APPLIED AND ENVIRONMENTAL MICROBIOLOGY,0099-2240/99/$04.00!0

May 1999, p. 2222–2229 Vol. 65, No. 5

Differentiation of Methanosaeta concilii and Methanosarcina barkeri inAnaerobic Mesophilic Granular Sludge by Fluorescent In Situ

Hybridization and Confocal Scanning Laser Microscopy†SYLVIE ROCHELEAU,1 CHARLES W. GREER,2* JOHN R. LAWRENCE,3 CHRISTIANE CANTIN,1

LOUISE LARAMEE,2 AND SERGE R. GUIOT1

Environmental Bioengineering Group1 and Environmental Microbiology Group,2 Biotechnology Research Institute,National Research Council Canada, Montreal, Quebec, Canada H4P 2R2, and National Water

Research Institute, Saskatoon, Saskatchewan, Canada S7N 3H53

Received 25 November 1998/Accepted 17 February 1999

Oligonucleotide probes, designed from genes coding for 16S rRNA, were developed to differentiate Meth-anosaeta concilii, Methanosarcina barkeri, and mesophilic methanogens. All M. concilii oligonucleotide probes(designated MS1, MS2, and MS5) hybridized specifically with the target DNA, but MS5 was the most specificM. concilii oligonucleotide probe. Methanosarcina barkeri oligonucleotide probes (designated MB1, MB3, andMB4) hybridized with different Methanosarcina species. The MB4 probe specifically detected Methanosarcinabarkeri, and the MB3 probe detected the presence of all mesophilic Methanosarcina species. These newoligonucleotide probes facilitated the identification, localization, and quantification of the specific relativeabundance of M. concilii and Methanosarcina barkeri, which play important roles in methanogenesis. Thecombined use of fluorescent in situ hybridization with confocal scanning laser microscopy demonstrated thatanaerobic granule topography depends on granule origin and feeding. Protein-fed granules showed no layeredstructure with a random distribution of M. concilii. In contrast, a layered structure developed in methanol-enriched granules, where M. barkeri growth was induced in an outer layer. This outer layer was followed by alayer composed of M. concilii, with an inner core of M. concilii and other bacteria.

Anaerobic bioreactors are used to treat various organicwastes, which are ultimately converted into methane. It is gen-erally accepted that two-thirds or more of the methane pro-duced in an anaerobic bioreactor is derived from acetate (47).Of the many methanogenic genera, only two, Methanosaetaand Methanosarcina, are known to grow by an acetoclasticreaction, producing methane from acetate (47). Methanosaetaconcilii is solely an acetoclastic bacterium and is the only me-sophilic species of its genus, other species being thermophiles(43). Methanosarcina barkeri is metabolically the most versatileof all the mesophilic methanogenic bacteria isolated in pureculture, since it can form methane from H2 and CO2 (hydrog-enotroph), from methanol and methylamines (methylotroph),and from acetate (acetoclast) (24, 47).

Upflow anaerobic sludge blanket (UASB) bioreactors arethe most commonly used systems for wastewater anaerobictreatment. The retention of large amounts of biomass in aUASB bioreactor is due to the ability of bacterial cells toaggregate and form a granular structure which can settle andaccumulate in the reactor (29). The ultrastructure of granularsludge was initially characterized by using light microscopy andscanning and transmission electron microscopy (10, 15, 23, 29,37). Guiot and coworkers (16, 29) presented a layered concep-tual model for glucose-fed granules in which Methanosaetaformed the internal core, which was surrounded by a secondlayer of acetogenic and hydrogenotrophic bacteria, with a pe-ripheral layer composed predominantly of acidogenic, sulfate-reducing, and hydrogenotrophic bacteria. The layered struc-

ture of UASB granules was also observed with othersubstrates, such as sucrose, brewery and potato wastes, wheat-starch, and papermill wastewaters (10, 20, 37). On the otherhand, no layered granular structure was observed in UASBreactors treating propionate, ethanol, glutamate, sugar refinerywastewaters, and methanol waste (7, 10). Granules at 15 and25°C exhibited a uniform structure and were colonized pre-dominantly by Methanosaeta-like organisms, while granules at5°C showed a layered structure (5). These studies indicate thatthe bacterial composition and ultrastructure of granular sludgeseem to be dependent on growth substrate and temperature (5,40).

Oligonucleotide probes designed from 16S ribosomal DNAs(rDNAs) have been developed to identify microorganismspresent in anaerobic bioreactors (15, 18, 22, 28, 42, 44, 46).Antibody probes have also been developed to characterize thetopography of anaerobic granular consortia (15, 18, 22, 28, 44,46). Recently, the fluorescent in situ hybridization (FISH)technique combined with confocal scanning laser microscopy(CSLM) has been used to analyze the spatial distribution ofspecifically labeled target cells present in different types ofwastewater processes (2, 3, 31), but few studies have examinedthe relative distributions and quantifications of methanogenicpopulations.

The objectives of the present study were (i) to develop andvalidate 16S rDNA oligonucleotide probes to differentiate M.concilii and Methanosarcina barkeri at the species level andmesophilic methanogens at the group level and (ii) to useFISH coupled with CSLM to determine quantitative profiles ofboth bacteria in two types of anaerobic granular consortia.

MATERIALS AND METHODS

Bacterial strains and growth conditions. M. concilii GP6, Methanosarcinabarkeri Fusaro, and Methanosarcina mazei were supplied by Gerish Patel (Na-

* Corresponding author. Mailing address: Biotechnology ResearchInstitute, National Research Council Canada, 6100 Royalmount Ave.,Montreal, Quebec, Canada H4P 2R2. Phone: (514) 496-6182. Fax:(514) 496-6265. E-mail: charles.greer@nrc.ca.

† Publication 41841 of the National Research Council Canada.

2222

tional Research Council Canada, Ottawa, Ontario, Canada). Methanospirillumhungatei and Syntrophomonas wolfei strains were supplied by Michael McInerney(University of Oklahoma, Norman). Pure bacterial strains were grown anaero-bically at 35°C in serum bottles. The sources (33, 35), culture media (4, 33, 35),and trophic levels (13, 14, 41, 43) of bacteria used in this study are listed in Table1.

Anaerobic granule enrichment conditions. The anaerobic granules used in thisstudy were obtained from an industrial UASB bioreactor (Champlain Industries,Cornwall, Ontario, Canada) that treats food production wastewater rich in pro-teins and from lab-scale UASB enrichment processes (9). Three types of en-riched anaerobic granular consortia were examined in the slot blot analysis: (i)Methanosaeta-enriched consortia, (ii) Methanosarcina-enriched consortia, and(iii) syntroph-enriched consortia. Details of the enrichment procedure weredescribed previously (9).

DNA extraction from pure bacterial cultures and from anaerobic granules.Several DNA extraction methods were examined (6, 32, 34, 36, 39). A modifiedversion of the Johnson technique (21) resulted in the highest quantity and qualityof DNA (data not shown). An overnight incubation at 37°C after addition of 10to 30 mg of dry lysozyme (Sigma, St. Louis, Mo.) was required to initiate lysis ofpure cultures. Anaerobic granular consortia were homogenized aseptically witha cell homogenizer (Kinematica PT10-35; Brinkmann Instruments, Westbury,N.Y.). Lysis of more resilient anaerobic granular consortia was initiated byfreezing cells in a dry ice-ethanol bath for 10 min and thawing in a water bath at70°C for 15 min. A five-cycle freeze-thaw procedure of anaerobic granules wasperformed prior to lysozyme addition. Lysis was completed as described byJohnson (21), proteins were precipitated (39), and the DNA was dissolved inRNase-containing Tris-EDTA (TE) buffer and stored at "20°C until slot blotswere performed.

Design and synthesis of the oligonucleotide probes. The nucleotide sequencesof 16S rDNAs from methanogenic bacteria were retrieved from GenBank (Na-tional Center for Biotechnology Information, Bethesda, Md.). Oligonucleotideprobes of 15 to 22 bases in length (Table 2) were designed with the Gene Worksprogram (IntelliGenetics Inc., Mountain View, Calif.). All oligonucleotides weresynthesized on a Biosearch 8750 DNA synthesizer (Biosystems, Cambridge,Mass.) (8). The oligonucleotides were purified with SepPak cartridges (Waters,Milford, Mass.), as described by the manufacturer.

Slot blot analysis. The specificities of the oligonucleotide probes were exam-ined by slot blot analysis by a modified method of Raskin et al. (38). ExtractedDNA was denatured by boiling it in TE buffer (pH 8.0) for 8 min, instead of byglutaraldehyde denaturation as previously suggested (38). Boiling DNA in TEbuffer gave the best 32P-signals and was the most effective DNA denaturationmethod, compared to incubation in 2% glutaraldehyde at room temperature for10 minutes (38) and to boiling in a 1.6 M NaOH–40 mM EDTA solution for 10min (data not shown). Extracted DNA was filtered on Zeta Probe nylon mem-branes (Bio-Rad Laboratories, Hercules, Calif.) with a Minifold II Slot Blotsystem (Schleicher & Schuell, Keene, N.H.). Slot blots were cross-linked twicewith a UV Stratalinker 1800 (Stratagene, La Jolla, Calif.). Membranes were airdried and stored at "20°C. Purified oligonucleotide probes (8 pmol) were 5# endlabeled with a solution containing 5 $l of [%-32P]ATP (4,500 Ci/mmol; NENResearch Products, Dupont Inc., Markham, Ontario, Canada), 6.67 U of T4DNA kinase (New England Biolabs, Beverly, Mass.), and 2 $l of 10& kinasebuffer (New England Biolabs) and brought to a volume of 20 $l with steriledeionized H2O. The labeling reaction was performed at 37°C for 2 h. Slot blots

were prehybridized at 40°C for 2 h in 40 ml of Zeta Probe hybridization solutionto which 5% dextran sulfate had been added and hybridized overnight at 40°Cwith the 32P-labeled oligonucleotide. Hybridized membranes were rinsed twice inZeta Probe wash 1 at 40°C for 60 min, and final wash conditions in Zeta Probewash 2 were optimized for each oligonucleotide (Table 3). Probed membraneswere exposed to X-ray films (Kodak X-Omat AR and BioMax MR; EastmanKodak Co., Rochester, N.Y.) at "80°C for 7 to 14 days.

In situ hybridization of anaerobic granular consortia with fluorescence-la-beled probes. Fresh and frozen granules (2 ml) from the inoculum and fromMethanosarcina-enriched consortia were gently washed twice with 5 ml of phos-phate-buffered saline (PBS). Granules were fixed overnight at 4°C in fresh 4%paraformaldehyde–PBS (5 ml) and washed twice with PBS (17). Fixed granuleswere dehydrated at room temperature in increasing concentrations of ethanol(50, 70, 95, and 100%), in pure xylenes, and then in an equal amount of xylenesin Paraplast wax overnight (19). Granules were embedded in Paraplast wax at60°C for 3 h (19). Paraplast blocks were cut at room temperature with a Histostatrotary microtome (model 820; Reichert/Jung, Buffalo, N.Y.) into 8-$m-thicksections. The microtome sections were transferred onto poly-L-lysine-coatedmicroscope slides (Polysciences, Warrington, Pa.), subbed with 1% gelatin, driedovernight at 42°C, deparaffinated, and air dried (19).

In situ hybridization was performed with (i) the complementary sequences ofMB4 that had been 5# end labeled with FAM–N-hydroxysuccinimide (NHS; asuccinimidyl ester of carboxyfluorescein) or with Cy5 (indodicarbocyanine), syn-thesized by Medicorps (Montreal, Quebec, Canada), and with (ii) MS5 that hadbeen 5# end labeled with TAMRA NHS (tetramethyl rhodamine carboxylic acid),synthesized by University Core DNA Services (Calgary, Alberta, Canada). Pu-rification of the probes was performed by high-performance liquid chromatog-raphy. A volume of 10 $l of hybridization solution (35% deionized formamide,0.9 M NaCl, 20 mM Tris-HCl [pH 7.2], 0.01% sodium dodecyl sulfate, 25 ng ofeach fluorescence-labeled probe) was added to each granule section, and themixture was incubated at 46°C for 2 h (30). Sections were rinsed with washingbuffer (20 mM Tris, 0.01% sodium dodecyl sulfate, 40 mM NaCl, 5 mM EDTA)

TABLE 1. Sources, cultivation conditions, and trophic levels in anaerobic mesophilic fermentors of pure bacterial strains

Strainno. Strain Source

(reference)Culture medium

(reference)a or strainTrophic nature(s)

and/or location

1 Methanosarcina barkeri Fusaro G. B. Patel (35) Medium 3 (4) Acetoclast, hydrogenotroph, methanotroph2 Methanosarcina acetovirans C2A OCM 95 Medium 3 (4) Acetoclast, methanotroph, found in sediments3 Methanosarcina mazei G. B. Patel (35) Medium 3 (4) Acetoclast, hydrogenotroph, methanotroph4 Methanosarcina vacuolata ATCC 35090 ATCC 1043 Acetoclast, hydrogenotroph, methanotroph5 Methanosarcina sp. strain WH1 DSM 4659 Medium 3 (4) Found in anaerobic sands6 Methanosaeta concilii GP6 G. B. Patel (35) Aa medium (35) Acetoclast7 Methanospirillum hungatei M. J. McInerney (33) Basal medium (33) Hydrogenotroph8 Methanobrevibacter arboriphilus ATCC 33747 ATCC 1045 Hydrogenotroph9 Methanogenium bourgense ATCC 43281 ATCC 1340 Hydrogenotroph, formate degrader10 Methanocorpusculum aggregans MSt OCM 21 MG medium from OCM Hydrogenotroph, formate degrader11 Methanobacterium formicicum MF OCM 55 MS medium from OCM Hydrogenotroph, formate degrader12 Methanobacterium wolfei ATCC 43096 ATCC 1045 Hydrogenotroph13 Methanobacterium espanolae OCM 178 MG medium from OCM Hydrogenotroph14 Methanobacterium bryantii M.o.H. OCM 110 MS medium from OCM Hydrogenotroph15 Syntrophomonas wolfei M. J. McInerney (33) Basal medium (33) Hydrogen-producing acetogen16 Clostridium aceticum ATCC 35044 ATCC 1612 Acidogen17 Clostridium populeti ATCC 35295 ATCC 1345 Acidogena Aa, acetic acid; MG, Methanogenium; MS, :Methanosarcina; OCM, Oregon Collection of Methanogens, Portland, Oreg.

TABLE 3. Hybridization final-wash conditions

Oligonucleotideprobe

Final-washtemp (°C)

No. of final washes(30 min each)

MX825 59 4MS1 40 3MS2 42 4MS5 55 3

MS821 60 2MB1 45 3MB3 45 2MB4 42 3

MG3 40 3

VOL. 65, 1999 ANAEROBIC GRANULE TOPOGRAPHY WITH 16S rRNA AND BY CSLM 2223

TABLE 2. Oligonucleotide sequences and specificities

Target bacteriumor bacteria

Oligonucleotideprobe (reference)

Oligonucleotide probesequence (5#–3#)

Length(bases) Gene Works specificities Specificity or specificities tested here

with pure bacterial strains

Methanosaeta concilii MS1 CCGGATAAGTCTCTTGA 17 Methanothrix soehngenii, Methanosaeta concilii Methanosaeta conciliiMS2 CTGAATGAGAGCGCTTTCTTT 21 Methanothrix soehngenii, Methanosaeta concilii Methanosaeta conciliiMS5 GGCCACGGTGCGACCGTTGTCG 22 Methanothrix soehngenii, Methanosaeta concilii,

Methanothrix sp. strain CALS-1,Methanothrix sp. strain PTT, Methanosaetathermoacetophila

Methanosaeta concilii

MX825(38) TCGCACCGTGGCCGACACCTAGC 23 Methanosaeta thermoacetophila, Methanothrixsoehngenii, Methanosaeta concilii

Methanosaeta concilii

Methanosarcina barkeri MB1 TTTGGTCAGTCCTCCGG 17 Methanosarcina frisius, Methanosarcina sp.,Methanosarcina acidovorans, Methanosarcinathermophila, Methanosarcina barkeri

Methanosarcina barkeri,Methanosarcina mazei,Methanosarcina acetivorans,Methanosarcina sp. strain WH1

MB3 CCAGACTTGGAACCG 15 Methanosarcina frisius, Methanosarcinaacidovorans, Methanosarcina thermophila,Methanosarcina barkeri

Methanosarcina barkeri,Methanosarcina mazei,Methanosarcina acetivorans

MB4 TTTATGCGTAAAATGGATT 19 Methanosarcina thermophila, Methanosarcinabarkeri

Methanosarcina barkeri

MS821 (38) CGCCATGCCTGACACCTAGCCAGC 24 Methanosarcina frisius, Methanosarcina sp.,Methanosarcina acidovorans, Methanosarcinathermophila, Methanosarcina barkeri,Methanoholophilus mahii, Methanophilus sp.

Methanosarcina barkeriMethanosarcina sp. strain WH1,Methanosarcina mazei,Methanosarcina acetivorans

Mesophilicmethanogens

MG3 CTCCTTGCACACACCGCCC 19 All methanogens ! Halobacterium spp.,Pyrococcus spp., Sulfolobus spp., Homosapiens, Thermofilum spp., Pyrobaculum spp.

All mesophilic methanogens tested

2224R

OC

HE

LE

AU

ET

AL

.A

PPL.EN

VIR

ON.M

ICR

OB

IOL.

and incubated in washing buffer at 48°C for 20 min. Sections were carefullyrinsed with ultrapure H2O, air dried, and covered with fade retardant in PBS(Molecular Probes Inc., Eugene, Oreg.) prior to application of a glass coverslip.

Confocal laser microscopy and staining. A Bio-Rad MRC 1000 CSLM with akrypton-argon laser system mounted on a Nikon Microphot-SA microscope wasused to image thin sections of the anaerobic inoculum (for treating protein-richwastewater) and Methanosarcina-enriched granular consortia. The microscopewas equipped with a variety of objective lenses. The CSLM was operated asdescribed previously (25, 27) to collect single and serial thin sections in the xyplane.

Sections were imaged at two scales of observation: (i) at low resolution with a10& 0.18-numerical-aperture lens objective in combination with a laser intensityof 100%, pinhole setting of 7.0, and gain of 1,500, with sections being collectedthrough Kalman filtration, and (ii) at higher resolution with a 60& 1.4-numerical-aperture oil immersion lens objective (Nikon Corporation, Chiyoda-ku, Tokyo,Japan), laser intensity of 10 to 30%, pinhole of 1.2, and gain of 1,100, withKalman filtration. The 10& lens provided a full scan of the entire hybridizedgranule section, whereas the 60& lens allowed detailed examination of granulesalong transects across the sectioned granule material. Images were collected bytwo- and three-channel imaging procedures, where carboxyfluorescein (FAMNHS [green])-labeled probes were visualized by excitation at 488 nm and emis-sion at 522/32, tetramethyl rhodamine (TAMRA NHS [red])-labeled probeswere visualized by excitation at 568 nm and emission at 605/32, and Cy5 (farred)-labeled probes were visualized by excitation at 647 nm and emission at680/32 (26). Sections were also scanned for autofluorescence signals at the samewavelengths. After completion of observations, hybridized sections were per-fused with the general nucleic acid stain Syto 9 (Molecular Probes) and the samemicroscope locations were reexamined at 10& and 60& lens objectives to obtaininformation on the total numbers of bacterial cells.

Image analysis and processing. Digital image analysis of the CSLM thinsections in each of the channels was used to determine the bacterial cell area(biomass) binding each of the rRNA probes and Syto 9. The software packageNIH Image, version 1.61, was used for all analyses. CSLM images were thresh-olded to form a binary (black-and-white) image, with the object, i.e., the bacterialcell, being defined prior to measurement of the object area. Details of discrim-ination, object recognition, and measurement may be found in the work ofLawrence et al. (25, 27). Results of object area analyses for an image series werethen plotted versus granule location, and ratios of cell area bound by each probewere calculated to assess treatment effects. Digital images obtained by CSLMwere also used to construct two- and three-color digital images of the stainedgranule sections with the software NIH Image and Adobe Photoshop. The colorsgreen, red, and blue were assigned to the green-, red-, and far-red-wavelengthimages, respectively.

RESULTS AND DISCUSSION

Optimization of slot blotting conditions. The slot blottingconditions published by Raskin et al. (38) were modified byusing Zeta Probe hybridization solutions and by optimizing thefinal wash conditions. Efficiencies of the hybridization solu-tions with and without poly(A) from the Raskin et al. protocol(38) were compared with those of the Zeta Probe hybridizationsolutions. The Zeta Probe solutions gave stronger hybridiza-tion signals (results not shown) and were therefore used for allsubsequent hybridizations. Final wash conditions such as tem-perature, duration, and frequency of washes were optimizedfor each oligonucleotide probe (Table 3). Additional washes,compared to the number recommended by Raskin et al. (38),were required for MX825 and MS821 to increase specificity,probably because different hybridization conditions were used.

Specificities of the designed oligonucleotide probes. The de-signed oligonucleotide probes were aligned with DNA se-quences available in GenBank with the BLAST program (1) toassess their theoretical specificities and to compare their spec-ificities to those of the MX825 and MS821 probes designed byRaskin et al. (38). All Methanosaeta-specific oligonucleotideprobes (MS1, MS2, MS5, and MX825) had 100% homology toM. concilii and Methanothrix soehngenii 16S ribosomal genesequences, which indicates that these probes may show equiv-alent specificities (Table 2). The Methanosarcina-specific oli-gonucleotide probe MB4 was 100% homologous to Methano-sarcina barkeri and Methanosarcina thermophila only, whichindicates that this probe may be specific to Methanosarcinabarkeri found in mesophilic granules. The other Methanosar-

cina-specific oligonucleotide probes (MB1, MB3, and MS821)had 100% homology to other Methanosarcina spp., and MS821had 100% homology to two non-Methanosarcina species. Themesophilic methanogen oligonucleotide probe (MG3) had100% homology to all methanogen 16S rDNA sequences butwas also homologous to other species that are not normallyfound in anaerobic digesters (Table 2).

The specificities of the oligonucleotide probes were assessedby slot blot analysis, with pure bacterial strains being used aspositive controls (Table 2). The chosen bacteria are normallyfound in anaerobic mesophilic fermentors that treat industrialand municipal sludge (Table 1). The three M. concilii-specificoligonucleotide probes (MS1, MS2, and MS5), designed in thisstudy, hybridized only with their corresponding positive control(Fig. 1). MS5 was chosen as the most specific M. concilii oli-gonucleotide probe because it had the most stringent finalwash temperature. The MX825 probe hybridized with Meth-anobacterium formicicum, a non-Methanosaeta species (datanot shown). The Methanosarcina barkeri-specific probe MB4hybridized only with M. barkeri and Methanosarcina sp. strainWH1. The MB1 probe hybridized with Methanosarcina barkeri,Methanosarcina mazei, Methanosarcina vacuolata, Methanosar-cina sp. strain WH1, Methanosarcina acetovirans, and Methano-spirillum hungatei. The MB3 probe hybridized with Methano-sarcina barkeri, Methanosarcina mazei, and Methanosarcinavacuolata. The MS821 probe hybridized with Methanosarcinamazei, Methanosarcina vacuolata, and Methanosarcina sp. andpoorly with the target species, Methanosarcina barkeri (data notshown). Based on these results, the MB4 oligonucleotide probecan be used to specifically identify Methanosarcina barkeri,since Methanosarcina sp. strain WH1 is unlikely to be found inanaerobic digesters that treat industrial and municipal sludge(43). The MB3 probe can be used to detect the presence of allMethanosarcina species in anaerobic mesophilic granular con-sortia. The MG3 mesophilic methanogen-specific oligonucle-otide probe hybridized with all positive controls but not withthe negative controls Syntrophomonas wolfei, Clostridium ace-ticum, and Clostridium populeti (Fig. 1). Therefore, MG3 canbe used to detect mesophilic methanogens normally found inanaerobic digesters that treat industrial and municipal sludge.

Slot blotting of DNAs extracted from anaerobic granules.Slot blots with the oligonucleotide probes were performed withtotal-community DNAs extracted from three types of anaero-bic granular consortia: (i) Methanosaeta-enriched consortia,(ii) Methanosarcina-enriched consortia, and (iii) syntroph-en-riched consortia (Fig. 1). M. concilii and Methanosarcina bark-eri were present in all three types of granules, as detected byhybridization with all the designed oligonucleotide probes. Thepresence of bacteria of Methanosaeta spp. was expected in theMethanosaeta- and syntroph-enriched granules but unantici-pated in the Methanosarcina-enriched granules. This resultmay suggest that although enrichment of Methanosarcina tookplace in the Methanosarcina-enriched granules, M. concilii con-tinued to be present in the consortium. Similarly, the detectionof Methanosarcina barkeri in Methanosaeta-enriched granuleswas not expected, although Methanosarcina barkeri was rela-tively less abundant in these granules.

FISH and CSLM. In order to avoid autofluorescence fromMethanosarcina barkeri in the green wavelength (17, 42), theMB4 probe was labeled with the Cy5 (far red) fluorochrome.The MS5 probe, specific to M. concilii, was labeled with theTAMRA NHS (red) fluorochrome. Syto 9 (green) staining wasused to obtain information on the total number of bacterialcells. The colors of the digital images obtained by CSLM wereblue for MB4, red for MS5, and green for Syto 9, colors

VOL. 65, 1999 ANAEROBIC GRANULE TOPOGRAPHY WITH 16S rRNA AND BY CSLM 2225

assigned to differentiate between Methanosarcina barkeri, M.concilii, and the rest of the bacterial population, respectively.

The MB4 and MS5 fluorescent probes were evaluated withtwo types of granules: one obtained from a protein-rich waste-water treatment plant and the other obtained from a metha-

nol-enriched consortium. CSLM observations demonstratedhow the granule structures may differ, depending on origin andfeeding. In the protein-fed granule, no layered structure wasobserved, the granules were composed mainly of M. conciliidistributed randomly throughout the granule (Fig. 2A), and

1234567891011121314151617181920

1234567891011121314151617181920

A B C A B C A B C A B C

A B C A B C A B C

MS1 MS2 MS5 MG3

MB1 MB3 MB4FIG. 1. Hybridization of 32P-labeled Methanosaeta spp. oligonucleotide probes (MS1, MS2, and MS5), Methanosarcina spp. oligonucleotide probes (MB1, MB3, and

MB4), and a mesophilic-methanogen probe (MG3) with slot blots with 17 pure bacterial strains and three anaerobically enriched consortia. Rows 1 to 17, bacterialstrains 1 to 17 presented in Table 1; row 18, Methanosaeta-enriched consortium; row 19, Methanosarcina-enriched consortium; row 20, syntrophic-methanationconsortium. For pure bacterial cultures, the DNA concentrations were 1,000 ng in column A, 250 ng in column B, and 50 ng in column C. For anaerobic enrichedconsortia hybridized with Methanosaeta oligonucleotide probes, the DNA concentrations were 2,500 ng in column A, 500 ng in column B, and 100 ng in column C. Foranaerobic enriched consortia hybridized with Methanosarcina oligonucleotide probes, the DNA concentrations were 25,000 ng in column A, 5,000 ng in column B, and1,000 ng in column C.

2226 ROCHELEAU ET AL. APPL. ENVIRON. MICROBIOL.

Methanosarcina barkeri was essentially absent (Fig. 2C). Themethanol enrichment induced the growth of Methanosarcinabarkeri (Fig. 2B), and a layered structure developed during theenrichment process, where Methanosarcina barkeri was presentin a second layer, just below the granule surface. The secondlayer was followed by an inner layer of M. concilii closelyassociated with Methanosarcina barkeri (Fig. 2B and D), andthe centers of the enriched granules were sparsely colonized bythe rest of the bacterial population, as demonstrated by Syto 9staining.

Relative quantification and localization of the two targetedbacteria. Transects across the granule centers showed thatMethanosarcina barkeri was not detected in the protein-richwastewater-fed granules and that M. concilii was randomlydistributed throughout the granules (Fig. 3A and B). In themethanol-enriched granules, both Methanosarcina barkeri andM. concilii were detected in the outer layers (Fig. 3C and D).Moreover, the surface area occupied by both of these targetedbacteria was shown to have increased, in comparison to thetotal cell area, a result of the enrichment of the granular sludgewith methanol. By combining transects across the granule cen-ters with the cell area graphs, it was possible to observe andquantify the relative levels of abundance of both targeted bac-teria.

Comprehensive comparison of the observed granules topog-raphy. Results of the present study show that the bacterialorganization of UASB granular consortia was dependent on

the growth substrate. Anaerobic degradation is a multistepprocess involving hydrolysis, acidogenic fermentation, aceto-genesis, and methanogenesis. Carbohydrates, for which theinitial step of degradation is notably faster than subsequentsteps, produce granules with a layered structure, as has beenobserved in UASB granules fed with a variety of carbohydratewastes (10, 20, 29, 37). In protein-rich effluents, proteolysis andacetogenesis from amino acids are the limiting steps in theoverall degradation process. When acid formation is the rate-controlling step, low and homogeneous concentrations of ac-etate throughout the granule are the result. Slow-growingMethanosaeta usually has a competitive advantage over Meth-anosarcina at low concentrations of acetate (45, 47). Theseconditions explain why, for granules grown on protein-richwastewater, no layered structure was demonstrated and M.concilii was distributed randomly throughout the granule whileMethanosarcina populations were practically absent. This ex-planation is in agreement with previous scanning electron mi-croscopic observations where a uniform microstructure devel-oped in glutamate-degrading granular consortia (10), inprotein- and peptone-degrading granules (11), and in propi-onate-degrading granules (11, 15).

Granules that convert single substrates, such as formate andacetate, directly into methane appear to produce uniform mi-crostructures, with one methanogen species predominating(11). However, in this study, a layered structure was formed inthe anaerobic granules enriched with methanol. Bacteria other

FIG. 2. Simultaneous in situ hybridization of UASB granules with the MS5 M. concilii-specific probe (labeled with TAMRA NHS [red]) and the MB4 Methano-sarcina barkeri-specific probe (labeled with Cy5 [blue]). Low-resolution (10& lens objective) CSLM optically thin sections (xy plane) show the random distribution ofM. concilii within the rest of the bacterial population (green) in the inoculum granules (A) and the layered structure of the Methanosarcina-enriched granules (B), inwhich Methanosarcina barkeri and M. concilii are present within the layers. Higher-resolution (60& lens objective) CSLM sections show the absence of Methanosarcinabarkeri from the inoculum granules (C) and the colocalization of Methanosarcina barkeri and M. concilii within the Methanosarcina-enriched granules (D).

VOL. 65, 1999 ANAEROBIC GRANULE TOPOGRAPHY WITH 16S rRNA AND BY CSLM 2227

than Methanosarcina and Methanosaeta occupied the outer-most layer, Methanosarcina barkeri was present in the under-lying layer, followed by a layer of M. concilii and an inner corecomposed of M. concilii and other bacteria. Since methanol isboth a methanogenic and an acetogenic substrate, bacteriafound in the outermost layer were probably methanol consum-ers other than Methanosarcina, such as homoacetogens. Ho-moacetogens are known to out-compete methanogens whenmethanol and cobalt concentrations are relatively high (over 2g/liter and 0.05 mg/liter, respectively) and inorganic carbon isreadily available (9, 12), conditions that were used in this studyto produce the methanol-enriched granules. Since methanol isusually degraded rapidly, a decreasing methanol concentrationgradient is likely to occur due to diffusional limitations. Thismethanol gradient probably created a niche more favorable toMethanosarcina than to the homoacetogens in the underlyinglayer. Finally, the acetate produced from the conversion ofmethanol by the homoacetogens diffused along a decreasinggradient, explaining why the obligate acetoclastic M. conciliiwas also present in significant numbers on the inside of theMethanosarcina barkeri layer and randomly distributed in thecore of the granule.

In conclusion, 16S rDNA oligonucleotide probes were de-veloped to differentiate M. concilii, Methanosarcina barkeri,and mesophilic methanogens present in anaerobic mesophilicfermentors. The specificities of the MS5 and MB4 oligonucle-

otide probes, targeting the 16S rRNA sequences of M. conciliiand Methanosarcina barkeri, respectively, were demonstratedby slot blot analysis with DNAs extracted from pure bacterialcultures and from anaerobic granular consortia. The MB3Methanosarcina-specific oligonucleotide probe detected alltested mesophilic Methanosarcina species. The MG3 oligonu-cleotide probe detected all tested mesophilic methanogensnormally found in anaerobic digesters. FISH with the species-specific probes MS5 and MB4 combined with CSLM was usedto identify and quantify the specific relative abundance of M.concilii and Methanosarcina barkeri in two different types ofgranules. The present study is the first attempt to simulta-neously visualize the spatial distribution and quantify the rel-ative abundance of these two important methanogenic bacte-ria, at the species level, in anaerobic granules. This novelapproach may be an extremely versatile method to monitorpopulation dynamics in UASB processes.

ACKNOWLEDGMENTS

We acknowledge David Juck, Michelle Manuel, Tara Norcott, Al-berto Mazza, Lyle Whyte, Gabrielle Prefontaine, Daniel Dignard,Josee Ash, and Joanne Magoon from the Biotechnology ResearchInstitute. We thank George D. W. Swerhone from the National WaterResearch Institute for his confocal scanning laser microscopy technicalexpertise.

FIG. 3. Relative quantifications of Methanosarcina barkeri and M. concilii cell areas by CSLM digital image analysis. Simultaneous in situ hybridization wasperformed on 8-$m-thick sections of UASB protein-rich wastewater-fed granules (A and B) and of methanol-enriched granules (C and D) with the TAMRA(red)-labeled MS5 M. concilii-specific probe and the Cy5 (blue)-labeled MB4 Methanosarcina barkeri-specific probe. Transects across the centers of the granules wereanalyzed, and the cell area containing both M. concilii and Methanosarcina barkeri and the total cell area (detected with Syto 9) were determined. Data are expressedas relative cell area (percentages of the field) versus location within the granule, and the arrows indicate the center of each thin section. Frame numbers representtransects of these thin sections through the center of the granule.

2228 ROCHELEAU ET AL. APPL. ENVIRON. MICROBIOL.

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403–410.

2. Amann, R., H. Lemmer, and M. Wagner. 1998. Monitoring the communitystructure of wastewater treatment plants: a comparison of old and newtechniques. FEMS Microbiol. Ecol. 25:205–215.

3. Amann, R., J. Snaidr, M. Wagner, W. Ludwig, and K.-H. Schleifer. 1996. Insitu visualization of high genetic diversity in a natural microbial community.J. Bacteriol. 178:3496–3500.

4. Balch, W. E., G. E. Fox, C. J. Magrum, C. R. Woese, and R. S. Wolfe. 1979.Methanogens: reevaluation of a unique biological group. Microbiol. Rev.43:260–296.

5. Banik, G. C., T. G. Ellis, and R. R. Dague. 1997. Structure and methanogenicactivity of granules from an ASBR treating dilute wastewater at low tem-peratures. Water Sci. Technol. 36:149–156.

6. Beji, A., D. Izard, F. Gavini, H. Leclerc, M. Leseine-Delstanche, and J.Krembel. 1987. A rapid chemical procedure for isolation and purification ofchromosomal DNA from Gram-negative bacilli. Anal. Biochem. 162:18–23.

7. Bhatti, Z. I., K. Furukawa, and M. Fujita. 1993. Treatment performance andmicrobial structure of a granular consortium handling methanolic waste. J.Ferment. Bioeng. 76:218–223.

8. Chatellier, J., A. Mazza, R. Brousseau, and T. Vernet. 1995. Codon-basedcombinatorial alanine scanning site-directed mutagenesis: design, implemen-tation, and polymerase chain reaction screening. Anal. Biochem. 229:282–290.

9. El-Mamouni, R., S. R. Guiot, R. Leduc, and J. W. Costerton. 1995. Charac-terization of different microbial nuclei as potential precursors of anaerobicgranulation. J. Biotechnol. 39:239–249.

10. Fang, H. H. P., H. K. Chui, and Y. Y. Li. 1994. Microbial structure andactivity of UASB granules treating different wastewaters. Water Sci. Tech-nol. 30:87–96.

11. Fang, H. H. P., H. K. Chui, and Y. Y. Li. 1995. Effect of degradation kineticson the microstructure of anaerobic biogranules. Water Sci. Technol. 32:165–172.

12. Florencio, L., J. A. Field, and G. Lettinga. 1994. Importance of cobalt forindividual trophic groups in an anaerobic methanol-degrading consortium.Appl. Environ. Microbiol. 60:227–234.

13. Garcia, J. L. 1990. Taxonomy and ecology of methanogens. FEMS Micro-biol. Rev. 87:297–308.

14. Gottschalk, G., and M. Braun. 1981. Revival of the name Clostridium ace-ticum. Int. J. Syst. Bacteriol. 31:476.

15. Grotenhuis, J. T. C., M. Smit, C. M. Plugge, Y. Xu, A. A. M. van Lammeren,A. J. M. Stams, and A. J. B. Zehnder. 1991. Bacteriological composition andstructure of granular sludge adapted to different substrates. Appl. Environ.Microbiol. 57:1942–1949.

16. Guiot, S. R., A. Pauss, and J. W. Costerton. 1992. A structured model of theanaerobic granule consortium. Water Sci. Technol. 25:1–10.

17. Harmsen, H. J. M., H. M. P. Kengen, A. D. L. Akkermans, A. J. M. Stams,and W. M. de Vos. 1996. Detection and localization of syntrophic propi-onate-oxidizing bacteria in granular sludge by in situ hybridization using 16SrRNA-based oligonucleotide probes. Appl. Environ. Microbiol. 62:1656–1663.

18. Howgrave-Graham, A. R., A. J. L. Macario, and F. M. Wallis. 1997. Quan-titative analysis and mapping of micro-organisms in anaerobic digester gran-ules using a combination of transmission electron microscopy with immuno-technology. J. Appl. Microbiol. 83:587–595.

19. Janssen, K. 1996. In situ hybridization and immunohistochemistry, p. 14.0.1–14.2.8. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G.Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecularbiology. John Wiley & Sons, New York, N.Y.

20. Jianrong, Z., H. Jicui, and G. Xiasheng. 1997. The bacterial numeration andan observation of a new syntrophic association for granular sludge. WaterSci. Technol. 36:133–140.

21. Johnson, J. L. 1991. Isolation and purification of nucleic acids, p. 1–20. In E.Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterialsystematics. John Wiley & Sons, West Sussex, England.

22. Koornneef, E., A. J. L. Macario, J. T. C. Grotenhuis, and E. C. de Macario.1990. Methanogens revealed immunologically in granules from five upflowanaerobic sludge blanket (UASB) bioreactors grown on different substrates.FEMS Microbiol. Ecol. 73:225–230.

23. Kosaric, N., R. Blaszczyk, L. Orphan, and J. Valladares. 1990. The charac-teristics of granules from upflow anaerobic sludge blanket reactors. WaterRes. 24:1473–1477.

24. Koster, I. W. 1988. Microbial, chemical, and technological aspects of the

anaerobic degradation of organic pollutants, p. 285–316. In D. L. Wise (ed.),CRC biotreatment systems. CRC Press, Boca Raton, Fla.

25. Lawrence, J. R., D. R. Korber, G. M. Wolfaardt, and D. E. Caldwell. 1996.Analytical imaging and microscopy techniques, p. 29–51. In C. J. Hurst, G. R.Knudsen, M. McInerney, L. D. Stetzenbach, and M. V. Walter (ed.), Manualof environmental microbiology. ASM Press, Washington, D.C.

26. Lawrence, J. R., T. R. Neu, and G. D. W. Swerhone. 1998. Application ofmultiple parameter imaging for the quantification of algal, bacterial andexopolymer components of microbial biofilms. J. Microbiol. Methods 32:253–261.

27. Lawrence, J. R., G. M. Wolfaardt, and T. R. Neu. 1997. The study of biofilmsusing confocal laser scanning microscopy, p. 431–465. In M. H. F. Wilkinsonand F. Schut (ed.), Digital image analysis of microbes: imaging, morphom-etry, fluorometry and motility techniques and applications. John Wiley andSons Ltd., Sussex, United Kingdom.

28. Macario, A. J. L., F. A. Visser, J. B. van Lier, and E. C. de Macario. 1991.Topography of methanogenic subpopulations in a microbial consortiumadapting to thermophilic conditions. J. Gen. Microbiol. 137:2179–2189.

29. MacLeod, F. A., S. R. Guiot, and J. W. Costerton. 1990. Layered structure ofbacterial aggregates produced in an upflow anaerobic sludge bed and filterreactor. Appl. Environ. Microbiol. 56:1598–1607.

30. Manz, W., R. Amann, W. Ludwig, M. Wagner, and K.-H. Schleifer. 1992.Phylogenetic oligonucleotide probes for the major subclasses of proteobac-teria: problems and solutions. Syst. Appl. Microbiol. 15:593–600.

31. Manz, W., M. Eisenbrecher, T. R. Neu, and U. Szewzyk. 1998. Abundanceand spatial organization of Gram-negative sulfate-reducing bacteria in acti-vated sludge investigated by in situ probing with specific 16S rRNA targetedoligonucleotides. FEMS Microbiol. Ecol. 25:43–61.

32. Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acidfrom micro-organisms. J. Mol. Biol. 3:208–218.

33. McInerney, M. J., M. P. Bryant, and N. Pfennig. 1979. Anaerobic bacteriumthat degrades fatty acids in syntrophic association with methanogens. Arch.Microbiol. 122:129–135.

34. Meakin, S. A., J. H. E. Nash, W. D. Murray, K. F. J. Kennedy, and G. D.Sprott. 1991. A generally applicable technique for the extraction of restrict-able DNA from methanogenic bacteria. J. Microbiol. Methods 14:119–126.

35. Patel, G. B. 1984. Characterization and nutritional properties of Methano-thrix concilii sp. nov., a mesophilic acetoclastic methanogen. Can. J. Micro-biol. 30:1383–1396.

36. Pitchner, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction ofbacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol.8:151–156.

37. Quarmby, J., and C. F. Forster. 1995. A comparative study of the internalarchitecture of anaerobic granular sludges. J. Chem. Technol. Biotechnol.63:60–68.

38. Raskin, L., J. M. Stromley, B. E. Rittmann, and D. A. Stahl. 1994. Group-specific 16S rRNA hybridization probes to describe natural communities ofmethanogens. Appl. Environ. Microbiol. 60:1232–1240.

39. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

40. Schmidt, J. E., and B. K. Ahring. 1995. Granulation in thermophilic upflowanaerobic sludge blanket (UASB) reactors. Antonie Leeuwenhoek 68:339–344.

41. Sleat, R., and R. A. Mah. 1985. Clostridium populeti sp. nov., a cellulolyticspecies from a woody-biomass digester. Int. J. Syst. Bacteriol. 35:160–163.

42. Sorensen, A. H., V. L. Torsvik, T. Torsvik, L. K. Poulsen, and B. K. Ahring.1997. Whole-cell hybridization of Methanosarcina cells with two new oligo-nucleotide probes. Appl. Environ. Microbiol. 63:3043–3050.

43. Staley, J. T., M. P. Bryant, N. Pfennig, and J. G. Holt. 1989. Bergey’s manualof systematic bacteriology, vol. 3. Williams & Wilkins, Baltimore, Md.

44. Visser, F. A., J. B. van Lier, A. J. L. Macario, and E. C. de Macario. 1991.Diversity and population dynamics of methanogenic bacteria in granularconsortium. Appl. Environ. Microbiol. 57:1728–1734.

45. Zehnder, A. J., K. Ingvorsen, and T. Marti. 1982. Microbiology of methanebacteria, p. 45–68. In Proceedings of the 2nd International Symposium onAnaerobic Digestion. Elsevier Biomedical Press, Amsterdam, The Nether-lands.

46. Zellner, G., A. J. L. Macario, and E. C. de Macario. 1997. A study of threeanaerobic methanogenic bioreactors reveals that syntrophs are diverse anddifferent from reference organisms. FEMS Microbiol. Ecol. 22:295–301.

47. Zinder, S. H. 1993. Physiological ecology of methanogens, p. 128–206. InJ. G. Ferry (ed.), Methanogenesis: ecology, physiology, biochemistry andgenetics. Chapman & Hall, New York, N.Y.

VOL. 65, 1999 ANAEROBIC GRANULE TOPOGRAPHY WITH 16S rRNA AND BY CSLM 2229