Brain-Derived Neurotrophic Factor Expression Is Increased in theHippocampus of 5-HT2C Receptor Knockout Mice

Rachel A. Hill,1* Simon S. Murray,2,3 Paul G. Halley,1 Michele D. Binder,2,3 Sally J. Martin,1

and Maarten van den Buuse1

ABSTRACT: Several studies have suggested a close interactionbetween serotonin (5-HT) and BDNF; however, little is known of thespecific relationship between BDNF and the 5-HT2C receptor. Therefore,in this study we investigated BDNF expression in 5-HT2C receptorknockout mice (5-HT2CKO). We also assessed functional consequencesof any changes in BDNF using a behavioral test battery. Western blotanalysis demonstrated a significant 2.2-fold increase in the expression ofthe mature form of BDNF in 5-HT2CKO mice when compared with wild-type controls (WT) in the hippocampus (P 5 0.008), but not frontal cor-tex or striatum. No differences in the expression of the pro-BDNF iso-form were found, and the ratio of mature/pro BDNF was significantlyincreased in 5-HT2CKO (P 5 0.003). BDNF mRNA expression in the hip-pocampus was not different between the genotypes. Hence, increasedmature BDNF levels in 5-HT2CKO hippocampus are most likely due toincreased extracellular cleavage rates of pro-BDNF to its mature form.Protein expression of the BDNF receptor, tropomycin-related receptor B(TrkB), was also unchanged in the hippocampus, frontal cortex and stria-tum. With repeated training in a 10-day win-shift radial arm maze task,5-HT2CKO and WT showed similar decreases of the number of workingmemory and reference memory errors. In addition, no genotype specificdifferences were observed for passive or active avoidance learning. 5-HT2CKO showed modest locomotor hyperactivity but no differences intests for anxiety, sensorimotor gating, or depressive-like behaviors; how-ever, in the tail suspension test 5-HT2CKO showed significantly reducedclimbing (P < 0.05). In conclusion, loss of 5-HT2C receptor expressionleads to a marked and selective increase in levels of the mature form ofBDNF in the hippocampus. Despite this marked increase, 5-HT2CKOshow only subtle behavioral changes. VVC 2010 Wiley-Liss, Inc.

KEY WORDS: serotonin; depression; neurotrophin; memory; cognition

INTRODUCTION

Depression is one of the most common of all mental health disorders,affecting approximately one in five individuals at some stage in theirlives. Although several lines of treatment currently exist, the most com-

mon antidepressants prescribed are selective serotoninreuptake inhibitors (SSRIs). However, antidepressanttreatment is only effective in about 50–70% ofdepressed patients, and several do not respond at all,or relapse (Kemp, 2009). In addition, most treatmentsare slow acting, with a two–three week lag periodbefore any beneficial effects are observed. Current the-ories to account for this delay include slow desensiti-zation of receptors involved in monoamine release,such as 5-HT1A or 5-HT2C receptors, or activation ofdownstream signaling pathways, such as neurotro-phins, which takes two–three weeks to manifest(Schechter et al., 2005). Several studies have indicatedthat antidepressant treatment leads to changes in theproduction (Altar, 1999) and expression (Nibuyaet al., 1995) of the neurotrophin, brain-derived neuro-trophic factor (BDNF), in the brain. In addition,infusion of recombinant BDNF into the midbrain(Siuciak et al., 1997) or hippocampus (Shirayamaet al., 2002) produces antidepressant-like effects inanimal models of depression. These antidepressanteffects of midbrain BDNF infusion are thought to bedue to regulation of monoaminergic pathways whichproject to the hippocampus and frontal cortex (Siu-ciak et al., 1997).

Brain-derived neurotrophic factor is the most com-mon neurotrophic factor in the brain and is abundantthroughout the central nervous system. Functionally,BDNF plays a role in several integral mechanisms, suchas neuronal survival and migration, axonal and dendri-tic growth, and synaptic plasticity (Martinowich andLu, 2008). Such functions of BDNF are mediated bythe activation of its receptors, TrkB and p75NTR.BDNF is initially synthesized as a precursor (pro-BDNF, 32kDa) which may then be cleaved to itsmature form, mature BDNF (mBDNF, 13.5kDa)(Mowla et al., 2001). The mature form of BDNF bindsto both TrkB and p75NTR, albeit most of its effects areattributed to TrkB activation (Woo et al., 2005). Uponbinding, BDNF-TrkB activation triggers a number ofintracellular signaling pathways, including MAP kinaseor ERK kinase-mitogen-activated protein kinase(MEK-MAPK), phosphatidylinositol-3-kinase (PI-3-K), and phospholipase C-g (PLC-g) (Martinowich andLu, 2008). In contrast, pro-BDNF binds with a higheraffinity to a receptor complex consisting of p75NTR and

1Behavioral Neuroscience Laboratory, Mental Health Research Institute,Parkville, Victoria, Australia 3052; 2Center for Neuroscience, Universityof Melbourne, Parkville, Victoria, Australia; 3 Florey NeuroscienceInstitute, c/- University of Melbourne, Parkville 3010, AustraliaGrant sponsor: National Health and Medical Research Council ofAustralia.*Correspondence to: Dr. Rachel Hill, Behavioral Neuroscience Labora-tory, The Mental Health Research Institute of Victoria, 155 Oak St., Park-ville, VIC 3052, Australia. E-mail: r.hill@mhri.edu.auAccepted for publication 17 November 2009DOI 10.1002/hipo.20759Published online 19 January 2010 in Wiley Online Library(wileyonlinelibrary.com).

HIPPOCAMPUS 21:434–445 (2011)

VVC 2010 WILEY-LISS, INC.

sortilin, and pro-BDNF—p75NTR activation has been linked tothe induction of apoptosis (Teng et al., 2005) and facilitation ofhippocampal long-term depression (Woo et al., 2005). Withinthe hippocampus BDNF regulates synaptic plasticity related tolearning and memory mechanisms, and decreased BDNF expres-sion in the hippocampus has been correlated with stress-induceddepressive behaviors (Martinowich and Lu, 2008).

Several studies have demonstrated an interaction betweenBDNF and serotonin (5-HT) in the hippocampus. Indeed,both acute (Kozisek et al., 2008) and chronic (Deltheil et al.,2008b) administration of selective serotonin reuptake inhibitors(SSRIs) increased both mRNA and protein expression ofBDNF in this brain region (Deltheil et al., 2008a). Conversely,5-HT depletion in the hippocampus decreased mRNA expres-sion of BDNF in rats and, in addition, caused increased anxi-ety-like behavior and learning impairments (Zhou et al., 2008).Hence, there is a clear relationship in the hippocampusbetween BDNF and serotonin, which may play a role in theregulation of anxiety, memory, and learning processes. How-ever, the specific serotonin receptors involved in this relation-ship remain to be established.

Serotonin 5-HT2C receptors are G-protein coupled receptorsthat are linked to several cellular signaling pathways (Berget al., 2008). They are widely expressed throughout the cortico-limbic system, including the frontal cortex, hippocampus, andnucleus accumbens, and are also localized to the ventral teg-mental area. Functionally, the 5-HT2C receptors exert inhibi-tory effects upon the dopaminergic and noradrenergic pathwaysand their activity has been implicated in several disordersrelated to dopaminergic dysfunction including depression,schizophrenia and Parkinson’s Disease (Millan et al., 1998;Gobert et al., 2000; Berg et al., 2008). In the hippocampus,5-HT2C receptor activation has been implicated in the effectsof 5-HT on learning and memory (Berg et al., 2008). Althoughlittle is known on the relationship between the 5-HT2C recep-tor and BDNF, one recent study has found that chronic admin-istration of the 5-HT2C receptor antagonist, S32006, leads toincreased BDNF mRNA expression in the dentate gyrus (DG)of rats (Dekeyne et al., 2008). This study suggests a possibleinteraction between the 5-HT2C receptor and BDNF expres-sion. Mice with deletion of the 5-HT2C receptor gene (5-HT2C

receptor knockout, 5-HT2CKO) display an overweight pheno-type due to appetite disruptions and are reportedly prone tospontaneous death from seizures (Tecott et al., 1995). In thisstudy, we used these mice to gain a better understanding of theinteraction between 5-HT2C receptors and BDNF. We alsoassessed functional consequences of any changes in BDNFexpression in these animals using a behavioral test battery.

METHODS

Animals

5-HT2CKO and wild-type controls (WT) were derived froma breeding colony at the Mental Health Research Institutewhich was established with breeders purchased from The Jack-

son Laboratory (B6.129-Htr2Ctm1Jul/J, JAX Mice and Services,Bar Harbor, Maine, USA). The animals were genotyped byPCR according to the Jackson Laboratory genotyping protocoland housed under standard conditions with ad libitum accessto water and mouse chow. The weight of 5-HT2CKO mice was23–29 g (mean 26.16), while WT controls weighed between21 and 32 g (mean 25.7) at 10–16 weeks of age. Mice werekilled by cervical dislocation, their brains removed and eithersnap frozen whole, or dissected in RNA later and snap frozenin dry ice for protein or RNA extraction. All experimental pro-cedures were approved by the Animals Experimentation EthicsCommittee of the Howard Florey Institute, University OfMelbourne, Australia.

Protein Extraction

Tissue samples were weighed and the appropriate amount oflysis buffer [1 M Tris HCl, 10% SDS, glycerol, dH2O and1 3 protease inhibitor tablet (Sigma, Castle Hill, NSW, Aus-tralia)] was added according to the weight (1,000 ll per 100lg). Samples were sonicated and subsequently incubated at958C for 10 min. After centrifugation for 30 min at 14,000g,the resulting supernatant was transferred to a new eppendorfand 1 ll was used for protein assay using the Bradford proteinassay kit (Bio-Rad Laboratories, Hercules, CA).

Western Blot Analysis

Western blot analysis was performed on protein lysatesextracted from the hippocampus, frontal cortex and striatum of10–16 week old male 5-HT2CKO and WT. Sample volumerequired for 20 lg of protein was added along with an equalvolume of loading buffer (9 mL lysis buffer, 1 mL b-mercapto-ethanol, 4 lg bromophenol blue). In addition, as positive con-trols, recombinant pro-BDNF and mature BDNF (generouslydonated by Dr. Simon Murray) were added to some lanes.Samples were then denatured for 5 min at 1008C before SDS–PAGE (15% or 10% acrylamide gel, 120 V, 1.5 h) and trans-ferred to a nitrocellulose membrane. Primary antibodies wererabbit anti-BDNF (N-20, 1:1,000, Santa Cruz Biotechnology,Santa Cruz, CA), rabbit anti-pro-BDNF (1:2,000, Abcam,Cambridge, MA), rabbit anti-TrkB (H-181, 1:500, Santa CruzBiotechnology, Santa Cruz, CA) or mouse anti-b-tubulin(1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA). Primaryantibody was incubated with the membrane overnight at 48C.The next day, the membrane was incubated with either anti-rabbit or anti-mouse IgG HRP-linked secondary antibodies(Cell Signaling, Danvers, MA). Images were captured using theLuminescence Image Analyzer (Fuji film LAS-4,000, FujiFilmLife Science, Stamford, CT), and analyzed using Multi Gaugesoftware (FujiFilm Life Science, Stamford, CT). BDNF and TrkBexpression levels were then normalized against levels of the housekeeping gene, b-tubulin. Each Western blot assay was repeatedtwo–three times on three different cohorts of animals.

BDNF EXPRESSION IN 5-HT2CKO MICE 435

Hippocampus

Quantitative PCR (qPCR)

RNA was extracted from hippocampal and frontal cortexsamples using the Trizol, Tri reagent (Sigma, St Louis, MO),method of RNA extraction. Prior to use in qPCR analysis,RNA was incubated with 1U of DNase/lg RNA (Roche, India-napolis, IN) for 2 h at 378C. cDNA was prepared from RNAat a concentration of 1.0 lg/100 ll reaction volume using Taq-man Reverse Transcription reagents (Applied Biosystems, FosterCity, CA) according to the manufacturer’s instructions. Quanti-tative PCR was performed on an ABI7700 sequence detectionsystem (Applied Biosystems, Foster City, CA) using the com-parative Ct method (Livak and Schmittgen, 2001). Primers forqPCR were designed using Primer Express 1.5 (Applied Biosys-tems, Foster City, CA). Sequences of primers were: 18S For-ward: 50CGGCTACCACATCCAAGGAA30, Reverse: 50GCTGGAATTACCGCGGCT30, BDNF Forward: 50AGCGGCTTCACAGGAGACA30, Reverse: 50TGTAGCTATGATGTATCTTAGTGGGTAAGA30. SYBR green (Applied Biosystems, FosterCity, CA) was used to determine relative Ct values accordingto manufacturer’s instructions. All reactions were run as single-plex reactions using 5 ll of cDNA template per reaction andthe 22DDCT value expressed relative to 18S (Livak and Schmitt-gen, 2001). All changes are shown as relative expression values.

Immunohistochemistry

Frozen brains were sectioned at 10 lm throughout the hip-pocampus and mounted on gelatin-coated slides. These werewashed in phosphate buffered saline (PBS) for 2 3 5 min,then incubated for 30 min in phosphate-buffered formalin.Slides were then washed for 3 3 5 min in PBS and subse-quently incubated in ice cold 100% methanol for 30 min. Fol-lowing washing, 3 3 5 min in PBS, sections were blocked in1% milk in phosphate buffer for 1 h at room temperature.Blocking solution was then tipped off and slides were incubatedin a humidified chamber at 48 overnight with primary antibodyrabbit anti-BDNF (1:50 in 2% BSA in PB, Santa Cruz bio-technology, Santa Cruz, CA). The next day, slides were washedin PBS for 3 3 5 min, then incubated for 1 h in a humidifiedchamber at room temperature, in the dark, with secondaryantibody (Alexa Fluor1 488 goat antirabbit IgG, 1:400, Mo-lecular Probes, Eugene, OR). Slides were again washed inPBS for 2 3 5 min and then mounted in dim light withVectashield hard set mounting medium with 40,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA).

Radial Arm Maze Learning

To assess learning and memory performance, mice weretrained using a three-out-of-eight arms baited protocol, a varia-tion of that previously described (He et al., 2002). This hippo-campus-dependent spatial learning paradigm allowed the simul-taneous assessment of both short-term (working) and long-term(reference) memory in 5-HT2CKO mice and WT over 10 days.The radial maze apparatus (TSE Systems, Hamburg, Germany)was constructed from gray plastic and consisted of a central

arena (18 cm in diameter) and eight radial arms (15 3 6 328 cm3). Access to the arms could be controlled by means ofan automated guillotine door at each entrance, and a food cup(2 cm in diameter) was located at the far end of each arm. Theradial maze was fully automated, containing infrared sensorsthat could detect and record the location of the animal at alltimes. All testing was carried out in a quiet well-lit room, con-taining a number of extra-maze spatial cues which remainedconstant for the duration of the study.

For three days prior to their introduction to the maze, allmice were put on a restricted diet until a target ‘‘fooddeprived’’ weight was reached (�80–85% of starting bodyweight). This was followed by two consecutive days of habitua-tion, whereby mice were placed in the center of the maze for30 s, after which all doors were opened and the animal wasallowed to freely explore the maze for 10 min. During thistime all eight arms were baited with food (�20 mg ofKellogg’s� fruit loops). The next 10 days consisted of 10 con-secutive training sessions, comprising of six trials per day. Aspart of the training task, only three arms were baited with foodeach day, according to the sequence: two adjacent arms, onearm skipped and the next arm baited (e.g., arms 3, 4, 6). Thelocation of food was different for each mouse and remainedconsistent for the 10-day period. To eliminate any olfactorycues, a fruit loop was placed behind the back wall of each armthroughout the study. For each trial, mice were again placed inthe center of the maze, facing in the same direction, for 30 sand then allowed to explore the maze for a maximum of 5min, or until it had found all three food pellets. During eachtrial, the number of working memory errors (the mouse re-enters an arm previously visited in the same trial) and referencememory errors (the mouse enters an arm that does not containfood) was automatically recorded by the maze software. Dataobtained were used to generate learning curves for both work-ing and reference memory over the 10-day period.

Active and Passive Avoidance Learning

Separate cohorts of 5-HT2CKO and WT mice were alsoassessed for either active avoidance or passive avoidance learn-ing, using the GEMINI system (San Diego Instruments, USA).The two-way automated shuttle-box apparatus consisted of atest chamber, subdivided into two equal-sized compartments bya wall with a motorized guillotine door, and contained a gridfloor made from independently electrified stainless steel bars.Photocells, located just above the chamber floor, recorded thelocation of the animal at all times.

The active avoidance protocol used was a variation of onedescribed previously (Chioca et al., 2008). The mice wereallowed a 3-min habituation period, after which they were sub-jected to seven trials. During each trial the animal was pre-sented with a 7-s conditioned stimulus (a light cue in the com-partment in which it was located) that was paired with a mild,3 s 2 mA footshock. To avoid this footshock the mouse wasrequired to move to the opposite compartment within the ini-tial 4 s of the conditioned stimulus, at which point both the

436 HILL ET AL.

Hippocampus

light and shock would be disabled. Training was carried out inan identical manner (i.e., seven trials per day) for five days.Learning was represented by an increase in the number ofshocks avoided over this five-day period.

Also passive avoidance testing was carried out as describedpreviously (Wang et al., 2003). Briefly, the guillotine door wasclosed and the mouse was placed in the right side compart-ment. Following an acclimation period of 30 s, the house lightin this compartment was switched on and the guillotine doorwas raised. When the animal moved from the light compart-ment to the adjacent dark compartment, the door was shutand a mild, inescapable 2-mA foot shock was delivered for 2 s.Each animal underwent a training session consisting of five tri-als. Training was carried out to criterion whereby if the mouseremained in the light compartment for the maximum 300 s,on two out of the five trials, it was adjudged to have success-fully acquired the task. Memory recall was assessed one, four,and seven days later, during which each animal was subjectedto a single trial. This test session ended when the animalcrossed over to the dark compartment (failed) or remained inthe light compartment for 300 s (passed). No shock wasadministered during recall trials. Memory performance wasmeasured as the latency of each animal to cross over to thedark compartment.

Forced Swim Test

Mice were individually placed in a 2-L glass cylinder (24 cmin diameter), which was filled with �1.5 L of water (15 cm inheight) at a temperature of 25 6 28C. Each animal was forcedto remain in the water for 6 min, during which period theamount of time spent swimming, immobile, and climbing wasrecorded. In this case, immobile was defined as floating, with-out struggling and with minimal effort, while swimming meantthat all paws were simultaneously moving. The animal wasconsidered to be climbing when all four limbs were in a verti-cal position against the side wall, as if attempting to escape.Testing was carried out on two consecutive days in a well-lit,quiet room. Data analysis was based on behaviors scored dur-ing the last 4 min of each session.

Tail Suspension Test

Mice were suspended, by adhesive tape that was placedapproximately 1.5 cm from the tip of the tail, for 6 min. Allanimals were tested twice on two consecutive days in a well-lit,quiet room. All sessions were recorded and each animal wasscored for the amount of time spent immobile, moving andclimbing up the tail during this period.

Elevated Plus Maze

The elevated plus maze test was carried out as previouslydescribed (van den Buuse et al., 2007). Briefly, the apparatuswas constructed from opaque gray plastic and consisted of fourarms (6 cm wide 3 36 cm long), attached at right angles to acentral platform. Two arms were enclosed by 30-cm-high walls,

while the other two were left open, and the maze was elevated30 cm off the floor. All testing was carried out and recorded ina quiet room in dimmed light. Mice were placed in the centerof the maze and allowed to freely explore all four arms for 10min, during which time the number of entries into each arm,as well as the total number of arm entries (open and closed)were recorded. The number of visits to the open arms wasexpressed as a percentage of the total arm entries for eachgroup.

Emergence Test

The emergence test carried out was a modified version ofthat previously described (Minor et al., 1994). The apparatusconsisted of an open field arena (40 3 28 3 12 cm), the floorof which was covered with saw dust. A small cardboard‘‘escape’’ box (7 3 7 3 12 cm3) was located at one end of thearena. Mice were individually placed into the open field, withtheir head facing the opening of the escape box, and for 10min the amount of time the animal spent outside the escapebox was recorded.

Locomotor Activity

Mice were individually placed in locomotor boxes (27 3 273 40 cm3) (TruScan, Coulbourn Instruments, Whitehall, PA)in a quiet, well-lit room. Horizontal activity was detected by32 photocells, situated 2 cm above the floor of the arena andspaced at 0.76-cm intervals, generating an infrared grid. Loco-motor boxes were fully automated and movement was meas-ured by the number of infrared beams crossed by the animalover a 1-h session. Testing was carried out for five consecutivedays. Preliminary data analysis showed habituation during eachsession but no habituation over the five days of testing. There-fore, we calculated the average locomotor activity over the fivedays of testing during the first and last 30 min of the sessions.

Prepulse Inhibition of Startle Response

Prepulse inhibition (PPI) of up to eight mice was simultane-ously measured using automated startle chambers (SR-Lab; SanDiego Instruments, San Diego) as previously described (vanden Buuse et al., in press). The animals were placed in a plexi-glass cylinder, within a well-lit sound attenuating cabinet. Thecylinder was attached to a motion sensor which measuredwhole-body startle responses in arbitrary units. A PPI sessionconsisted of a 3-min acclimatization period followed by 104trials. The first and last eight trials consisted of a 40 ls burstof 115 dB of white noise (pulse-alone startle stimuli). The mid-dle 88 trials consisted of a pseudorandomized delivery of 16additional pulse-alone stimuli and 64 trials in which a prepulsewas given at 2, 4, 8, or 16 dB above background noise fol-lowed by the 115 dB pulse after either a 30 or 100 ms intersti-mulus interval (ISI). In addition, there were eight trials duringwhich no stimulus was delivered. Percentage PPI was calculatedas 5 (average response to pulse trials 2 average response toprepulse-pulse trials)/average response to pulse trials 3 100.

BDNF EXPRESSION IN 5-HT2CKO MICE 437

Hippocampus

Statistical Analysis of Behavioral Data

All data are expressed as mean 6 standard error of the mean[standard error of mean (SEM)]. Statistical analysis on WesternBlot results was done by nonparametric Mann-Whitney U test(GraphPad Prism version 5.00 for Windows, GraphPad Soft-ware, San Diego, CA). Passive avoidance behavior was analyzedusing Chi-square test. Data from all other behavioral experi-ments was analyzed using analysis of variance (ANOVA) withrepeated measures where appropriate (Systat 9.0, SPSS Inc,Chicago, IL). If P-values were less than 0.05, differences wereconsidered to be statistically significant.

RESULTS

Western Blot Analysis for Protein Expressionof BDNF in 5-HT2CKO Mice

The antibody for mature BDNF revealed a band at theexpected size of 13.5 kDa, as shown by the recombinantmature BDNF positive control (Fig. 1A). The pro-BDNF anti-body revealed a band at the appropriate size of 32 kDa, whichagain corresponded to the size of the recombinant positive con-trol (Fig. 1B).

Western Blot analysis demonstrated a region-specific increasein mature BDNF expression in 5HT2CKO mice when com-pared to WT controls (Figs. 1 and 2). Densitometry revealeda significant 2.2-fold increase in the expression of the matureform of BDNF in the hippocampus of 5HT2CKO mice com-pared to WT controls (Fig. 1A, P 5 0.008). However, no sig-nificant differences were found in the expression of pro-BDNF(Fig. 1B). Consequently, the ratio of mature- to pro-BDNFwas significantly increased in the hippocampus of 5-HT2CKO

when compared to WT controls (Fig. 1C, P 5 0.003). Nosignificant differences were found in the expression of matureand pro-BDNF within the frontal cortex (Fig. 2A) and thestriatum (Fig. 2B). However, within the striatum, there was atrend for an increase in mature BDNF expression (Fig. 2B,P 5 0.09).

Western Blot Analysis for Protein Expressionof TrkB in 5-HT2CKO Mice

Protein expression analysis of the BDNF receptor, TrkB,revealed two bands at the expected size of �95 kDa (truncatedTrkB) and 140 kDa (full length TrkB) (Fig. 3A). Densitometryanalysis revealed no significant differences in TrkB proteinexpression in the hippocampus (Fig. 3B), frontal cortex (Fig.3C) and striatum (Fig. 3D). Hence, despite significant altera-tions in the protein expression of mature BDNF within thehippocampus, no changes in the expression of the BDNF re-ceptor, TrkB, were evident.

qPCR Analysis for mRNA Expression ofBDNF in 5-HT2CKO Mice

RNA expression of BDNF, as determined by qPCR analysis,was unchanged in the hippocampus (Fig. 4A) and frontal cor-tex (Fig. 4B) of 5-HT2CKO mice when compared with WTcontrols.

BDNF Immunoreactivity in the Hippocampus of5-HT2CKO Mice

Immunohistochemical staining of 5-HT2CKO and WTdorsal hippocampus showed that protein expression of BDNFis highest within the stratum lacunosum moleculare (LMol)and, to a lesser extent, within the polymorphic layer of the

FIGURE 1. Western blot analysis of mature BDNF (13.5 kDa)and pro-BDNF (32 kDa) expression in the hippocampus of 5-HT2CKO compared with WT control. A: Typical example blot ofmature BDNF expression, (positive control in Lane 1) and abso-lute values of mature BDNF expression divided by b-tubulin con-

trol. B: Typical example blot of pro-BDNF expression, (positivecontrol in Lane 1) and absolute values of pro-BDNF expressiondivided by b-tubulin control. C: Ratio of mature BDNF expressiondivided by pro-BDNF expression. In all cases n 5 10–12 pergroup. *P < 0.05 from WT controls.

438 HILL ET AL.

Hippocampus

dentate gyrus (Figs. 5A,B). Within the CA1 and CA2, lightBDNF-immunoreactive staining surrounded a small numberof cell nuclei (counter-stained with DAPI) in the pyramidalcell layer. In the stratum radiatum of the CA1, a high levelof BDNF staining was evident in the fibers (Figs. 5A,B). Inthe LMol, high levels of BDNF staining tended to surroundthe cell nuclei (Figs. 5C,D). Moderate levels of BDNF stain-ing were expressed in the fibers of the polymorphic and gran-ular layers of the dentate gyrus, with punctate staining aroundthe cell nuclei of the polymorphic layer and the marginbetween the polymorphic layer and granular layer (Figs.5E,F). Light BDNF staining was also seen within the fibersof the stratum lucidum and stratum oriens of the CA3 region(not shown).

Consistent with the Western blot results, we found markedlygreater BDNF staining in the hippocampus of 5-HT2CKO

mice when compared with WT controls (Figs. 5A,B). This up-regulation of BDNF seemed to be most prominent within theLMol (Figs. 5C,D). BDNF expression also tended to be moreintense within the dentate gyrus of 5-HT2CKO when comparedwith WT controls (Figs. 5E,F).

Assessment of Learning and Memoryin 5-HT2CKO Mice

Following the observation that BDNF expression was sub-stantially increased in the hippocampus of 5-HT2CKO mice,we set out to examine the functional significance of this onlearning and memory performance using the radial arm maze,active avoidance, and passive avoidance paradigms (Fig. 6).ANOVA analysis of radial maze performance demonstrated thatboth groups of animals had successfully acquired the task, asreflected by a statistically significant decrease in the number ofworking memory errors (main effect of day, F(9,315) 5 18.8,P < 0.001) and reference memory errors over this trainingperiod (main effect of day, F(9,315) 5 25.2, P < 0.001).However, no significant genotype effect or genotype by timeinteraction could be detected for either working memory orreference memory performance.

Analysis of the active avoidance data revealed a statisticallysignificant increase in the number of trials passed (shocksavoided), for both 5-HT2CKO and WT mice over the fiveconsecutive training sessions (main effect of day, F(4,84) 59.131, P < 0.001). Again, no significant genotype effect orgenotype by time interaction was observed, indicating no dif-ferences in learning ability between the two groups (Fig. 6C).This was also the case with passive avoidance learning.Although a comparison of the medians for the single-triallatencies suggested a trend towards a reduction in memoryretention in the 5-HT2CKO mice during recall testing (Fig.6D), chi-square analysis of the pass/failure scores for bothgroups found no genotype-specific differences in memoryperformance.

Thus, the increase in hippocampal BDNF expression did nottranslate to an improvement in learning ability during this task.

Assessment of Depressive-Like Behaviorin 5-HT2CKO Mice

5-HT2CKO mice and WT were also compared using twotests for depressive-like behavior, the forced swim test and tailsuspension test. The extent of this depressive-like behavior wasjudged by the amount of time spent immobile by the animalsduring each task. Analysis of forced swim test data revealed nodifferences in the amount of time spent immobile by eithergroup (Fig. 7A). Furthermore, no differences in the amount oftime spent climbing could be observed between the twogroups, reflecting a relatively low level of agitation in allanimals.

Similar observations were made for the tail suspension test,as again no significant differences could be detected for immo-bility between the groups. However, the 5-HT2CKO mice spent

FIGURE 2. Western blot analysis of mature BDNF (13.5 kDa)and pro-BDNF (32 kDa) expression in the (A) frontal cortex, and(B) striatum, of 5-HT2CKO compared with WT control. n 5 8–12per group.

BDNF EXPRESSION IN 5-HT2CKO MICE 439

Hippocampus

significantly less time climbing up their tails than their WT lit-termates (Fig. 7B, F(1, 14) 5 8.0, P 5 0.014).

Assessment of Anxiety-Like Behaviorin 5-HT2CKO Mice

Levels of anxiety and exploratory behavior were measured inWT and 5-HT2CKO mice using the elevated plus maze andemergence test. During the plus maze, both groups of animalsexhibited similar levels of exploratory behavior, as reflected bythe total number of arms visited within the 10-min period (Fig.7C). In addition, no significant difference could be seen for thepercentage time spent in the open arms, suggesting no apparentgenotype-specific variation in anxiety response. This was furtherreflected in the emergence test, as both groups of animals wereseen to spend a similar amount of time outside the escape box,during the first and last 5-min intervals (Fig. 7D).

Assessment of Locomotor Activity andSensorimotor Gating in 5-HT2CKO Mice

Analysis of five-day locomotor activity in both groups ofanimals revealed significant hyperactivity in 5HT2CKO micecompared with WT, as represented by a greater distance trav-eled by these animals over the first 30 min [Fig. 7E, F(1,14)5 9.4, P 5 0.008]. However, this genotype difference dimin-

ished over time and was not evident during the second 30-minperiod.

ANOVA of the average startle and PPI data revealed noeffect of genotype (Fig. 7F). There was also no genotype differ-ence in the relationship between prepulse level and PPI, or instartle habituation (data not shown).

DISCUSSION

This study demonstrated a significant 2.2-fold increase inthe expression of the mature form of BDNF in 5-HT2CKOmice when compared with WT controls, which was specific tothe hippocampus and not found in frontal cortex or striatum.No differences in the expression of pro-BDNF, the BDNFreceptor, TrkB, or BDNF mRNA were found. There were nogenotype differences in learning and memory in a radial armmaze task, nor in tests for depressive-like behaviors, anxiety, orsensorimotor gating. 5-HT2CKO showed modest locomotorhyperactivity and reduced climbing in the tail suspension test.These results show that loss of 5-HT2C receptor expressionleads to a marked and selective increase in levels of the matureform of BDNF in the hippocampus, but only subtle behavioralchanges.

FIGURE 3. Western blot analysis of full length (FL) and truncated (Trunc.) TrkB expression in5-HT2CKO compared with WT control. A: Typical example blot of TrkB expression in the hippocam-pus. B: Absolute values of TrkB expression divided by b-tubulin control in the hippocampus, (C)frontal cortex, and (D) striatum. n 5 8–12 per group.

440 HILL ET AL.

Hippocampus

Increased hippocampal BDNF expression following loss of5-HT2C receptor function has been shown previously, aschronic administration of the 5-HT2C receptor antagonist,S32006, increased BDNF levels in the dentate gyrus of the hip-pocampus of rats (Dekeyne et al., 2008). However, in contrastto our results, 5-HT2C receptor antagonist treatment increasedBDNF mRNA expression (Dekeyne et al., 2008), whereas wefound no differences in mRNA expression but profoundincreases in protein expression. This difference between theeffect of pharmacological inhibition of 5-HT2C receptor func-tion and our results with 5-HT2C receptor knockout may bedue to species differences, developmental effects of the knock-out but not the drug treatment, or other methodologicalvariables.

In contrast to levels of mature BDNF, we observed no differ-ences in the expression of pro-BDNF between the genotypes.Consequently, the ratio of mature to pro-BDNF levels was sig-nificantly increased in 5-HT2CKO. Previous studies have alsoreported increases in the level of mature BDNF, with no

change in the precursor, pro-BDNF (Griesbach et al., 2009).In addition, it has recently been reported that it is mainly themature form of BDNF that is secreted from neurons, not pro-BDNF (Matsumoto et al., 2008). Hence the increase in matureBDNF that we have shown in this study may represent anincrease in BDNF secretion but not synthesis.

Our immunohistochemical studies found that BDNF proteinexpression was much more intense within the stratum lacuno-sum moleculare (LMol) and dentate gyrus of the dorsal hippo-campus of 5-HT2CKO mice when compared with WT. TheLMol consists of nonpyramidal interneurons, which extend tothe stratum radiatum and stratum oriens of the CA1 and mayalso project across the hippocampal fissure to the dentate gyrus(Lacaille and Schwartzkroin, 1988). Interneurons of the LMolare mostly GABAergic (Ribak et al., 1978), express high levelsof GABAB receptors, and are innervated by a high density ofserotonergic terminals originating from the dorsal raphe(Mamounas and Molliver, 1988; Gulyas et al., 1999).

Despite a significant 2.2-fold increase in hippocampal pro-tein expression of the mature form of BDNF, 5-HT2CKO miceshowed few behavioral changes. This may indicate that themarked up-regulation of BDNF levels in the hippocampus of5-HT2C receptor knockout mice is in fact a compensatorymechanism which the mice have developed in response to thelack of 5-HT2C receptors, enabling these animals to maintainnormal behavior, at least in the majority of tests we performed.It would then be of interest to assess the effect of inhibition ofBDNF synthesis or function, which would elicit more pro-nounced effects in the 5-HT2C receptor knockout mice than incontrols.

Previous studies in 5-HT2CKO mice have shown impairedlong-term potentiation (LTP) and abnormal performance dur-ing some aspects of Morris water maze learning (Tecott et al.,1998). However, this reduction of LTP was specific to thosesynapses within the medial perforant path afferents from ento-rhinal cortex (EC) and dentate granule cells, and was notdetected in any of the other major hippocampal excitatorypathways of these mice. Furthermore this memory impairmentobserved was selective to water maze recall as acquisition of thetask was normal in both groups of animals, and the mice didnot display a general learning impairment (Tecott et al., 1998).We could not detect any spatial learning deficit using the radialarm maze, although this may be due to the various differencesbetween the two paradigms used, such as a combination ofincreased exertion levels and stress on learning behavior in thewater maze, or the positive (food reward) vs. negative (escape)motivations for learning.

The observed lack of any differential effects on learning andmemory behavior in the 5-HT2CKO mice was interesting giventhe increase in hippocampal BDNF, which several studies havesuggested to facilitate learning-associated synaptic plasticity.There may be a number of possible reasons for this. Ourimmunohistochemical analysis revealed that the increase inBDNF expression was widely distributed within the LMol and,to a lesser extent, in the dentate gyrus. However, spatial learn-ing does not lead to a global activation of hippocampal neu-

FIGURE 4. qPCR analysis of mRNA expression of BDNF inthe (A) hippocampus, and (B) frontal cortex, of 5-HT2CKO micecompared to WT controls. n 5 5–6 per group.

BDNF EXPRESSION IN 5-HT2CKO MICE 441

Hippocampus

rons but rather specific subpopulations of pyramidal cell synap-ses, within the dorsal hippocampus, that are involved in theformation of the memory trace (O’Keefe and Dostrovsky,1971; Wilson and McNaughton, 1993; Hollup et al., 2001).Similarly, studies using partial hippocampal lesions have dem-onstrated the importance of neurons within the ventral hippo-campus during fear conditioning and avoidance learning, sug-gesting that regional dissociations are likely to exist within thisstructure (Ambrogi Lorenzini et al., 1997; Moser and Moser,1998; Bannerman et al., 2004). While a transient increase inBDNF expression occurs during normal learning (Ma et al.,1998), this effect is considered to occur in a controlled and ac-

tivity-dependent manner within these selective synapses (Lu,2003). Therefore, a sustained increase in BDNF expressionwithin certain areas of the hippocampus, as a result of 5-HT2C

receptor knockout, may not influence learning because it is notphasic or not actually expressed in specific synapses that areactive during the learning task.

The plasticity-associated effects of BDNF also appear to bedependent on activation of the TrkB receptor, the surfaceexpression of which can be regulated in an activity-dependentand synapse-specific manner (Nagappan and Lu, 2005). How-ever, while expression levels of TrkB are unchanged, the activityof the TrkB receptor (e.g., TrkB phosphorylation) may be

FIGURE 5. Immunohistochemical analysis of BDNF expres-sion (green) in the hippocampus of 5-HT2CKO mice, counter-stained with DAPI (blue). A: 5-HT2CKO dorsal hippocampus,310 magnification; B: WT dorsal hippocampus, 310 magnifica-tion and negative control in right hand corner; C: 5-HT2CKOCA1 region, 320 magnification; D: WT CA1 region, 320 magni-fication and negative control in right hand corner; E: 5-HT2CKO

dentate gyrus, 320 magnification; F: WT dentate gyrus, 320magnification and negative control in right hand corner. Scale bar5 100 lm. Rad, stratum radiatum; LMol, stratum lacunosummoleculare; Mol, molecular layer; Or, stratum oriens; Py, pyrami-dal layer; GrDG, granule layer dentate gyrus; PoDG, polymorphiclayer dentate gyrus.

442 HILL ET AL.

Hippocampus

affected by the increase in mature BDNF expression. Furtherstudies analyzing the expression of phosphorylated TrkB expres-sion will be needed to address this possibility.

In tests for anxiety (elevated plus maze and emergence test)and sensorimotor gating (PPI), no significant differences werefound between the genotypes. This lack of effect of increasedhippocampal BDNF on anxiety is consistent with previousreports of unchanged anxiety levels in the elevated plus maze inBDNF transgenic mice (Croll et al., 1999). Rats with phency-clidine induced up-regulation of BDNF in the corticolimbicsystem showed decreased PPI (Takahashi et al., 2006). Wefound no differences in PPI in 5-HT2CKO mice but thesemice showed increased BDNF expression in the hippocampusonly, as opposed to more widespread BDNF up-regulation inprevious studies (Takahashi et al., 2006).

Significant locomotor hyperactivity was found within thefirst 30 min of testing in 5-HT2CKO, but this differencediminished in the last 30 min once the mice habituated totheir novel environment. It is unlikely that this change in loco-motor activity reflects altered anxiety, as there were no differen-ces between 5-HT2CKO and WT in the elevated plus maze oremergence tests. Previous studies have linked both increased(Sauer et al., 1993; Li et al., 2007) and decreased (Kernieet al., 2000; Rios et al., 2001; Monteggia et al., 2004) BDNF

levels with locomotor hyperactivity. In contrast, others foundno effect on locomotor activity following selective loss ofBDNF in either the CA1 or dentate gyrus (Adachi et al.,2008). These conflicting reports suggest an involvement ofBDNF in locomotor activity; however, the exact region ofBDNF-mediated locomotor hyperactivity remains unclear.Interestingly, while the 5-HT2C antagonist, S32006, had noeffect on spontaneous locomotor activity, it blocked reducedlocomotor activity induced by the 5-HT2C agonist, m-chloro-phenylpiperazine (mCCP) (Dekeyne et al., 2008).

Increased BDNF expression in the hippocampus has beenassociated with decreased immobility time in the forced swimtest (Li et al., 2007). In addition, chronic administration of the5-HT2C antagonist, S32006, decreased forced swim test immo-bility time in rats (Dekeyne et al., 2008). We found no signifi-cant differences in time spent immobile in both the forced swimtest and the tail suspension test, indicating that chronic loss of 5-HT2C receptor has no effect on immobility in mice. As suggestedearlier, perhaps the increased BDNF expression within the hip-pocampus of 5-HT2CKO mice is a compensatory mechanism forthe loss of 5-HT2C receptor, and hence renders the mice normalwhen compared to WT controls in terms of behavioral despairmeasured by immobility. However, although immobility wassimilar between the genotypes in both depressive-like behavioral

FIGURE 6. Learning and memory in 5-HT2CKO mice com-pared to WT controls. Top panels represent the number of work-ing memory errors (A) and reference memory errors (B) in the ra-dial arm maze over ten days of training (5-HT2CKO n 5 21 andWT n 5 17). Bottom panels represent the number of trials passed

(shocks avoided) over five days of active avoidance training (C.,5-HT2CKO n 5 11 and WT n 5 12) and the median time spentin the light compartment during passive avoidance retentiontrials (D., 5-HT2CKO n 5 8 and WT n 5 9).

BDNF EXPRESSION IN 5-HT2CKO MICE 443

Hippocampus

tests, the time spent climbing in the tail suspension test was sig-nificantly decreased in 5-HT2CKO mice. Climbing behavior inthe tail suspension test has previously been associated with nor-adrenergic stimulation (Cryan et al., 2002). As 5-HT2C receptorantagonists increase the release of noradrenaline (Millan et al.,1998), lack of 5-HT2C receptor function in the 5-HT2CKOmice may lead to disturbances in the release of noradrenaline,which may be effecting climbing activity.

In conclusion, adult 5-HT2CKO mice show a significant,2.2-fold up-regulation of mature BDNF protein expression inthe hippocampus. These data suggest a strong relationshipbetween the 5-HT2C receptor and BDNF protein expression.The 5-HT2C receptor knockout mouse thus represents a modelof hippocampus-specific up-regulation of BDNF proteinexpression and hence may be a useful tool in the study ofaltered BDNF function in the hippocampus.

Acknowledgments

The authors are grateful to Marlijn Jansen and BastijnKoopmans for their technical assistance.

REFERENCES

Adachi M, Barrot M, Autry AE, Theobald D, Monteggia LM. 2008.Selective loss of brain-derived neurotrophic factor in the dentategyrus attenuates antidepressant efficacy. Biol Psychiatry 63:642–649.

Altar CA. 1999. Neurotrophins and depression. Trends Pharmacol Sci20:59–61.

Ambrogi Lorenzini CG, Baldi E, Bucherelli C, Sacchetti B, Tassoni G.1997. Role of ventral hippocampus in acquisition, consolidationand retrieval of rat’s passive avoidance response memory trace.Brain Res 768:242–248.

Bannerman DM, Rawlins JN, McHugh SB, Deacon RM, Yee BK,Bast T, Zhang WN, Pothuizen HH, Feldon J. 2004. Regional dis-sociations within the hippocampus—Memory and anxiety. Neuro-sci Biobehav Rev 28:273–283.

Berg KA, Clarke WP, Cunningham KA, Spampinato U. 2008. Fine-tuning serotonin2c receptor function in the brain: Molecular andfunctional implications. Neuropharmacology 55:969–976.

Chioca LR, Raupp IM, Da Cunha C, Losso EM, Andreatini R. 2008.Subchronic fluoride intake induces impairment in habituation andactive avoidance tasks in rats. Eur J Pharmacol 579:196–201.

Croll SD, Suri C, Compton DL, Simmons MV, Yancopoulos GD,Lindsay RM, Wiegand SJ, Rudge JS, Scharfman HE. 1999. Brain-derived neurotrophic factor transgenic mice exhibit passive avoidancedeficits, increased seizure severity and in vitro hyperexcitability in thehippocampus and entorhinal cortex. Neuroscience 93:1491–1506.

Cryan JF, Page ME, Lucki I. 2002. Noradrenergic lesions differentiallyalter the antidepressant-like effects of reboxetine in a modifiedforced swim test. Eur J Pharmacol 436:197–205.

Dekeyne A, Mannoury la Cour C, Gobert A, Brocco M, Lejeune F,Serres F, Sharp T, Daszuta A, Soumier A, Papp M, Rivet JM, FlikG, Cremers TI, Muller O, Lavielle G, Millan MJ. 2008. S32006, anovel 5-HT2C receptor antagonist displaying broad-based anti-depressant and anxiolytic properties in rodent models. Psychophar-macology (Berl) 199:549–568.

Deltheil T, Guiard BP, Cerdan J, David DJ, Tanaka KF, Reperant C,Guilloux JP, Coudore F, Hen R, Gardier AM. 2008a. Behavioraland serotonergic consequences of decreasing or increasing hippo-campus brain-derived neurotrophic factor protein levels in mice.Neuropharmacology 55:1006–1014.

Deltheil T, Guiard BP, Guilloux JP, Nicolas L, Delomenie C, ReperantC, Le Maitre E, Leroux-Nicollet I, Benmansour S, Coudore F,David DJ, Gardier AM. 2008b. Consequences of changes inBDNF levels on serotonin neurotransmission, 5-HT transporterexpression and function: Studies in adult mice hippocampus. Phar-macol Biochem Behav 90:174–183.

Gobert A, Rivet JM, Lejeune F, Newman-Tancredi A, Adhumeau-Auclair A, Nicolas JP, Cistarelli L, Melon C, Millan MJ. 2000.Serotonin(2C) receptors tonically suppress the activity of mesocort-ical dopaminergic and adrenergic, but not serotonergic, pathways:A combined dialysis and electrophysiological analysis in the rat.Synapse 36:205–221.

Griesbach GS, Hovda DA, Gomez-Pinilla F. 2009. Exercise-inducedimprovement in cognitive performance after traumatic brain injuryin rats is dependent on BDNF activation. Brain Res 1288:105–115.

Gulyas AI, Acsady L, Freund TF. 1999. Structural basis of the cholin-ergic and serotonergic modulation of GABAergic neurons in thehippocampus. Neurochem Int 34:359–372.

FIGURE 7. Behavioral phenotyping analysis of 5-HT2CKO (n5 7) compared with WT controls (n 5 9). Top panels depictdepression-like behavior (A, forced swim test; B, tail suspensiontest), middle panels depict anxiety-like behavior (C, elevated plusmaze; D, emergency test), bottom panels depict locomotor activity(E) and prepulse inhibition (PPI) of startle (F), respectively. *P <0.05 for difference with WT controls.

444 HILL ET AL.

Hippocampus

He J, Yamada K, Nakajima A, Kamei H, Nabeshima T. 2002. Learn-ing and memory in two different reward tasks in a radial arm mazein rats. Behav Brain Res 134:139–148.

Hollup SA, Molden S, Donnett JG, Moser MB, Moser EI. 2001.Accumulation of hippocampal place fields at the goal location inan annular watermaze task. J Neurosci 21:1635–1644.

Kemp A, Gordon E, Rush AJ, Williams LM. 2009. Improving theprediction of treatment response in depression: Integration of clini-cal, cognitive, psychophysiological, neuroimaging, and geneticmeasures. CNS Spectrums 13:1066–1086.

Kernie SG, Liebl DJ, Parada LF. 2000. BDNF regulates eatingbehavior and locomotor activity in mice. EMBO J 19:1290–1300.

Kozisek ME, Middlemas D, Bylund DB. 2008. The differential regu-lation of BDNF and TrkB levels in juvenile rats after four days ofescitalopram and desipramine treatment. Neuropharmacology 54:251–257.

Lacaille JC, Schwartzkroin PA. 1988. Stratum lacunosum-moleculareinterneurons of hippocampal CA1 region. I. Intracellular responsecharacteristics, synaptic responses, and morphology. J Neurosci 8:1400–1410.

Li B, Suemaru K, Cui R, Araki H. 2007. Repeated electroconvulsivestimuli have long-lasting effects on hippocampal BDNF anddecrease immobility time in the rat forced swim test. Life Sci 80:1539–1543.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR, the 22DDCT method.Methods 25:402–408.

Lu B. 2003. BDNF and activity-dependent synaptic modulation.Learn Mem 10:86–98.

Ma YL, Wang HL, Wu HC, Wei CL, Lee EH. 1998. Brain-derivedneurotrophic factor antisense oligonucleotide impairs memoryretention and inhibits long-term potentiation in rats. Neuroscience82:957–967.

Mamounas LA, Molliver ME. 1988. Evidence for dual serotonergicprojections to neocortex: Axons from the dorsal and median raphenuclei are differentially vulnerable to the neurotoxin p-chloroam-phetamine (PCA). Exp Neurol 102:23–36.

Martinowich K, Lu B. 2008. Interaction between BDNF and serotonin:role in mood disorders. Neuropsychopharmacology 33:73–83.

Matsumoto T, Rauskolb S, Polack M, Klose J, Kolbeck R, Korte M,Barde YA. 2008. Biosynthesis and processing of endogenousBDNF: CNS neurons store and secrete BDNF, not pro-BDNF.Nat Neurosci 11:131–133.

Millan MJ, Dekeyne A, Gobert A. 1998. Serotonin (5-HT)2C recep-tors tonically inhibit dopamine (DA) and noradrenaline (NA), butnot 5-HT, release in the frontal cortex in vivo. Neuropharmacology37:953–955.

Minor TR, Dess NK, Ben-David E, Chang WC. 1994. Individual dif-ferences in vulnerability to inescapable shock in rats. J Exp PsycholAnim Behav Process 20:402–412.

Monteggia LM, Barrot M, Powell CM, Berton O, Galanis V, GemelliT, Meuth S, Nagy A, Greene RW, Nestler EJ. 2004. Essential roleof brain-derived neurotrophic factor in adult hippocampal func-tion. Proc Natl Acad Sci USA 101:10827–10832.

Moser MB, Moser EI. 1998. Functional differentiation in the hippo-campus. Hippocampus 8:608–619.

Mowla SJ, Farhadi HF, Pareek S, Atwal JK, Morris SJ, Seidah NG,Murphy RA. 2001. Biosynthesis and post-translational processingof the precursor to brain-derived neurotrophic factor. J Biol Chem276:12660–12666.

Nagappan G, Lu B. 2005. Activity-dependent modulation of theBDNF receptor TrkB: Mechanisms and implications. Trends Neu-rosci 28:464–471.

Nibuya M, Morinobu S, Duman RS. 1995. Regulation of BDNFand trkB mRNA in rat brain by chronic electroconvulsive sei-

zure and antidepressant drug treatments. J Neurosci 15:7539–7547.

O’Keefe J, Dostrovsky J. 1971. The hippocampus as a spatial map.Preliminary evidence from unit activity in the freely-moving rat.Brain Res 34:171–175.

Ribak CE, Vaughn JE, Saito K. 1978. Immunocytochemical localiza-tion of glutamic acid decarboxylase in neuronal somata followingcolchicine inhibition of axonal transport. Brain Res 140:315–332.

Rios M, Fan G, Fekete C, Kelly J, Bates B, Kuehn R, Lechan RM,Jaenisch R. 2001. Conditional deletion of brain-derived neurotro-phic factor in the postnatal brain leads to obesity and hyperactivity.Mol Endocrinol 15:1748–1757.

Sauer H, Fischer W, Nikkhah G, Wiegand SJ, Brundin P, LindsayRM, Bjorklund A. 1993. Brain-derived neurotrophic factor enhan-ces function rather than survival of intrastriatal dopamine cell-richgrafts. Brain Res 626:37–44.

Schechter LE, Ring RH, Beyer CE, Hughes ZA, Khawaja X, MalbergJE, Rosenzweig-Lipson S. 2005. Innovative approaches for the de-velopment of antidepressant drugs: Current and future strategies.NeuroRx 2:590–611.

Shirayama Y, Chen AC, Nakagawa S, Russell DS, Duman RS. 2002.Brain-derived neurotrophic factor produces antidepressant effects inbehavioral models of depression. J Neurosci 22:3251–3261.

Siuciak JA, Lewis DR, Wiegand SJ, Lindsay RM. 1997. Antidepres-sant-like effect of brain-derived neurotrophic factor (BDNF). Phar-macol Biochem Behav 56:131–137.

Takahashi M, Kakita A, Futamura T, Watanabe Y, Mizuno M, Saki-mura K, Castren E, Nabeshima T, Someya T, Nawa H. 2006.Sustained brain-derived neurotrophic factor up-regulation and sen-sorimotor gating abnormality induced by postnatal exposure tophencyclidine: Comparison with adult treatment. J Neurochem99:770–780.

Tecott LH, Logue SF, Wehner JM, Kauer JA. 1998. Perturbed dentategyrus function in serotonin 5-HT2C receptor mutant mice. ProcNatl Acad Sci USA 95:15026–15031.

Tecott LH, Sun LM, Akana SF, Strack AM, Lowenstein DH, DallmanMF, Julius D. 1995. Eating disorder and epilepsy in mice lacking5-HT2c serotonin receptors. Nature 374:542–546.

Teng HK, Teng KK, Lee R, Wright S, Tevar S, Almeida RD, Kermani P,Torkin R, Chen ZY, Lee FS, Kraemer RT, Nykjaer A, HempsteadBL. 2005. ProBDNF induces neuronal apoptosis via activation of areceptor complex of p75NTR and sortilin. J Neurosci 25:5455–5463.

van den Buuse M, Martin S, Holgate J, Matthaei K, Hendry I. 2007.Mice deficient in the alpha subunit of G(z) show changes in pre-pulse inhibition, anxiety and responses to 5-HT1A receptor stimula-tion, which are strongly dependent on the genetic background. Psy-chopharmacology (Berl) 195:273–283.

van den Buuse M, Wischhof L, Xi Lee R, Martin S, Karl T. 2009.Neuregulin 1 hypomorphic mutant mice: Enhanced baseline loco-motor activity but normal psychotropic drug-induced hyperloco-motion and prepulse inhibition regulation. Int J Neuropsychophar-macol 12:1383–1393.

Wang JH, van den Buuse M, Tian SW, Ma YY. 2003. Effect of para-doxical sleep deprivation and stress on passive avoidance behavior.Physiol Behav 79:591–596.

Wilson MA, McNaughton BL. 1993. Dynamics of the hippocampalensemble code for space. Science 261:1055–1058.

Woo NH, Teng HK, Siao CJ, Chiaruttini C, Pang PT, Milner TA,Hempstead BL, Lu B. 2005. Activation of p75NTR by proBDNFfacilitates hippocampal long-term depression. Nat Neurosci8:1069–1077.

Zhou J, Li L, Tang S, Cao X, Li Z, Li W, Li C, Zhang X. 2008.Effects of serotonin depletion on the hippocampal GR/MR andBDNF expression during the stress adaptation. Behav Brain Res195:129–138.

BDNF EXPRESSION IN 5-HT2CKO MICE 445

Hippocampus