AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 98:395-401 (1995)

Beta-Globin Gene Cluster Haplotype Distribution in Five Brazilian Indian Tribes

LIA R.M. BEVILAQUA, VANESSA S. MATTEVI, GISELE M. EWALD, FRANCISCO M. SALZANO, CARLOS E.A. COIMBRA, JR., RICARDO V. SANTOS, AND MAFU H. HUTZ Departamento de Genetica, Instituto de Biociincias, Universidade Federal do Rio Grande do Sul, 91501-970 Porto Alegre, RS (L.R.M.B., VS.M., G.M.E., RM.S., M.H.H.), Departamento de Endemias Samuel Pessoa, Escola Nacional de Saude Publica, Fiocruz, 21041-210 Rio de Janeiro, RJ (C.E.A.C., R.VS.), Departamento de Antropologia, Museu Nacional, Universidade Federal do Rio de Janeiro, 20940-040 Rio de Janeiro, RJ (R. VS.), Brazil

KEY WORDS Amerindians, Hemoglobin

DNA polymorphism, Genetic diversity,

ABSTRACT Haplotypes derived from five polymorphic restriction sites in the beta-globin gene cluster were investigated in 139 individuals from five different Brazilian Indian tribes by the polymerase chain reaction (PCR). Eight haplotypes were identified. Haplotypes 2 (+ - - - -1 and 6 (- + + - +) were the most frequent and were common to all tribes. Their prevalences ranged from 60% to 93% and from 3% to 18%, respectively. Average heterozy- gosity measured by the Gini-Simpson index is markedly reduced among these Brazilian Indians when compared with Europeans (56%), but much less (8%) in relation to Asiatics, suggesting the absence of an important bottleneck effect in the early colonization of South America. The coefficient of gene differentiation (GST’) was estimated as 0.082 among six Brazilian Indian tribes, but when only three Tupi-Monde-speaking tribes were considered, this estimate was reduced to 0.030. o 1995 Wiley-Liss, Inc.

The study of genetic variability of Amerin- dians at the protein level has been the sub- ject of research for several years, but major questions about the nature of this variabil- ity and the processes that shaped it are still unanswered (Salzano and Callegari- Jacques, 1988). Data a t the DNA level are still scarce, and most of them deal with mito- chondrial DNA. Published analyses (Schurr e t al., 1990; Torroni et al., 1992, 1993) re- vealed the presence of four groups of haplo- types, and most of the variation within the haplogroups was tribe specific. Nuclear DNA polymorphisms were investigated by Kidd e t al. (1991) in two Brazilian and one Central American tribes. The level of heterozygosity observed in these groups did not show evi- dence of an important reduction in size (“bot-

tleneck effect”) during the migration of Am- erindians to South America.

The beta-globin gene cluster system has already proved to be very useful in studies of the evolutionary relationships of African, Eurasian, and Pacific Islander populations. The results of such studies have supported an African origin for modern Homo sapiens and a phyletic structuring of the major geo- graphical regions. On a global scale, haplo- types 2 (+-- - - I , 5 (-+-++), and 6 ( - + + - + I are the most prevalent in Eur-

Received August 10, 1994; accepted June 27, 1995. Address reprint requests to Mara H. Hutz, Ph.D., De-

partamento de GenBtica, Instituto de Biocikcias, Universidade Federal do RIO Grande do Sul, Caixa Postal 15053, 91501-970 Porto Alegre, RS, Brazil.

0 1995 WILEY-LISS, INC

396 L.R.M. BEVILAQUA ET AL.

asians, while in Africans haplotype 3 ( - - - - +) reaches its highest frequency, 50% or more (Wainscoat et al., 1986; Long et al., 1990; Chen et al., 1990). Guerreiro et al. (1992) reported the distribution of these haplotypes among the Brazilian Yano- mama Indians, but no other aboriginal popu- lation from the Americas was investigated in relation to this system. The present paper gives information about these haplotypes in five Brazilian Indian tribes and tries to an- swer the following questions: (a) What infor- mation can beta-globin haplotypes provide concerning the early colonization of the American continent and the subsequent oc- currence of significant bottlenecks? (b) Is the coefficient of gene differentiation estimated from this system similar to those obtained by other investigators in South American Indians using protein markers?

MATERIALS AND METHODS The Brazilian Indian samples consisted of

139 individuals from the Xavante (301, Zor6 (30), Gaviao (29), Surui (221, and Wai-Wai (28) tribes. The populations sampled can be characterized as follows.

Xavante The Xavante language can be assigned to

the Macro-Ge subdivision of the Ge-Pano- Carib groups (Rodrigues, 1986; Greenberg, 1987). At present they live in six different areas. The village from which material was collected is Ria das Mortes (51"40'W, 13'20's) and is situated near the western boundary of the Indian Reservation Pimen- tel Barbosa, State of Mato Grosso, Brazil. More extensive contacts with non-Indians started in 1946. The Xavante have experi- enced marked population growth in recent decades. From an estimated number of 1,500-2,000 in the 1960s, they have in- creased to 6,233 individuals (Ricardo, 1991; Flowers, 1994) at present. The total popula- tion of the Rio das Mortes village numbered 461 individuals in 1990.

Zoro The Zord language is classified in the Tupi

stock of the Monde family (Rodrigues, 1986). The Zoro live in a single village located 20 km from the Rio Branco river (6O02O'W,

10°20'S), Aripuana Park, State of Mato Grosso, Brazil. More extensive contacts with non-Indians began only in 1977, a t which time they had an estimated population size of 350. By this time the ZorB had already been affected by epidemics of infectious dis- eases, as it was estimated that they num- bered 1,000-1,500 in the 1960s. In the early years after extensive contact began, the group continued experiencing population de- cline due to epidemics. By July-August, 1990, the Zoro numbered 215, following a period of population increase (Santos, 1991).

Gaviao This Tupi-Monde group should not be con-

founded with Ge-speaking groups of the same name living in southeast Para (Gavigo- Parkateje) or Maranhao (Gaviiio-Pukoby6). The population we studied actually lives fur- ther west than the ZorB in the Indian Area Igarape Lourdes, State of Rondonia, Brazil. They are distributed in two villages, but many of them have houses in both, and we obtained samples from people of the two communities (geographical coordinates: 61"8'W-10"10'S). In July-August, 1990 we estimated their total population as 288 per- sons (Santos, 1991). The Gaviao were con- tacted by non-Indians in the early 1940s and are much more acculturated than their neighbors, the Zor6.

Surui This tribe also speaks a Tupi-Monde lan-

guage. They live in the Indian Area Sete de Setembro (61"10'W-10"50'S), located partly in the State of Rondonia and partly in the State of Mato Grosso, Brazil, and currently have a population of approximately 500 indi- viduals distributed in 10 villages. The sam- ples were collected at random among the 10 villages. This tribe lives in a contiguous area with that occupied by the Zoro and east of where the Gaviao live. The Surui were con- tacted in 1969 by members of the National Indian Foundation. There are estimates that this population experienced a reduction in size of about 45% in 1972-1973 due to epi- demics of infectious diseases. Their life has undergone profound changes in the last few decades due to the adoption of cash income practices. The Surui and the two other pre-

BETA-GLOBIN HAPLOTYPES IN BRAZILIAN INDIANS 397

viously mentioned Tupi-Monde tribes have been investigated together as a model for the study of acculturation on health (Coim- bra and Santos, 1989; Santos, 1991; Santos and Coimbra, 1991; Coimbra et al., 1993, 1994).

Wai-Wai These Indians speak a language classified

in the Carib Stock, Parukoto-Charumg fam- ily (Rodrigues, 1986). Blood samples were collected in the Mapuera village, located at the east bank of the Mapuera river, State of Para, Brazil (57”55’W-Oo40’S). Although the majority of Indians in Mapuera are from the Wai-Wai tribe, members of several other groups also live in this village. Some ad- mixed families in which the male is Wai-Wai and the female is from another group were observed. The Mapuera population was esti- mated as having about 700 individuals in 1980 (Almeida, 1981).

Experimental Procedures The blood samples were refrigerated

shortly after collection and sent by air to Porto Alegre, where high molecular weight DNA was extracted using the salting out pro- cedure described by Miller et al. (1988) for the Xavante, Zor6, Gavigo, and Surui, and the technique described by Lahiri and Nurn- berger (1991) for the Wai-Wai samples.

The five polymorphic restriction sites con- sidered in this study were detected using endonucleases HincII (three polymor- phisms) and Hind111 (two polymorphisms), which are the most commonly employed in population genetics studies (Wainscoat e t al., 1986; Long et al., 1990; Chen et al., 1990). The sites they identify are distributed along a 31.3 kb region 5’ to the beta-globin gene, and the amplification products ob- tained are as follows: HincII-5’~, 619 bp; HindIII-Gy, 770 bp; HzndIII-*y, 760 bp; Hin- cII-IJJP, 700 bp; and HincIII-S’IJJp, 590 bp. These fragments were PCR-amplified using the oligonucleotide primers and conditions shown in Table 1. The samples were subse- quently digested with the appropriate re- striction endonuclease and separated by electrophoresis in 3% agarose gels con- taining ethidium bromide. The presence or absence of specific bands was then verified

under UV-induced fluorescence, using as a molecular weight marker +X174 DNA di- gested with HueIII.

The frequencies of polymorphic restriction sites and haplotypes were determined as de- scribed by Chen et al. (19901, and their dis- tributions among tribes were compared by the Roff and Bentzen (1989) x 2 test. Genetic diversity was measured by the Gini-Simpson index, which can be computed according to the formula

GSI = 1 - C p:, k

where pk is the frequency of the kth allele in the sample (Rao, 1982; Long et al., 1990). The index can be interpreted as the probabil- ity that two randomly sampled beta-globin haplotypes will differ in state.

To further evaluate the degree of intrapop- ulation and interpopulation variation in this system, we used the measures of gene diver- sity proposed by Nei (1973). He introduced a coefficient of gene differentiation defined by GST = (HT - Hs)/HT, where Hs and HT are the average heterozygosity within popula- tions and the average heterozygosity for the entire population disregarding the popula- tion structure, respectively. HT - Hs is often indicated by DST and represents the inter- populational genetic variation. However, GST is known to be affected by the number of populations examined. Therefore, Gsr’ (Nei, 1986) was also used, defined as GST‘ = Dm/ Hs + Dm, where Dm is rDsT/(r - 1). In this case r represents the number of subpopula- tions examined, while Dm is a measure of the absolute gene differentiation (Nei, 1973; Livshits and Nei, 1990).

RESULTS The frequencies of the haplotypes ob-

served in the five Indian tribes investigated in the present study and those observed by Guerreiro et al. (1992) for the Yanomama are given in Table 2. Haplotypes 2 (+----) and 6 (- + + - +) were the most prevalent and occurred in all tribes. Their frequencies ranged from 60% to 93% and from 3% to 18%, respectively. Haplotype 5 (- + - + +) was identified in 15% and 4.5% of the chro- mosomes of the Xavante and Surui Indians,

398 L.R.M. BEVILAQUA ET AL.

TABLE 1. Primers and annealing teinperatures used for the amplification of the diferent regions

Primer Primer sequence (5' + 3') Region Annealing

temperature

1 2 3 4' 5 6 7 8 9

TAGTCCCACTGTGGACTACTT CCTGAGAGCTTGCTAGTGATT AAGTGTGGAGTGTGCACATGA TGCTGCTAATGCTTCATTACAA TAAATGAGGAGC ATGC AC AC AC GAAC AGAAGTTGAGATAGAGA ACTCAGTGGTCTTGTGGGCT TCTGCATTTGACTCTGTTAGC GGACCCTAACTGATATAACTA

€

E

GY GY> 5

QP $P

3'QP 3'18

57 57 56 56,57 57 55 55 54 54

'Primer 4 amplifies both regions cy and 5, a t temperatures of 56°C and 57"C, respectively. Primers 1 and 2 were described by Guerreiro et al. (1992) and the remaining by Sutton et al. (1989).

TABLE 2. Frequencies (%I of beta-globin gene cluster haplotypes observed zn six Brazilian Indian tribes

Indian tribe Haplotypesl (no. of 1 2 3 5 6 7 11 16 chromosomes) ( - - - - - ) (+- - - - ) ( - - - -+) ( -+ -++) ( - + + - + I (-++--) ( - - - + + I ( - + - - - I

Xavante (60) 0.0 60.0 0.0 15.0 18.3 5.0 0.0 1.7 Zoro (60) 0.0 93.3 0.0 0.0 6.7 0.0 0.0 0.0 Gavi6o (58) 1.7 87.9 1.7 0.0 3.4 5.2 0.0 0.0 Surui (44) 0.0 81.8 0.0 4.5 11.4 0.0 2.3 0.0 Wai-Wai (56) 0.0 87.5 0.0 0.0 12.5 0.0 0.0 0.0 Yanomama (34Y 2.9 91.2 0.0 0.0 5.9 0.0 0.0 0.0

'Haplotype designation according to Long et al. (1990) 'Data from Guerreiro et al. (1992).

respectively. The other haplotypes were observed in low frequencies in only one or two tribes. The presence of haplotype 3 (- - - - +) in one chromosome of an individ- ual of the Gaviao tribe is probably due to admixture with a person having African an- cestry. When these frequencies were com- pared they showed a heterogeneous distribu- tion (x2 = 73.1; degrees of freedom [DFI = 35; P = 0.001). This result is mainly due to the Xavante; they have the highest number of haplotypes (5), and four of these haplo- types (labeled as 2, 5, 6, 7) have relatively high frequencies. When another test was performed excluding this tribe, a much more homogeneous distribution of haplotypes was observed (x2 = 35.7; DF = 28; P = 0.150).

Haplotypic diversity, measured by the Gini-Simpson index (Long et al., 19901, is shown in Table 3. The highest value for this index was observed among the Xavante (0.582) and the lowest in the Zoro (0.124). Average GSI for all Brazilian Indians inves- tigated was 0.271. This value was used to estimate the proportion of reduction of vari- ability in relation to Europeans, Asiatics,

and Pacific Islanders (data from Long et al., 1990). The largest reduction was observed in the comparison between Brazilian Indian and European populations (56%), but a re- duction of only 8% was observed when Bra- zilian Indians were compared with Asiatics. When this analysis is made by tribe, the largest reduction was observed among the Zoro (58% less than Asiatics). The Xavante and Surui did not show any reduction ofvari- ability when compared with values of this ethnic group.

Table 4 shows several estimates of gene diversity, as described by Livshits and Nei (1990). Two levels of population subdivision were considered. In the first we included all tribes investigated, while for the second we considered the three Tupi-Monde- speaking Indians only. The GST' and Dm for Brazilian Indians in general were 0.082 and 0.024, while for the Tupi-Mondk these values were 0.030 and 0.007, respectively. Although no precise standard errors have been derived for these indices, the Tupi- Monde numbers are clearly lower (36% and 29%, respectively) than those obtained

BETA-GLOBIN HAF'LOTYPES IN BRAZILIAN INDIANS 399

TABLE 3. Haplotypic diversity and reduction of variability (96) i n relation to other populations

Other Donulations' Brazilian Indians (GSI12

- Europe GSP = 0.622

- Asia Pacific Islands GS13 = 0.295 G S I ~ = 0.413

BraziJan Indians in general (GS13 = 0.271)

Xavante (0.582) Surui (0.315) Gaviao (0.222) Wai-Wai (0.218) Yanomama (0.164)4 Zor6 (0.124)

56.4 6.4

49.3 64.3 65.0 73.6 80.1

8.1 41.5 0 0 0 32.0

24.7 52.0 26.1 53.0 44.4 64.6 58.0 73.2

'Data from Long et al. (1990). ' GSI: Gini-Simpson index. 'a: Average Gini-Simpson index. 4Data from Cuerreiro et al. (1992).

TABLE 4. Gene diversity analysis i n Brazilian Indians

No. o f No. o f Ethnic group subpopulations loci HT Hs DST D, GST GW' Brazilian Indians 6 1 0.290 0.271 0.020 0.024 0.065 0.082

Tupi-Monde- 3 1 0.225 0.220 0.005 0.007 0.020 0.030 in general

speaking Indians

HT: total genetic variation; Hs: intrapopulational heterozygoaity; D,: gene differentiation among populations; D,m: average minimum genetic distance among subpopulations; G+ coeficient of gene differentiation; Gsr': coefficient of gene differentiahon considering the number of populations examined (cf. Nei, 1973, 1986; Livshits and Nei, 1990).

when all six Brazilian Indian tribes are considered together.

DISCUSSION Eight beta-globin haplotypes were ob-

served among Brazilian Indians; five of them (1,2,3,5, and 6) are considered as primitive or first order, derived directly from the an- cestral or another first-order haplotype. Haplotype 1 (- - - - -1 is regarded as the natural link between first-order haplotypes and is suggested to be the ancestral one, although it can be formed by various recom- bination events (Long et al., 1990). Haplo- type 2 (+ - - - -) could also be the ancestral one, as suggested by Chen et al. (1990).

Haplotypes 2 and 6 were the most fre- quent, being present in all Brazilian tribes. Haplotype 2 is the most prevalent world- wide, except in Africans, but it reaches its highest frequencies in Asiatics and Pacific Islanders (6694%; Long et al., 1990; Chen et al., 1990). Haplotype 6 shows the same range of frequencies in Brazilian Indians a s those observed in populations of these ethnic groups (0-19%). Haplotype 5 was observed

among the Xavante (15%) and Surui (4.5%), while its prevalences in Asiatics and Pacific Islanders varied from 0% to 18% (Shimizu, 1987; Long et al., 1990; Chen et al., 1990). These three haplotypes were probably pres- ent in the ancestral Amerindians who colo- nized South America, since they are sepa- rated from each other by at least two steps of mutation and recombination (Long et al., 1990).

The second-order haplotypes (those that would have been derived from the original arrangements) identified in Brazilian Indi- ans were number 7 (- + + - - 1, observed in two tribes (Xavante and Gaviiio), and num- bers 11 (- - - + +) and 16 (- + - - -), found among the Surui and Xavante, respectively. All of them occur with low prevalences (2- 5%), and similar low frequencies are found in Asiatics and Pacific Islanders. They could have been present among the continent's col- onizers or could have originated by recombi- nation events that occurred after the process of tribalization.

A small reduction in the variability of 30 RFLP systems was detected by Kidd et al.

400 L.R.M. BEVILAQUA ET AL

(1991) for two Brazilian Indian groups, the Karitiana and Surui (27% and 18%, respec- tively) in relation to Europeans. The reduc- tion observed in the present study is much higher (average 56%) when considering this same ethnic group. But when the level of heterozygosity is compared with that veri- fied in Asiatics, with whom they probably share more recent common ancestors, the reduction observed is much lower (average: 8%). For two tribes (Xavante and Surui), we did not detect any reduction in relation to Asiatics. These results suggest the absence of an important bottleneck effect in the early colonization of South America.

The estimate of the coefficient of gene dif- ferentiation (GST’) obtained with beta-glo- bin haplotypes for Brazilian Indians (0.082) was somewhat higher than that observed by Livshits and Nei (1990) for seven South American Indian populations using 29 pro- tein loci (0.066). This is not unexpected, be- cause heterozygosity is usually higher in DNA noncoding regions. But the GST’ for the three Tupi-Monde tribes (Zor6, Gaviso, and Surui) was considerably smaller (0.0301, being close to those obtained by Livshits and Nei (1990) for the intratribal variation (Gu- aymi, 0.023; Ticuna, 0.019). They pointed out that the coefficient of genetic differentia- tion is generally correlated with the extent of geographical isolation. These three Tupi- Monde tribes live in relatively close geo- graphical proximity and have many cultural traits in common, in addition to speaking similar languages. Therefore, genetic simi- larity was expected.

ACKNOWLEDGMENTS Thanks are due to Dr. Lavinia Schuler and

Girley V. Simdes for help in the collection of the Wai-Wai samples. This research was supported by Financiadora de Estudos e Pro- jetos, Conselho Nacional de Desenvolvi- mento Cientifico e Tecnologico, FundaFiio de Amparo a Pesquisa do Estado do Rio Grande do Sul, and Coordena@o de Aperfeicoa- mento de Pessoal de Nivel Superior. Field work was supported by the Wenner-Gren and MacArthur Foundations. The Fundaciio Nacional do Indio (FUNAI) gave permission to study the Indians and provided logistic

help. Approval by the Indian leaders was also obtained before sample collection.

REFERENCES Almeida MHP (1981) Elei@o e DelimitaCBo dos PIS.

Nhamunda e, Mapuera (AMPA). Brasilia: FundaqBo Nacional do Indio.

Chen LZ, Easteal S, Board PG, and Kirk RL (1990) Evolution of P-globin haplotypes in human popula- tions. Mol. Biol. Evol. 7:423437.

Coimbra CEA Jr, and Santos RV (1989) Black Piedra among the Zor6 Indians from Amazonia (Brazil). My- copathologia 107.57-60.

Coimbra CEA Jr, Santos RV, Yoshida C N , Baptista ML, Flowers NM, Valle ACF, and Mercadante LAC (1993) Hepatitis B epidemiology in four native populations from the Brazilian Amazon. Am. J. Phys. Anthro- pol., 16(Suppl.):71-72.

Coimbra CEA Jr, Wanke B, Santos RV, Valle ACF, Costa RLB, and Zancope-Oliveira RM (1994) Paracoccidioi- din and histoplasmin sensitivity in Tupi-Monde Amer- indian populations from Brazilian Amazonia. Ann. Trop. Med. Parasitol. 88:197-207.

Flowers NM (1994) Demographic crisis and recovery: A case study of the Xavante of Pimentel Barbosa. South Am. Ind. Stud. 4:18-36.

Greenberg J H (1987) Language in the Americas. Stan- ford, CA Stanford University Press.

Guerreiro JF, Figueiredo MS, Santos SEB, and Zag0 MA (1992) P-globin gene cluster haplotypes in Yanornama Indians from the Amazon region of Brazil. Hum. Genet. 89529-631.

Kidd JR, Black FL, Weiss KM, Balazs I, and Kidd KK (1991) Studies of three Amerindian populations using nuclear DNA polymorphisms. Hum. Biol. 63:775-794.

Lahiri DK, and Nurnberger J I Jr (1991) A rapid non- enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 195444.

Livshits G, and Nei M (1990) Relationships between intrapopulational and interpopulational genetic di- versity in man. Ann. Hum. Biol. 17501-513.

Long J C , Chakravarti A, Boehm CD, Antonarakis S, and Kazazian, HH (1990) Phylogeny of human P-globin haplotypes and its implication for recent human evo- lution. Am. J . Phys. Anthropol. 81:113-130.

Miller SA, Dykes DD, and Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:1215.

Nei M (1973) Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 70:3321-3323.

Nei M (1986) Definition and estimation of fixation indi- ces. Evolution 40t643-645.

Rao CR (1982) Diversity and dissimilarity coefficients: A unified approach. Theor. Popul. Biol. 21:2443.

Ricardo CA (1991) Povos Indigenas no Brasil (1987/88/ 89/90) SBo Paulo: Centro Ecum6nico de Documentagio e InformaGBo.

Rodrigues AD (1986) Linguas Brasileiras. Para o Con- hecimento das Linguas Indigenas. SBo Paulo: Ediq6es Loyola.

BETA-GLOBIN HAPLOTYPES IN BRAZILIAN INDIANS 40 1

Roff DA, and Bentzen P (1989) The statistical analysis of mitochondrial DNA polymorphisms: and the problem of small samples. Mol. Biol. Evol. 6t539-545.

Salzano FM, and Callegari-Jacques SM (1988) South American Indians: A Case Study in Evolution. Oxford: Clarendon Press.

Santos RV (1991) Coping with change in native Ama- zonia: A bioanthropological study of GaviBo, Surui and Zoro, Tupi-Monde speaking societies from Brazil. Ph.D. dissertation, Department of Anthropology, Indi- ana University, Bloomington.

Santos RV, and Coimbra CEA Jr (1991) Socioeconomic transition and physical growth of Tupi-Mond6 Amer- indian children of the AripuanB Park, Brazilian Ama- zon. Hum. Biol. 63t795-819.

Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merri- wether DA, Lawrence DN, Knowler WC, Weiss KM, and Wallace DC (1990) Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. Am. J. Hum. Genet. 46t613-623.

Shimizu K (1987) DNA polymorphism patterns in the

p-globin gene cluster in the Japanese population. He- moglobin IIt487-496.

Sutton M, Bowhassira EE, and Nagel RL (1989) Poly- merase chain reaction amplification applied to the de- termination of p-like globin gene cluster haplotypes. Am. J. Hematol. 32:66-69.

Torroni A, Schurr TG, Cabell MF, Brown MD, Nee1 Jv, Larsen M, Smith DG, Vullo CM, and Wallace DC (1993) Asian affinities and continental radiation of the four founding native American mtDNAs. Am. J. Hum. Genet. 53t563-590.

Torroni A, Schurr TG, Yang CC, Szathmary EJE, Wil- liams RC, Schanfield MS, Troup GA, Knowler WC, Lawrence DN, Weiss KM, and Wallace DC (1992) Na- tive American mitochondrial DNA analysis indicates that Amerind and Na-Dene populations were founded by two independent migrations. Genetics I3Ot153-162.

Wainscoat JS, Hill AVS, Boyce AL, Flint J, Hernandez M., Thein SL, Old JM, Lynch JR, Falusi AG, Weath- era11 DJ, and Clegg JB (1986) Evolutionary relation- ships of human populations from an analysis of nu- clear DNA polymorphisms. Nature 319t491-493.