biolog­a y geolog­a 1. bachillerato 6. la biodiversidad esquema

Download Biolog­a y Geolog­a 1. Bachillerato 6. La biodiversidad ESQUEMA

Post on 04-Jan-2015

24 views

Category:

Documents

6 download

Embed Size (px)

TRANSCRIPT

  • Diapositiva 1
  • Biologa y Geologa 1. Bachillerato 6. La biodiversidad ESQUEMA
  • Diapositiva 2
  • Biologa y Geologa 1. Bachillerato 6. La biodiversidad Endemismos en Espaa El guila imperial (Aquila heliaca) presenta una reducida poblacin exclusiva de la pennsula ibrica. El pinsapo (Abies pinsapo) es un abeto de porte cnico. De las aproximadamente 50 aves de las Islas Canarias, tres son endmicas.
  • Diapositiva 3
  • Biologa y Geologa 1. Bachillerato 6. La biodiversidad Bosque mediterrneo El rbol representativo del bosque mediterrneo es la encina o carrasca (Quecus ilex). El lince (Lynx lynx) es el representante de la fauna predadora. El jabal (Sus escorfa) es un omnvoro muy extendido por el bosque mediterrneo. En el Parque Natural de Monfrage tiene su densidad de poblacin ms alta el buitre negro (Aegypus monachus).
  • Diapositiva 4
  • Biologa y Geologa 1. Bachillerato 6. La biodiversidad Hayedos y robledales El oso (Ursus arctos) se encuentra actualmente en Asturias, Santander y los Pirineos. El lobo (Canis lupus) es el principal depredador de los ecosistemas ibricos. El urogallo (Tetrao urogallus) es un ave de gran tamao que habita montes cntabros.
  • Diapositiva 5
  • Biologa y Geologa 1. Bachillerato 6. La biodiversidad Especies representativas de humedales y ambientes acuticos Entre la fauna de los humedales y lagos, las aves acuticas, como las antidas estn bien representadas. Entre los vegetales del Mediterrneo destaca la Posidonia ocenica, una especie endmica que se distribuye formando praderas.
  • Diapositiva 6
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida ESQUEMA
  • Diapositiva 7
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida La idea de evolucin biolgica Algunos filsofos griegos (Anaximandro y Empdocles) expresan la idea de que los organismos pueden transformarse unos en otros. La cultura judeocristiana extiende la idea de que las especies han sido creadas tal y como se conocen: fijas e inmutables. Surge la idea conocida como FIJISMO. 610 - 423 a.C. Edad Media Siglo XVIII El fijismo se mantiene defendido por naturalistas de gran prestigio. 1707-1778 Carl Linn (Linneo) utiliza la inmutabilidad de las especies como eje central para su sistema de clasificacin de animales y plantas. 1707-1788 George Leclerc (conde de Buffon) empieza a dudar sobre la existencia de las especies como unidades fijas e inmutables. En sus obras se refiere a la posibilidad de una evolucin por degeneracin a consecuencia de la accin de factores ambientales. 1769-1832 Georges Cuvier (paleontlogo) reconoce los fsiles como restos de seres vivos diferentes a los actuales pero que desaparecieron debido a catstrofes a escala planetaria seguidas de otras tantas creaciones. Siglo XIX En 1809 Lamarck publica su obra Filosofa zoolgica en la que expone su teora evolucionista conocida como transformismo o lamarckismo. Ese mismo ao nace Charles Darwin, naturalista que publicar cincuenta aos despus su obra Sobre el origen de las especiesen la que explica la evolucin por seleccin natural.
  • Diapositiva 8
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida El lamarckismo CON EL TIEMPO LA ESPECIE SE TRANSFORMA LAS MODIFICACIONES SON TRANSMITIDAS A LA DESCENDENCIA CAMBIOS EN LOS RGANOS Las teoras de Lamarck se fundamentan en dos ideas: Los organismos cambian a lo largo del tiempo de modo continuo y gradual desde formas ms simples a otras ms complejas. MODIFICACIONES EN LOS HBITOS CAMBIOS EN EL MEDIO AMBIENTE Los cambios en el medio provocan la transformacin de las especies del siguiente modo: CRTICAS AL LAMARCKISMO No hay pruebas de una tendencia en los organismos a la transformacin ni a la complejidad. Solo se heredan los caracteres cuya informacin resida en los genes. Las ideas de Lamarck contribuyeron en su tiempo a la aceptacin de las teoras evolucionistas.
  • Diapositiva 9
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida El viaje a bordo del Beagle Darwin, durante el viaje en el Beagle, realiz mltiples observaciones que influyeron sobre sus ideas incompatibles con el fijismo. Al viajar de norte a sur unas especies eran sustituidas por otras afines. Los fsiles de mamferos extintos recogidos en las Pampas presentaban una gran similitud con la forma de los mamferos actuales. Las islas Galpagos eran ricas en endemismos que parecan estar relacionados con las especies del continente cercano (Amrica del Sur).
  • Diapositiva 10
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida La evolucin por seleccin natural 1.-En una poblacin los individuos presentan variaciones heredables. En una poblacin natural de jirafas, algunas nacen con las patas delanteras y el cuello ms largo, caracteres que transmiten a su descendencia. 2.-Nacen ms individuos de los que pueden sobrevivir. En un perodo de escasez las jirafas de cuello largo tienen ventaja, pues pueden acceder a las hojas ms altas de los rboles. 3.-Algunas variantes hereditarias proporcionan ventajas a los individuos que las poseen a la hora de sobrevivir y dejar mayor descendencia. Al poder sobrevivir mejor,las jirafas de cuello alto dejan ms descendientes que tambin portarn esa caracterstica. La poblacin cambia.
  • Diapositiva 11
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida La teora sinttica La reproduccin diferencial TEORA DARWINISTA Leyes de Mendel Teora cromosmica de la herencia Gentica de poblaciones TEORA SINTTICA La unidad evolutiva no es el individuo sino la poblacin La evolucin se produce por un cambio gradual en la constitucin gentica de las especies Variabilidad gentica Presin ambiental Seleccin Mutacin Reproduccin sexual
  • Diapositiva 12
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida Respuestas evolutivas frente a la seleccin SELECCIN NORMALIZADORA SELECCIN DIRECCIONAL SELECCIN DIVERSIFICADORA Variacin fenotpica de una especie Nmero de individuos Estudiando los efectos sobre los fenotipos se observan distintos tipos de seleccin: Tiende a favorecer los fenotipos ms frecuentes y excluye los valores extremos. Se ven favorecidos los fenotipos en una direccin particular. Un ambiente, al no ser homogneo, puede favorecer dos o ms fenotipos a la vez.
  • Diapositiva 13
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida El estudio del registro fsil EVOLUCIN DEL CABALLO Hyracotherium (50 M.a.) Mesohippus (35 M.a.) Merychippus (20 M.a.) Equus Un caso bien estudiado es el del caballo En el caso del Archaeopteryx se encontr el eslabn entre reptiles y aves. Fsil de Archaeopteryx En algunos casos los restos descubiertos permiten reconstruir la evolucin de un determinado organismo. En otras ocasiones se encuentra el eslabn perdido que puede explicar las fases de transicin entre dos grandes grupos.
  • Diapositiva 14
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida Distribucin geogrfica de los seres vivos Continentes que estuvieron unidos Los archipilagos ocenicos alejados de continentes La separacin de los continentes provoc el aislamiento de las especies y favoreci un proceso evolutivo por separado a partir de antecesores comunes. Los pocos colonizadores de estas islas quedaran aislados de sus antecesores con una evolucin independiente. El estudio de la distribucin geogrfica de las especies proporciona datos acerca de su evolucin. Jaguar Leopardo Armadillo Armadillo de nueve bandas Rinoceronte Tapir Catarrino Platirrino
  • Diapositiva 15
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida La anatoma comparada Investiga las homologas o similitudes estructurales heredadas por los organismos, tanto en su esqueleto como en cualquier otro rgano, y permite reconstruir su filogenia. Caballo Ave Murcilago Por ejemplo, existe una similitud estructural en las extremidades de vertebrados. Humano Delfn
  • Diapositiva 16
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida El desarrollo embrionario El parentesco evolutivo de distintas especies queda reflejado en las similitudes o diferencias de los patrones de su desarrollo embrionario. En las fases tempranas de su desarrollo los embriones de diferentes vertebrados son muy parecidos entre s. PEZ GALLINA VACA HUMANO
  • Diapositiva 17
  • Biologa y Geologa 1. Bachillerato 7. El origen y la evolucin de la vida La biologa molecular 24262527282930313233343536373839404142434445 GTTAACCCTAACAAA AACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATT Humanos TATAACCCTAACAAA AACTCATATCCC TTATGTGAAATCCATTATCGCGTCCACCTTTATC Chimpancs ATCAATCCTAACAAA AGCTCATACCCCCATTACGTAAAATCTATCGTCGCATCCACCTTTATC Gorilas ATTAACCCC AAA AACCCATACCCCCACTATGTAAAAACGGCCATCGCATCCGCCTTTACT Orangutanes ATTAACCCCAATAAAAAGAACTTATACCCGCACTACGTAAAAATGACCATTGCCTCTACCTTTATA Gibones Tanto el ADN como las protenas determinadas por l, aportan informacin sobre la historia evolutiva de los organismos. La uniformidad en la composicin qumica y en los procesos metablicos revela la existencia de antepasados comunes. El lenguaje utilizado por el ADN es el mismo para todos los seres vivos. Esto indica un origen comn. Comparar secuencias de nucletidos de ADN de especies diferentes puede proporcionar informacin sobre su parentesco evolutivo. Podemos comparar una secuencia de nucletidos de cada uno de los cinco grupos de primates. Tripletes comunes a 3 de los gruposTripletes comunes Tripletes comunes a 4 de los 5 de los grupos (las diferencias del quinto slo afectan a una b