bioinformatics by: jesus caban boxuan gu. what is bioinformatics? bioinformatics has been defined as...

Bioinformatics

By: Jesus CabanBoxuan GU

What is Bioinformatics? Bioinformatics has been defined as a

means for analyzing, comparing, graphically displaying, modeling, storing, systemizing, searching, and ultimately distributing biological information, which includes sequences, structures, function, and phylogeny.

Researches in Bioinformatics the study of DNA structure and its

functions gene and protein expressions protein production, structure and

functions genetic regulatory systems clinical applications

Biology employs a digital language for representing its information using the four basic alphabets (A, C, G, T).

All the chromosomes in an organism‘s cell have been represented and being dentified using these alphabets.

The demanding challenge here is to determine how this digital language of the chromosomes is being converted into the three-dimensional and sometimes four-dimensional languages of living and breathing organisms.

Bioinformatics language

Central Dogma of Molecular Biology

DNA RNA Protein

StructuresProcesses

CellEnvironment

Protein structure

How many different protein structures are there?How different are they?

Protein structure

What is this?Is the DNA normal?

Computational Biology - Applications and Approaches

The Overview of DNA and RNA

Deoxyribonucleic acid (DNA) is a macromolecular chain of nucleotides that serves as a basic carrier of genetic information and is able to self-replicate. DNA can be represented as a sequence of nucleotide bases.

DNA DNA sequences are typically from

thousands to millions of bases long. DNA usually consists of two strands of complementary nucleotide sequences that are base paired to each other.

DNA in humans forms a linear chain, but DNA can also form a circular molecule.

DNA

A hypothetical double-stranded DNA molecule can be represented as ACGTGGTAGAGACCCTGTGTGATAGACCACGGGTA

TGCACCATCTCTGGGACACACTATCTGGTGCCCAT

As A pairs with T and C pairs with G and vice versa

Here A - Adenine, C - Cytocine, G - Guanine, T - Thymine

RNA The RNA is the same as above DNA with the

exception that T is replaced by U, which represents uricil nucleotide.

An organism is further classified into two types. Eukaryotes - higher-order organisms whose DNA

is enclosed in a cell nucleus. E.g. humans Prokaryotes - organisms such as bacteria whose

DNA is not enclosed in a nucleus. E.g. bacteria.

GENE

A gene is a contiguous interval of DNA that contains the information needed to code for a protein. Genes form the basic units of heredity.

The Biological problem in CS

computer scientists were empowered to consider a variety of biologically important problems defined primarily on sequences, or (more in the computer science vernacular) on strings

reconstructing long strings of DNA from overlapping string fragments

Cont.• determining physical and genetic maps from

probe data under various experimental protocols;

• storing, retrieving, and comparing DNA strings

• comparing two or more strings for similarities• searching databases for related strings and

substrings• defining and exploring different notions of

string relationships

Cont.

• looking for new or ill-defined patterns occurring frequently in DNA

• looking for structural patterns in DNA and protein

• determining secondary(two-dimensional) structure of RNA

• finding conserved, but faint, patterns in many DNA and protein sequences; and more

Challenges In molecular biology, there are several hundred

specialized databases holding raw DNA, RNA, and amino acid strings, or processed patterns (called motifs) derived from the raw string data.

The currently available algorithms for this problem are a little bit slow and erroneous due in the contexts that billions of DNA sequences are stored in present day DNA and protein databases available world wide

Cont.

the question here is that exact matching will remain a problem of interest as the size of the databases grow exponentially and

also because it will continue to be a subtask needed for more complex searches that will be devised in the near future to fulfill the various and advanced requirements of molecular biologists

DNA contamination

Contamination is often caused by a fragment (substring) of a vector (DNA string) used to incorporate the desired DNA in a host organism or the contamination is from the DNA of the host itself.

Contamination can also come from very small amounts of undesired foreign DNA that gets physically mixed into the desired DNA and then amplified by PCR (Polymerase chain reaction) used to make copies of the desired DNA.

Cont.

DNA contamination problem can be represented as follows: Given a string S1 (the newly isolated and sequenced

string of DNA) and a known string S2 (the combined sources of possible contamination), find all substrings of S2 that occur in S1 and that are longer than some given length l.

These substrings are candidates for unwanted pieces of S2 that have contaminated the desired DNA string.

Matching and Alignment

Exact string matching Knuth-Morris-Pratt and Boyer-Moore Exact matching with a set of

patterns Aho-Corasick Inexact matching Edit Distance and dynamic programming Sequence alignment problems Multiple alignment problems

How to Solve

Naive method-Slide P along T and for each alignment, compare characters from left to right. O(n*(m-n+1)).

Knuth-Morris-Pratt(KMP algorithm)-O(n+m).

String is not Sequence A string is not the same as the

concept of a (sub)sequence in biology!

(Sub)sequences in the biological literature refer to strings that might be interspersed with other characters, such as gaps

bioinformatics by: jesus caban boxuan gu. what is bioinformatics? bioinformatics has been defined as...

Documents

dna normal

dna stringscomparing

approachesthe overview

rnadeoxyribonucleic

contiguous interval

different protein structures

biological information

organisms cell