Cancer Cell, Volume 26

Supplemental Information

Acetylation of Snail Modulates

the Cytokinome of Cancer Cells

to Enhance the Recruitment of Macrophages

Dennis Shin-Shian Hsu, Hsiao-Jung Wang, Shyh-Kuan Tai, Chun-Hung Chou, Chia-Hsin Hsieh, Po-Hsien Chiu, Nien-Jung Chen, and Muh-Hwa Yang

1

Supplemental Data

Figure S1, related to Figure 1. CBP interacts with Snail to remodel the chromatin on target genes.

2

(A) Quantitative chromatin immunoprecipitation (qChIP) for analyzing the enrichments of H3K4Ac (upper) and H3K14Ac (lower) on the promoter of ERCC1 and IL8 in FaDu cells transfected with Snail (FaDu-Snail) or a control vector (FaDu-CDH). Data represents means ± S.E.M. **p < 0.01. (B) qChIP for analyzing the enrichments of H3K18Ac (upper), H4R3me2 (middle), and H3K27me3 (lower) on the promoter of ERCC1, IL8, and CDH1 in FaDu cells treated with TGFβ 5 ng/ml for 7 days for induction of EMT or a vehicle control. Data represents means ± S.E.M. *p < 0.05. (C) Mapping the CBP-interacting domain on Snail. Left: schematic representation of the constructs. The interacting fragments are indicated as +. TRD, transcription regulatory domain. Z1-Z4, zinc finger domain. Right: immunoprecipitation-western blot in 293T cells co-transfected with pHA-CBP and different GST-Snail constructs to show the interaction between CBP and different Snail fragments. (D) Mapping the Snail-interacting domain on CBP. Left: schematic representation of the constructs. The interacting fragments are indicated as +. Right: immunoprecipitation-western blot in 293T cells co-transfected with GST-Snail and different FLAG-tagged CBP fragments to show the interaction between Snail and different CBP fragments.

3

Figure S2, related to Figure 2. Acetylation of Snail by CBP. (A)-(B) Proximity ligation assay. (A) The 293T cells were transfected with p53 expression vector (pRC-CMV-p53) with or without co-transfection of CBP expression vector (pHA-CBP), then were incubated with the anti-p53 and anti-acetyl lysine antibodies and detected by DuoLink probe. (B) The 293T cells were transfected

4

with different vectors expressing WT Snail or mutant Snail (K146R, K187R, or 2R) with or without co-transfection of CBP, and then were incubated with the anti-Snail and anti-acetyl lysine antibodies and detected by DuoLink probe. Red, Duolink fluorescence; blue, nuclei stained by DAPI. The negative control was the cells co-transfected with p53 and CBP (A), or WT Snail and CBP (B) and incubated with an anti-acetyl lysine antibody alone. The acetylated p53 detected by proximity ligation assay is a positive control for the study. Red, Duolink fluorescence; blue, nuclei stained by DAPI. Scale bar=10μm. (C) Validation of the anti-acetylated Snail lysine 146 and the anti-acetylated Snail lysine 187 antibodies. Dot blot analysis was used for showing the specificity of the anti-acetylated Snail lysine 146 antibody (upper) and anti-acetylated Snail lysine 187 antibody (lower). The biotin-tagged peptides around the sequence of Snail lysine 146/187 with or without acetylated modification on lysine 146/187 were used for experiments, and the peptide sequence was shown. The antibody specific for non-acetylated Snail lysine 146/187 was a negative control for experiment. (D) Western blot for detecting lysine 146- or lysine 187-acetylated Snail in FaDu-Snail transfectants receiving shRNA against different acetyltransferases or a control vector (pLKO). β-actin was a loading control.

5

6

Figure S3, related to Figure 3. The impact of Snail acetylation on target genes transactivation, stability, DNA binding ability, subcellular localization of Snail, and EMT. (A) Luciferase reporter assay. The 293T cells were co-transfected with the reporter plasmid containing ERCC1 (pXP2-ERCC1) promoter, pFLAG-Snail and pHA-CBP with or without the treatment of a HAT inhibitor C646 (6 μM for 8 hr). Data represents means ± S.E.M. *p < 0.05. (B) Quantitative RT-PCR for examining the expression of FN1 in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R. Data represents means ± S.E.M. *p < 0.05. (C) Immunoprecipitation-western blot of OECM-1 cells. The lysates were immunoprecipitated with an anti-p65 antibody and immunoblotted with the indicated antibodies. (D) Immunoprecipitation-western blot of 293T cells co-transfected with pMT2T-p65, pHA-CBP, and pFLAG-Snail/pFLAG-Snail2R. The protein lysates were immunoprecipitated by an anti-FLAG antibody and immunoblotted with anti-FLAG and anti-p65 antibodies. (E) Immunoprecipitation-western blot of 23T cells co-transfected with pHA-CBP, pFLAG-Snail, and pMT2T-p65. The lysates were immunoprecipitated with an anti-HA antibody or an anti-p65 antibody and immunoblotted with the indicated antibodies. (F) ChIP and sequential ChIP assay in FaDu cells. The protein-DNA was cross-linked and immunoprecipitated by one or two antibodies as indicated. The DNA fragment containing the NF-κB binding site on the promoter of FN1 was amplified by PCR and analyzed by electrophoresis. (G) Luciferase reporter assay. The 293T cells were co-transfected with the reporter plasmid containing FN1

7

promoter (pGL4-FN1) and different plasmids as indicated. The red box is the p65 binding site, whereas the blue boxes indicate the Snail binding sites. Data represents means ± S.E.M. *p < 0.05. (H) Western blot of FLAG in 293T cells transfected with pFLAG-Snail (upper panel) or pFLAG-Snail2R (lower panel) after cyclohexamide (CHX) treatment for different periods. (I) Quantification of the western blot results in (H). (J) Immunoprecipitation-western blot for analyzing the phosphorylated or acetylated Snail in 293T cells transfected with WT Snail (pFLAG-Snail) or non-acetylatable Snail mutant (pFLAG-Snail2R) with or without co-transfection of pHA-CBP. Phospho-Ser/Thr, phosphorylated serine/threonine. (K) Analysis of polyubiquitinated FLAG-Snail in 293T cells co-transfected with pFLAG-Snail/pFLAG-Snail2R and pHA-ubiquitin. The FLAG-Snail was immunoprecipitated and analyzed for its polyubiquitination. Immunoglobulin G (IgG) was a control for immunoprecipitation. (L) Analysis of polyubiquitinated FLAG-Snail in 293T cells co-transfected with WT Snail or non-phosphorylatable Snail mutant (pFLAG-Snail6SA), pHA-CBP, and pHA-ubiquitin, and with or without the treatment of a HAT inhibitor C646 (6 μM for 8 hr). The FLAG-Snail was immunoprecipitated and analyzed for its polyubiquitination. Immunoglobulin G (IgG) was a control for immunoprecipitation. (M) EMSA. Left panel: western blot for indicating the expression of Snail or Snail2R in 293T cells for EMSA. Right panel: EMSA. Nuclear extracts from 293T cells under different transfection conditions were incubated with biotin-labeled probe containing the Snail binding site. Adding of the 30x non-labelled probe abrogated the shifted bands. The positions of shifted band are indicated. (N) Immunofluorescent staining of Snail in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R cells. Green, Snail; blue, nuclei. Scale bar=100 μm. (O) Western blot of the EMT markers (E-cadherin, γ-catenin, and fibronectin) in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R cells. β-actin was a loading control. (P) Immunofluorescent staining of E-cadherin and fibronectin in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R cells. Red, E-cadherin; green, fibronectin; blue, nuclei. Scale bar=20 μm.

8

9

Figure S4, related to Figure 5. The mesenchymal genes and TNFA, CCL2, and CCL5 are target genes activated by acetylated Snail. (A) Quantitative RT-PCR for analyzing the expression of the mesenchymal genes ZEB1 and THBS1 in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R. Data represents means ± S.E.M. *p < 0.05. (B) IPA analysis of the Snail-upregulated cytokine genes.

10

(C) Quantitative RT-PCR for validating the expression of different cytokine genes in HCT15-Snail vs HCT15-control. Data represents means ± S.E.M. *p < 0.05. (D) Left: quantitative RT-PCR for analyzing the expression of IL6 in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R. Right: ELSIA for analyzing the level of secreted IL6 in the corresponding cells. Data represents means ± S.E.M. *p < 0.05. (E) ELSIA for analyzing the level of secreted TNFα (left), CCL2 (middle), and CCL5 (right) in FaDu-CDH, FaDu-Snail, and FaDu-Snail2R. Data represents means ± S.E.M. *p < 0.05. (F) Western blot analysis of Snail, TNFα, CCL2, and CCL5 in OECM-1 cells receiving shRNA against SNAI1 (sh-Snail) or a scrambled sequence (sh-scr). β-actin was a loading control. The fold change of target proteins was shown. (G) Quantitative RT-PCR analysis of the mRNA level of SNAI1, TNFA, CCL2, and CCL5 in OECM-1 cells receiving sh-Snail vs. sh-scr. Data represents means ± S.E.M. *P < 0.05. (H) Western blot analysis of Snail, TNFα, CCL2, and CCL5 in HT-29 cells receiving shRNA against SNAI1 (sh-Snail) or a scrambled sequence (sh-scr). β-actin was a loading control. The fold change of target proteins was shown. (I) Quantitative RT-PCR analysis of the mRNA level of SNAI1, TNFA, CCL2, and CCL5 in HT-29 cells receiving sh-Snail vs. sh-scr. Data represents means ± S.E.M. *p < 0.05. (J) Quantitative ChIP for analyzing the occupancy of Snail on the promoter of TNFA, CCL2, and CCL5 in FaDu cells transfected with Snail (FaDu-Snail) or a control vector (FaDu-CDH). The organization of TNFA, CCL2, and CCL5 and the primer-amplified region was shown. TSS, transcription start site. E1, E2, E3, and E4 indicate E-boxes. IgG was a control for immunoprecipitation. Data represents means ± S.E.M. *p < 0.05. (K) Quantitative RT-PCR assay for analyzing the relative mRNA level of TNFA, CCL2, ERCC1, and IL8 in in FaDu cells transfected with WT Snail (FaDu-Snail), non-acetylatable Snail (FaDu-Snail2R), or an empty vector (FaDu-CDH) with or without Etanercept treatment (25 μg/ml for 8hr). Data represents means ± S.E.M. *p < 0.05. (L) Quantitative RT-PCR for analyzing the relative mRNA expression of CCND1 in FaDu-CDH vs. FaDu-Snail cells treated with the NFκB inhibitor parthenolide (PAR)(10 μM for 8hr). The data is presented as the percentage of target genes repression after PAR treatment compared with the cells without PAR treatment. Data represents means ± S.E.M. (M) Quantitative RT-PCR for analyzing the relative mRNA expression of CCL2, CCL5, and IL8 in FaDu-CDH vs. FaDu-Snail cells treated with the NFκB inhibitor parthenolide (PAR)(10 μM for 8 hr). The data is presented as the percentage of target genes repression after PAR treatment compared with the cells without PAR treatment. Data represents means ± S.E.M. *p < 0.05. (N) Quantitative RT-PCR for analyzing the relative mRNA expression of TNFA, CCL2, and CCL5 in OECM-1 cells receiving shRNA against Snail (OECM1-sh-Snail) or a scrambled sequence (OECM1-sh-scr). The data is presented as the folds of mRNA induction by TNFα compared with the cells without TNFα treatment. Data represents means ± S.E.M. *p < 0.05. Table S1, related to Figure 5. Provided as a separated Excel file. Upregulated and downregulated genes in cDNA microarray analysis of FaDu-Snail vs. FaDu-Snail2R.

Table S2, related to Figure 5. Provided as a separated Excel file. PCR array for analyzing the expression of 84 cytokine genes in FaDu-Snail vs. FaDu-CDH and HT29-scr vs. HT29-Snail.

11

Figure S5, related to Figure 6. Acetylated Snail promotes M2-like polarization and recruitment of tumor-associated macrophages. (A) Quantitative RT-PCR for analyzing the relative mRNA level of MRC1 in CD14+ human monocytes (upper) or a human monocytic cell line THP1 (lower) incubated with the conditioned medium from FaDu cells expression WT Snail (FaDu-Snail), acetylation sites-mutated Snail (FaDu-Snail2R), or an empty vector (FaDu-

12

CDH) for 3 days. Data represents means ± S.E.M. **p < 0.01. (B) Flow cytometry for analyzing the expression of mannose receptor (MR) in CD14+ human monocytes incubated with the conditioned medium from FaDu-Snail, acetylation FaDu-Snail2R, or FaDu-CDH for 3 days. The cells were incubated with an anti-mannose receptor antibody (lower panel) or an isotype IgG control (upper panel) and subject to flow cytometry analysis. The percentage of mannose receptor-positive cells is shown in each panel. (C) Western blot for detecting acetylated Snail lysine 187 in the 4T1-formed orthotopic tumors. Ctrl, 4T1-control cells-formed tumor; Snail, 4T1-Snail cells-formed tumors; Snail2R, 4T1-Snail2R cells-formed tumors. Each group contains 6 mice (Ctr1(1)-(6), Snail(1)-(6), and Snail2R(1)-(6)). β-actin was a loading control. (D) Immunohistochemistry of arginase 1 in 4T1-formed orthotopic tumors. Scale bar=100 μm.

13

Figure S6, related to Figure 7. Immunohistochemistry of arginase 1 for indicating the TAMs in LLC1-formed tumors. Scale bar=100 μm.

14

Figure S7, related to Figure 8. Correlation between SNAI1, CCL2, and CCL5 in public array database, and the association between acetylated Snail and tumor-associated macrophages in lung cancer samples. (A) Left: a heatmap showing the relative level of CDH1, SNAI1, CCL2, and CCL5 in cancer cells lines from NCI-60 panel. Right: a table showing the correlation between the level of CDH1, SNAI1, CCL2, and CCL5 in cells lines from NCI-60 panel. (B) Summary of the expression of SNAI1, CCL2, and CCL5 in human head and neck cancer originated from different sites. LSCC, laryngeal squamous cell carcinoma; OSCC, oral cavity squamous cell carcinoma; OPSCC, oropharyngeal squamous cell carcinoma; TSCC, tongue squamous cell carcinoma; TsSCC, tonsillar squamous cell carcinoma. The data is obtained from Hensen dataset. (C) Immunohistochemistry using an anti-acetylated Snail lysine 187 antibody for recognizing acetylated Snail and an anti-CD163 antibody for detecting tumor-associated macrophages in non-small cell lung cancer samples. Case 1 is a representative case of double positive, whereas case 2 is a representative case of double negative. Scale bar for acetylated Snail staining=100 μm, for CD163=200 μm.

15

Table S3, related to Figure 8. Provided as a separated Excel file. Characteristics of 15 head and neck cancer patients analyzed by immunohistochemistry and proximity ligation assay. Table S4, related to Figure 8. Provided as a separated Excel file. Characteristics of 82 head and neck cancer patients for immunohistochemical analysis of acetylated Snail and TAMs.

16

Supplemental Experimental Procedures Cell lines, plasmids, and reagents. The human head and neck cancer cell line FaDu, the human embryonic

kidney cell line 293T, the human colon cancer cell line HCT15, the BALB/C mouse breast carcinoma cell line

4T1, and the C57BL/6 mouse lung carcinoma cell line LLC1 were originally from ATCC. The human head and

neck cancer cell line OECM-1 was provided by Dr. Kuo-Wei Chang (National Yang-Ming University of

Taiwan). The human lung adenocarcinoma cell lines CL1-1 and CL1-5 were obtained from Professor Pan-Chyr

Yang (National Taiwan University, Taipei, Taiwan). The pFLAG-CBP, pHA-CBP, pHA-EECBP, pHA-AACBP,

and SnailS6A expression vectors and the MEFs from Ikkα, Ikkβ, and Ikkγ-KO mice were gifts from Professor

Mien-Chie Hung (M.D. Anderson Cancer Center, Houston, TX, USA). The pRC-CMV-p53 plasmid was

provided by Professor Fung-Fang Wang (National Yang-Ming University, Taipei, Taiwan). The pMT2T-p65

plasmid was provided by Professor Kou-Juey Wu (National Yang-Ming University, Taipei, Taiwan). The

pcDNA3-Snail, pSUPER-sh-Snail, and pSUPER-scramble have been previously described (Hsu et al., 2010).

The GST-Snail, pFLAG-Snail, pCDH-Snail, and pHA-Ajuba plasmids were generated by inserting full-length

cDNA (SNAI1: NM_005985; AJUBA: NM_032876) into the pGEX4T1, pFLAG-CMV2, pCDH-CMV-MCS-

EF1-puro, and pHA-MEX vectors, respectively. The pLKO.1-shLuc, CBP shRNA (TRCN000006487), p300

shRNA (TRCN000009883), PCAF shRNA (TRCN000039380), GCN5 shRNA (TRCN0000038879), HDAC1

shRNA (TRCN0000004814, TRCN00000017), HDAC2 shRNA (TRCN0000004819, TRCN00000021 ), and Tnf

shRNA (TRCN00000362863) were obtained from the National RNAi Core Facility of Taiwan for gene

silencing. The pFLAG-Snail-K146R, pFLAG-Snail-K187R, and pFLAG-Snail2R plasmids were generated by

creating a mutation in the SNAI1 sequence. Specifically, the sequence encoding lysine 146, lysine 187, or both

sites in the SNAI1 sequence was mutated to arginine. The luciferase reporter constructs for the ERCC1 promoter

(pXP2-ERCC1) and the IL8 promoter (pXP2-IL8) have been described previously (Hsu et al., 2010; Hwang et

al., 2011). The proximal promoter regions of TNFA (-1160 ~ +175 to TSS), CCL2 (-1220 ~ +1 to TSS), CCL5 (-

1100 ~ +190 to TSS), and FN1 (-520~+571 to TSS) were cloned into pXP2 (TNFA) and pGL4.2 (CCL2, CCL5,

FN1) to generate the promoter reporter constructs. Recombinant human TNFα was purchased from ABBIOTEC

17

(Cat No.600173, ABBIOTEC, Inc., San Diego, CA). Recombinant murine Tnfα was obtained from Sino

Biological Inc. (Cat No.50349-MNAE, Sino Biological Inc., Beijing, China). Recombinant human TGFβ was

purchased from PreproTec (Cat No.100-21, PreproTec, Rocky Hill, NJ). The NFκB inhibitor parthenolide was

purchased from BioVision (Cat No.1868-10, BioVision Inc., Milpitas, CA). The protein synthesis inhibitor

cycloheximide was purchased from Sigma (Cat No.C7698, Sigma-Aldrich, Inc., St. Louis, MO). The histone

acetyltransferase inhibitor C646 was purchased from EMD chemicals (Cat No.382113, EMD Chemicals,

Billerica, MA). The TNFα inhibitor TNFI was purchased from Calbiochem (No.654256, Merck KGaA,

Darmstadt, Germany), and Etanercept was purchased from Pfizer (Pfizer, Inc., New York City, NY).

Trichostatin (TSA) and nicotinamide (NAM) were from Selleckchem (Selleckchem, Inc., Houston, TX).

Immunoblotting and immunoprecipitation. For immunoprecipitation, the lysates were mixed with an equal

amount of Co-IP buffer (150 mM NaCl, 1% NP-40, 1% deoxycholate, 0.1% SDS, and 50 mM Tris-Hcl PH 7.5).

The primary antibody or IgG was added to the lysates, and the reactions were incubated in 4ºC at a rotary

device for 2 hr, then blocked with protein A beads (Millipore Corp., Billerica, MA) overnight. The beads were

collected by centrifugation and washed gently by TNTG buffers prior to immunoblotting. An anti-acetyl-lysine

antibody-coated agarose (Cat. #ICP0388, ImmuneChem Pharmaceuticals Inc., Burnaby, Canada) was used for

purifying lysine-acetylated proteins. The immunoblotting was performed as described (Hwang et al., 2014).

ImageJ software was used for densitometry measurements of the western blots.

Mass spectrometry. GST-Snail proteins were purified from 293T cells co-transfected with GST-Snail and

pHA-CBP by using Glutathione Sepharose 4 Fast Flow (GE Healthcare, Uppsala, Sweden). Protein bands were

excised and collected from the SDS-PAGE gels. The gel pieces were washed twice with 50 mL of 50%

acetonitrile (ACN)/50% 200 mM ammonium bicarbonate for 5 min and shrunk with 100% ACN until the gels

turned white. Then, the gels were dried for 5 min in a concentrator. The gel pieces were rehydrated at room

temperature in 15 mL of 50 mM ammonium bicarbonate (37°C, 4 min). An equivalent volume of trypsin

18

solution (20 ng/mL in 50 mM ammonium bicarbonate) was then added, and the gel pieces were incubated at

37°C for at least 16 hr. After digestion, the digests were extracted from the gel slices using 0.1% formic acid in

50% ACN. All extracts were dried in a concentrator. The peptides resulting from the trypsin digestion were

prepared by suspending the extracts completely with 0.1% formic acid. Additionally, peptides were stored at -

80°C until liquid chromatography/tandem mass spectrometry (LC/MS/MS) analysis was performed using

a Finnigan LTQ XL Linear Ion Trap Mass Spectrometer (Thermo Electron Corp., Waltham, MA, USA).

Proximity ligation assay. The proximity ligation assay was used to investigate the proximity of epitopes

recognized by the anti-Snail and anti-acetyl lysine antibodies, which represent the expression of acetylated Snail

in cancer cells. The experiment was performed according to the manufacturer’s instructions with minor

modifications. Briefly, after incubation with primary antibodies, the corresponding DuoLink In Situ PLA

probes (OLINK Bioscience, Uppsala, Sweden) were applied for 1 hr at 37°C as recommended. Subsequent

ligations and detections using DuoLink In Situ Detection Reagents Red Kit (OLINK Bioscience, Uppsala,

Sweden) were performed. Blocking, antibody hybridizations, proximity ligations, and detections were

performed according to the manufacturer’s recommendations (DuoLink In Situ, OLINK Bioscience, Uppsala,

Sweden). Co-staining of p53 and acetyl lysine was used as a positive control to confirm the efficacy of the

DuoLink for detecting acetylated protein in cells. The fluorescence images were captured using Olympus

Fluoview FV10i Laser confocal microscope (Olympus corporation, Tokyo, Japan). Images were collected

sequentially on a confocal laser scanning microscope (Olympus UPLSAPO 60XO, NA 1.35) and analyzed by

Olympus FV10-ASW Version 3.0 Software. The results were quantified by MetaMorph® Microscopy

Automation & Image Analysis Software.

Generation of the anti-acetylated Snail antibody. Antibodies that specifically recognize lysine 146- or lysine

187-acetylated Snail were generated by Yao-Hong Biotechnology, Inc. (Taipei, Taiwan). Synthetic acetylated

peptides representing portions of Snail around lysine 146 and lysine 187 were used as antigens for producing

19

antibodies. The antibodies were then purified using an acetyl-peptide and a non-acetyl-peptide-conjugated

column. The specificity of these two antibodies was validated by dot blots using acetylated or non-acetylatable

peptides (Figure S2C).

ChIP and sequential ChIP assay. The ChIP assay was performed as described (Yang et al., 2010). For the

sequential ChIP assay, the cells were cross-linked with 1% formaldehyde and harvested with SDS buffer (50

mM Tris [pH 8.0], 0.5% SDS, 100 mM NaCl, 5 mM EDTA, and protease inhibitors). After centrifugation, the

nuclear fractions were resuspended and subjected to sonication, and then the lysates were incubated with protein

A+G beads conjugated to specific antibodies for different proteins or an IgG control. Then, the DNA-protein

complexes were eluted by incubation at 37ºC with 50:l of 10 mM dithiothreitol (DTT) for 30 min. After

centrifugation, the supernatant was collected and diluted to 500:1 with IP buffer and subjected to the ChIP

procedure again.

Electrophoretic mobility shift assay (EMSA). The Snail EMSA kit (GS0089, BioCat GmbH, Heidelberg,

Germany) was used for detecting the DNA binding activity of WT and mutant Snail. Briefly, a double-stranded

DNA containing putative binding sequences of Snail were labeled with biotin and incubated with the nuclear

extracts harvested from HEK-293T cells transfected with pFLAG-Snail or pFLAG-Snail2R. Electrophoresis

was performed and the gel was transferred to a nylon membrane and detected by the Strepatvidin-HRP and a

chemiluminescent substrate. In the competition assay, excess amounts of unlabeled competitors were added

prior to the labeled probes. The sequence of the probe used in EMSA is: biotin-CGCAGCACCTGTTAGCAGC.

The concentration of the probe is 20ng/ul.

Immunofluorescence staining. Cells were seeded onto poly-L-Lysine coated slides and fixed with 4%

paraformaldehyde, permeabilized with 0.5% Triton X-100, and blocked with 1% BSA. Hoechst 33342 was used

for nuclear staining. The images were captured by the Olympus Fluoview FV10i Laser confocal microscope

20

(Olympus Corporation, Tokyo, Japan) equipped with a 60x oil objective (Olympus UPLSAPO 60XO, NA 1.35).

Images were collected sequentially on a confocal laser scanning microscope and analyzed by Olympus FV10-

ASW Version 3.0 Software.

cDNA microarray and data analysis. The gene expression patterns of FaDu-CDH, FaDu-Snail, and FaDu-

Snail2R cells were analysed using Agilent SurePrint G3 Human V2 GE 8X60K Microarray (Agilent

Technologies, Inc, Santa Clara, CA). Total RNA collection, cRNA probe preparation, array hybridization,

feature selection and computational analysis were performed as we previously described (Yang et al., 2010).

The gene ontology analysis was performed by DAVID Bioinformatics Resources 6.7

(http://david.abcc.ncifcrf.gov/).

PCR array. The Human RT² Profiler™ PCR Array (PAHS-011Z, Qiagen, Germantown, MD, USA), which

profiles the expression of 84 key secreted cytokines and chemokines, was used to analyze the differentially

expressed cytokine/chemokine genes in FaDu-CDH verses FaDu-Snail cells and HT29 cells receiving shRNA

against Snail or a control sequence. The PCR array was performed according to the manufacturer’s instructions.

Ingenuity pathway analysis. Pathway and global functional analyses were performed

using Ingenuity Pathway Analysis 6.0 (IPA; Ingenuity® Systems, www.ingenuity.com). A data set containing

gene identifiers and corresponding expression values was uploaded, and each gene was mapped using

the Ingenuity Pathways Knowledge Base (IPKB). Genes from the data sets that are associated with biological

functions or with a canonical pathway in the IPKB and that met the p-value cutoff of 0.005 were used to build

the interactome. Fisher's exact test was used to calculate the p-value.

Analysis of the public array database. Microarray gene expression data of tumor cell lines of diverse origins

(NCI-60 panel) were downloaded from the website of the Stanford NCI-60 Cancer Microarray Project (Ross et

21

al., 2000). Data were generated by Gene Logic, Inc. using Affymetrix U133. The ONCOMINE was applied to

evaluate gene expression patterns in normal and cancerous tissues (Rhodes et al., 2004), and the database from

Hensen et al. was analyzed (Hensen et al., 2008). The accession number for Hensen’s dataset is GSE9349.

Enzyme-linked immunosorbent assay. The measurement of CCL2, CCL5, TNFα, and IL6 was performed

using the ELISA kits for detecting human CCL2 (No. DCP00, R&D Systems, Minneapolis, MN), CCL5 (No.

BMS287/2INST, eBioscience, Inc., San Diego, CA), TNFα (No.BMS223INST, eBioscience, Inc., San Diego,

CA), and IL6 (BMS213INST, eBiosciences, Inc., San Diego, CA) according to the manufacturer’s instructions.

Preparation of human monocytes. Peripheral mononuclear cells were isolated from the blood of healthy

donors by standard density gradient centrifugation with Ficoll-Paque (Amersham Biosciences, Inc., Piscataway,

NJ). CD14+ cells were subsequently purified from peripheral mononuclear cells by high-gradient magnetic

sorting using anti-CD14 microbeads (No.130-050-201, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany).

CD14+ monocytes were cultured in complete RPMI-1640 medium (Life Technologies, Inc., Gaithersburg, MD)

supplemented with hM-CSF for 3 days. Fresh medium supplemented with hM-CSF (10 ng/ml) (No.30025,

PeproTech, Inc., Rocky Hill, NJ) was added on day 1. To investigate the effects of conditioned medium from

FaDu cells expressing either WT or mutant Snail on polarizing macrophages, CD14+ monocytes were incubated

with the conditioned medium from FaDu cells for 3 days and then subjected to flow cytometry to analyze

surface markers.

In vitro monocytes migration assay. The migration of human peripheral blood-derived CD14+ monocytes was

measured with a QCM™ 5 μm 24-well Chemotaxis Cell Migration Assay kit (ECM507, Chemicon, Inc.,

Billerica, MA). CD14+ cells were loaded into the migration chamber, and FaDu clones were cultured in the

lower chamber. After allowing cell migration to progress for 16 hr, the cells were removed from the upper side

of the membranes. The migratory cells on the lower side of the membrane were lysed, and the number of

22

migratory cells was determined using CyQUANT GR Dye (No. 90132, Chemicon, Inc., Billerica, MA) and a

fluorescence plate reader.

Flow cytometry. Cells were harvested and washed twice with PBS. The cells were then incubated with mouse

anti-mannose receptor antibodies (No.321102, BioLegend, Inc., San Diego, CA) for 1 hr at 4°C and then with

secondary FITC-conjugated goat anti-mouse IgG antibodies for 30 min at 4°C (AP124F, Chemicon, Inc.,

Billerica, MA). Stained cells were analyzed on a Cytomics™ FC500 Flow Cytometry apparatus (Beckman

Coulter, Inc., Brea, CA) using Cytomics CXP Analysis software (Beckman Coulter, Inc., Brea, CA).

Immunohistochemistry and interpretation. The slides were independently scored by two individuals. We

scored CD68- and CD163-positive macrophage infiltration as high or low. For CD68- or CD163-positive

macrophages, high infiltration was defined as ≥50 cells in each low power field (LPF) (20x10), whereas <50

cells per LPF was defined as low infiltration. Microvascular density (MVD) was determined by staining for

CD31, an endothelial cell marker, in tumor samples and counting all of the vessels at 400x magnification. Each

stained lumen was regarded as a single countable microvessel. Values are expressed as the number of

vessels/high power field.

Primers for quantitative PCR and chromatin immunoprecipitation (ChIP)

Assay Gene name Sequence (5’to 3’) Amplicon quantitative SNAI1

F CTTCCAGCAGCCCTACGAC 71

R CGGTGGGGTTGAGGATCT PCR TNFA

F TCAGCCTCTTCTCCTTCCTG 124

R GCCAGAGGGCTGATTAGAGA CCL2

F GCCTCCAGCATGAAAGTCTC 109

R AGGTGACTGGGGCATTGAT CCL5

F TACACCAGTGGCAAGTGCTC 100

R TGTACTCCCGAACCCATTTC CCL7

F GAAAGCCTCTGCAGCACTTC 150

R TAGCTCTCCAGCCTCTGCTT

23

CCR2A

F GGCAATCCTACAGCCAAGAG 72 R CCCATCATCTATGCCTTCGT

CCR2B

F TTCTGATAAACCGAGAACGAGAT 104 R TGAGACAAGCCACAAGCTGA

CCR5

F CATCCGTTCCCCTACAAGAA 102 R GGCAGGGCTCCGATGTATAA

CCL19

F CCTGCTGGTTCTCTGGACTT 108 R CTCACGATGTACCCAGGGAT

CXCL10

F GACATATACTCCATGTAGGGAAGTGA 132 R GAAAGCAGTTAGCAAGGAAAGGT

IL8 F CGGAAGGAACCATCTCACTG 116 R AGCACTCCTTGGCAAAACTG ERCC1

F CTGCACCCAGACTACATCCA 125

R CACATCTTAGCCAGCTCCTTG CCND1

F TCCTCTCCAAAATGCCAGAG 109

R GGCGGATTGGAAATGAACTT MRC1

F TACCCCTGCTCCTGGTTTTT 97

R CAGCGCTTGTGATCTTCATT GAPDH

F AAGGTCGGAGTCAACGGATTTG 149

R CCATGGGTGGAATCATATTGGAA IL6

F AGTGAGGAACAAGCCAGAGC 112

R CATTTGTGGTTGGGTCAGG FN1

F CCATAAAGGGCAACCAAGAG 91

R ACCTCGGTGTTGTAAGGTGG

ZEB1 F CCAGGTGTAAGCGCAGAAAG

145 R CAGTCAGCTGCATCTGTAACAC THBS1

F CAATGCCACAGTTCCTGATG 114

R TTGCCACAGCTCGTAGAACA

CDH1 F TGCTCTTCCAGGAACCTCTGTG

169 R GGTGACCACACTGATGACTCCTG ChIP ERCC1

F AGGCTAGCATCTGGACGC 165

R CCAAGACCAGCAGGTGAG CDH1

F CCTAGACCCTAGCAACTC 221

R CAGGTGCTTTGCAGTTCCG IL8

F AGAAAATCATCCATGATCTTGTT 177

R AATACGGAGTATGACGAAAGTT TNFA

F CCGCTTCCTCCAGATGAGC 119

R GGCAGTTGTTGGCACACC CCL2

F TCTTAGTTCACATCTGTGG 146

R CAGCATCCTGTGGATTTCC

24

CCL5

F TGCTATTTTGGAAACTCCCC 139 R ACCTTCATGGTACCTGTGG

FN1 F GGCGCTCGGACGCCCG

140 R TGGGGAAGGGGACGGGTG

Information for antibodies used in the experiments

Protein Assay Antibody Origin Dilution Incubation period

β-actin WB MAB1501, Chemicon International Inc.

mmab 1/5000 o/n, 4°C

H3K4Ac ChIP 07-539, Millipore corporation

rpab 1/100 o/n, 4°C

H3K14Ac ChIP #5275, Cell Signaling Technology, Inc.

rpab 1/100 o/n, 4°C

H3K18Ac ChIP 39587, Active Motif. rpab 1/100 o/n, 4°C H4R3me2 ChIP Ab5823, abcam. rpab 1/100 o/n, 4°C H3K27me3 ChIP Ab8898, abcam. rpab 1/100 o/n, 4°C PCAF WB A301-666A, Bethyl

Laboratories, Inc. rpab 1/1000 o/n, 4°C

GCN5 WB sc-6303, Santa cruz Biotechnology, Inc.

gpab 1/1000 o/n, 4°C

p300 WB LS-C2745, Lifespan Biosciences, Inc.

mmab 1/250 o/n, 4°C

CBP

WB Sc-583X, Santa Cruz Biotechnology Inc.

rpab

1/1000 o/n, 4°C IP 1/100 o/n, 4°C ChIP 1/100 o/n, 4°C

Snail

ChIP AF3639, R&D systems.

gpab 1/100 o/n, 4°C

WB #3895, Cell Signaling Technology, Inc.

mmab

1/1000 o/n, 4°C IP 1/100 o/n, 4°C PLA 1/100 o/n, 4°C IF 1/200 o/n, 4°C

HA

WB MMS-101P, Covance Inc.

mmab

1/1000 o/n, 4°C IP 1/100 o/n, 4°C

FLAG

WB F1804, Sigma-Aldrich

mmab

1/100 o/n, 4°C IP 1/100 o/n, 4°C

normal mouse IgG

IP Sc-2025, Santa Cruz Biotechnology Inc.

-

1/100 o/n, 4°C ChIP 1/100 o/n, 4°C

25

normal rabbit IgG

IP Sc-2027, Santa Cruz Biotechnology Inc.

-

1/100 o/n, 4°C ChIP 1/100 o/n, 4°C

acetylated lysine

IP Ab80178, abcam

rpab

1/100 o/n, 4°C PLA 1/100 o/n, 4°C

Sin3A

WB Sc-767, Santa Cruz Biotechnology Inc.

rpab

1/1000 o/n, 4°C IP 1/100 o/n, 4°C ChIP 1/100 o/n, 4°C

Ajuba

WB #4897, Cell Signaling Technology, Inc.

rpab

1/1000 o/n, 4°C IP 1/100 o/n, 4°C ChIP 1/100 o/n, 4°C

TNFα WB #3707, Cell Signaling Technology, Inc.

rpab 1/1000 o/n, 4°C

CCL2 WB Ab7814, abcam. rpab 1/1000 o/n, 4°C CCL5 WB LS-C137907,

LifeSpan BioSciences, Inc.

rmab 1/1000 o/n, 4°C

Phosphorylated serine/threonine

IP 612549, BD Transduction Laboratories™

mmab 1/100 o/n, 4°C

mannose receptor

FC 321102, BioLegend mmab 1/200 o/n, 4°C

CD68 IHC M0876, Dako mmab 1/200 o/n, 4°C CD163 IHC MCA1853, AbD

Serotec. mmab 1/200 o/n, 4°C

F4/80 IHC 14-4801,eBioscience rpab 1/400 o/n, 4°C CD31 IHC 250590, ABBIOTEC rpab 1/300 o/n, 4°C Arginase 1 IHC Sc-20150, Santa Cruz

Biotechnology Inc rpab 1/400 o/n, 4°C

Zeb1 WB Sc-25388, Santa Cruz Biotechnology Inc

rpab 1/1000 o/n, 4°C

Fibronectin WB GTX112794,GeneTex Inc.

rpab 1/1000 o/n, 4°C IF 1/50 o/n, 4°C

E-cadherin

WB #4065, Cell Signaling Technology, Inc

rpab

1/1000 o/n, 4°C IF 1/50 o/n, 4°C

γ-catenin WB 610253, BD Transduction Laboratories™

mmab 1/1000 o/n, 4°C

Abbreviations: ChIP, chromatin immunoprecipitation; FC, flow cytometry; IF, immunofluorescence; IHC, immunohistochemistry; IP, immunoprecipitation; mmab, mouse monoclonal antibody; o/n, overnight; PLA, proximity ligation assay; rpab, rabbit polyclonal antibody; WB, western blot

26

Supplemental References

• Hensen, E.F., De Herdt, M.J., Goeman, J.J., Oosting, J., Smit, V.T., Cornelisse, C.J., and Baatenburg de Jong, R.J. (2008). Gene-expression of metastasized versus non-metastasized primary head and neck squamous cell carcinomas: A pathway-based analysis. BMC Cancer 8, 168.

• Ross, D.T., Scherf, U., Eisen, M.B., Perou, C.M., Rees, C., Spellman, P., Iyer, V., Jeffrey, S.S., Van de Rijn, M., Waltham, M., et al. (2000). Systematic variation in gene expression patterns in human cancer cell lines. Nat. Genet. 24, 227-235.

• Yang, M.H., Hsu, D.S., Wang, H.W., Wang, H.J., Lan, H.Y., Yang, W.H., Huang, C.H., Kao, S.Y., Tzeng, C.H., Tai, S.K., et al. (2010). Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition. Nat. Cell Biol. 12, 982-992.