Indian J. Anim. Res., 43 (2) : 89-93, 2009 AGRICULTURAL RESEARCH COMMUNICATION CENTRE

www.arccjournals.com/indianjournals.com

DETECTION OF MICROSATELLITE MARKERS IN POLYACRYLAMIDE GELSBY A FAST AND SENSITIVE SILVER STAINING METHOD USING BUFFALO

BREEDS·

n.B. Shinde, B.V. GUiar, A.S. JinturKar and S.B. Adangale'Marathwada Agricultural University,

Parbhani 431402, India.

ABSTRACTA fast, reliable, cheap and sensitive silver staining method to detect microsatellite markers in

polyacrylamide gel was modified from the two standard staining procedures. The main differencesbetween standard method and modified. method concerned are the pre-exposure of gel withformaldehyde during silver nitrate impregnation, the addition of sodium hydroxidf? instead ofsodium thiosulphate and sodium carbonate during development, the inclusion of the absoluteethanol with acetic acid in the stop solution and the duration of the different reaction steps. Themodified method allowed the detection of polymorphisms for simple sequence repeats (SSR)with different buffalo breeds with the lower backgrounds and higher conservation duration of thegels and allowed reutilization of most of the solutions used in the staining procedure for 4-5times, making it quite cheap.

Key words: Microsatellite markers, Polyacrylamide gels, Silver staining, Buffalo breeds.

autoradiography and fluorescence labelingtechniques (Christensen et a1., 1999).

The standard method of silver staining(Bassam et al., 1991) require long duration fordevelopment of gel, needs to maintain the geltemperature at 10°C, gives relatively. poor stainingof the DNA bands and low rate of reuse of thestaining solutions (Helima Benbouza et al; 2006).In the present communication, the said methodpracticed by crop scientists was modified to suitlivestock research. The advantages of the modified

. method are less time requirement for geldevelopment, better staining of DNA fragments and

Silver staining was originally described for reuse of the staining solutions.detection of polypeptide's separated bypolyacrylamide gel electrophoresis (Merril et al., MATERIAL AND METHODS1981) and later modified for detection of nucleic acid For isolation of genomic DNA, buffalo bloodwith increased sensitivity due to various small samples were collected aseptically in the vacutainersadaptations of the original silver staining methods containing anticoagulant solution. The genomic(Sommerville and Wang, 1981; Beidler eta1., 1982; DNA was extracted from 200 J.l.l of blood by highGoldman and Merril, 1982; Blum et aI., 1987; salt method (Senthil et al., 1996) with someBassam et aI., 1991; Sanguinetti et aI., 1994). The modifications. The quality of DNA was checked bylast detection methods of nucleic acids using silver agarose gel electrophoresis and quantitation wasstaining could be considered as sensitive as done by UV-spectrophotometry.

INTRODUCTIONFluorescent or radioactive detection

techniques of DNA molecular markers are expensive,time-consuming and require special facilities, whichrender them difficult to adopt in most tropicalcountries, where there is lack of sophisticatedinfrastructure. Contrary to these techniques, silverstaining is a relatively rapid and inexpensivealternative. In 1979, Merril and his co-workerreported a new ultra-sensitive stain for proteins calledsilver stain, which detects as little as 0.01 nanogramof protein per square millimeter in polyacrylamidegels.

* Part of post-graduate thesis submitted by Senior Author.

90 INDIAN JOURNAL OF ANIMAL RESEARCH

Table 1: Microsatellite markers used.

Micro- Primer sequences (5'_3') Chrom- Referencesatellite osomal

locationCSSM043 F:AAAACTCTGGGAACTTGAAAACTA 27 Barker et a/. (1997)

R: TTCATATAAGCAGTTTATAAACGC Moioli et a/. (2001)

CSSM 038 F: TTCATATAAGCAGTTTATAAACGC 10 Barker et al. (1997)R:ATAGGATCTGGTAACTTACAGATG Moioli et al. (2001)

ILSTS 005 F:GGAAGCAATGAAATCTATAGCC 10 Moioli et a/. (2001)R:TGTTCTGTGAGTTTGTAAGC Ritz et al. (2000)

Brezinsky et a/. (1993)SRCRSP8 F:TGCGGTCTGGTTCTGATTTCAC unknown Li et a/. (2002)

R:GTTTCTTCCTGCATGAGAAAGTCGATGCT Luikart et al. (1999)

TAG Maudet et al. (2002)

OarFCB 48 F:GAGTTAGTACAAGGATGACAAGAGGCAC 17 Barker et al. (2001)

R: GACTCTAGAGGATCG/CAAAGAACCAG Maudet et al. (2002)Luikart eta/. (1999)

Five microsateBite primer pairs customlysynthesized at Operon Biotechnologies, GMbH,Germany and utilized in the study for amplificationof 47 buffalo genotypes~ using PCR are listed asfollows in Table-I. The microsatellite primersequences used for study are also available at ht:m.;LIwwwuser.gwdg.de/-uatz/FAQlbuffalo.html.

The amplication reactions were carried outusing a thermal cycler (Biometra Ltd., Eppendorf)PCR machine in reaction volume of 25,u1. Each 25,ul PCR reaction contained 60 to 90 ng templateDNA, 2.5 ,ul of Ix PCR buffer, 10 Pmole of eachprimer, 200,uM each of dNTPs; 1 unit of Taq DNApolymerase; 0.75 to 1.0,u1 of 1.5 mM MgClz.

The amplification profile consisted of aninitial period of DNA denaturation at 94°C for 5min, followed by 30 cycles at 94°C for 45 sec, 56°Cfor 45 sec, and 72°C for 45 sec.After 30 cycles, theextension temperature of 72°C was held for 10 min.

Initially prepared 100 ml of 40% acrylamidesolution containing 38 g acrylamide and 2 gbisacrylamide. Then a solution of urea: acrylamidewas prepared by mixing 75 ml of 40% acrylamidesolution, 50 ml of lOx TBE (1 M trizma, 89 mM boricacid, 20 mM Naz EDTA) and 210 g of urea, Whichwas made up to 500 ml with distilled water. Thesolution was filtered and kept in an amber colouredbottle, at 4°C as stock solution.

For assembling the gel sandwich, the notchedglass plate and outer glass plate of the sequi-GenGT nucleic acid sequencing cell (BioRadLaboratories) were cleaned thoroughly with milddetergent, rinsed several times with distilled water.The glass plate was wiped with tissue paper and theouter glass plate was treated with repel silane (350,u1)and the notched glass plate was treated with bindsilane, (10,u1 diluted to 1ml in ethanol) and allowedto dry. After placing spacers of 0.4 mm thickness,the gel sandwich was assembled.

The gel solution was prepared (6%polyacrylamide; 7 M urea) by mixing 70 ml of theurea: acrylamide solution in lOX TBE buffer with240,u1 of ammonium persulphate and 80 ,ul ofTEMED (Sigma). Then applied the gel solution tothe assembled gel sandwich, which was insertedpreviously in to cam-operated precision caster base,using sequencing gel electrophoresis apparatus (Bio­Rad Laboratories). For application of 6 % gelsolution, the gel sandwich was laid flat on lab benchand after application allowed the gel to polymerizefor 60 min.

The PCR amplified products were denaturedfor 5 min at 95°C in the thermalcycler and placedon ice before being applied to the gel in 5 ,ulcontaining an equal volume of stop solution (10 mMNaOH, 95 %formamide, 0.05 %bromophenol Blue,

200bp

150bp

200bp

150bp

91

Phot9plate 1- Photograph showing alleles at microsatellite locus

ILSTS005 in local buffaloes {50 bp DNA ladder}

300bp

250bp

200bp

, 300 bp

250bp

" 200bp

Photoplate 2- Photograph showing alleles at microsatellite locus

SRCRSP8 in local buffaloes {50 bp DNA ladder}

200bp

150bp

200bp

Photoplate 3- Photograph showing alleles at microsatellite locus

oarFCB48 in local buffaloes {50 bp DNA ladder}

0.05 % xylene cyanol). The running conditions were1890 V, 45 rnA, 90 W for 90 min, after a pre-run ofthe gels at 1680 V, 40 rnA, 80 W for 60 min. Theelectrophoresis running buffer (1 X TBE) contained10 mM trizma, 8.9 mM boric acid, 2 mM Na2 EDTA.

After electrophoresis, gels were silver stainedusing a optimized method. The improved stainingmethod we optimized is a modification of differentsteps proposed by Bassam et ai. (1991) andSanguinetti et a1., (1994), which are described below:

92 INDIAN JOURNAL OF ANIMAL RESEARCH

OPTIMISED SILVER STAINING METHOD: sigma, Formaldehyde and silver nitrate were ACS1. After electrophoresis gel was allowed to cool for reagent from sigma and Aldrich, respectively.

5 min. RESULTS AND DISCUSSION2. Then 2000 ml cold (10-12°C) fixing solution The optimized method was fast (20 min) thancontaining 10% ethanol, 0.5 % acetic acid was the original silver staining method, which requireprepared and gel was washed in it for 5 min long time (2 hours) for overall completion. It also3 Washed gel was soaked in a 2000 ml solution gives better staining of DNA fragments, in which allc~ntaining 3.0 gm AgNO . 2 ml 37 % HCOH- for the steps were carried out at room temperature. The6-8 min at room t~mperat~re (22-24 0 C), , polyacrylamide gels stained using this procedure

'. .. could be stored for long duration and the all the~. After ~oakmg gel m AgNO.3 solution, ~t ,was solutions except developer, used in the differentnnsed qUickly (10-15 sec) once With 2000 ml distilled staining steps were reused at least 4 to 5 times, withH20. a maximum of seven times for the silver nitrate5. For development, gels were soaked at room solution, without loss of sensitivity. The silver nitratetemperature (22-24 0C) in a 2000 ml developing solution and the developing solution containingsolution containing 25 g NaOH, 3 ml 37 % HCOH NAOH only, were stored at room temperature, whileuntil the bands appear with a sufficient intensity Le. fiXing solution was stored at 4°C.

near about 5 to 6 min, The optimized silver staining method allowed6. After achieving desired intensity, development was a drastic reduction of acetic acid concentration (fromstopped before impregnating the gelinstop solution. 10% to 0.5 %) necessary to render the7. Finally gel was impregnated in a 2000 ml of stop macromolecules insoluble in the gel and preventsolution containing 10% absolute ethanol and 0.5 them from diffusing out of the matrix during the% acetic acid for 1 to 2 min. subsequent staining steps. Also the presence of

. absolute ethanol at a rate of 10% in fiXing solution8. Care was taken to aVOid over development and 'ts I' . t· f I I th t' t rf ·th. . . permI e Imma Ion 0 mo ecu es a m e ere WIalso to prevent over Impregnation of gel m stop 'I t . . h d tu ts d t ts

, . Sl ver s ammg suc as urea, ena ran , e ergensolution, which cou!d result m an orange brown and electrophoresis buffer. The presence ofbackground of gel With low contrast bands and also f Id h d . th '1' t' I t'. orma eye m e Sl ver Impregna Ion so u Ionsepa~at!on of gel from bound glass plate or crackmg improved both sensitivity and intensity of the detectedofge. bands (Photoplate-1,2,3). Also washing the gels

All the steps were done in plastic containers. briefly following this step removes the excess of silverThe gel plate was agitated in a shaker throughout from their surface.the staining process. All the solutions were prepared Replacing sodium carbonate by sodiumusing ultra pure distilled water. The fixing solution, hydroxide permits to establish alkaline conditionsstop solution, the silver nitrate solution and developer (pH 13) for silver ion reduction to metallic silverwithout formaldehyde containing only sodium by formaldehyde. The development at roomhydroxide solution was prepared in advance. temperature (22-24°C) with a high formaldehydeImpregnation with silver nitrate was performed concentration in the development solutionunder room lighting. In developer, formaldehyde was apparently increased band intensity and so alsoadded just before actual use. For that, 3 ml of the sensitivity of the method and it decreased theformaldehyde was added systematically into the time for development. The reduction of silver bysodium hydrOXide solution just before actual start of formaldehyde is temperature dependent.gels development after impregnation with silver Increasing temperature enhances it; conversely,nitrate solution. Gels were dried at room temperature decreasing the temperature of the developmentand DNA bands were viewed directly with the aid solution below the 18-25 °C range (Blum et a/.,of a white light box and then scanned. 1987) increases developing time. Bands appeared

The absolute ethanol and sodium hydrOXide dark brown black on an uniformly pale yellowfrom Merck Eurolab was used. Acetic acid was from background. Over development resulted in an

Vol. 43, No.2, 2009 93

orange brown backgrounp with low contrastbands. As for the fiXing step, the addition ofabsolute ethanol permits to decrease theconcentration of acetic acid to 0.5 % in thesolution that stops the reduction of silver ions tometallic silver. Its short duration permits thestaining of a large number of gels per day.

ACKNOWLEDGEMENTThe authors are grateful to Dr. B.R.Yadav

(NDRI, Kamal) and Dr.D.K.Sadana (NBAGR,Karhal) for their-technical guidance and Dr.H.B.Patil, Dr. S.PMehtre, (MAU,Parbhani) and Mr.Ulhas Kadam (National Grape Research Station,Pune) for their skillful help.

REFEHENCESBarker, J.S.F. et al. (1997). Anim. Genet., 28:103-115.Barker, J.S.F. eta/. (2001). J. Anim. Breed. Genet., 118:213-233.Bassam, B.J. et a/. (1991). Anal. Biochem. 196: 80-83.Beidler,J.I et a/. (1982). Anal. Biochem. 126: 374-380.Blum, H. et al. (1987).Electrophoresis. 8:93-99.Brezinsky, L. eta/. (1993)', Anim. Genet., 24:73.Christensen,M. et a/.(1999).Scand.J.Clin.Lab.Invest. 59:167-178.Goldman,O.and Merril, C.R. (1982). Electrophoresis. 3:24-26.Halima, B. etal. (2006).Biotechnol. Agron. Soc.Environ. 10(2),77-81.U MH et a/.(2002). Genet.Sel.EvoI.34(6):729-744.Luikart, G. et a/. (1999). Aim. Genet., 30:431-438.Maudet C. et a/. (2002t. Mol. Ecol., 11:421-436.Merril, C.R. etal. (1981). Science. 211:1437-1438.Moioli, B. etal. (2001). Livestock Production Sci., 70:203-211.Ritz, L.R. et a/. (2000). Anim. Genet., 31(3):178cI85Sanguinetti, C.J. eta/. (1994). Biotechniques.17:915-919.Senthil, M. et al. (1996). Int. J. Anim. Sd, 11:413-414.Sommerville, L.L.and Wang, K. (1981). Biochem. Biophys. Res Commun. 120:530-548.