. Aggregates were visualized by polyubiquitin staining and confocal microscopy.


to proteasome degradation, a massive reorganization of ubiquitinlinkages is also likely to be required to achieve this conversion andcould occur in ALIS. This hypothesis is supported by the highturnover of ubiquitin observed in dendritic cells-specific ALIS(DALIS) by FRAP.27 Thus the accumulation of differentpolyubiquitin chains upon autophagy inhibition could be theresult of the cell attempts to dispatch the excess of autophagicsubstrates in the different degradation pathways still available.

The precise role of the adaptors p62 and NBR1, are currentlyunder intense scrutiny.12 We could demonstrate that p62 isdispensable for autophagic DRiPs degradation, but not foraccumulation in ALIS. Furthermore, we could identify NBR1as the adaptor responsible for addressing DRiPs to autophagy,which is supported by the much faster lysosomal turnover ofNBR1 in comparison to p62.33 These data also indicate thatpolyubiquitinated protein accumulation is a direct consequence ofautophagy shutdown, and not of proteasome inhibition.16 Thefact that NBR1 has been shown to heterodimerize with p62 andthat its depletion induces ALIS formation suggests that thefunction of p62 cannot be considered independently of NBR1fate and the stoichiometric ratio of the two molecules might be ofgreat importance to control polyubiquitinated protein aggrega-tion.26 Our previous and current observations also support thatDRiPs aggregation after autophagy inhibition occur in differentsteps (insolubility, micro-aggregation),27 the latest being themicroscopy visible macro-aggregation (ALIS), which is strictlyp62-dependent, but is not absolutely required for redirectingautophagic DRiPs toward UPS mediated degradation and MHC Ipresentation.

A still missing biochemical step in allowing DRiPs recognitionby NBR1 is the identification of the ubiquitin-ligases andregulatory proteins responsible for the ubiquitination tagging ofthese defective proteins allowing their autophagic degradation.The Bcl-2 associated athanogene (BAG) proteins modulate thechaperone activities of Hsc70 and provide a physical link betweenthe chaperone system and the different degradation pathways.Thus BAG proteins are likely candidates to control DRiPs sortingto the different degradation pathways. We confirmed that BAG-6control DRiPs addressing to the UPS,41 while demonstrating thatBAG-3 is probably involved in their autophagy targeting.39

Surprisingly, BAG-1 and CHIP silencing did not impact DRiPsprocessing nor aggregation, suggesting that, at least three differentfolding quality control pathways are at work to promote thedegradation of defective proteins (Fig. S5).

Interestingly polyubiquitinated oxidized protein aggregateshave been observed upon interferon-c stimulation of cells.44 Weare unsure of the nature of these aggregates, since they form withmuch slower kinetics than ALIS, and require immunoproteasomesfor clearance. Interferon-c has been shown to increase autophagicactivity,51 thus ALIS formation is unlikely to depend on theproduction of reactive oxygen species. Similarly, subsequentautophagic DRiPs processing is unlikely to be immunoprotea-some dependent since HeLa cells in steady-state express theimmunoproteasome catalytic subunits only at very low levels.52

Our observations clearly imply that autophagy modulates theMHCI presentation pathway by controlling the flow of antigens

available for proteasome degradation. Thus the variations inautophagy activity observed in cells exposed to differentimmunologically relevant stimuli are likely to impact directly onthe pool of cytosolic antigens available for MHCI-restrictedpresentation and change the outcome of the immune response.

Material and Methods

Cell culture. HeLa cells were maintained in DMEM (GibcoInvitrogen, 41965) supplemented with 10% fetal calf serum(Hyclone, SV30160.03), at 37°C and 5% CO2. iHeLa cells weregenerated by transfection with pcDNA3.1-H-2Kb (G418selection), pcDNA-Zeo-rtTA (Zeocin selection) and co-transfec-tion of pTRE-eGFP-SL8 and pTK-Hyg (Clontech, Hygromycinselection). Chemicals used were: 3-methyladenine (Sigma,M9281), puromycin (Sigma, P8833), cycloheximide (Sigma,C7698), Epoxomycin (Tebu, EW8700), MG132 (Tebu,ZW8440), bafilomycin A1 (Applichem, 7823). SiRNA againstBeclin 1 (SignalSilence Beclin 1 siRNA I, Cell Signaling), ATG5(Hs_APG5L_6), p62 (Hs_SQSTM1_1_HP), NBR1(Hs_M17S2_2), HSC 70 (Hs_HSPA8_11), CHIP(Hs_STUB1_1), BAG-1 (Hs_BAG1_10), BAG-3(Hs_BAG3_2), BAG-6 (Hs_BAT3_3) or unspecific control (allfrom Qiagen) were transfected using Lipofectamine2000(Invitrogen, 11668).

Immunodetection. Twenty-five to 50 mg of TX-100 solublematerial, or total protein from 5x104 cells (resuspended directly in2x reducing sample buffer, boiled and sonicated) was separated by3% to 15% gradient or 12% nongradient SDS-PAGE priorimmunoblotting and chemiluminescence detection. For immu-nofluorescence, cells on coverslips were fixed with 3.5% PFA andpermeabilized with 0,1% Triton X-100. Where indicated, cellswere permeabilized (0.2% Triton X-100, 5 min, on ice) prior tofixation (3.5% PFA), in order to remove soluble protein anddecrease background signal. Antibodies used were p62 rabbitpolyclonal (Santa Cruz Biotechnology, sc-25575), anti-actin(Sigma AC-15, A1978), rabbit anti-ATG5 (n-term, Sigma,A0731), anti-LC-3 (2G6 and 5F10, nanotools), anti-NBR1(6B11, AbD Serotec), anti-conjugated ubiquitin (clones FK1 andFK2, Biomol), anti-HSC70 (B6, Santa Cruz), anti-CHIP (rabbitpolyclonal, kind gifts from R. Takahashi53 and C. Patterson54),anti-BAG1 (rabbit polyclonal, Santa Cruz), anti-SIINFEKL(IF10.2.2,55), anti-GFP (JL-8, Clontech), and anti-Puromycin(12D10,32). Secondary antibodies were from JacksonImmunoresearch and from Molecular Probes.

Imaging. Immunofluorescence and confocal microscopy wasperformed with a Zeiss LSM 510 using a 40x and 63x objectiveand accompanying imaging software. For DALIS scoring, totalcell number was determined by TOPRO-3 staining of nuclei, andcells with DALIS (p62 and FK2 positive, extranuclear structures)were counted. Pearson’s coefficient was calculated using ImageJand the JACoP plugin (using Costes’ automatic threshold andrandomization, excluding the nucleus).

Plasmids. All plamids were generated using standard cloning,PCR and fusion PCR techniques. The H-2Kb cDNA (kind giftfrom F. Momburg, Heidelberg) was inserted into pcDNA3.1.


mCherry-eGFP-LC3 cDNA (kind gift from T. Johansen46) wassubcloned into pCDNA3.1. The rtTA (Clontech) was subclonedinto pcDNA/Zeo. GFP-SL8 was subcloned into pTRE (Clontech).

qPCR. RNA was isolated from iHela cells (RNeasy, Qiagen74104) and cDNA produced according to standard protocols(Invitrogen). qPCR was performed (Power SYBR green, AppliedBiosystems 4367659) using primers hBag3.fwd AACCGATGTGTGCTTTAGGG, hBag3.rev TTTGCCTCCACCCAAGTTAC, hBag6.fwd ATCTTTGAGCCTGGAGCTGA,hBag6.rev CCGTTGTAGTGGCTGGAAAT. Primers forNRF2 signaling targets were from34: hNrf2.for ACACGGTCCACAGCTCATC, hNrf2.rev TGTCAATCAAATCCATGTCCTG, hKeap1.for ATTGGCTGTGTGGAGTTGC,hKeap1.rev CAGGTTGAAGAACTCCTCTTGC, hHO-1.forAACTTTCAGAAGGGCCAGGT, hHO-1.rev CTGGGCTCTCCTTGTTGC, hNQO1.for ATGTATGACAAAGGACCCTTCC, hNQO1.rev TCCCTTGCAGAGAGTACATGGhGCLM.for GACAAAACACAGTTGGAACAGC, hGCLM.revCAGTCAAATCTGGTGGCATC, hMRP2.for TGAGCATGCTTCCCATGAT, hMRP2.rev CTTCTCTAGCCGCTCTGTGG.

Flow cytometry. Anti-KB/SL8 25D1.1656 and anti H-2Kb

(HB-176) were purified and fluorochrome-coupled using the

AlexaFluor647 protein labeling kit (Invitrogen, A20173). Datawas acquired on a FACS LSRII or CantoII (BD Biosciences) andanalyzed using FlowJo (Treestar).

Declaration of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

The laboratory is supported by la Ligue Nationale Contre leCancer (‘‘Equipe Labelisée La Ligue’’), l’Agence Nationale de laRecherche ANR 07-MIME-005 “DC-TRANS,” Institut Nationaldu Cancer (INCA). T.W. is a Feodor-Lynen-Fellow of theAlexander von Humboldt-foundation and a INCA postdoctoralfellow. S.T. is a Uehara Memorial Foundation fellow andFondation de la Recherche Médicale fellow. N.Ca. is supportedby Association Pour la Recherche Contre le Cancer. We alsothank the PICsL Imaging and the CIML Flow Cytometry corefacilities for expert technical assistance.

Note

Supplemental materials can be found at:www.landesbioscience.com/journals/autophagy/article/18806

References1. Kaganovich D, Kopito R, Frydman J. Misfolded

proteins partition between two distinct quality controlcompartments. Nature 2008; 454:1088-95; PMID:18756251; http://dx.doi.org/10.1038/nature07195

2. Yewdell JW, Nicchitta CV. The DRiP hypothesisdecennial: support, controversy, refinement and exten-sion. Trends Immunol 2006; 27:368-73; PMID:16815756; http://dx.doi.org/10.1016/j.it.2006.06.008

3. Princiotta MF, Finzi D, Qian SB, Gibbs J,Schuchmann S, Buttgereit F, et al. Quantitating proteinsynthesis, degradation, and endogenous antigen proces-sing. Immunity 2003; 18:343-54; PMID:12648452;http://dx.doi.org/10.1016/S1074-7613(03)00051-7

4. Navon A, Ciechanover A. The 26 S proteasome: frombasic mechanisms to drug targeting. J Biol Chem 2009;284:33713-8; PMID:19812037; http://dx.doi.org/10.1074/jbc.R109.018481

5. Young JC. Mechanisms of the Hsp70 chaperonesystem. Biochem Cell Biol 2010; 88:291-300;PMID:20453930; http://dx.doi.org/10.1139/O09-175

6. McDonough H, Patterson C. CHIP: a link between thechaperone and proteasome systems. Cell StressChaperones 2003; 8:303-8; PMID:15115282; http://dx.doi.org/10.1379/1466-1268(2003)008,0303:CALBTC.2.0.CO;2

7. Kabbage M, Dickman MB. The BAG proteins: aubiquitous family of chaperone regulators. Cell MolLife Sci 2008; 65:1390-402; PMID:18264803; http://dx.doi.org/10.1007/s00018-008-7535-2

8. Yewdell JW. Plumbing the sources of endogenousMHC class I peptide ligands. Curr Opin Immunol2007; 19:79-86; PMID:17140786; http://dx.doi.org/10.1016/j.coi.2006.11.010

9. Khan S, de Giuli R, Schmidtke G, Bruns M,Buchmeier M, van den Broek M, et al. Cutting edge:neosynthesis is required for the presentation of a T cellepitope from a long-lived viral protein. J Immunol2001; 167:4801-4; PMID:11673482

10. Mehrpour M, Esclatine A, Beau I, Codogno P.Overview of macroautophagy regulation in mammaliancells. Cell Res 2010; 20:748-62; PMID:20548331;http://dx.doi.org/10.1038/cr.2010.82

11. Kim PK, Hailey DW, Mullen RT, Lippincott-SchwartzJ. Ubiquitin signals autophagic degradation of cytosolicproteins and peroxisomes. Proc Natl Acad Sci USA2008; 105:20567-74; PMID:19074260; http://dx.doi.org/10.1073/pnas.0810611105

12. Kirkin V, McEwan DG, Novak I, Dikic I. A role forubiquitin in selective autophagy. Mol Cell 2009;34:259-69; PMID:19450525; http://dx.doi.org/10.1016/j.molcel.2009.04.026

13. Clausen TH, Lamark T, Isakson P, Finley K, LarsenKB, Brech A, et al. p62/SQSTM1 and ALFY interact tofacilitate the formation of p62 bodies/ALIS and theirdegradation by autophagy. Autophagy 2010; 6:330-44;PMID:20168092; http://dx.doi.org/10.4161/auto.6.3.11226

14. Thurston TL, Ryzhakov G, Bloor S, von Muhlinen N,Randow F. The TBK1 adaptor and autophagy receptorNDP52 restricts the proliferation of ubiquitin-coatedbacteria. Nat Immunol 2009; 10:1215-21; PMID:19820708; http://dx.doi.org/10.1038/ni.1800

15. Dikic I, Wakatsuki S, Walters KJ. Ubiquitin-bindingdomains - from structures to functions. Nat Rev MolCell Biol 2009; 10:659-71; PMID:19773779; http://dx.doi.org/10.1038/nrm2767

16. Korolchuk VI, Mansilla A, Menzies FM, RubinszteinDC. Autophagy inhibition compromises degradation ofubiquitin-proteasome pathway substrates. Mol Cell2009; 33:517-27; PMID:19250912; http://dx.doi.org/10.1016/j.molcel.2009.01.021

17. Pandey UB, Nie Z, Batlevi Y, McCray BA, Ritson GP,Nedelsky NB, et al. HDAC6 rescues neurodegenera-tion and provides an essential link between autophagyand the UPS. Nature 2007; 447:859-63; PMID:17568747; http://dx.doi.org/10.1038/nature05853

18. Cuervo AM, Wong ES, Martinez-Vicente M. Proteindegradation, aggregation, and misfolding. Mov Disord2010; 25(Suppl 1):S49-54; PMID:20187257; http://dx.doi.org/10.1002/mds.22718

19. Yamamoto A, Cremona ML, Rothman JE. Autophagy-mediated clearance of huntingtin aggregates triggeredby the insulin-signaling pathway. J Cell Biol 2006;172:719-31; PMID:16505167; http://dx.doi.org/10.1083/jcb.200510065

20. English L, Chemali M, Duron J, Rondeau C, LaplanteA, Gingras D, et al. Autophagy enhances thepresentation of endogenous viral antigens on MHCclass I molecules during HSV-1 infection. NatImmunol 2009; 10:480-7; PMID:19305394; http://dx.doi.org/10.1038/ni.1720

21. Schmid D, Pypaert M, Munz C. Antigen-loading com-partments for major histocompatibility complex class IImolecules continuously receive input from autophago-somes. Immunity 2007; 26:79-92; PMID:17182262;http://dx.doi.org/10.1016/j.immuni.2006.10.018

22. Dengjel J, Schoor O, Fischer R, Reich M, Kraus M,Muller M, et al. Autophagy promotes MHC class IIpresentation of peptides from intracellular sourceproteins. Proc Natl Acad Sci USA 2005; 102:7922-7;PMID:15894616; http://dx.doi.org/10.1073/pnas.0501190102

23. Lee HK, Mattei LM, Steinberg BE, Alberts P, Lee YH,Chervonsky A, et al. In vivo requirement for Atg5 inantigen presentation by dendritic cells. Immunity 2010;32:227-39; PMID:20171125; http://dx.doi.org/10.1016/j.immuni.2009.12.006

24. Pierre P. Dendritic cells, DRiPs, and DALIS in thecontrol of antigen processing. Immunol Rev 2005;207:184-90; PMID:16181336; http://dx.doi.org/10.1111/j.0105-2896.2005.00300.x

25. Szeto J, Kaniuk NA, Canadien V, Nisman R,Mizushima N, Yoshimori T, et al. ALIS are stress-induced protein storage compartments for substrates ofthe proteasome and autophagy. Autophagy 2006;2:189-99; PMID:16874109

26. Bjørkøy G, Lamark T, Brech A, Outzen H, PeranderM, Overvatn A, et al. p62/SQSTM1 forms proteinaggregates degraded by autophagy and has a protectiveeffect on huntingtin-induced cell death. J Cell Biol2005; 171:603-14; PMID:16286508; http://dx.doi.org/10.1083/jcb.200507002

27. Lelouard H, Ferrand V, Marguet D, Bania J,Camosseto V, David A, et al. Dendritic cell aggre-some-like induced structures are dedicated areas forubiquitination and storage of newly synthesized defec-tive proteins. J Cell Biol 2004; 164:667-75; PMID:14981091; http://dx.doi.org/10.1083/jcb.200312073


http://www.ncbi.nlm.nih.gov/pubmed/18756251
































28. Lelouard H, Gatti E, Cappello F, Gresser O,Camosseto V, Pierre P. Transient aggregation ofubiquitinated proteins during dendritic cell maturation.Nature 2002; 417:177-82; PMID:12000969; http://dx.doi.org/10.1038/417177a

29. Kettern N, Rogon C, Limmer A, Schild H, Hohfeld J.The Hsc/Hsp70 co-chaperone network controls antigenaggregation and presentation during maturation ofprofessional antigen presenting cells. PLoS ONE 2011;6:e16398; PMID:21283720; http://dx.doi.org/10.1371/journal.pone.0016398

30. Lamark T, Kirkin V, Dikic I, Johansen T. NBR1 andp62 as cargo receptors for selective autophagy ofubiquitinated targets. Cell Cycle 2009; 8:1986-90;PMID:19502794; http://dx.doi.org/10.4161/cc.8.13.8892

31. Riley BE, Kaiser SE, Shaler TA, Ng AC, Hara T, HippMS, et al. Ubiquitin accumulation in autophagy-deficient mice is dependent on the Nrf2-mediatedstress response pathway: a potential role for proteinaggregation in autophagic substrate selection. J CellBiol 2010; 191:537-52; PMID:21041446; http://dx.doi.org/10.1083/jcb.201005012

32. Schmidt EK, Clavarino G, Ceppi M, Pierre P.SUnSET, a nonradioactive method to monitor proteinsynthesis. Nat Methods 2009; 6:275-7; PMID:19305406; http://dx.doi.org/10.1038/nmeth.1314

33. Kirkin V, Lamark T, Sou YS, Bjorkoy G, Nunn JL,Bruun JA, et al. A role for NBR1 in autophagosomaldegradation of ubiquitinated substrates. Mol Cell 2009;33:505-16; PMID:19250911; http://dx.doi.org/10.1016/j.molcel.2009.01.020

34. Lau A, Wang XJ, Zhao F, Villeneuve NF, Wu T, JiangT, et al. A noncanonical mechanism of Nrf2 activationby autophagy deficiency: direct interaction betweenKeap1 and p62. Mol Cell Biol 2010; 30:3275-85;PMID:20421418; http://dx.doi.org/10.1128/MCB.00248-10

35. Qian SB, Reits E, Neefjes J, Deslich JM, Bennink JR,Yewdell JW. Tight linkage between translation andMHC class I peptide ligand generation impliesspecialized antigen processing for defective ribosomalproducts. J Immunol 2006; 177:227-33; PMID:16785518

36. Yewdell JW. Not such a dismal science: the economicsof protein synthesis, folding, degradation and antigenprocessing. Trends Cell Biol 2001; 11:294-7;PMID:11413040; http://dx.doi.org/10.1016/S0962-8924(01)02030-X

37. Kunisawa J, Shastri N. The group II chaperonin TRiCprotects proteolytic intermediates from degradation inthe MHC class I antigen processing pathway. Mol Cell2003; 12:565-76; PMID:14527404; http://dx.doi.org/10.1016/j.molcel.2003.08.009

38. Alberti S, Esser C, Hohfeld J. BAG-1–a nucleotideexchange factor of Hsc70 with multiple cellularfunctions. Cell Stress Chaperones 2003; 8:225-31;PMID:14984055; http://dx.doi.org/10.1379/1466-1268(2003)008,0225:BNEFOH.2.0.CO;2

39. Gamerdinger M, Hajieva P, Kaya AM, Wolfrum U,Hartl FU, Behl C. Protein quality control during aginginvolves recruitment of the macroautophagy pathwayby BAG3. EMBO J 2009; 28:889-901; PMID:19229298; http://dx.doi.org/10.1038/emboj.2009.29

40. Gehring U. Biological activities of HAP46/BAG-1. TheHAP46/BAG-1 protein: regulator of HSP70 chaper-ones, DNA-binding protein and stimulator of trans-cription. EMBO Rep 2004; 5:148-53; PMID:14755308; http://dx.doi.org/10.1038/sj.embor.7400083

41. Minami R, Hayakawa A, Kagawa H, Yanagi Y,Yokosawa H, Kawahara H. BAG-6 is essential forselective elimination of defective proteasomal substrates.J Cell Biol 2010; 190:637-50; PMID:20713601;http://dx.doi.org/10.1083/jcb.200908092

42. Rohde M, Daugaard M, Jensen MH, Helin K,Nylandsted J, Jaattela M. Members of the heat-shockprotein 70 family promote cancer cell growth bydistinct mechanisms. Genes Dev 2005; 19:570-82; PMID:15741319; http://dx.doi.org/10.1101/gad.305405

43. Mayer MP, Bukau B. Hsp70 chaperones: cellularfunctions and molecular mechanism. Cell Mol Life Sci2005; 62:670-84; PMID:15770419; http://dx.doi.org/10.1007/s00018-004-4464-6

44. Seifert U, Bialy LP, Ebstein F, Bech-Otschir D, VoigtA, Schroter F, et al. Immunoproteasomes preserveprotein homeostasis upon interferon-induced oxidativestress. Cell 2010; 142:613-24; PMID:20723761;http://dx.doi.org/10.1016/j.cell.2010.07.036

45. Tyedmers J, Mogk A, Bukau B. Cellular strategies forcontrolling protein aggregation. Nat Rev Mol Cell Biol2010; 11:777-88; PMID:20944667; http://dx.doi.org/10.1038/nrm2993

46. Pankiv S, Clausen TH, Lamark T, Brech A, Bruun JA,Outzen H, et al. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated proteinaggregates by autophagy. J Biol Chem 2007;282:24131-45; PMID:17580304; http://dx.doi.org/10.1074/jbc.M702824200

47. Komatsu M, Waguri S, Koike M, Sou YS, Ueno T,Hara T, et al. Homeostatic levels of p62 controlcytoplasmic inclusion body formation in autophagy-deficient mice. Cell 2007; 131:1149-63; PMID:18083104; http://dx.doi.org/10.1016/j.cell.2007.10.035

48. Hara T, Nakamura K, Matsui M, Yamamoto A,Nakahara Y, Suzuki-Migishima R, et al. Suppression ofbasal autophagy in neural cells causes neurodegenerativedisease in mice. Nature 2006; 441:885-9; PMID:16625204; http://dx.doi.org/10.1038/nature04724

49. Itakura E, Mizushima N. p62 Targeting to the auto-phagosome formation site requires self-oligomerizationbut not LC3 binding. J Cell Biol 2011; 192:17-27; PMID:21220506; http://dx.doi.org/10.1083/jcb.201009067

50. Sha Y, Pandit L, Zeng S, Eissa NT. A critical role forCHIP in the aggresome pathway. Mol Cell Biol 2009;29:116-28; PMID:18955503; http://dx.doi.org/10.1128/MCB.00829-08

51. Gutierrez MG, Master SS, Singh SB, Taylor GA,Colombo MI, Deretic V. Autophagy is a defensemechanism inhibiting BCG and Mycobacterium tuber-culosis survival in infected macrophages. Cell 2004;119:753-66; PMID:15607973; http://dx.doi.org/10.1016/j.cell.2004.11.038

52. Heink S, Ludwig D, Kloetzel PM, Kruger E. IFN-gamma-induced immune adaptation of the proteasomesystem is an accelerated and transient response.Proc Natl Acad Sci USA 2005; 102:9241-6;PMID:15944226; http://dx.doi.org/10.1073/pnas.0501711102

53. Imai Y, Soda M, Hatakeyama S, Akagi T, HashikawaT, Nakayama KI, et al. CHIP is associated with Parkin,a gene responsible for familial Parkinson’s disease, andenhances its ubiquitin ligase activity. Mol Cell 2002;10:55-67; PMID:12150907; http://dx.doi.org/10.1016/S1097-2765(02)00583-X

54. Ballinger CA, Connell P, Wu Y, Hu Z, Thompson LJ,Yin LY, et al. Identification of CHIP, a noveltetratricopeptide repeat-containing protein that inter-acts with heat shock proteins and negatively regulateschaperone functions. Mol Cell Biol 1999; 19:4535-45;PMID:10330192

55. Hilton CJ, Dahl AM, Rock KL. Anti-peptide antibodyblocks peptide binding to MHC class I molecules in theendoplasmic reticulum. J Immunol 2001; 166:3952-6;PMID:11238640

56. Porgador A, Yewdell JW, Deng Y, Bennink JR,Germain RN. Localization, quantitation, and in situdetection of specific peptide-MHC class I complexesusing a monoclonal antibody. Immunity 1997; 6:715-26; PMID:9208844; http://dx.doi.org/10.1016/S1074-7613(00)80447-1





































autophagy inhibition promotes defective neosynthesized proteins storage in alis, and induces...

Documents