Burnaby NewsLeader, July 23, 2014

Download Burnaby NewsLeader, July 23, 2014

Post on 01-Apr-2016

219 views

Category:

Documents

3 download

DESCRIPTION

July 23, 2014 edition of the Burnaby NewsLeader

TRANSCRIPT

  • page3 page6 page9PIPELINE COMPANY SEEKS HAMMER B.C. BACK IN BLACK, DEEP IN DEBT LOCAL TEEN LAST SEEN A MONTH AGO

    www.burnabynewsleader.com

    WEDNESDAY JULY 23 2014

    SkyTrain chaos strikes again

    For the second time in less than a week, a technical issue caused a major disruption with the SkyTrain system after service on two lines was shut down on Monday.

    All SkyTrain cars on Metro Vancouvers Expo and Millennium lines were halted.

    The Canada Line was not affected and was operating extra trains to help offset the problems on the other two lines, said the regional transportation authority. Bus bridges between stations were also added.

    TransLink advised commuters to make other transportation arrangements while they dealt with the technical issue.

    Last week, on Thursday night, SkyTrain service between Burnaby and Surrey was disrupted for several hours, affecting service for thousands of passengers.

    TransLink offered an apology Friday morning for the delay.

    We apologize to our customers for this unusual incident, which caused parts of our SkyTrain system to be out of service for such a lengthy period of time, said Fred Cummings, president of TransLinks B.C. Rapid Transit Co. subsidiary.

    Huge boost to Burnaby economyWanda Chowwchow@burnabynewsleader.com

    In many ways, the health of the local film industry was mirrored by the recent health scare of Ron Hrynuik.

    Hrynuik, the general manager of Bridge Studios in Burnaby, was skiing at Blackcomb in February 2012 when he collapsed from a heart attack.

    Luckily for him, the man skiing

    right behind him happened to be a doctor visiting from Seattle. The doctor performed CPR until an automated external defibrillator (AED) arrived to jump-start his heart.

    Hrynuik, 54, ended up having quadruple bypass surgery and was off work for a lengthy period of recovery.

    That coincided with a downturn in the local film business when productions were slow to arrive at Bridge Studios.

    They didnt miss me, the North Burnaby resident said with a laugh.

    It was a far cry from 2007 and 2008 when productions were lined up for studio time one after the other. That was followed by a drop in business in 2010 when the Canadian dollar started going up, a jump in bookings in 2011 and then a really bad year in 2012.

    Nobody saw it coming, recalled Hrynuik, who also serves on the board of the Motion Picture Production Industry Association of

    B.C. (MPPIA)Other jurisdictions, including

    South Carolina and Louisiana, started offering higher tax credits for film shoots that located there. Ontario began offering a 25 per cent tax credit on all film shoot spending.

    British Columbia, meanwhile, has maintained a 33 per cent tax credit on labour costs of local shoots, which generally make up about half of a productions location shoot budget.

    Local film industry back on upswing

    WANDA CHOW/NEWSLEADERRon Hrynuik, general manager of Bridge Studios in Burnaby, says the film industry is now back on the upswing after increased competition and a strong Canadian dollar slowed the number of productions coming to B.C. in recent years.

    He was once B.C.s youngest-ever elected

    official, and now he hopes to become an MP

    in Burnaby.See Page A5

    Please see PRODUCTIONS, A3

    Looking for a Notary? Were here to help.

    Your MARKET CROSSING NotaryLooking for a Notary? Were here to help.

    Notary

    604-558-0678 | sadhranotary.com | info@sadhranotary.com#210-7270 Market Crossing, South Burnaby (ABOVE LONDON DRUGS)

    MEMBER

    Sadhra & AssociatesNotaries Public Corporation

    Promotivate LP2300 Yonge Street, Suite 2800Toronto, Ontario M4P 1E4 T 416-929-2946 | Toll Free: 1-800-387-5527

    Colour InformationPrinting Inks: 4 Colours Sign Offs

    Docket #: 14-393 Trim Size: 4.25" x 1.35" Cyan N/A Creative (Designer/AD/CD)

    Description: Newspaper ad Burnaby Leader Live Area: XXX" x XXX" Magenta N/A

    Client: Nandos Bleed Size: N/A Yellow N/A Account Executive

    File Name: 14-393_Kingsway_Burnaby_Leader_News_ad_4i25x1i35_01 Folded Size: N/A Black N/A

    Contact: Lauren Aubrey Scale: 1"= 1" | 100% Dieline/Foldmarks Inks DO NOT PRINT Studio/Traffi c/Production ManagerModifi ed Date: June 30, 2014 4:23 PM Trim Size (Build): XXX" x XXX" Foldmarks N/A

    Due Date: June 30, 2014 Live Area (Build): XXX" x XXX" Dieline N/A MG

    Studio Designer: dijon, clam Bleed Size (Build): XXX" x XXX" Perf Line N/A

    NOTES: THIS IS NOT A COLOUR PROOF. Refer to pantone chips and process match books for accurate colour samples. No trapping has been done to this fi le. Our artists have done everything possible to make this fi le mechanically perfect. However, before signing approval please check all copy, dimensions and colour space.

    Two can dine for $18.99*

    *Offer includes two chicken breast meals, or two double leg meals, or one of each. Each meal comes with one regular side. Offer cannot be combined with any other offers and has no cash value.

    Valid only at Nandos Kingsway until August 31st, 2014.

  • A2 NewsLeader Wednesday, July 23, 2014

    Why Beltone?In-Home Appointments

    3776 Hastings St, Burnaby | 604-569-1162(1 block east of Boundary Rd on south side of Hastings)

    www.beltoneonhastings.com

    Call today to book yourFREE HEARING SCREENING

    604-569-1162

    ON HASTINGS

    Helping the WorldHear Better Since 1940

    604-569-162

    23% offup to

    Not valid on previous purchases. Expires April/01/2013

    We have the lowest price, guaranteed... on digital aids.premium

    Is Your Child Safe when

    Grandpa Can't Hear?Finally! Your long-

    awaited romantic

    weekend getaway

    with your spouse is

    near. Reservations

    confirmed? Check.

    Dancing shoes

    packed? Check.

    Babysitter lined

    up? Check.

    Grandma and Grandpa, who better?

    Better recheck that babysitter before you head

    out the door. Before you hire a stranger, you are going

    to investigate them pretty carefully, aren't you? But

    your folks usually get a pass, even if they don't hear so

    well. After all, they love your kids and whose hearing

    isn't going downhill?

    The current statistics from the Better Hearing

    Institute are that one in six baby boomers have hearing

    loss and 3 in 10 of people over 65 have hearing loss;

    seniors in their 80's have greater than a 50% incidence

    of hearing loss. However, keep in mind that these

    statistics don't tell the whole story. Almost everyone

    knows at least one person who has a hearing loss that

    is affecting communications but resolutely refuses to

    acknowledge or do anything about it.

    If your child's babysitter is one of the 24

    million people who need hearing aids and don't have

    them, there could be serious problems. Effective

    caregivers need to be environmentally vigilant to

    assure the safety of your child; the ability to hear is a

    key component in assuring the safety of your child.

    The risks of not hearing a smoke or carbon monoxide

    detector, an intruder, or a child crying in the backyard

    could be fatal or result in an injury. Spending too much

    time speech reading while driving can cause a crash, as

    can failing to hear a siren. Older children have been

    known to take advantage of an adult's hearing loss to

    get permission to do something the adult wouldn't

    agree to if they understood what the child said.

    Before heading out for that weekend, consider this:

    General Child Care

    A 66-year-old man was aggravated that his wife

    dragged him in to a hearing evaluation, and decided

    that he did not need the amplification the audiologist

    recommended. (His wife just didn't talk right.) 18

    months later he was back. While watching his three-

    year-old grandson, the child had opened the screen

    door of the living room while his grandfather was there

    and wandered down the street. A neighbour found and

    returned him, and the family forced him to get his

    hearing checked and get amplification if he was ever

    again to sit with his beloved grandson. After

    reluctantly getting his hearing aids, he returned two

    days later, laughing and shaking his head. What a fool

    I have been. This is not bad at all.

    If you or a loved one has difficulty hearing, please

    call Beltone for a complimentary hearing evaluation.

    Our practitioners have many years of experience

    helping people hear better. We can even arrange to do

    the evaluation and the hearing aid fitting in the

    comfort and convenience of your home.

    In-Home appointments available!

    3776 Hastings Street, Burnaby, BC(1 block east of Boundary Road on south side of Hastings)

    You can arrange to have your hearing tested

    & your hearing aids demonstrated & dispensed

    in the comfort and convenience of your home.on Hastings

    A division of GG Hearing Alternative Inc.

    Call 604-569-1162 for an appointment.

    Savings off MSRP. Cannot be combined with other offers.Not valid on previous purchases. Expires June 15, 2013

    BelCare Promise The Most Comprehensive HearingHealthcare Plan in the IndustryBelCare is our commitment to provide outstanding patient service. The BelCare plan covers every step of the hearing aid purchase process, guaranteeing the highest level of patient satisfaction.

    Have your hearing tested and your Beltone hearing aids demonstrated and dispensed in the comfort and convenience of your home. Call for an appointment!

    Hearing AidsAS LOW AS

    $109 Per MonthASK FOR DETAILS

  • Wednesday, July 23, 2014 NewsLeader A3Wednesday, July 23, 2014 NewsLeader A3

    Infocus OpInIOn page 6 | Letters page 7 | spOrts page 11

    That meant it was equivalent to 16.5 per cent of overall spending.

    Concern about the slowdown led last year to calls for the provincial government to match Ontarios tax credits and a campaign dubbed Save B.C. Film.

    Burnaby is home to 62 per cent of purpose-built film studio space in the Lower Mainland, which itself has 88 per cent of all such space in the province.

    According to a 2013 city staff report, the industry injected at least $408 million in direct and

    spinoff spending into the Burnaby economy in 2012. It directly employed at least 2,425 Burnaby residents as cast and crew, with combined earnings of more than $32.9 million.

    Hrynuik stressed Burnaby city hall has been hugely supportive of the industry, knowing what a difference it makes to the economy.

    the B.C. AdvAntAge

    Despite a highly publicized campaign for increased tax credits, the provincial government stayed put. But Hrynuik said in the end, the local

    film industry is recovering based on what it has to offer Hollywood.

    Film producers may have tried other locations and their incentives, but appear to be coming back, he said.

    In addition to a favourable exchange rate, B.C. is closer to Los Angeles and in the same time zone, compared to Ontario, and the facilities and experienced local crews have a sterling reputation.

    You can film every day of the year here. In Toronto, youre not going outside in January.

    But in general, the industry is something of a

    revolving door, Hrynuik said.

    While business is brisk right now there are spaces available for bookings.

    At Bridge Studios, last week four smaller productions started and one big production finished.

    Two TV shows will be returningOnce Upon a Time for its fourth season and Motive, a Canadian co-production will be back for a third season.

    Those shows take up 70 per cent of the site at Bridge.

    Similarly, Paul Clausen, vice president of Mammoth

    Studios in Burnaby, said by email that it is currently on a break between productions there.

    Night at the Museum 3, a production which has been occupying the facility since September of last year and has just wrapped a few weeks ago. Prior to that we had Man of Steel shooting in there, Clausen said.

    There are few sound stage facilities in the world that are large enough to accommodate the size of production like Night at the Museum, Man of Steel, or Planet of the Apes; we are proud to say that

    Mammoth is one of them.Clausen said Mammoth

    is uncertain what will be scheduled next but noted 20th Century Fox Features holds a long term lease on the facility which indicates their level of commitment to the province.

    Hrynuik said the MPPIA is no longer calling for increased tax credits but is now seeking a full-time presence in Los Angeles to market B.C. to filmmakers.

    We need to be proactive, we need to keep our eyes on [competition from] the rest of the world.

    twitter.com/WandaChow

    Kinder Morgan will ask NEB for order if necessaryJeff nagelBlack press

    Kinder Morgan Canada will ask the National Energy Board to force a resistant City of Burnaby to give it access to study a possible tunnel through Burnaby Mountain for its proposed Trans Mountain oil pipeline.

    President Ian Anderson said the company will also seek formal permission from Burnaby but hopes to secure an order from the NEB within weeks if the city doesnt relent.

    Burnaby Mayor Derek Corrigan has indicated his city wont cooperate with Kinder Morgan unless its forced to do so. The city would have the ability to appeal any NEB order, potentially causing further delay.

    My hope is that we can get the permission of the city, Anderson said in a media conference call Friday, adding he hopes to repair what has become a toxic

    relationship with Burnaby as quickly as possible.

    The company wants to conduct test drilling into the mountain as part of environmental and geotechnical work to assess whether either a bored tunnel or directionally drilled route is possible there that would avoid the need to run the twinned pipeline near homes to the west of the mountain to reach the Westridge Marine Terminal.

    Anderson said he prefers a bored tunnel because that could let Kinder Morgan to deactivate the existing section of pipeline approaching the tanker terminal and relocate it through the mountain as well.

    He said he wishes the revised route had been pursued sooner, but called the idea of drilling through Burnaby Mountain an engineering revelation that came to project planners as they gained more understanding of the sensitivities along the original route.

    A tunnel would drive up the projects costs, but Anderson

    could not say by how much.The proposed route change

    unveiled this spring prompted the NEB to this month push back a final recommendation on project approval by seven months to allow more time for study.

    That will take it to Jan. 25, 2016 past the next federal election but Anderson said he did not expect the delay to

    threaten the project.I dont consider the election

    cycle to be a determinant of the national interest on a project such as ours, he said, adding the proposed $5.4-billion pipeline would be buffeted by politics regardless.

    The company has been under fire from intervenors including the provincial government and

    Lower Mainland regional districts for failing to adequately answer numerous questions they have posed.

    The province said it couldnt assess the projects risks without access to its emergency response plan, which Kinder Morgan had refused to publicly divulge as part of the NEB process over security concerns.

    Anderson said the company will publicly table by Aug. 1 a sanitized version of the emergency plan thats stripped of private and confidential information as well elements that could undermine security.

    But its unclear if that will satisfy the intervenors, because Anderson said Burnaby and the province may already have a copy of the non-confidential plan.

    He said it will ultimately be up to the NEB to decide whether or not Kinder Morgan has been right in declining to answer some intervenor questions as irrelevant to the project.

    with files from Wanda Chow

    Pipeline firm to seek hammer over Burnaby

    BLACk pressKinder Morgan Canada president Ian Anderson calls the idea of drilling in Burnaby Mountain an engineering revelation and wishes theyd thought of it sooner.

    Productions returning due to B.C.s many benefits from frOnt pAge

    and were there when you need us with over 67 years of award-winning collision repairs

    ALL MAKES & MODELS Courtesy Cars Lifetime Guarantee

    FREE Mobile Estimates(WITHIN 30 KM)

    FREE Mini Detail with Every Job

    and were there when you need us with over and were there when you need us with over and were there when you need us with over

    ...by Accident We Meet

    6919 Merritt Ave., Burnaby604-434-7221 www.donndeancollision.com

    DONN DEANMETROTOWNCollision Repairs Ltd.

    1PLACE2013

    New place, familiar faceNew place, familiar face

    NEW LOCATION!#2055066 Kingsway, Burnaby, BC V5H 2E7

    604-434-2070

    Stuart Lloyd Owner & Hearing

    Instrument Practitioner

    Over 43 years of serving the Burnaby community! Same dedicated team, brand new location. Formerly Sears Hearing Clinic, Lloyd Hearing Solutions will continue to provide the same friendly and professional service you know and trust!

    Our Services Locally owned and operated Top notch, professional service High quality products Competitive pricing to

    suit your budget Free underground parking

    at rear of building Voted Best of Burnaby Hearing

    Centre for 15 years in a row!

    (formerly Sears Hearing Clinic)

    We look forward to seeing you soon!Call today for a free hearing assessment!

    GRAND OPENING JULY 8, 2013

    5066 Kingsway, Burnaby

    YOUR HEARING ISA PRICELESS GIFTDONT TAKE IT FOR GRANTED.

    At Lloyd Hearing Solutions we offersolutions to t your communication

    needs, lifestyle and budget

    www.lloydhearingsolutions.ca

    604-434-2070

    Stuart LloydOwner & Hearing Instrument PractitionerCall today

    for a FREE Hearing

    ScreeningNEW MANAGEMENT! NEWLY RENOVATED SPACE!

    MARINE PUB5820 SE Marine Dr

    604 435-2245www.marinepub.ca

    1PLACE2013

    WEDNESDAYWINGS 35

    with the purchase of a drink

    EVERY SATURDAYLIVE BAND

    NO COVER!

    60 & 100 HD TVs

    DAILY$3.95

    DRINK SPECIAL

    DAILY$8.95

    LUNCH SPECIAL

    LIVE BAN

    D

    LAST SA

    TURDAY

    EVERY M

    ONTH

  • A4 NewsLeader Wednesday, July 23, 2014

    Marine Way

    Byrne

    Rd.

    Bill Fox Way

    Marine Dr.Southbridge Dr.

    riverwayevents@burnaby.ca

    A first class venue for all of your event needs.

    BirthdaysRetirementsCelebrationsAnniversaries Meetings

    For all inquiries please contact our event coordinator

    at Riverway Clubhouse

    9001 Bill Fox Way604 297 4883

    1PLACE 2013

    1PLACE 2013

  • Wednesday, July 23, 2014 NewsLeader A5Wednesday, July 23, 2014 NewsLeader A5

    Was BCs youngest-ever elected official at age 18Wanda Chowwchow@burnabynewsleader.com

    At age 18, Terry Beech was B.C.s youngest-ever elected official when he became a city councillor in Nanaimo in 1999.

    Now 15 years later, hes hoping to get back into public service after winning the nomination Wednesday as the federal Liberal candidate for the new riding of Burnaby North-Seymour.

    Beech, now 33, said he was always interested in politics and how the country is run, perhaps unusually so for a teenager. I paid for cable when I was a teen so I could watch CPAC and pay attention to question period.

    He was coaching his high school debate team when he started using Nanaimo city council agendas to find issues to debate for practice, followed by watching the meetings to see what happened.

    Thats when he got the idea that he could run for office, serve the community and make a difference.

    His debate team became his campaign team and he was elected to Nanaimo council. It turned out to be one of the most fulfilling jobs Ive ever had You actually can see the difference that youre making.

    At the end of his three-year term he didnt seek re-election because he moved to Burnaby

    to attend Simon Fraser University. Since then hes been focused on getting an education and building a career as an entrepreneur and teacher.

    Beech has a bachelor degree in business and economics from SFU and an MBA from Oxford

    University. He co-founded Beech Partners which works with entrepreneurs, small businesses and startups and Hiretheworld.com which serves as a global graphic design marketplace. And he currently serves as an

    adjunct professor in innovation and entrepreneurship at SFU and the University of B.C.

    He was always looking for an opportunity to get back into politics but I wanted to do it as service, not as a job. Thats why he focused on his business and gaining financial stability first.

    He told his wife, Ravi, that hed wait until after their wedding before he made a decision. They were married a year ago and last Wednesday, Ravi and her mom were busy preparing all the food for the ridings nomination meeting at Confederation Centre, where Beech was acclaimed.

    He feels the new riding, which now includes North Vancouver and North Burnaby, is winnable. He lives in North Burnaby but is familiar with North Van, having attended Capilano University at one point.

    So far, the issues of most concern hes hearing from constituents is the economy and

    a need for a strong focus on an empowered middle class and making sure were providing improved opportunities for future generations.

    The proposed expansion of the Trans Mountain pipeline, which terminates in the riding, is also a hot topic.

    Im concerned the Conservative party has been acting more as a cheerleader for pipelines in B.C. instead of a referee, Beech said. Im not convinced the current proposal is the best possible option for Burnaby North-Seymour.

    But he plans to meet with stakeholders to find out all the facts before taking a position.

    Now that hes got the nomination, Beech will start gearing up for the next federal election which will take place in October 2015 or earlier. Hes already taken a leave from UBC and will start his leave from SFU at the end of the year.

    As for other potential candidates for Burnaby North-Seymour, the NDP have two people so far who plan to run for the nomination, Trevor Ritchie and Michael Charrois.

    The Conservatives have Mike Little, a District of North Vancouver councillor, and Burnaby resident Daren Hancott vying for that partys nomination.

    In the new riding of Burnaby South, current Burnaby-Douglas MP Kennedy Stewart already has the NDP nomination. The Liberals are so far choosing between Adam Pankratz and Ken Beck Lee.

    Beech gets Liberal nod in Burnaby North-Seymour

    BeeCh

    604-419-8888 | www.GFFG.comCall us today to learn more!

    *Rates subject to change without notice. Some conditions may apply.

    Great mortage rates and experts who can work around YOUR schedule. Plus most mortgages approved within 24 hours and a multi-lingual staff we speak your language!

    2.75%*3 YR

    THE G&F DIFFERENCE: Great mortage rates and experts who can work

    %*

    No time to come in?Our Mobile Mortgage Experts will come to You!

    GREAT BIG SAVINGS, TEENY-TINY MORTGAGE RATE!

    Alburz Smoke Shop .......................604-433-4448Anytime Fitness .............................604-428-4848Donair Delight ..............................604-451-0111Dr. Michael Tiu Inc.........................604-438-8131Easy Financial Services ..................604-436-0143Fen Lin Tailor.................................604-434-1617Gala Caf ....................................604-620-9956Ha Caf .......................................604-438-4818Heng Sheng Financial Party Ltd. .....604-737-9966Jenny Craig ..................................604-435-6616Kerrisdale Cameras .......................604-437-8551Kingsway Computers .....................604-222-1000Liquor Distribution Branch ..............604-660-5486

    Mengs Art Studio ..........................604-780-3803New Oriental Tutoring Centre .........604-438-1396Old Orchard Beauty Salon.............604-434-3334Old Orchard Lanes .......................604-434-7644Old Orchard Medical Clinic ...........604-431-6585Pacific Sun Produce .......................604-451-7788Pat Anderson Insurance .................604-430-8887Pearl Castle Restaurant ..................604-559-7929Shoppers Drug Mart ......................604-434-2408Subway ........................................604-434-7444Tang Tang Sushi Restaurant ............604-558-3556The Laundry Basket .......................604-437-7744Vacuum Mart ................................604-431-8345

    With over 25 shops and services, you can enjoy a coffee...relax over lunch, keep fit AND find everything you need on your doorstep!

    From convenient services to groceries and gift items; from designer fragrances to cameras ... its all here at OLD ORCHARD CENTRE!

    Old Orchard CentreOld Orchard CentreShopping made easy at...

    KINGSWAY & WILLINGDON, BURNABY

    www.anytime tness.com#1-4429 Kingsway, Burnaby | 604-428-4848

    OPEN 24/7!

    SEE YOU AT THE GYM!

    Try us free for 7 daysTry Anytime Fitness free for 7 days

    with absolutely no obligation.See why an Anytime Fitness club is just right for you!

    BREAKFAST LUNCH DINNEROpen 7 days a week Take out Delivery

    Mon-Fri 9am-9pm Sat 10am-8pm Sun 11am-5pm604-438-4818

    Try our specialNOODLE SOUP

    $7.95

    BREAKFAST LUNCH DINNER

  • A6 NewsLeader Wednesday, July 23, 2014A6 NewsLeader Wednesday, July 23, 2014

    OPINION

    Jean Hincks Publisher

    Chris Bryan Editor

    Matthew Blair Creative Services Supervisor

    Richard Russell Circulation Manager

    The NewsLeader is a member of the British Columbia Press Council, a self-regulatory body governing the provinces newspaper industry. The council considers complaints from the public about the conduct of member newspapers. Directors oversee the mediation of complaints, with input from both the newspaper and the complaint holder. If talking with the editor or publisher does not resolve your complaint about coverage or story treatment, you may contact the B.C. Press Council. Your written concern, with documentation, should be sent to B.C. Press Council, 201 Selby St., Nanaimo, B.C. V9R 2R2. For information, phone 888-687-2213 or go to www.bcpresscouncil.org

    7438 Fraser Park Dr., Burnaby, B.C. V5J 5B9newsroom@burnabynewsleader.com

    burnabynewsleader.com | newwestnewsleader.com

    Newsroom: 604-438-6397

    Delivery: 604-436-2472

    Classifieds: 604-575-5555

    Advertising: 604-438-6397

    Fax: 604-438-9699

    VICTORIA When the audited public accounts confirmed a $353 million surplus for the last fiscal year, B.C. Liberal political staff were quick to remind reporters of the NDPs main theme from last years election campaign.

    Pages of election quotes from almost every NDP MLA were waiting to be distributed. It was a bogus budget, one of the more polite tags applied to the governments pre-election fiscal plan.

    It underestimates the costs in a whole bunch of ministries and were going to have to review that because all of the decisions that we propose in our platform will have to be implemented, said then-leader Adrian Dix, describing the NDPs plans to tax and spend more.

    Skeena MLA Robin Austin targeted health care in the budget debate: Bearing in mind that our population is actually increasing, bearing in mind that our population is aging, I think its very unrealistic to think we can actually limit health care expenditures to 2.7 per cent.

    As it turned out, health care spending grew by just over two per cent. It still went up by $360 million from the previous year, but after annual increases of six or seven per cent had become the norm, this is quite an achievement. New agreements remain to be negotiated with doctors and nurses, so were unlikely to see the same cost control results for the current year.

    Ottawas health care transfer payment formula has changed, and increases are to be capped at three per cent a year by 2016, so this is the kind of spending restraint all provinces are expected to produce.

    Education was the only other ministry to receive significant extra funding last year, up $299 million despite continuing enrolment decline. Like health,

    the education budget goes up every year, and these increases, along with strong student performance results, expose the rhetoric of the B.C. Teachers Federation about a cash-starved system for what it is.

    But the biggest fabrication of last years election was the debt free B.C. slogan emblazoned on the side of Premier Christy Clarks campaign bus.

    The public accounts confirm that the provinces total debt rose to just over $60 billion, the latest of a series of increases since 2008. The much-touted balanced budget is on the operating side, while the province continues to pile up debt to pay for the Port Mann mega-project, hospitals, schools and other big infrastructure.

    Finance Minister Mike de Jong emphasized the difference between capital and operating expenditures.

    Were borrowing to build as opposed to paying for the groceries, he said.

    Debt free B.C. was not an outright misrepresentation, merely one of the most far-

    fetched promises ever delivered in the history of B.C. politics. The legislature is to convene in October so the B.C. Liberals can pass a taxation framework for the nascent liquefied natural gas industry, which the government hopes willgenerate the revenues to ultimately pay off the provinces$60-billionmortgage.

    Meanwhile there is more capital debt ahead. The cabinet is expected to green-light the Site C dam on the Peace River this fall, a decade-long project estimated to cost $8 billion.

    Along with the public accounts, the finance ministry released a list of surplus land sales. The sale of 50-odd properties, some of them closed schools, netted the provincial treasury about $310 million, which accounts for most of the surplus.

    Was this selling off the family silverware to try and balance the books, as now-NDP leader John Horgan termed it before the election? Its certainly not a revenue source to be matched next year.

    Twitter: @tomfletcherbc

    B.C. back in black, deep in debt

    Two announcements last week underlined just how important the Fraser River is to the local economy and why its vital more steps be taken to prevent flooding.

    A new report commissioned by the Richmond Chamber of Commerce, in partnership with other chambers in the region, warns a massive flood would cause tens of billions of dollars in damage and catastrophic losses for the 300,000 residents of the floodplain, as well as business and industry.

    As well, the Lower Mainland Flood Management Strategy wants an action plan to begin the process of raising dikes and improving other flood defences in the years ahead.

    Saskatchewan and Manitoba were recently hit with severe flooding and its likely the Lower Mainland and Fraser Valley will see flood damage in the future. In fact, recent studies by the province project that major floods will be more frequent and severe as a result of climate change.

    Richmond, being below sea level to begin with, already has an extensive diking system. But with global weather patterns taking a turn to the extreme in recent years, cities on floodplains cannot take flooding for granted. Look at what happened in Calgary and many parts of normally dry Alberta last year, when the Bow River swelled past its banks.

    While Richmond may be prepared, many dikes in the Fraser Valley are too low.

    Yet if Fraser Valley dikes are strengthened, that means more water will be being directed at Richmond. Thats why a coordinated strategy is essential.

    Its good that business groups and government are taking a proactive approach at a potential future risk. Lets hope senior governments put their money where there mouths are in doing upgrades now, rather than throwing money at cleaning up a disaster zone in the future.

    Richmond Review/Black Press

    NEWSLEADERS VIEW:

    THIS WEEK:

    Should seniors levels of government be putting more money into flood protection?Vote at www.burnabynewsleader.com

    LAST WEEK:

    Will faster speed limits on highways make them less safe?

    QUESTION OF THE WEEK:

    Ready on the river

    73%27% NO

    YES

    PUBLISHED & PRINTED BY BLACK PRESS LTD. at 7438 Fraser Park Drive, Burnaby, B.C. V5J 5B9

    Tom Fletchertfletcher@blackpress.ca

  • Wednesday, July 23, 2014 NewsLeader A7Wednesday, July 23, 2014 NewsLeader A7

    COMMENTRe: Burnaby finances in good health (NewsLeader, July 18)

    It is pretty funny that the NewsLeader did a two-page story on the health of Burnabys fiscal reserves.

    I checked out the Fraser Institutes study for myself. It presents Burnaby, along with 17 other municipalities, on a list of communities with positive net financial assets. The report does not even include a single sentence about our great city. This is old news. In fact, the fiscal reserves will have grown substantially after the city posted a $100-million surplus in 2013.

    This is not an anomaly. Between 2009 and 2013, the city accumulated surpluses in excess of $482 million.

    It is not difficult to build a surplus when a municipal government misleads its constituents by overestimating its annual needs and underestimating how much tax it will collect. According to BC Stats estimates, Burnabys population was 231,811. Its overall tax levy, which it controls, for city services was $213.5 million in 2013. Consequently, Burnaby had the highest per-person tax levy of the four municipalities in the strongest financial positions in the Fraser Institutes simplistic study.

    If you collect more taxes from residents and businesses than other municipalities, as Burnaby does, your net assets will grow faster than your neighbours.

    Is the Burnaby Citizens Associations approach fiscal caution or fiscal piracy?

    Finally, I am disappointed the NewsLeader would allow Coun. Paul McDonell and the Mayor to misrepresent the position of their critics without contacting the critics themselves.

    No one is suggesting dipping into the reserves in place of paying taxes.

    Clearly, with average annual surpluses of $96 million, the city could have minimized tax increases, maintained its reserve and still self-financed amenities like the Edmonds

    Community Centre. The one who pays the piper

    calls the tune I suppose.Rick McGowan

    Burnaby

    THANKS MAYORRe: Pipeline firm to seek hammer over Burnaby

    Congratulations and a thank you Mayor Corrigan, you are speaking for us all, and thats 205,000 citizens of the City of Burnaby. Good stuff.

    Peter Dickinson-Starkey

    The arrogance of Kinder Morgan is astounding.

    Gail Benedet

    Not reallyits commonplace, actually. For example, Nestle wants to privatize water supplies and denies that water is a human right.

    These people are sociopaths that view humanity as a resource to be exploited. If our legal machinery was firing

    on all cylinders, these people would be automatically ordered to undergo a psychological assessment, and locked away where they cant do any further damage.

    Greg Monks

    I am so glad Mayor Derek Corrigan is saying what he is saying and doing what he is doing. We dont need a big Houston corporation owning giant, exclusive right-of-ways that bar the citizens of Burnaby or of the province of B.C. from city-owned park land.

    Plus, we dont want the added higher risk of environmental contamination.

    By land or by sea.No extra pipelines or extra

    Pacific crossings by tanker traffic in and out of Stanley Park and Burrard Inlet waterways. Dropping their bilge water times two, using up fuel to cross and spewing pollution.

    Karin Alzneronline comments

    burnabynewsleader.com

    Fiscal caution or piracy?

    Book your Special Partyor Function with us!

    EVERY FRIDAY & SATURDAYFor complete band listi ngcheck out our website

    STAY UP-TO-DATE! @ re ghterspub

    Like us onFacebook!

    Burnabys Premier

    LiveEntertainment Hot Spot

    DAILY 3pm - 5:30pm

    JOIN US FOR...

    DRINK & FOOD SPECIALS!

    Located in the heart of Metrotown...6515 Bonsor Avenue, Burnaby | 604-437-4347

    www. re ghtersclub.com

    FIREFIGHTERSpublic housepublic house

    Cajun NY Steak & Caesar

    $12.955pm-7pm

    SUNDAY FEATURE

    Follow us onTwitter!

  • A8 NewsLeader Wednesday, July 23, 2014

  • Wednesday, July 23, 2014 NewsLeader A9Wednesday, July 23, 2014 NewsLeader A9

    Apartment building destroyed by blaze in 2013Wanda Chowwchow@burnabynewsleader.com

    The site of an apartment building with a history of serious fires is now being proposed for a townhouse development.

    The four-storey rental complex at 3526 Smith Ave. was destroyed by fire in February 2013.

    While no one was killed, several pets in the pet-friendly

    building perished.Four years earlier,

    in March 2009, a fire broke out in the buildings lobby.

    A 60-year-old woman died of her injuries and an eight-year-old boy suffered extensive burns.

    Now vacant, the owner of the site at the southeast corner of Smith Avenue and Linwood Street is seeking a rezoning to allow for a three-storey, stacked townhouse project with underground parking. Vehicle access would be from Linwood Street.

    The site is designated for medium-density, multi-family residential use in Burnabys Broadview Community Plan, said a city staff report.

    The proposal consists of 34 units within five townhouse buildings separated from each other by landscaped courtyards and pedestrian walkways.

    The report noted

    that a Section 219 covenant would be registered on the property to ensure the protection of Spring Brook which runs through Avondale Park next door.

    A public hearing on the rezoning will be held Aug. 26 at 7 p.m. in Burnaby city hall council chambers.

    twitter.com/WandaChow

    Hasnt been seen for over a month

    Burnaby RCMP are seeking the publics help in finding a teen who hasnt been seen since last month.

    Zoe Denise Olesen was last seen on June 16 at 5:30 p.m.

    She was reported missing to police on July 16.

    Olesen is described as a 15-year-old Aboriginal Metis girl with long hair dyed pink, blue and

    purple. She is five-feet-four, 115

    pounds, has green eyes and wears glasses.

    She was last seen wearing blue jeans and a red/blue plaid shirt with a white tank top underneath.

    Anyone with information on her whereabouts is asked to call Burnaby RCMP at 604-294-7922 and quote file number 2014-31998.

    Zoe Denise Olesen, 15, is described as having long hair dyed pink, blue and purple.

    Contributed photo

    Townhouses eyed for Smith Ave. fire site

    Police seek missing teen

    10th

    Str

    eet

    Royal Ave.

    Columbia St.

    I.G.A.

    Columbia Square Plaza

    XEntry

    hidden in corner

    www.fabriclandwest.com

    vancouver1678 SoutheastMarine Drive

    604-321-1848

    new weSt1015 columbia Street

    columbia Square Plaza

    604-525-0074

    Store HoursMon.-Wed. & Sat. 9:30-5:30 Thurs. & Fri.

    9:30 - 9 Sun. 12 - 5

    NEW LOCATIONEXPANDED LOCATION

    COME PLAY WITH US!Community Music School Private and Group Lessons

    GROUP CLASSES (New Westminster)

    Guitar, voice, audio engineering, folk ensembles and more.

    PRIVATE LESSONS (New Westminster & Coquitlam)

    Piano, guitar, woodwinds, percussion and more.

    Classes off ered September to June for all ages and levels.

    REGISTER NOW! 604 527 5469

    MORE INFO: douglascollege.ca/cms

    14-068d

    The Fair at the PNE is back...

    ...to win gate and ride passes go to our websiteand click on CONTESTS

    ride passes go to our website

    with all your fair favourites and, new for this year only, Game of

    Thrones: The Exhibition, Internet Cat Video Festival, 360 degree

    travel experience, ToonCity kids zone featuring an animation exhibit,

    plus over 30 Nightly concerts on two stagesall FREE with admission.

    August 16-September 1(closed Aug 18 & 25)

    to win gate and ride passes

    ENTER TO

    WINt i t d id

    RREEEEEEEEEEENNNNNNNNNNNTTTTTTTTTEEEEEEEEEERRRRRRRRRRR TTTTTTTTTTOOOOOOOOOENTER TO

    WINwww.burnabynewsleader.com

    yers. coupons. deals. savings tips.

    Visit

    (MJHPTZY\JJPQ^^JWXAND SAVE!

    Browse yers from your favourite national and local retailers

    Featured Retailers

    yers. coupons. deals. savings tips.

    Visit

    Check out weekly yers

    and SAVE!Browse yers from your favourite national and local retailers

    Featured Retailers

    yers. coupons. deals. savings tips.

    Visit

    (MJHPTZY\JJPQ^^JWXAND SAVE!

    Browse yers from your favourite national and local retailers

    Featured Retailers

    yers. coupons. deals. savings tips.

    Visit

    (MJHPTZY\JJPQ^^JWXAND SAVE!

    Browse yers from your favourite national and local retailers

    Featured Retailers

    yers. coupons. deals. savings tips.

    Visit

    Check out weekly yers

    and SAVE!Browse yers from your favourite national and local retailers

    Featured Retailers

    BEST BUY Correction NoticeIn the July 18 flyer, page 5, the Bose QuietComfort 15 Acoustic Noise-Cancelling Headphones (WebCode: 10173935) were advertised with an incorrect price. Please be advised that these headphones are $296.99 NOT $269.99, as previously advertised. Also we would like to clarify the Asus TF701T Transformer Pad (WebCode: 10275831) advertised on page POP 3. Please be advised that this tablet DOES NOT come with a keyboard, as previously advertised. We sincerely apologize for any inconvenience this may have caused our valued customers.

  • A10 NewsLeader Wednesday, July 23, 2014A10 NewsLeader Wednesday, July 23, 2014

    F MILY & P RENTING

    Children do not often attend dinner parties. Adults with children typically leave the kids with a babysitter when attending a dinner parties with colleagues or friends.

    But some hosts choose to make their dinner parties kid-friendly. This can make things easier on guests, who wont have to go to the trouble or expense of hiring a babysitter for the night. It also can make things easier on hosts with children of their own and dont want to add finding a sitter to their list of things to do in the days leading up to the party. Kids can add some life to a dinner party, but hosts may to employ a few strategies to ensure their kid-friendly dinner parties are enjoyable for adults and children alike.

    FEEd ThE kIds FIRsT

    Kids cant ignore their appetites as long as their adult counterparts, so make sure dinner for the kids is served once all of them have arrived.

    Choose kid-friendly fare like pizza or macaroni and cheese so kids are more likely to eat and not complain of hunger later in the evening.

    Feeding the kids first also makes it easier for adults to enjoy uninterrupted conversation when its their turn to sit down and eat.

    kEEP ThE kIds ENTERTaINEd

    Whether its a movie, a board game or another distraction, finding something to keep the kids entertained throughout the night should be a priority for hosts.

    A selection of movies that kids can choose from might be your best bet, as films that are between 90 and 120 minutes long can keep youngsters occupied for much of the night. Let kids watch their movies in a playroom thats separate from where adult guests will be gathering prior to dinner, and periodically check in on the kids as the night progresses. Provide some snacks like popcorn or even some candy to create a night at the movies atmosphere for kids.

    REMINd kIds To bE GRacIous hosTs

    When choosing activities for kids, remind your own children that its their responsibility to be gracious hosts, even if that means playing games they arent interested in

    or watching movies they have already seen. Let youngsters know in advance that if they fulfill their responsibilities at hosts they can choose how to spend the following day or weekend.

    choosE aN aduLT ENTREE ThaTs sIMPLE To PREPaRE

    No matter how well behaved kids may be before and during a dinner party, hosts should not add to their already considerable workload by preparing an especially complicated meal for their adult guests. Keep things simple, especially if you are preparing a separate meal for the kids. Much of the stress of hosting a dinner party comes with preparing the meal, and that may only prove more stressful if you are preparing two meals while simultaneously catering to the needs of your youngest guests.

    coNsIdER hIRING a babYsITTER

    Sometimes hiring a babysitter makes sense even when mom and dad are home. A babysitter can look after the kids while the parents are elsewhere in the home enjoying a good meal and great company.

    Adults attending the party with their children can split the cost of a babysitter, even if he or she charges extra to look after several kids at once.

    Hosting a kid-friendly dinner party can make for a memorable night for parents and their children.

    Hosts can make the night even better by employing several strategies to make the party feel like a more traditional affair even if the kids are in the next room.

    Hosting a kid-friendly dinner party

    When hosting a kid-friendly dinner party, hosts can serve youngsters a dish like pizza or macaroni and cheese to ensure they dont complain of hunger later in the night.

    Where History Comes to Life

    Thanks to our partners:

    burnabyvillagemuseum.ca

    Thanks to our partners:

    burnabyvillagemuseum.ca

    Sign up today! Ice Cream Making WorkshopsEvery Saturday 10am & 1pmFun for the whole family.

    Enter at: newwestnewsleader.com/contest

    WIN A $350 PRIZE PACKAGE COURTESY OF UPTOWN LIVE!

    New Westminster premiers MusicFest happening on Sunday, August 10th. Bands include Five Alarm Funk and the Bright Light Social Hour, direct from Austin, Texas.

    Enter on-line for a $250 Gift Certi cate from Royal City Centre, plus a Festival Swag Bag that includes CDs and T-Shirts!

    CONTESTCONTEST

    NAME: PHONE:

    AUGUST 8-9-10

    Drop off at The Burnaby Newsleader

    7438 Fraser Park Drive, Burnabyby 5:00 pm on Friday, August 1

    GATES OPEN: FRI. 4:30 PM; SAT. & SUN. 9:00 AMwww.abbotsfordairshow.com

    Tell us why you want to go to the Airshow . . .

    nab by yby

    NEW Friday NightTWILIGHT SHOW!

    WIN TICKETS!FrFTWTSHSH

    ABBOTSFORD INTERNATIONAL

    AAAAAGATGGATGATGATGATESSESESESES OPEOPEOPEEOPEOPEENNNNN

    AAAAAA

  • Wednesday, July 23, 2014 NewsLeader A11Wednesday, July 23, 2014 NewsLeader A11

    SPORTS

    Kolby SolinskyBlack Press

    Coach Hugh Podmore and Team Canada played host to the world last weekend at the 2014 Quidditch Global Games, a sort-of world cup for the once-fictional sport invented by JK Rowling.

    Its a huge honour. Its very good to be the host nation, Podmore said on Saturday at the all-day event at Burnaby Lake Sports Complex West.

    Weve been able to have a lot of fans come out here and support us, which has been fantastic.

    Team USA won its second-straight Global Games, destroying Australia in the final, 210-0. Canada won bronze at its own event, and fared well against the eventual champion

    Americans, losing 130-70 in the first match of the day.

    The Canucks then beat Harry Potters

    nation, the United Kingdom, 60-40 in the third-place game.

    Canadian Quidditch is really, really strong, said Podmore.

    This is our chance to get out there and prove it.

    It was a homecoming for Canadas captain, who went to

    high school in South Surrey at Southridge School. Podmore then went on to university at McGill in Montrealwhere he first picked up Quidditchand now lives in Toronto as the coach of his own national squad, where he also plays for Valhalla Quidditch club.

    Ive been playing Quidditch for a while, all my friends think Im a little bit silly, he said. But its nice to come back with Team Canada and have this tournament here and show everyone what it is that we really do at the top level game.

    Other nations at the event included Belgium, France and Mexico.

    U.S. wins Quidditch Global Games

    video-online]

    burnabynewsleader.com

    BRITISH COLUMBIA GOLFBurnabys Michael Belle swings away at the B.C. Amateur last week.

    Burnabys Michael Belle had a B.C. Amateur Golf Championship in his grasp before losing a five-hole playoff to Jordan Lu, 17, of Vancouver on Friday.

    Belle led for much of the tournament at the Seymour Golf and Country Club in North Vancouver. He had a three-shot lead after 11 holes in the final round. He even went into the 72nd hole of the four-round tournament with a one-stroke lead but Lu, who started the day four strokes behind Belle, made a birdie to force a sudden death playdown.

    It was tough coming down the stretch. My nerves got the best of me coming down 15, 16, 17, 18. But other than that I was pretty happy with the way I played, Belle told Dan Russell

    on his Sportstalk Sunday Golf show on CISL. The last (playoff) hole I had a 12-footer

    to win and ended up three-putting to lose. It was a tough way to lose, but thats how it goes sometimes.

    You try to put that tough 12-foot putt out of your mind, but I didnt and I ended up missing that three-foot putt (for par) in the end.

    Belle, who just finished his senior season playing for the Simon Fraser University mens golf team, shot an even-par 284 (69-71-71-73).

    Alex Francois, 16, of Burnaby finished tied for fourth just two strokes back of Belle and Lu. Francois and Roy Kang, 15, beat out 64 teams to win the best-ball competition with a combined 19-under 265.

    Both Belle and Francois recorded hole-in-ones on the first day of play last Tuesday.

    The Burnaby Lakers moved into second place in the Western Lacrosse Association and clinched a playoff spot with a pair of one-goal wins on the weekend.

    The Lakers began at home by edging the Coquitlam Adanacs 7-6 in overtime at Bill Copeland Arena on Friday. They then went to Maple Ridge on Sunday to nip the Burrards 8-7 and leapfrog over them into second place. Burnaby is 9-6-0 with three games left, one more than Maple Ridge which is 8-7-1. The Victoria Shamrocks (13-1-2) have already locked up first place.

    Casey Jackson scored the only goal of the 10-minute overtime Friday on the power play 2:33

    in. Jason Jones had two goals and an assist with Robert Church getting a goal and three assists. Other Burnaby scorers were Tyler Digby, Dane Stevens and Scott Jones. Tyler Richards stopped

    39 of 45 Coquitlam shots to get the win.He stopped 33 of 40 in Maple Ridge

    on Sunday while Jackson had a goal and five assists. Scott Jones notched two goals and three assists with other goals going to Digby, Justin Salt, Stevens, Shaun Dhaliwal and Jason Jones.

    The Lakers will travel to Vancouver Island to take on the Shamrocks on Friday and the Nanaimo Timbermen (4-10-1) Saturday. They finish the WLA regular season by taking on Coquitlam at home Aug. 1.

    Belle beaten by teen in B.C. Amateur playoff

    Lakers leap into second

    GREG SAKAKI/BLACK PRESSAlex Fediaev, left, of Burnaby, wrestles Logan Schell of Prince George on Saturday at the B.C. Summer Games in Nanaimo. Fediaev won the match and went on to take a bronze in the 63-kilogram division.

    Fairhall Zhang & Associates Ltd. Jim and Lindy McQueen Big O Tires

    Gord-Ron`s Auto Metal The Mulberry Retirement Residences

    Peter Julian, MP With support from Raj Chouhan, MLA

    Sponsored by:

    EPICs Music in the Park will showcase local musical talent and provide an opportunity for

    neighbourhood residents to attend free local events and hear

    family friendly music.

    Sunday July 27, 2014Sunday August 31, 2014

    6:30 8:30 pm

    EPIC MUSIC in the Park Series

    in Edmonds Community

    Centre Plaza

    Event is rain or shine! Bring your own chairs or blankets!

    presents a series of three free outdoor concerts in Edmonds Park

    FREE CONCERT

    S

  • A12 NewsLeader Wednesday, July 23, 2014

    CONGRATULATIONS!

    Thank you to the coaches, ocials, volunteers, and families who support these growing champions.

    See photos, videos and results at BCGAMES.ORG

    289 athletes from Fraser River - Delta competed at the 2014 BC Summer Games bringing home 83 medals.

  • Wednesday, July 23, 2014 NewsLeader A13

    JOBFAIRPersons with

    Disabilitiesfor

    When:

    Where:

    Thursday, October 23, 201412:30pm - 3:30pm

    Firefighters Banquet & Conference CentreMetrotown Complex, Burnaby, BC

    The job fair is exclusively for job seekers with a disability. It will feature employers committed to an inclusive workforce, as well as local service providers.

    See you there!Questions? Please contact: Neil Squire Society 604.637.3577 or sarab@neilsquire.cawww.neilsquire.ca

  • A14 NewsLeader Wednesday, July 23, 2014

    Are you confi dent enough to develop business conversations? Black Press publishes the Surrey Leader, Langley Times and Peace Arch News along with 150 other publications. We will develop individuals with an ambition to succeed whether they have deep post-secondary credentials or not. This is an exceptional opportunity if you are adept at making successful calls and highly rewarding to those that maintain the required pace.We have an immediate opening for a Sales Consultant on our Digital team representing our highly successful online recruitment platform LocalWorkBC.ca.

    Primary Focus: Contact prospective business clients via phone and email Develop trustworthy and informative relationships Maintain a strong volume of calls with the assistance of our CRM system

    Qualifi cations: Strong telephone skills Marketing and/or creative mindset Ability to thrive in a fast-paced environment Basic computer skills Strong command of english, both verbal and written

    It is also an asset if you have a good knowledge of BC communities.This is a full time position based in Surrey, BC. Black Press offers competitive compensation, a team environment, benefi ts and opportunity for career advancement.Please forward your resume with a brief note on why you are a great candidate to:

    Kristy OConnor, Digital Sales Managerkoconnor@bpdigital.ca

    Competition closes August 13, 2014

    Sales Advisor - Digital Products

    blackpress.ca X bclocalnews.com

    www.burnabynewsleader.com www.newwestnewsleader.com

    Zone CheckerThe Burnaby NewsLeader is looking for energetic and customer friendly individuals for its Circulation Department. The right candidate must have excellent communication and organizational skills, attention to detail, the ability to work with minimum supervision, and basic knowledge of MS Word, Excel and Outlook Express.

    Duties include supervising 100+ youth carriers, recruiting and hiring new carriers, surveying old and new delivery areas, monitoring carrier performance, and following up on householder delivery concerns. A reliable vehicle is a must.

    A vulnerable sector criminal record check is also mandatory. This permanent part-time position is available immediately.

    Please forward your resum to:

    Circulation Manager Burnaby New Westminster NewsLeader 7438 Fraser Park Drive Burnaby, BC V5J 5B9 circmanager@burnabynewsleader.com No phone calls please.

    All emailed submissions will receive a reply for confirmation of receipt; however, only candidates selected for an interview will be contacted further.

    FAMILY ANNOUNCEMENTS

    6 IN MEMORIAM GIFTS

    COMMUNITY ANNOUNCEMENTS

    33 INFORMATIONCANADA BENEFIT GROUP - Do you or someone you know suffer from a disability? Get up to $40,000 from the Canadian Government. Toll-free 1-888-511-2250 or www.canadabenefi t.ca.

    COMMUNITY ANNOUNCEMENTS

    041 PERSONALSMeet singles right now! No paid op-erators, just real people like you. Browse greetings, exchange mes-sages and connect live. Try it free. Call now: 1-800-712-9851

    TRAVEL

    74 TIMESHARE

    CANCEL YOUR TIMESHARE. NO Risk Program STOP Mortgage & Maintenance Payments Today. 100% Money Back Guarantee. FREE Consultation. Call Us NOW. We Can Help! 1-888-356-5248

    76 VACATION SPOTS

    Fountain of Youth Spa and RV Re-sort Offers more vacation for less money, hot mineral springs, events, activities, fi tness, entertainment. www.foyspa.com or 888-800-0772.

    EMPLOYMENT/EDUCATION

    108 BUSINESS OPPORTUNITIES

    A Great JanitorialFranchise Opportunity

    ANNUAL STARTING REVENUE $24,000 - $120,000 Minimum investment

    as low as $6,050 required Guaranteed Cleaning Contracts Professional Training Provided

    Financing Available Ongoing Support

    A Respected Worldwide Leader in Franchised Of ce Cleaning.Coverall of BC 604.434.7744

    info@coverallbc.comwww.coverallbc.com

    109 CAREER OPPORTUNITIES

    EMPLOYMENT/EDUCATION

    108 BUSINESS OPPORTUNITIESGET FREE VENDING MACHINES. Can Earn $100,000.00 + Per Year. All Cash-Retire in Just 3 Years. Protected Territories. Full Details CALL NOW 1-866-668-6629. Web-site WWW.TCVEND.COM.

    114 DRIVERS/COURIER/TRUCKING

    Atlas Power SweepingHiring Drivers

    WATER TRUCK OPERATORS- require Class 3.

    SWEEPER OPERATORS- require air ticket.

    Experience is benefi cial but we will train. Burnaby based, must be avail for weekends. Good driving record & abstract reqd.

    Email: jobs@atlasg.net or Fax: 604-294-5988

    HIGHWAYOWNER OPERATORS

    $3500 SIGNING BONUSVan Kams group of compa-nies req. Highway linehaul owner operators based in our Surrey terminal for runs throughout BC and Alberta. Applicants must have winter and mountain driving experi-ence/training.

    We offer above average rates and an excellent

    employee bene ts package.To join our team of profession-al drivers, email a detailed re-sume, current drivers abstract and details of your truck to:

    careers@vankam.com orCall 604-968-5488 or

    Fax: 604-587-9889Only those of interest

    will be contacted.Van Kam is committed toEmployment Equity and

    Environmental Responsibility.

    115 EDUCATIONMEDICAL TRANSCRIPTION is an in-demand career in Canada! Em-ployers have work-at-home posi-tions available. Get the online train-ing you need from an employer-trusted program. Visit: Career-Step.ca/MT or 1-888-528-0809 to start training for your work-at-home career today!

    EMPLOYMENT/EDUCATION

    115 EDUCATION

    APARTMENT/CONDOMANAGER TRAINING

    Certifi ed Home Study

    Course Jobs

    RegisteredAcross Canada Gov. Certifi ed

    www.RMTI.ca / 604.681.5456 or 1.800.665.8339

    Excavator & Backhoe Operator Training. Be employable in 4-6wks. Call 604-546-7600. www.rayway.ca

    130 HELP WANTED

    An Alberta Oilfi eld Company is hiring experienced dozer and excavator operators, meals and lodging provided. Drug testing required. 1-(780)723-5051.

    CARRIERS NEEDEDYOUTH & ADULTS

    Deliver newspapers (2x per week) on Wednesdays and Fridays in your area. Papers are dropped off at your home with the fl yers pre-inserted! Call Christy 604-436-2472for available routes emailEmail circulation@burnaby

    newsleader.com

    Landscaping Sales & Service Opportunities

    Up To $400 CASH DailyF/T & P/T Outdoors. Spring /

    Summer Work. SeekingHonest, Hard Working Staff.

    www.PropertyStarsJobs.com

    115 EDUCATION

    EMPLOYMENT/EDUCATION

    130 HELP WANTED

    CUSTOMER SERVICEAdmin Assistant (seasonal work)Start Aug 18th. Hours 8:00am to

    4:30pm Monday to Friday. Are you looking for a job that will give you spring break, Christmas

    and summer holidays off?

    - Qualities we are looking for:- Excellent customer service skills.- Superior verbal and written English communication skills.- Profi cient with Outlook, MSWord and Excel.

    - Excellent time management and organizational skills.- Must be able to multi task.- Reliable and punctual.

    Starting Wage $12.00 hrPlease drop off your resume in person from Aug 5th to Aug 8th

    to Lifetouch Canada 1610 Ingleton Ave Burnaby BC.

    DELIVERYPERSONS

    Yellow PagesPHONE BOOKS

    Mature persons with own car, truck, or van, or Clubs, Charitable Organizations, School, Church Groups, or Sport Teams. Earn money delivering the Yellow Pages Directories door to door in Burnaby and New Westminster in July.

    NO SELLING INVOLVEDStart Immediately!

    PDC LogisticsCall: 604.421.2403

    Mon.- Fri. 8:00am - 4:00pmhttp://www.deliverYELLOW.ca

    EXPERIENCED PARTS PERSON required for a progressive auto/in-dustrial supplier. Hired applicant will receive top wages, full benefi ts and RRSP bonuses working 5 day work week, plus moving allowanc-es. Our 26,000ft2 store is located 2.5 hours N.E. of Edmonton, Alber-ta. See our community at LacLa-BicheRegion.com. Send resume to: Sapphire Auto, Box 306, Lac La Biche, AB, T0A 2C0. Email: hr@sapphireinc.net.

    115 EDUCATION

    EMPLOYMENT/EDUCATION

    130 HELP WANTED

    .Flagpersons & Lane Closure Techs required. Must have reliable vehicle. Must be certifi ed & experienced. Union wages & benefi ts. Fax resume 604-513-3661 email: darlene.hibbs@shawbiz.ca

    Re CYCLE your unwanted items in

    bcclassified.com 604-575-5555

    EMPLOYMENT/EDUCATION

    130 HELP WANTED

    FLAGGERS NEEDED. No Certifi cation? Get Certifi ed, 604-575-3944

    INDEX IN BRIEFFAMILY ANNOUNCEMENTS ............... 1-8

    COMMUNITY ANNOUNCEMENTS ... 9-57

    TRAVEL............................................. 61-76

    CHILDREN ........................................ 80-98

    EMPLOYMENT ............................. 102-198

    BUSINESS SERVICES ................... 203-387

    PETS & LIVESTOCK ...................... 453-483

    MERCHANDISE FOR SALE........... 503-587

    REAL ESTATE ............................... 603-696

    RENTALS ...................................... 703-757

    AUTOMOTIVE .............................. 804-862

    MARINE ....................................... 903-920

  • Wednesday, July 23, 2014 NewsLeader A15

    www.benchmarkpainting.caCALL TODAY! 604-803-5041

    Ask about our$99

    ROOM SPECIAL

    EMPLOYMENT/EDUCATION

    130 HELP WANTED

    PRODUCTION WORKERSCanadas Largest Independently owned newspaper group, is currently looking for Part-Time Production Workers to work at our Delta - Vantage Way 24/7 production facility.

    This is an entry level, general labour position that involves the physical handling of newspaper & related advertising supplements.

    REQUIREMENTS: Prior bindery and/or machine operator experience is preferred Motivated self-starter willing to work in a fast-paced enviro. performing repetitive tasks Must be able to lift 35lbs. & stand for long periods of time Ability to work co-operatively in a diverse, team-based enviro. Must be reliable & dependable Excellent communication skills & detail oriented Completion of high school Must have own transportation

    This P/T position has a variety of afternoon & graveyard shifts (Mon - Fri). The incumbent must be able to work on a weekly schedule with short notice.

    Starting Wage $12.20 +Shift Premiums!

    If you are interested in this position, please e-mail your

    resume, including Production Worker in the subject line to:

    jobs.vantageway@gmail.com

    131 HOME CARE/SUPPORTF/T Caregiver required for elderly care. Minimum wage. Email: jsgaliano@telus.net

    139 MEDICAL/DENTAL

    Full time Certifi ed Dental As-sistant required for team orien-tated family dental practice. Awesome wage and benefi ts package. Apply by resume to: 121 N. 1st Avenue, Williams Lake, BC V2G 1Y7, Fax: (250)398-8633 or by E-mail:vitoratos@shaw.ca Visit our website: www.cariboodentalclinic.com

    160 TRADES, TECHNICALBISON Transport is looking for positive, team oriented Tractor Trailer Technicians for our expand-ing maintenance team in Langley. Great company with leadership op-portunities. Competitive wages and benefi ts dependent on experience and qualifi cations. Red Seal and BC Safety Certifi cation an asset. To apply, visit the Careers page on www.bisontransport.com.

    Commercial Transport& Diesel Engine

    MechanicsRequired for Cullen Diesel Power Ltd. and Western Star and Sterling Trucks of Vancouver Inc. Positions available in Surrey. Cummins, Detroit Diesel and MTU engine exp. considered an asset. Factory training provided.

    Union Shop - Full Bene tsFax Resume: 604-888-4749

    E-mail: ars@cullendiesel.com

    MASTER CRAFTSMENWANTED

    Plumbers Painters Electricians Finish

    Carpenters Tilers Dry Wallers Handymen /

    Jack Of All TradesMust have min. 10 years exp. Serving Metro Vancouver & sur-rounding area. F/T, P/T, Flexible hours & great compensation!

    Apply On-line: www.handymanconnection.com

    /handyman-job-careers-opportunities.aspx

    329 PAINTING & DECORATING

    EMPLOYMENT/EDUCATION

    160 TRADES, TECHNICAL

    HEAVY DUTY TRUCK/ TRAILER MECHANICS

    K-Line Trailers is a custom trans-port trailer manufacturer in Lang-ley, BC. We seek long-term, F/T, qualifi ed Truck-Trailer mechanics to repair, maintain, inspect and certify trucks and trailers. Must have appropriate hand tools, be a solid self-starter but great in a team setting. MVI/CVI required, Class 1 drivers an asset.

    Highly Competitive Wages Health, Dental, RRSP Bene ts

    that grow with long-term employment

    Please email resume:employment@klinetrailers.com

    Join one of North Americas most respected & fastest growing heavy civil infra-structure contractors.

    Flatiron has been named Heavy Civil Contractor of the Year in Alberta & has won numerous employer awards.

    Flatiron Constructors has an immediate need for:

    Formwork Carpenters Apprentice Carpenters Skilled Laborers Grade Checkers Heavy Equipment OperatorsThis is an opportunity to join us in the Edmonton Area. The Northeast Anthony Hen-day Drive project includes the construction of 27 kms of six and eight-lane divided roadway, nine interchanges, two fl yovers, eight rail cross-ing & two bridges across the North Saskatchewan River.

    You can view all skilled trade and construction management positions

    and apply viawww. atironcorp.com

    or forward your resume: canadarecruiter@ atironcorp.com

    Build The Best.Be The Best!

    165 WORK WANTED

    Writer: creative, innovative, poetic, yearning to fulfi ll my creativity! Do you need someone to write: short stories for fi lm/tv, marketing, adver-tising, slogans, or to come up with a brilliant idea for business? Please contact: berliner10@shaw.ca

    PERSONAL SERVICES

    182 FINANCIAL SERVICES

    Are You $10K Or More In Debt? DebtGo can help reduce a signifi -cant portion of your debt load. Callnow and see if you qualify. 1-800-351-1783GET BACK ON TRACK! Bad credit? Bills? Unemployed? Need Money? We Lend! If you own your own home - you qualify. Pioneer Acceptance Corp. Member BBB.

    1-877-987-1420 www.pioneerwest.com

    IF YOU own a home or real estate, ALPINE CREDITS can lend you money: Its That Simple. Your Cred-it / Age / Income is NOT an issue. 1.800.587.2161.Unfi led Tax Returns? Unreported Income? Avoid Prosecution and Penalties. Call a Tax Attorney First! 855-668-8089 (Mon-Fri 9-6 ET)

    329 PAINTING & DECORATING

    Buying, Renting,Selling?

    www.bcclassi ed.com

    PERSONAL SERVICES

    182 FINANCIAL SERVICES

    Need CA$H Today? Own a vehicle? Borrow up to $25,000. Snapcarcash.com 604-777-5046

    HOME/BUSINESS SERVICES

    260 ELECTRICALLow Cost. Same Day Guaranteed. Res/Com. Small job expert. Renos Panel changes ~ 604-374-0062

    YOUR ELECTRICIAN $29 Service Call Lic #89402 Same day guarntd We love small jobs! 604-568-1899

    287 HOME IMPROVEMENTS

    HANDYMAN CONNECTION Home Repairs, Renovations, Installations. Licensed & Bonded. 604-878-5232

    FULL SERVICE Plumbing from Parker Dean. Fast, reliable, 24/7 service. Take $50 off your next job if you present this ad. Vancouver area. 1-800-573-2928

    288 HOME REPAIRS

    If I cant do it

    It cant be done

    Call Robert 604-941-1618 OR 604-844-4222

    INTERIORS: Baths (renos/repairs) specializing in drywall, doors, fl ooring, tiling, plumbing,

    painting, miscellaneous, etc.VERSATILE! EXPERIENCED IN

    OVER 30 LINES OF WORK!* Quality work * Prompt Service

    * Fair prices For positive results Call Robert

    SERVICE CALLS WELCOME

    300 LANDSCAPING

    GREENWORKS Redevelopment Inc. Hedges, Pavers, Ponds &

    Walls. Returfi ng, Demos, Drainage, Concrete cutting, Jack hammering,

    old swimming pools fi lled in &decks. 604-782-4322

    778-710-2185

    320 MOVING & STORAGE

    1PRO MOVING & SHIPPINGAcross the street - across the world

    Real Professionals, Reas. Rates. Best in every way! 604-721-4555.

    CURLY JOES MOVING - Free moving for people on social assis-tance or disabilities. 604-618-7766

    AFFORDABLE MOVINGwww.affordablemoversbc.com

    From $45/Hr1, 3, 5, 7 & 10 Ton Trucks

    Licensed ~ Reliable ~ 1 to 3 MenFree Estimate/Senior DiscountResidential~Commercial~PianosLOCAL & LONG DISTANCE

    604-537-4140ABE MOVING - $35/Hr. Per Person*Reliable Careful Movers. *RubbishRemoval. *24 Hours. 604-999-6020

    329 PAINTING & DECORATING

    www.paintspecial.com 604.339.1989 Lower Mainland

    604.996.8128 Fraser ValleyRunning this ad for 10yrsPAINT SPECIAL

    3 rooms for $299,2 coats any colour

    (Ceiling & Trim extra) Price inclsCloverdale Premium quality paint.

    NO PAYMENT until Job iscompleted. Ask us about our

    Laminate Flooring & Maid Services.

    Shop from home!Check out our FOR SALE sections:

    class 500s for Merchandise, 600s for RealEstate, and for Automotive view our 800s.

    bcclassified.com

    HOME/BUSINESS SERVICES

    329 PAINTING & DECORATING

    ABOVE THE REST Interior & Exterior Unbeatable

    Prices & Professional Crew. Free Est. Written Guarantee

    No Hassle Quick Work Insured WCB

    778-997-9582

    332 PAVING/SEAL COATING

    ASPHALT PAVING Brick Driveways Retaining Walls Foundation Repairs Sealcoating 604-618-2304

    338 PLUMBING

    10% OFF if you Mention this AD! *Plumbing *Heating *Renos *More Lic.gas fi tter. Aman: 778-895-2005

    Plumbing Services - Hvac Gas Fitting & Electrical. C & C Electrical Mechanical 604-475-7077

    BRO MARV PLUMBING 24/7Plumbing, heating, plugged drains BBB. (604)582-1598, bromarv.com

    341 PRESSURE WASHING

    POWER WASHINGGUTTER CLEANING

    SAME DAY SERVICE AVAILABLE Call Ian 604-724-6373

    353 ROOFING & SKYLIGHTS

    10% DISCOUNT. MG Roofi ng & Siding. WCB

    Re-roofi ng, New Roof Gutters & Replace Fascia 604-812-9721FIVE STAR ROOFING

    All kinds of re-roofi ng & repairs. Free est. Reasonable rates.

    778-998-7505 or 604-961-7505

    Roo ng Experts. 778-230-5717Repairs/Re-Roof/New Roofs. All work Gtd. Free Est. Call Frank.

    .A East West Roofi ng & Siding Co. Repairs, new roofs, torching, gutter services. 10% off. 604-783-6437

    356 RUBBISH REMOVAL

    JUNK REMOVAL By RECYCLE-IT!604.587.5865www.recycleitcanada.ca

    mikes hauling 604-516-9237

    FLEETWOOD WASTEBin Rentals 10-30 Yards.Call Ken at 604-294-1393

    372 SUNDECKS If you need a Vinyl Deck Expert for new & old deck. Call Gill fora Free Estimate 604-728-3785

    HOME/BUSINESS SERVICES

    372 SUNDECKS

    . Aluminum patio cover, sunroom, railing and vinyl. 604-521-2688

    .Aluminum patio cover, sunroom, railing and vinyl. 604-521-2688 www.PatioCoverVancouver.com

    374 TREE SERVICES

    ABC TREE MEN Pruning, Shaping, Tree Removal & Stump Grinding. 604-521-7594 604-817-8899

    PETS

    477 PETS

    CATS GALORE, TLC has for adoption spayed & neutered adult cats. 604-309-5388 / 604-856-4866GERMAN Shepherd pups. Working line. Black & black/tan. 6 weeks old. $700. 604-820-4230, 604-302-7602Male Stud Services. Looking for a Maltese. Will consider Pomeranian. Reasonable fee. 604-302-6647Pure bread CAIRN TERRIER Pups Shots, dewormed. $650. House pets. 778-588-1051,604-859-1724

    MERCHANDISE FOR SALE

    542 FRUIT & VEGETABLES

    BLUEBERRIES. U-PICK $1.25 lb. WE-PICK $2.00 lb. 19478 Dewdney Trunk Rd. Pitt Meadows.Call 604-763-2808 or 778-237-4032

    CHERRY JUBILEE Sour Cherries2014 HARVEST SEASON

    July 16 - July 27 (Closed July 20th)8:00a.m. - 3:00p.m.

    2017 - 272nd Street, AldergrovePlace Your Order: 604-856-5844

    560 MISC. FOR SALE

    KILL BED BUGS & THEIR EGGS! Buy Harris Bed Bug Killer Complete Treatment Program or Kit. Available: Hardware Stores, Buy Online: homedepot.comKILL ROACHES! Buy Harris Roach Tablets. Eliminate Bugs - Guaran-teed. No Mess, Odorless, Long Lasting. Available online only @ Ace Hardware & The Home DepotSTEEL BUILDINGS/METAL BUILDINGS 60% OFF! 20x28, 30x40, 40x62, 45x90, 50x120, 60x150, 80x100 sell for balance owed! Call 1-800-457-2206 www.crownsteelbuildings.ca.STEEL BUILDINGS...SUMMER MELTDOWN SALE! 20X20 $5,419. 25X26 $6,485. 30X30 $8,297. 32X34 $9,860. 40X48 $15,359. 47X68 $20,558. Front & Back Wall Included. Pioneer Steel 1-800-668-5422 www.pioneersteel.ca

    563 MISC. WANTED

    FIREARMS. All types wanted, es-tates, collections, single items, mili-tary. We handle all paperwork and transportation. Licensed Deal-er.1.866.960.0045.www.dollars4guns.com.

    REAL ESTATE

    609 APARTMENT/CONDOS

    $159,000 - #9-45 FourthColumbia Skytrain Stn at your

    doorstep 1 bdrm 645sf NE facing, PETS OK.

    Pat Ginn, 604-220-9188 Sutton Westcoast

    612 BUSINESSES FOR SALE

    For Lease $1500 pm or for sale $699,000 Gas Bar/Gro-cery Store, Fruit Stand, Restaurant, lots parking,7500 sq.ft. bldg on Trans Canada Hwy, Sicamous. 1 (250)309-0975

    DREAMING... of a NEW CAREER?Check out bcclassified.coms

    Employment and Career Sections in the 100s for information

    604-575-5555

    REAL ESTATE

    615 COMMERCIAL PROPERTY

    FOR LEASE OFFICES FOR - DOCTORS, CHIROPRACTORS, MEDICAL SPECIALISTS, NATU-ROPATHS or RETAIL PREMISES for LEASE by Burnaby General Hospital LESS THAN ONE BLOCK FROM BURNABY GENERAL HOS-PITAL - ALMOST 900 square feet. Available NOVEMBER 1st or SOONER. INCLUDES 4 PARKING SPOTS, STORAGE, APPLIANCES AND TELEPHONE SYSTEM. ONLY $3,500 per month, triple net or best offer. Please call 604.331-2505 for more information

    627 HOMES WANTED

    WE BUY HOMES BC All Prices All Situations

    All Conditions www.webuyhomesbc.com

    604-657-9422

    PRIMELAKEVIEW LOTS

    FROM $140,000Also; Spectacular 3 Acre

    Parcel at $390,0001-250-558-7888

    www.orlandoprojects.com~ FINANCING AVAILABLE ~

    630 LOTS

    2.5 ACRE LOTS, LUMBY, BC Mabel Estates 5 mins from town, pristine lush views. De-signed and ready to build. Wells & power at lot. Starting, $139,000, $50,000 below as-sessed value. 250-317-2807.

    RENTALS

    706 APARTMENT/CONDO

    Burnaby NELSON PLACE TOWNHOMES

    2701 2755 Bainbridge Ave.

    Renod 2 & 3 Bdrm Townhomes 2 Level, Private Enclosed Yard,

    Laminate Flrg, Huge Storage Rm Nr Sperling Skytrain & elem schls

    Pets Ok! From $1300/mo. 604.540-2028 or 778.714-7815

    COQUITLAMWelcome Home !

    1 Bedrooms available near Lougheed Mall and transit. Rent includes heat & hot water. Sorry No Pets. Refs required.

    Call (604) 931-2670

    MAPLE RIDGE. Large, new 1 bdrm & den grnd fl r apt. Luxurious, s/s appls, granite counters, prkg, F/P. $1100. Avail now. 604-730-6957NEW WEST, 1 Bdrm, 621 Colborne Ave. No pets, close to all amens, New fl ooring, completely renovated.$735/mo. Avail Aug 1st or ASAP. 604-454-4540 or 778-867-2531

    PARKVIEW TOWERSGrange St & McMurray Ave

    Deluxe 1, 2, 3 bdrm rentalsFitness centre, pool, close to

    Metrotown SkytrainAVAILABLE NOW!

    Call or e-mail: 604.433.5321 / parkviewtowers@

    bentallkennedy.comwww.rentparkview.com

    Proudly Managed by BentallKennedy Residential Services

    752 TOWNHOUSES

    PITT MEADOWS: 2 - 3 bdrm co-op T/H $1097/mo - $1199/mo. Shares reqd. Close to WCE, schools & shopping. No subsidy available. 19225 119th Ave. For more info & to book an appt. call 604-465-1938

    TRANSPORTATION

    810 AUTO FINANCING

    Auto Financing Dream Team - www.iDreamAuto.com or call 1.800.961.7022

    WERE ON THE WEBwww.bcclassified.com

    TRANSPORTATION

    810 AUTO FINANCING

    818 CARS - DOMESTIC

    2011 CHEV AVEO 4/dr Sedan, automatic, grey, 65,000/kms.$6000 fi rm. Call 604-538-9257.

    838 RECREATIONAL/SALE

    1995 Deluxe Elkhorn 10.5 Camper. Loaded, Exc cond! $5500/obo. Truck also avail.Call 604-317-7886 (Langley)

    845 SCRAP CAR REMOVALThe Scrapper

    TOP CA$H PAID TODAY For SCRAP VEHICLES! 2 hr. Service www.a1casper.com (604)209-2026

    #1 FREE SCRAP VEHICLE REMOVAL

    ASK ABOUT $500 CREDIT $$$ PAID FOR SOME

    604.683.2200AAA SCRAP CAR REMOVAL

    Minimum $150 cash for full size vehicles, any cond. 604-518-3673

    847 SPORT UTILITY VEHICLES

    2009 TOYOTA RAV4 LIMITEDV6, 3.5L, 4/dr, 4WD, 5spd, 83K. Pyrite colour, leather int, satellite radio, Bluetooth, a/c, pwr sunroof, heated front seats, rear fold-down seat, push button/smart key.

    One owner, non-smoker. LOADED! Exc Cond! $19,950

    604-338-4114

    REPAIRERS LIEN ACT Whereas, Jason, indebted to

    Mint Auto Body for repairs on a 1998 Mercedes VIN:

    WDBFA67FXWF160203. There is presently an amount due and

    owing of $12,000 plus any additional costs of storage, and sale. Notice is hereby given that

    on the 5th day of August, 2014 or thereafter, the said vehicle will be

    sold. For more information call Mint Auto Body LTD.

    604-433-1207

  • A16 NewsLeader Wednesday, July 23, 2014

    Oil Changes

    Vehicle Diagnostics

    PreventativeMaintenance

    Brakes

    SUMMER SPECIAL

    OUR SERVICES INCLUDE: Oil Changes Brakes Tune-Ups Custom Exhaust

    Transmission Suspension Engine Repair Fuel Injection

    Electrical Repair Air Conditioning Cooling systems Tire Repair

    3D Wheel Alignments Tire Sales Vehicles Diagnostics Power Steering

    SUMMER SPECIAL$1888Oil Change

    5L of Reg. Oil+ Oil Filter

    $5999Synthetic Oil

    5L + Oil Filter

    We BeatAny Written Estimates

    Fleet Services 3D Alignments

    AC Specialists Full Mechanical Services

    FOR INQUIRIES CALL: 604-436-5221 5587 Imperial Street, Burnaby

    info@autoservicedepot.ca | www.autoservicedepot.caPRICES IN EFFECT UNTIL AUGUST 15, 2014

    50% OFF*BRAKES

    Fleet Services AC Specialists 3D Alignments

    AC Specialists Full Mechanical Services

    *Some restrictions may apply