detection of genetically modified organisms

7/31/2019 Detection of Genetically Modified Organisms

1/12

Submitted to

Dr.P.K.Dhaka

By kamini singh

Ph.D Ag.Biotechnology

Id.No. 1962/11


2/12

INTRODUCTION

The need to monitor and verify the presence and the amount of GMOs in

agricultural crops and in products derived thereof has generated a demand for analytical

methods capable of detecting,Identifying and quantifying either the DNA introduced or

the protein(s) expressed in transgenic plants, because these components are

considered as the fundamental constituents.Several laboratories have developed

therefore, methods either based on DNA detection using the polymerase chain reaction

(PCR) technique, or on protein detection using enzyme linked Immunosorbent assays

(ELISA).

Genetically modified organisms (GMOs) entered the European food market in

1996. The first product to appear on UK supermarket shelves was a genetically

modified tomato puree. This product was clearly labelled and therefore anticipated theEuropean Commissions Novel Food Regulation (EC) No 258/97 (European

Commission, 1997) established in 1997, under which products containing GMOs must

be labelled if they differ substantially from their conventional counterpart, either by

composition, nutritional value or nutritional effects for the intended use of the food.

Since two other products - Round-up Ready soybeans and BT-176 maize - were

already authorised for marketing within Europe before the Novel Foods Regulation

came into force, a specific labeling regulation was established in 1998 (EC) No 1139/98

(European Commission, 1998). This regulation requires labelling if transgenic DNA or

newly expressed proteins can be found. For this purpose, qualitative methods for

detection of GMOs are required. It is likewise important to investigate whether the GMO

found is authorised or not; consequently, specific methods for identification of GMOs

are needed.

The detection of genetically modified organisms in food or feed is possible by

biochemical means. It can either be qualitative, showing which genetically modified

organism (GMO) is present, or quantitative, measuring in which amount a certain GMO

is present. Being able to detect a GMO is an important part of food safety, as without

detection methods the traceability of GMOs would rely solely on documentation.
http://en.wikipedia.org/wiki/Genetically_modified_organismhttp://en.wikipedia.org/wiki/Genetically_modified_organismhttp://en.wikipedia.org/wiki/Genetically_modified_organismhttp://en.wikipedia.org/wiki/Genetically_modified_organismhttp://en.wikipedia.org/wiki/Traceability_of_genetically_modified_organismshttp://en.wikipedia.org/wiki/Traceability_of_genetically_modified_organismshttp://en.wikipedia.org/wiki/Traceability_of_genetically_modified_organismshttp://en.wikipedia.org/wiki/Traceability_of_genetically_modified_organismshttp://en.wikipedia.org/wiki/Genetically_modified_organismhttp://en.wikipedia.org/wiki/Genetically_modified_organism


3/12

Technique for detection of genetically modified organisms

1) Polymerase chain reaction (PCR)

The polymerase chain reaction (PCR) is a biochemistry and molecular biology

technique for isolating and exponentially amplifying a fragment of DNA, via enzymatic

replication, without using a living organism. It enables the detection of specific strands

of DNA by making millions of copies of a target genetic sequence. The target sequence

is essentially photocopied at an exponential rate, and simple visualization techniques

can make the millions of copies easy to see.

The method works by pairing the targeted genetic sequence with custom designedcomplementary bits of DNA called primers . In the presence of the target sequence, the

primers match with it and trigger a chain reaction. DNA replication enzymes use the

primers as docking points and start doubling the target sequences. The process is

repeated over and over again by sequential heating and cooling until doubling and

redoubling has multiplied the target sequence several million-fold. The millions of

identical fragments are then purified in a slab of gel, dyed, and can be seen with UV

light.It is not prone to contamination.

a. Quantitative detection

Quantitative PCR (Q-PCR) is used to measure the quantity of a PCR product

(preferably real-time, QRT-PCR). It is the method of choice to quantitatively measure

amounts of transgene DNA in a food or feed sample. Q-PCR is commonly used to

determine whether a DNA sequence is present in a sample and the number of its copies

in the sample. The method with currently the highest level of accuracy is quantitativereal-time PCR. QRT-PCR methods use fluorescent dyes, such as Sybr Green, or

fluorophore-containing DNA probes, such as TaqMan , to measure the amount of

amplified product in real time. If the targeted genetic sequence is unique to a certain

GMO, a positive PCR test proves that the GMO is present in the sample.
http://en.wikipedia.org/wiki/Polymerase_chain_reactionhttp://en.wikipedia.org/wiki/Polymerase_chain_reactionhttp://en.wikipedia.org/wiki/Polymerase_chain_reactionhttp://en.wikipedia.org/wiki/DNAhttp://en.wikipedia.org/wiki/DNAhttp://en.wikipedia.org/wiki/DNAhttp://en.wikipedia.org/wiki/Primer_(molecular_biology)http://en.wikipedia.org/wiki/Primer_(molecular_biology)http://en.wikipedia.org/wiki/Primer_(molecular_biology)http://en.wikipedia.org/wiki/Transgenehttp://en.wikipedia.org/wiki/Transgenehttp://en.wikipedia.org/wiki/Transgenehttp://en.wikipedia.org/wiki/TaqManhttp://en.wikipedia.org/wiki/TaqManhttp://en.wikipedia.org/wiki/TaqManhttp://en.wikipedia.org/wiki/TaqManhttp://en.wikipedia.org/wiki/Transgenehttp://en.wikipedia.org/wiki/Primer_(molecular_biology)http://en.wikipedia.org/wiki/DNAhttp://en.wikipedia.org/wiki/Polymerase_chain_reaction


4/12

b. Qualitative detection

Whether or not a GMO is present in a sample can be tested by Q-PCR, but also

by multiplex PCR . Multiplex PCR uses multiple, unique primer sets within a single PCR

reaction to produce amplicons of varying sizes specific to different DNA sequences, i.e.

different transgenes. By targeting multiple genes at once, additional information may be

gained from a single test run that otherwise would require several times the reagents

and more time to perform. Annealing temperatures for each of the primer sets must be

optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base

pair length, should be different enough to form distinct bands when visualized by gel

electrophoresis .

2. Event-specific vs. construct-specific detection

When producers, importers or authorities test a sample for the unintended presence of

GMOs, they usually do not know, which GMO to expect. While EU authorities prefer an

event-specific approach to this problem, US authorities rely on construct-specific test

schemes.

a. Event-specific detection

An event-specific detection searches for the presence of a DNA sequence unique to a

certain GMO, usually the junction between the transgene and the organism's original

DNA. This approach is ideal to precisely identify a GMO, yet highly similar GMOs will

pass completely unnoticed. Event-specific detection is PCR-based.

b. Construct-specific detection

The construct-specific detection methods can either be DNA or protein based. DNA

based detection looks for a part of the foreign DNA inserted in a GMO. For technical

reasons, certain DNA sequences are shared by several GMOs. Protein-based methods

detect the product of the transgene, for example the Bt toxin . Since different GMOs may

produce the same protein, construct-specific detection can test a sample for several

GMOs in one step, but is unable to tell precisely, which of the similar GMOs are

present. Especially in the USA, protein-based detection is used for the construct-

specific approach.
http://en.wikipedia.org/wiki/Multiplex_PCRhttp://en.wikipedia.org/wiki/Multiplex_PCRhttp://en.wikipedia.org/wiki/Multiplex_PCRhttp://en.wikipedia.org/wiki/Ampliconhttp://en.wikipedia.org/wiki/Ampliconhttp://en.wikipedia.org/wiki/Ampliconhttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Proteinhttp://en.wikipedia.org/wiki/Proteinhttp://en.wikipedia.org/wiki/Proteinhttp://en.wikipedia.org/wiki/Bt_toxinhttp://en.wikipedia.org/wiki/Bt_toxinhttp://en.wikipedia.org/wiki/Bt_toxinhttp://en.wikipedia.org/wiki/Bt_toxinhttp://en.wikipedia.org/wiki/Proteinhttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Gel_electrophoresishttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Base_pairhttp://en.wikipedia.org/wiki/Ampliconhttp://en.wikipedia.org/wiki/Multiplex_PCR


5/12

3. Shortcomings of current detection methods

Currently, it is highly unlikely that the presence of unexpected or even unknown GMOs

will be detected, since either the DNA sequence of the transgene or its product, the

protein, must be known for detection. In addition, even testing for known GMOs is time-consuming and costly, as current reliable detection methods can test for only one GMO

at a time. Therefore, research programmes such as Co-Extra are developing improved

and alternative testing methods, for example DNA microarrays .

4 . Alternative detection methods

a. Improving PCR based detection

Improving PCR based detection of GMOs is a further goal of the European research

programme Co-Extra. Research is now underway to develop multiplex PCR methods

that can simultaneously detect many different transgenic lines. Another major challenge

is the increasing prevalence of transgenic crops with stacked traits . This refers to

transgenic cultivars derived from crosses between transgenic parent lines, combining

the transgenic traits of both parents. One GM maize variety now awaiting a decision by

the European Commission, MON863 x MON810 x NK603 , has three stacked traits. It is

resistant to an herbicide and to two different kinds of insect pests. Some combined

testing methods could give results that would triple the actual GM content of a sample

containing this GMO.

b. Detecting unknown GMOs

Almost all transgenic plants contain a few common building blocks that make unknown

GMOs easier to find. Even though detecting a novel gene in a GMO can be like finding

a needle in a haystack, the fact that the needles are usually similar makes it much

easier. To trigger gene expression, scientists couple the gene they want to add with

what is known as a transcription promoter . The high-performing 35S promoter is a

common feature to many GMOs. In addition, the stop signal for gene transcription in

most GMOs is often the same: the NOS terminator . Researchers now compile a set of

genetic sequences characteristic of GMOs. After genetic elements characteristic of
http://en.wikipedia.org/wiki/Co-Extrahttp://en.wikipedia.org/wiki/Co-Extrahttp://en.wikipedia.org/wiki/Co-Extrahttp://en.wikipedia.org/wiki/DNA_microarrayhttp://en.wikipedia.org/wiki/DNA_microarrayhttp://en.wikipedia.org/wiki/DNA_microarrayhttp://en.wikipedia.org/wiki/Gene_stacked_eventhttp://en.wikipedia.org/wiki/Gene_stacked_eventhttp://en.wikipedia.org/wiki/Gene_stacked_eventhttp://en.wikipedia.org/wiki/MON863http://en.wikipedia.org/wiki/MON863http://en.wikipedia.org/wiki/MON863http://en.wikipedia.org/wiki/MON810http://en.wikipedia.org/wiki/MON810http://en.wikipedia.org/wiki/MON810http://en.wikipedia.org/w/index.php?title=NK603&action=edit&redlink=1http://en.wikipedia.org/w/index.php?title=NK603&action=edit&redlink=1http://en.wikipedia.org/w/index.php?title=NK603&action=edit&redlink=1http://en.wikipedia.org/wiki/Promoter_(biology)http://en.wikipedia.org/wiki/Promoter_(biology)http://en.wikipedia.org/wiki/Promoter_(biology)http://en.wikipedia.org/wiki/Terminator_(genetics)http://en.wikipedia.org/wiki/Terminator_(genetics)http://en.wikipedia.org/wiki/Terminator_(genetics)http://en.wikipedia.org/wiki/Terminator_(genetics)http://en.wikipedia.org/wiki/Promoter_(biology)http://en.wikipedia.org/w/index.php?title=NK603&action=edit&redlink=1http://en.wikipedia.org/wiki/MON810http://en.wikipedia.org/wiki/MON863http://en.wikipedia.org/wiki/Gene_stacked_eventhttp://en.wikipedia.org/wiki/DNA_microarrayhttp://en.wikipedia.org/wiki/Co-Extra


6/12

GMOs are selected, methods and tools are developed for detecting them in test

samples. Approaches being considered include microarrays and anchor PCR profiling.

c. Near infrared fluorescence (NIR)

Near infrared fluorescence (NIR) detection is a method that can reveal what kinds of chemicals are present in a sample based on their physical properties. By hitting a

sample with near infrared light , chemical bonds in the sample vibrate and re-release the

light energy at a wavelength characteristic for a specific molecule or chemical bond. It is

not yet known if the differences between GMOs and conventional plants are large

enough to detect with NIR imaging. Although the technique would require advanced

machinery and data processing tools, a non-chemical approach could have some

advantages such as lower costs and enhanced speed and mobility.

5.) A microarray-based detection system for genetically Modified (GM) food

ingredients

Microarrays, also known as DNA chips , allow the analysis of multiple sequence targets

in one single assay. Being a highly adaptable tool, it can evolve together with the

increasing number of GMOs emerging in the food and feed markets. The main

advantages of DNA microarray technology are miniaturization, high sensitivity and

screening throughput.DNA microarray approaches have been developed to be used in

combination with multiplex PCRs: a multiplex DNA array-based PCR allowing

quantification of transgenic maize in food and feed (Rudi et al.,2003); a ligation

detection reaction coupled with an universal array technology allows the detection of the

Bt176 transgenic maize (Bordoni et al.,2004) or five transgenic events (Bordoni et

al.,2005); and recently, a peptide nucleic acid array approach was developed for the

detection of five transgenic events and two plant species (Germini et al., 2005). These

methods used fluorescent probes, which require costly material and are photosensitive,thus limiting the common use of microarrays for GM detection.
http://en.wikipedia.org/wiki/Fluorescencehttp://en.wikipedia.org/wiki/Fluorescencehttp://en.wikipedia.org/wiki/Fluorescencehttp://en.wikipedia.org/wiki/Infrared_lighthttp://en.wikipedia.org/wiki/Infrared_lighthttp://en.wikipedia.org/wiki/Infrared_lighthttp://en.wikipedia.org/wiki/Chemical_bondhttp://en.wikipedia.org/wiki/Chemical_bondhttp://en.wikipedia.org/wiki/Chemical_bondhttp://en.wikipedia.org/wiki/Wavelengthhttp://en.wikipedia.org/wiki/Wavelengthhttp://en.wikipedia.org/wiki/Wavelengthhttp://en.wikipedia.org/wiki/Wavelengthhttp://en.wikipedia.org/wiki/Chemical_bondhttp://en.wikipedia.org/wiki/Infrared_lighthttp://en.wikipedia.org/wiki/Fluorescence


7/12

A control test was also developed to allow the detection of possible false positive results

such as those arising from the presence of P-35S elements from a possible plant

infection with CaMV. A CaMV-specific assay already described was used as a

contamination control (Ferna ndez et al., 2005). Selectivity of the assay was confirmed

by the analysis of 100 ng of genomic DNA extracted from rapeseed leaves infected by

CaMV. A 20 lL of PCR were loaded on the biochips .Two capture probes (CaMV(a) and

CaMV(b)) were initially tested.CaMV(b) capture probe giving the most intensive signal

was kept on the final design of the microarray.

CaMV using the GMOchip. The DNA of CaMV infected-rapeseed leaves was extracted

(0.1 lg) and amplified by PCR and 20 lL of the amplicon solution were hybridized to the

GMOchip. Two capture probes (CaMV(a) and CaMV(b)) were initially tested. CaMV(b)

capture probe giving the most intensive signal was kept on the final design of the

microarray

6.) Electrochemiluminescence method -

Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of

species generated electrochemically on an electrode surface. It is a highly efficient andaccurate detection method. Electrochemiluminescence (ECL), where light-emitting

species are produced by reactions between electrogenerated intermediates, has

become an important and powerful analytical tool in recent years. An ECL reaction

using tri- propylamine (TPA) and tris (2,2 -bipyridyl) ruthenium (II) (TBR) has been

demonstrated to be a highly sensitive detection method for quantifying amplified DNA .


8/12

TPA and TBR are oxidized at approximately the same voltage on the anode

surface. After deprotonation, TPA chemically reacts with TBR and results in an electron

transfer. The resulted TBR molecule relaxes to its ground state by emitting a photon.

TPA decomposes to dipropyl amine and is therefore consumed in this reaction. TBR, on

the other hand, is recycled. Since both reactants are produced at the anode,

luminescence occurs there. Compared with other detection techniques, the ECL has

some advantages: no radioisotopes are used; detection limits are extremely low; the

dynamic range for quantification extends over six orders of magnitude; the labels are

extremely stable compared with those of most other chemiluminescence (CL) systems;

and the measurement is simple and rapid, requiring only a few seconds .

PCR amplifications for capsicums, tomatoes and Arabidopsis thalianas were

performed according to the IUPAC method that had been used for GMOsdetection. Almost all GM capsicums, tomatoes and Arabidopsis thalianas contain the cauliflower

mosaic virus promoter (P-CaMV35S) and nopaline synthase terminator (T-NOS) .

We designed two pairs of primers to amplify a 195 bp fragment in the P-

CaMV35S and a 180 bp fragment in the T-NOS. So, the fragments would be amplified

from GMOs instead of non-GMOs through PCR. After the PCR amplifications, the

products would hybridize with a pair of Oligonucleotide probes. They are designed to

hybridize with the 35S or NOS-PCR products. Non-specific amplified products could not

hybridize with the probes. One of the probes was labeled by biotin, but another was

labeled by TBR. The biotin-labeled DNA was linked on to the surface of streptavidin-

coupled beads through the highly selective biotin streptavidin linkage. The unlinked

DNA fragments were washed away. The TBR-labeled probe would emit light on the

anode surface. The light would be recorded as an ECL signal, which reflects the

quantity of the hybridized PCR products. Finally, we co uld confirm whether GM

components existed.


9/12

7.) GMO detection using a bioluminescent real time reporter (BART) of loopmediated isothermal amplification (LAMP)

Several nucleic acid amplification techniques (NAATs) are available for the detection of GM

contamination in plants and food of which the polymerase chain reaction (PCR) is by

far the most widely used. However PCR requires rapid thermo-cycling to denature the target

DNA strands, prior to and during amplification , which imposes specific equipment

requirements. Since the discovery of DNA polymerases with strand displacement activity,

novel amplification methods have been developed which operate under isothermal conditions

(iNAAT) and propagate the initial target sequence by promoting strand displacement using

enzymes or modified oligonucleotides.

Loop-mediated isothermal amplification (LAMP) is a sensitive, rapid and

specific nucleic acid amplification technology. It is characterized by the use of 4 different

primers,specifically designed to recognize 6 distinct regions on the target DNA template,

and proceeds at a constant temperature driven by invasion and strand displacement .

Amplification and detection of target genes can be completed in a single step at a

constant temperature, by incubating DNA template, primers and a strand displacement

DNA polymerase. It provides high amplification efficiency, with replication of the original

template copy 10 9-10 10 times during a 15 60 min reaction .The primer pairs used in

LAMP are given specific designations; LAMP primers that generate hairpin loops, theouter displacement primers, and LOOP primers that accelerate the reaction by

amplifying from the hairpin previously created by the LAMP primers.

A recently described bioluminescence real time assay [BART] allows the quantitative

analysis of iNAATs, in real time. The biochemistry of BART is based on the Enzymatic

Luminometric Inorganic pyrophosphate Detection Assay, or ELIDA .

Unlike previous applications of the ELIDA assay (most notably Pyro-sequencing TM),

BART allows dynamic changes in pyrophosphate levels to be monitored continuously in

real-time over extended periods at 60C for up to 2 hours. During a BART reaction, the

level of light output increases to a peak whose timing under the same assay conditions

reflects the initial concentration of the targeted DNA. Hence quantification of BART

reactions utilizes the time to peak light output and is not dependent on absolute light


10/12

intensity produced, which greatly simplifies data interpretation and the hardware

requirements, as well as making assays robust to turbidity and suspended solids .

Here we demonstrate the use of LAMP-BART to detect GM events at low copy number

levels in samples derived from maize, which has a large genome size and hence a relatively high

proportion of non-target DNA. We show that LAMP-BART tolerates crude plant extracts

without significant inhibition and examine the characteristics of the sample matrix that impact

upon the quantitative nature of this technique and demonstrate its suitability in fieldable systems.

BART analysis

All LAMP-BART coupled amplifications were performed on dedicated instruments that

simultaneously control temperature and quantify bioluminescence during a given assay.

Two variations of the hardware were used; a static thermally controlled machine,

equipped with a charged coupled device camera (http://www.lumora.co.uk), that has no

theoretical limit of sample numbers or configurations; and a portable device (19;

photodiode quantification PDQ; http://www.lumora.co.uk), that quantifies light using

photo-diodes, which is presently limited to the analysis of 16 samples. All LAMP-BART

reactions were performed in suitable nuclease free plastic tubes under molecular grade

mineral oil, at 60C for 90 min.

RT-PCR analysis

Each 25 l PCR reaction was performed using the JumpStart SYBR Green ready mix

(Sigma) supplemented with 5 pmol of respective primers (a dedicated pair for each

target; Reaction mixtures were denatured for 2 min at 94C (to disassociate the

polymerase from its protective antibody). Each cycle was: 94C for 30 s, 50C for 30 s,

72C for 30s, for 40 cycles. Amplification and analysis was performed using an ABI

Prism 7000 sequence detection system (Applied Biosystems). Results were processed

using Applied Biosystems SDS 2.312 software.

Primer design and synthesis

Previously published LAMP primers were used to target the cauliflower mosaic virus 35

S promoter (CaMV 35 S-p; GenBank: X79465), and the Agrobacterium tumefaciens

nopaline synthetase gene terminator (NOS-t; GenBank: V00087; 41), while the LAMP


11/12

primers used to target Zea mays alcohol dehydrogenase reference gene

(ADH1;GenBank: NM_001111939) were designed according to

http://loopamp.eiken.co.jp/e/lamp/primer.html.

.

Details of the primers used in the LAMP-BART and RT-PCR amplifications

Primer Type Orientation Target (5 base) Primer Sequence (5 -3 )

Displacement sense ADH1 (7) CTTTGGATCGATTGGTTTC

Displacement antisense ADH1 (287) CCCAAAATTACTCAACG

LAMP sense ADH1 (116) GTGATCAAGTGCAAAGGTCTTTTCATAAACCAAG

LOOP sense ADH1 (68) CGCCTTGTTTCTCCTCTGTC

LOOP antisense ADH1 (136) CCAAATCATCCACTCCGAGAC

Displacement sense CaMV-35 S-p (7214) AGGAAGGGTCTTGCG

LAMP antisense NOS-t (1947) CATGCTTAACGTAAT

TCAACAGTTTTTGAATCCTGTTGCCGGTC

PCR sense ADH1 (1297) AATTTTGGGGAAAGCTTCGT

PCR antisense ADH1 (1369) TTCACCACGATTGCAGGATA

PCR sense CaMV-35 S-p (7133) GATTCCATTGCCCAGCTATC

PCR antisense CaMV-35 S-p (7215) CAACGATGGCCTTTCCTTTA

Underscored bases of the LAMP primers are additional foreign nucleotides, introduced to link

different homology segments (CAMV-35 S-pLAMP primers contain four linker bases, while the other LAMP primers only contain 3 linker

bases)


12/12

References

Guy Kiddle, Patrick Hardinge,Neil Buttigieg,Olga Gandelman,Clint Pereira GMO detection using a bioluminescent real time reporter (BART) of loopmediated isothermal amplification (LAMP) suitable for field use BMC

Biotechnology 2012, 12:15.

Serge Leimanis1, Malcolm Burns4, Shirin Bruderer5, Thomas Glouden1, NeilHarris4, Othmar Kaeppeli5,Patrick Philipp6, Maria Pla2, Pere Puigdome`nech2,Marc Vaitilingom7, Yves Bertheau3and Jose Remacle A microarray-baseddetection system for genetically modified (GM) food ingredients PlantMolecular Biology (2006) 61:123 139 _ Springer 2006 DOI 10.1007/s11103-005-6173-4

Jinfeng Liu, Da Xing , Xingyan Shen, Debin Zhu, Electrochemiluminescencepolymerase chain reaction detection of genetically modified organisms Analytica Chimica Acta 537 (2005) 119 123

Nelson Marmiroli & Elena Maestri & Mariolina Gull & Alessio Malcevschi &Clelia Peano & Roberta Bordoni & Gianluca De Bellis, Methods for detection of

GMOs in food and feed

Anal Bioanal Chem (2008) 392:369 384 DOI10.1007/s00216-008-2303-6.

Arne Holst-Jensen Sissel B. Rnning Astrid Lvseth Knut G. Berdal PCRtechnology for screening and quantification of genetically modified organisms(GMOs) Anal Bioanal Chem (2003) 375 : 985 993 DOI 10.1007/s00216-003-1767-7

detection of genetically modified organisms

Documents