©Ja m

e s Ho lm

es/ Ce llm

a rk Di ag no stic s/ S

PL

DNA molecules are very long

They may consist of millions of base pairs

In order to study the structure of DNA, the molecules are broken up into smaller fragmentsby enzymes called restriction enzymes

Restriction enzymes do not break up the DNA molecule randomly but ‘cut’ it at particular sites

2Restriction enzymes

For example, a restriction enzyme called EcoR1*‘recognises’ the base sequence CAATTC and cuts itbetween the two As

--C-C-G-C-A-G-C-T-G-T-C-A-A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A

recognised

cut

--C-C-G-C-A-G-C-T-G-T-C-A

Other restriction enzymes cut the DNA in different placesand so produce fragments which are easier to analyse

--C-C-G-C-A-G-C-T-G-T-C-A

--C-C-G-C-A-G C-T-G-T-C-A A-T-T-C-T-C-C-G G-A-T-C-C-C-A-

A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-C-A-

A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A-

Restriction fragments 3

The fragments can be separated using gel electrophoresis(See slides 7 – 11)

The fragments cut by the restriction enzymes are calledrestriction fragments

4

Genetic fingerprinting

90% or more of DNA does not carry nucleotide triplets that codefor proteins

The non-coding DNA is often called ‘junk DNA’ but this only means that its functions have not yet been discovered

Some of the non-coding regions consist of repeated sequences of nucleotides

For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- *

The number of repeats in any one section of DNA varies from one individual to the next

Since these sections do not code for proteins (and, therefore are not genes) there is no observable difference in these individuals

Genetic fingerprinting

5

Particular repeat sequences can be ‘cut out’ by restriction enzymes

For example

-CATCCACGACATGCATGCATGCATGCCACATCCA-

restriction enzyme cuts

here……………and…..….…..here

or

-CCACGACATGCATGCATGCATGCATGCATGCCACAT-

here…….…..…..………and…...….…………..here

Restriction enzymes 6

Gel electrophoresis

The different sized fragments are separated by a process called gel electrophoresis

The separation takes place in a sheet of a firm but jelly-like substance (a ‘gel’)

Samples of the DNA extracts are placed in shallow cavities (‘wells’) cut into one end of the gel

A voltage is applied to opposite ends of the gel

DNA has a negative charge and moves slowly towardsthe positive end

The shorter fragments travel through the gel faster than the longer fragments

Gel electrophoresis

7

gelatinous sheet

well

solution

DNA extractadded

Gel electrophoresis 8

Voltage supply

negative electrode

DNA samples placed inwells cut in gel

positiveelectrode

thin slab ofgel

+DNA fragments Move from negativeTo positive

Gel electrophoresis 9

A sample with theshorter DNA fragmentstravels through the gelfaster than a samplewith the larger fragments

10

Next slide

11

Animation

Appearance of separated fragments on gel

These bands will contain the shorter DNA fragments

These bands will contain the longer DNA fragments

starting positions Appearance of bands

12

© Prof. E. Wood© Prof. E.J.Wood

Genetic fingerprinting

DNA analysis can be used for catching criminals, establishing parentage, finding how closely organisms are related and many other applications.

The pattern of bands in a gel electrophoresis is known as a genetic fingerprint or a ‘genetic profile’

If a genetic fingerprint found in a sample of blood or other tissueat the scene of a crime matches the genetic fingerprint of a suspect, this can be used as evidence

A DNA sample can be obtained from the suspect using blood, cheek epithelial cells taken from the mouth lining or even the cells clinging to the root of a hair

Genetic fingerprinting

13

….there is a chance of 1 in 10 that this fragment occurs in many individuals…

Suppose that…………

…and.there is a chance of 1 in 20 that this

fragment occurs in many individuals…

…and.there is a chance of 1 in 10 that this

fragment occurs in many individuals…

…and.there is a chance of 1 in 30 that this

fragment occurs in many individuals, but…

Chances of a match 14

…the probability of all 4 bands matching in any person other thanthe suspect is

1 in 10 x 1 in 20 x 1 in 10 x 1 in 30

= 1 in 10 x 20 x 10 x 30 That is 1 in 60,000

When a larger number of bands is involved, the probability that the suspect is not guilty becomes one in many thousands*

Probability of a match 15

V S S1 S2 S3

V Victim

S Sample from crime scene

S1 Suspect 1

S2 Suspect 2

S3 Suspect 3

More than 20 fragmentsfrom Suspect 1 match thosetaken from the crime scene

DNA profiles 16

Evidence from genetic fingerprinting

Genetic fingerprinting is powerful evidence in criminal trials but…

Many restriction fragments may be crowded into a single band

There may be variability in the speed with which a fragment travelsthrough the gel

There is a chance of contamination with ‘foreign’ DNA e.g. from bacteria

The jury may not understand the significance of genetic fingerprinting and may be dependent on conflicting claims from ‘expert’ witnesses

There may be arguments about the statistical significance of a match between DNA profiles

Evidence from genetic fingerprinting

17

Even if there is agreement about a match between the suspect’sDNA profile and forensic samples, it shows only that the suspect was present at the scene of the crime and does not prove that he or she committed the crime

DNA evidence should be considered as conclusive proof of guilt only if there is other supporting evidence

In cases of paternity disputes, the genetic evidence can be conclusive

Paternity can be decided on the basis of a single restriction site

Limitations of DNA evidence 18

position ofrestrictionfragment

part of DNA strand

mother father

Child will receive one copy of the restriction fragment from the mother and one from the father. It could be any one of thesecombinations

child

Paternity test 19

Starting position of sample

1 2 3 4

Genetic fingerprint of …

1 mother

2 child

3 possible father A

4 possible father B

There is a match between one ofthe child’s restriction fragmentsand one of the mother’s.

There is also a match between the child’s other fragment and one from possible father A.

Neither of the child’s restrictionfragments match those of possiblefather B

Paternity test

20

The Human Genome Project

An organism’s genome is its entire genetic make-up

The genome includes …

all the chromosomes

all the genes on the chromosomes

and all the DNA of the chromosomes

The human genome project set out to …

identify the genes in the human genome (about 25,000*)

discover the sequence of the base pairs (about 2.8 billion)

99% of the gene-containing part of human DNA had been analysed by 2003

Human genome project

21

Mapping is the identification of genes and their positions in the chromosome

Modern biochemical techniques are used to identify genes and their positions in the chromosome

Special staining methods reveal bands in the chromosomesThese do not necessarily represent genes but help to identify the position of genes

Chromosome 7

Chromosome 11

position of gene for cystic fibrosis

position of gene for sickle cell anaemia

Mapping

22

By special staining techniques, bands appear in the ‘giant chromosome’ of the fruit-fly (Drosophila)

© Biophoto Associates

Giant chromosomes 23

The bands do not necessarily represent genes but if, in mutant flies, some of the bands are missing, there is a corresponding defect in the fly

If bands are missing from this region, the fly has no colour in its eyes (normally red)

If this band is missing thereis an irregularity in the wing

Loss of this band leads to a change in the texture of the eye surface

One or more of the bands in this region controls the normaldevelopment of bristles

Chromosome banding

24

AGCTAGCCTCAGTTGATCATCGAGTGAGTACTGGACCATGC

Sequencing

Sequencing aims to find out the sequence of nucleotides in a stretch of DNA

The process can be automated to give results relatively quickly

Analysis of a small piece of DNA might give results somethinglike this

Further analysis is needed to decide which sequences code forproteins and represent genes

Sequencing

25

GCTTATCGATTCGGTGATACCATAGTGTAGTGTAGTCGCT

ATCCATCGCTTACGAGTCTGATGCGCATTAGCTAGCTAGCT

Applications of results from the Human Genome Project

It is hoped that a knowledge of the human genome will enable…

identification of defective genes and the chance of early treatment

identification of genes which could make a person susceptible to certain diseases, and so lead to preventative measures

prediction of the proteins that genes produce, giving the opportunityto enhance or inhibit these proteins by specially designed drugs

Among the possible drawbacks are the possibilities that …

insurance companies may refuse cover for people at risk of developing a genetic disability or disease

prediction of a disease or disability could blight a person’s life

26

Applications

Question 1

A restriction enzyme cuts DNA

(a) at random sites

(b) at sites with repeat nucleotides

(c) into single nucleotides

(d) at specific sites

27

Question 2

The proportion of human DNA which codes for proteins is

(a) 3-10%

(b) 10-20%

(c) 50-80%

(d) 80-90%

28

Question 3

Junk DNA is DNA which

(a) is functionless

(b) does not code for proteins

(c) codes for harmful genes

(d) may have functions not yet discovered

29

Question 4

A restriction fragment is a piece of DNA which

(a) contains a gene

(b) contains repeated nucleotide sequences

(c) breaks up DNA at specific sites

(d) codes for a protein

30

Question 5

In gel electrophoresis, the restriction fragments are separated

(a) by heat

(b) by chemicals

(c) by electricity

(d) by X-rays

31

Question 6

In gel electrophoresis

(a) short DNA fragments move faster than long fragments

(b) long DNA fragments move faster than short fragments

(c) the fragments move towards the positive end

(d) the fragments move towards the negative end

32

Question 7

If, in electrophoresis, specific bands appear in the same placein 10% of the population, what are the chances of 5 of these bandsoccurring in one individual?

(a) 1 in 100

(b) 1 in 1000

(c) 1 in 10,000

(d) 1 in 100,000

33

Question 8

In slide 19, each individual has two bands in the electrophoresisseparation. This is because

(a) only two fragments are being analysed

(b) DNA is double stranded

(c) in each individual, one of their fragments is inherited from the father and one from the mother

(d) the results are intended to distinguish between two possible fathers

34

Question 9

The human genome includes

(a) all the genes

(b) all the DNA

(c) all the nucleotides

(d) all the bases

35

Question 10

Mapping is

(a) identifying the genes

(b) finding the position of genes in the chromosome

(c) finding the sequence of nucleotides

(d) finding the number of genes in a chromosome

36

Question 11

Sequencing aims to find

(a) the sequence of nucleotides in DNA

(b) the sequence of genes in DNA

(c) the sequence of events in DNA replication

(d) the timing of the stages in replication

37

Answer

Correct

Answer

Incorrect