Editor: Editorial de la Universidad de GranadaAutor: María de las Mercedes Ruiz EstévezD.L.: GR 890-2014ISBN: 978-84-9028-937-2

El presente trabajo se ha realizado en el

Grupo de Genética Evolutiva del

Departamento de Genética de la Universidad

de Granada. La investigación ha sido

financiada por el Ministerio de Ciencia e

Innovación a través del proyecto CGL2009-

11917 y parcialmente realizada con fondos

FEDER.

Durante la realización de este proyecto de

Tesis Doctoral he disfrutado de una Beca

Predoctoral de Formación del Personal

Universitario (FPU), del Ministerio de

Ciencia y Tecnología, con la siguiente

referencia: AP2007-00348.

A mis padres Tomás y Mercedes, a mi hermana Marta

A Karl

y…

A todos los que me apoyaron durante todos estos años

Agradecimientos

Parece que fue ayer cuando empecé la Tesis Doctoral, pero parece también un día lejano

cuando me pongo a pensar en pequeños detalles del día a día. A lo largo de estos 5 años

he pasado por muuuuchos momentos buenos, pero también muchos momentos duros, en

los que los resultados no salen o los experimentos no van lo bien que, en tu mente

habías, planeado. Han sido momentos de sonrisas y lágrimas, alegrías y tristezas, y

muchísimas noches las que he soñado con esta bendita Tesis Doctoral. Ahora que se

acerca el final, la alegría que siento hace que todo lo malo se borre de la mente, y si

tuviera que empezar de nuevo esta Tesis, aceptaría con los ojos cerrados.

No podría imaginar un grupo de investigación mejor para desarrollar mi Tesis Doctoral.

En estos 5 años he entrado a formar parte de “una familia” en la que me he sentido muy

cómoda y feliz, a la vez que arropada en todos los sentidos. Grupos como éste hay

pocos, y por eso les doy las gracias por ser como son.

En primer lugar quería agradecer al Dr. Juan Pedro Martínez Camacho y a la Dra. Mª

Dolores López-León el haber sido unos directores de tesis excepcionales. Me siento

muy orgullosa de ellos porque son imparables, incansables y siempre están detrás de un

ordenador (sábados y domingos incluidos) para responder a mis preguntas. Nunca me

han dejado sola, me han ayudado, aconsejado, “dado caña” cuando había que hacerlo y,

sobre todo, me han enseñado a pensar de una manera autocrítica en el trabajo que

desarrollo, a no conformarme y mirar más allá, a tener inquietudes propias de un

investigador….en resumen, me han formado como científica.

También quiero agradecer a la Dra. Josefa Cabrero Hurtado el haber sido una parte

importante de su proyecto, y es que la considero una tercera directora de esta Tesis.

Gracias por ayudarme siempre, aconsejarme en los diferentes experimentos, enseñarme

el mundo de la citogenética, hablarme siempre desde el lado práctico, y ayudarme a que

no empeoraran mis dolores de espalda fruto de cientos de horas en el microscopio,

prestándome “tu cojín”. Y es que esto es solo un ejemplo de que te has comportado

conmigo siempre como una madre, y sé que hablo por mi madre Mercedes también

cuando digo que “gracias”.

Por otro lado, no puede faltar mi especial agradecimiento a la Dra. y amiga Eli Montiel.

Ella fue la que me enseñó el mundo del laboratorio cuando llegué a este grupo, me

enseñó a PeCeeRrear como una loca, a analizar resultados, y a empezar a ser crítica. Mi

iniciación en este mundo la asocio a ti, así que muchas gracias por tu paciencia y tus

ganas, siempre dispuesta a ayudarme con lo que fuera. También quiero darle las gracias

a mi amiga Tati López. Para mí siempre serás nuestra técnico y por supuesto, la mejor.

Gracias por enseñarme cosas del laboratorio, ayudarme, cuidar mis saltamontes cuando

yo no estaba, pero sobre todo, por recibirme cada mañana con energía, vitalidad, una

sonrisa, ganas de trabajar, cosas que contar, por llevarme a tu casa y hacerme sentir

parte de tu familia, ayudarme a hacer la mudanza, llevarme con tus amigas al Aquaola,

etc etc etc…Has sido durante estos 5 años una gran amiga (y lo seguirás siendo) y te he

9

echado muchísimo de menos estos últimos meses. Ojalá vuelvas pronto porque tú vales

lo que no está escrito. Continúo con Paquillo, “el crack”. Has estado siempre ahí

dispuesto a ayudarme, aunque supusiera dejar de hacer tus cosas. Poco a poco te has ido

convirtiendo en un gran amigo, y así las Tesis se hacen mejor. Gracias por las risas y

conversaciones que nos echamos, por tu forma de ser, por las comidas en los

comedores, por hacerme la guía turística de tu pueblo, por darme bollos de tu madre,

por ayudarme con cualquier programa/problema informático y por compartir conmigo

grandes momentos fuera del laboratorio, como los “hashs” que hemos corrido por

Granada, las cenas que hemos hecho en mi casa (acompañadas de los partidos de “beer-

pong”, que hasta para eso eres un crack!), las barbacoas, el partido de frisbee en Plaza

de Gracia…Son muchos buenos recuerdos, así que gracias por contribuir a que estos

años fueran muy buenos. También quiero agradecer a mi amiga y compañera Bea

Navarro su aportación a la presente Tesis. Gracias por compartir conmigo parte de estos

momentos, darme consejos, animarme, hacerme preguntas que me incitan a pensar más

allá de lo que yo creía, compartir conmigo tus inquietudes y aspectos personales. Tú

también me has metido en tu grupo de amigas y me has llevado tanto al campo como a

la montaña, así que has hecho que los días de esta Tesis sean más alegres. Gracias.

Continúo agradeciendo a Rubén Martín su granito de arena a esta Tesis. Llegaste el

último, por lo que hemos compartido menos momentos, pero no menos importante.

Gracias por tu humor y tu sentido práctico de las cosas, por mostrar interés en qué

estaba pasando por mi cabeza, y por apartar tu vista del ordenador en un segundo cada

vez que te preguntaba una duda.

Agradezco al Dr. Francisco Perfectti todas sus aportaciones a la presente Tesis. Tu ojo

estadístico, consejos y ayuda me han facilitado mucho las cosas. Así que una parte

importante de esta Tesis también se la debo a él. También le agradezco al Dr.

Mohammed Bakkali la ayuda que me ha brindado en todo momento, sus consejos, ser

tan directo a la hora de decir las cosas, las bromas que hemos tenido, haberme llamado

cuando tuve que ir al hospital, y también haberme “mentido” cuando le pregunté

gritando “¿estoy sangrando?”, tras haberme explotado un termo con nitrógeno líquido

en toda la oreja. Evitaste que me desmayara en ese momento. No podía olvidarme de la

Dra. María Teruel. Ella es otra persona, y además amiga, importante en mi iniciación en

el laboratorio. Cuando yo entraba tú casi salías, pero me enseñaste a organizarme, a no

parar de trabajar con cabeza y a que había que llegar a las 4 de la tarde a continuar

trabajando tras el almuerzo. Gracias por enseñarme muchas cosas teóricas y prácticas,

gracias por querer que fuera yo la que me quedara con tu puesto del lab cuando tú te

fueras, y gracias por enseñarme que si quería hacer una tesis tenía que ser fuerte para

superar el gran reto que es. Y es que aún recuerdo que tú escribías la tesis cuando yo

prácticamente acababa de llegar, y viéndote sabía que esto no iba a ser fácil. Me armé

de fuerzas y dije: “Yo puedo con esto”. Gracias. Mis agradecimientos también van para

la Dra. Inma Manríquez, con la que compartí muchos momentos en el lab, y con la que

competía a ver quién hablaba más y más alto, jeje. Pasamos buenos momentos y

entablamos una amistad que aún perdura. Tu alegría y desparpajo me hicieron sentirme

10

relajada y cómoda cuando llegué al lab, así que por eso y por los años posteriores,

gracias.

A Ángel, el que me mortifica llamándome “la niña que habla raro”, le agradezco ser un

amigo que me ha ayudado siempre que he tenido cualquier problema informático o a la

hora de dar las prácticas. Contigo he compartido además buenos momentos de

almuerzos en el comedor, tapas y clases de inglés, con lo que has aportado felicidad a

estos años. Gracias también Carmen, con tu alegría traías aire fresco al laboratorio, y se

agradece muchísimo. A la Dra. Ester, por tu forma de ser y tu humor, has sido una parte

importante de estos años y te has convertido en una buena amiga. Gracias por compartir

esas largas horas en el departamento conmigo, sobre todo cuando ya oscurecía y aún

seguíamos sacando resultados, a la vez que nos sacábamos fotos con la bata y la luna

llena (y tengo pruebas). A los Drs. Jesús y Moha, por enseñarme que hay que trabajar

duro, pasar mucho tiempo sentado delante del ordenador, e invertir mucho tiempo en el

departamento para llegar lejos. A Eva, por ser un torbellino lleno de energía y hacer que

los días que pasábamos juntas en el lab fueran más divertidos. A María Lucena, por

compartir conmigo momentos de pipeteos con una agradable conversación. En general,

a todos los profesores/becarios/alumnos internos del departamento les agradezco lo bien

que me lo han hecho pasar y lo agradables que siempre han sido conmigo, dispuestos

siempre a entretenerme con una alegre conversación. Me llevo un buen recuerdo de este

departamento.

Mis años de Tesis no sólo se desarrollaron en esta universidad, sino que tuve la

oportunidad de pasar unos meses aprendiendo y compartiendo pipeteos en el laboratorio

del Dr. Josef Vanden Broeck en Leuven (Bélgica). A él le agradezco que me abriera las

puertas desde el principio, que tuviera siempre hueco para reunirse conmigo, se

interesara por cómo iba mi trabajo, y me organizara hasta una fiesta de despedida. Mis

agradecimientos son igual de grandes para Liesbeth Badisco, que a pesar de estar

embarazada se metía conmigo en el laboratorio y me introdujo de una manera muy

sencilla en el mundo de la qRT-PCR. Siempre tenía una sonrisa en su cara, y a pesar de

estar liada con mil cosas, siempre tenía un tiempo para mí. Lo mismo Joost, el técnico

de ese grupo, pasamos muchas horas juntas en el laboratorio y nos hicimos buenos

amigos. Siempre alegrándome los días con bromas y buena música, así que le doy las

gracias. Y en general gracias a todos los de aquel departamento, que a pesar de ser un

país muy frío, siempre me tenían arropada.

Durante parte de los 5 años en que he desarrollado la presente Tesis Doctoral, mi vida

se ha desarrollado tanto dentro como fuera del laboratorio. Agradezco a todos los

amigos y compañeros de piso que me han acompañado estos años y me han brindado su

apoyo y amistad, haciendo que “no todo fuera trabajo en esta vida”. No puedo concebir

mi etapa de Tesis sin ellos. En especial a mi equipo de Ultimate Frisbee “Penultimanos-

Granayd”, el cual tuve el honor de capitanear durante un año y ser siempre “la corazón

del equipo”. Gracias a todos los jugadores de todos los rincones del mundo que han

pasado por nuestro equipo y a toda la comunidad de jugadores españoles, por hacerme

11

desconectar del laboratorio y llegar cada lunes con una sonrisa, agujetas, o incluso un

pie roto, pero con ganas de trabajar. Gracias, gracias, gracias, ¡son muy grandes!

Para el final he dejado los agradecimientos a las personas más importantes en mi vida.

En primer lugar, agradezco infinitamente a mis padres Tomás y Mercedes la vida que

me han dado, y la educación que he recibido. Sin ellos, nunca hubiese llegado a donde

estoy ahora mismo, así que una gran parte de esta tesis es de ellos y para ellos. Gracias

por apoyarme, escucharme, y ayudarme a llegar a donde estoy ahora mismo. Estas

páginas se quedarían cortas para decir todo lo que me gustaría. Lo mismo a mi hermana

Marta, gracias por ser parte de mí, interesarte por mi trabajo, estar siempre a mi lado,

escucharme y darme ánimos cuando lo necesitaba. La distancia nos ha separado

físicamente pero no de corazón, así que espero que siempre sigamos estando la una para

la otra. Gracias. A los tres les agradezco enormemente el que hayan hecho un gran

esfuerzo para estar conmigo en un día muy especial. También agradezco a toda mi

familia canaria y torrecampeña todo el apoyo que me han dado estos años, siempre

interesándose por esta bendita Tesis, preguntando “cuándo voy a acabar” y diciéndome

cosas como “ojalá encontraras trabajo y te quedaras colocada”. También a mi familia

americana Kristine, Richard, Aurora y Christopher, porque en los más de dos años que

nos conocemos se han interesado por cada detalle de esta Tesis de una manera sin igual,

preguntando en cada llamada o visita cómo me iba en el laboratorio, y dándome ánimos

desde la distancia.

Y por supuesto MIL GRACIAS a Karl, mi pareja, amigo y compañero. Has llegado a

mi vida en la mitad de la tesis y me has llenado de alegría y felicidad. Gracias a tu

faceta de biólogo y a tu inigualable personalidad, me has transmitido fuerzas, paz y

tranquilidad para trabajar con muchas más ganas. Te agradezco que CADA DÍA al

llegar a casa te interesaras por los experimentos realizados ese día, que si había subido

la temperatura de esto, que si había mirado la plata de lo otro… He podido compartir

contigo esta etapa apasionante de desarrollar una Tesis Doctoral, y agradezco mil veces

a la vida que te hayas cruzado en mi camino (bendito Ultimate Frisbee). Gracias por ser

como eres y por estar siempre dispuesto a escucharme y darme ánimos. Gran parte de

esta Tesis es tuya también.

12

Índice

Resumen 17

Capítulo 1. Introducción general y Objetivos 25

El ADN ribosómico________________________________________27

Estructura, abundancia y función biológica_____________________ 27

Expresión del ADNr. El nucleolo______________________________29

El nucleolo como sensor de estrés y daño del ADN________________31 Estudio del nucleolo________________________________________32

Los ITSs (Espaciadores Internos Transcritos) ribosómicos_________ 33

Modelos de evolución del ADNr______________________________ 34

Los cromosomas B________________________________________ 37

Historia del descubrimiento__________________________________37

Características generales y frecuencia_________________________ 37

Tamaño y composición molecular_____________________________ 38

Origen___________________________________________________41

Comportamiento meiótico___________________________________ 42

Modelos de mantenimiento de los cromosomas B en las

poblaciones_______________________________________________44 Efectos__________________________________________________ 45

Eyprepocnemis plorans_____________________________________46

La especie________________________________________________46

El genoma________________________________________________47

Los cromosomas B de E. plorans______________________________48

Referencias_______________________________________________50

Objetivos________________________________________________65

Capítulo 2. B-Chromosome ribosomal DNA is functional in

the grasshopper Eyprepocnemis plorans 67

Abstract_________________________________________________ 69

Introduction______________________________________________ 69

Results__________________________________________________ 70

Cytological analysis______________________________________70

Molecular analysis_______________________________________70

Discussion_______________________________________________ 71

Material and methods_______________________________________73

Experimental material____________________________________ 73

13

Cytological analysis of B-NOR expression____________________73

Molecular analysis of B-NOR expression_____________________73

Supporting Information__________________________________74, 76

References_______________________________________________74

Capítulo 3. B1 was the ancestor B chromosome variant in the

western mediterranean area in the grasshopper

Eyprepocnemis plorans 77

Abstract_________________________________________________ 79

Materials and methods______________________________________80

Results and discussion______________________________________ 80

References_______________________________________________ 83

Capítulo 4. Ribosomal DNA is active in different B

chromosome variants of the grasshopper Eyprepocnemis

plorans 85

Abstract_________________________________________________ 87

Introduction______________________________________________ 87

Materials and methods______________________________________88

Biological samples and characterization of B variants___________88

Cytological analysis of rRNA gene expression in B chromosomes__89

Molecular analysis of rRNA gene expression in B chromosomes___89

Results__________________________________________________ 89

Discussion_______________________________________________ 92

References_______________________________________________ 94

Capítulo 5. B chromosomes in Eyprepocnemis plorans are

present in all body parts analyzed and show extensive

variation for rDNA copy number 97

Abstract________________________________________________ 100

Introduction_____________________________________________ 100

Materials and methods_____________________________________101

Biological material preparation____________________________101

B presence in the body parts______________________________ 102

B-rDNA copy number estimation at the individual and body

part levels_____________________________________________102

Fluorescent in situ hibridization (FISH)_____________________ 103

14

Statistical analyses______________________________________103

Results_________________________________________________ 103

Analysis of B chromosome presence________________________ 103

B-rDNA copy number estimation in male bodies_______________104

No qITS2_B copy number variation among body parts__________107

Discussion______________________________________________ 107

References______________________________________________ 109

Capítulo 6. Ribosomal DNA on a B chromosome shows

differential expression level in several body parts of the

grasshopper Eyprepocnemis plorans 113

Abstract________________________________________________ 116

Introduction_____________________________________________ 116

Materials and methods_____________________________________118 Biological samples______________________________________118

Total RNA extractions and complementary DNA (cDNA)

synthesis______________________________________________118

B-rDNA expression in different body parts___________________118 Target and housekeeping genes primers___________________ 118

Housekeeping reference genes validation and relative

quantification of B-rDNA expression______________________119 Statistical analysis____________________________________ 120

Results and discussion_____________________________________ 120

References______________________________________________ 123

Supporting information____________________________________ 127

Capítulo 7. HP1 knockdown is associated with abnormal

condensation of almost all chromatin types 129

Abstract________________________________________________ 132 Introduction_____________________________________________ 132

Material and methods______________________________________135

Biological samples______________________________________135 Molecular analyses______________________________________135

Nucleic acid isolation and genotyping_____________________135

HP1 gene amplification, dsRNA synthesis and delivery_______ 136 HP1 silencing analysis_________________________________136

Analysis of rDNA, Bub1 and Hsp70 genes expression patterns

after HP1 knockdown__________________________________137

Cytological techniques___________________________________137

15

Silver Stain__________________________________________138

C-Banding__________________________________________ 138 Fluorescent in situ hybridization (FISH)___________________138

Immunofluorescence analysis___________________________ 138

Statistical Analyses_____________________________________ 139 Results _________________________________________________139

HP1 knockdown was effective in RNAi males_______________ 139

Influence of HP1 knockdown on the activity of other genes____ 141

Physiological effects of HP1 knockdown___________________141 Cytological effects of HP1 knockdown_____________________142

Discussion______________________________________________ 145

References______________________________________________ 149 Supporting information____________________________________ 154

Capítulo 8. High variation of ITS2 rDNA region and non-

random expression of rDNA units in a grasshopper

genome 157 Abstract________________________________________________ 160 Introduction_____________________________________________ 160 Materials and methods_____________________________________163

Biological samples and karyotypic characterization____________163 gDNA and RNA extractions, cDNA synthesis and B-NOR activity analysis________________________________________ 163

Tagged PCR and amplicon NGS sequencing__________________163 Data analysis__________________________________________ 164

Whole-Genome Shotgun Sequencing-NGS____________________165 Secondary structure and genetic diversity analyses_____________165

Statistical analyses______________________________________165

Results_________________________________________________ 165

Preliminary analysis of ITS2 variation______________________ 165 Body part experiment____________________________________166

Population experiment___________________________________167 Differential expression among haplotypes____________________170

Discussion______________________________________________ 172

References______________________________________________ 177

Supporting information____________________________________ 182

Capítulo 9. Discusión general 185

Referencias______________________________________________197

Capítulo 10. Conclusiones 203

Capítulo 11. Perspectivas 207

16

Resumen

17

18

Resumen

El ADN ribosómico (ADNr) es un componente esencial de los genomas porque codifica

para el ARN ribosómico que es el componente principal de los ribosomas junto con una

serie de proteínas ribosomales, y son los responsables de la síntesis proteica. Se localiza

en clusters altamente repetidos en tándem y esto posibilita la síntesis masiva de

ribosomas en períodos de rápido crecimiento. Cada cluster está separado por los

Intergenic Spacers (IGS) y formado por tres genes ribosómicos para los ARN 18S, 5.8S

y 28S (en animales), separados entre sí por los Internal Transcribed Spacers 1 y 2

(ITS1 e ITS2, respectivamente), que se transcriben pero no son incorporados al

ribosoma maduro. Delante del gen para el ARN 18S se encuentra el External

Transcribed Spacer (EGS). De todas las repeticiones de ADNr que hay en un genoma,

sólo el 50% están transcripcionalmente activas en un momento dado.

Eyprepocnemis plorans es una especie de saltamontes cuyo genoma estándar

está organizado en 23 cromosomas (11 parejas autosómicas y el cromosoma sexual con

determinismo X0/XX). Además de estos cromosomas (A), puede albergar un número

variable de cromosomas supernumerarios (también denominados cromosomas B). Los

cromosomas B son dispensables, de naturaleza heterocromática, que no recombinan con

los cromosomas A, muestran mecanismos de transmisión no mendeliana y están

constituidos principalmente por una variedad de secuencias repetidas entre las que

destacan ADN satélite (ADNsat), ADNr y elementos móviles. Sin embargo, estudios

recientes han revelado que los cromosomas B de esta especie, en la población española

de Torrox, son capaces de organizar nucleolos que pueden visualizarse asociados a las

Regiones Organizadoras Nucleolares (NORs) de los Bs. La obtención de ADN de varios

cromosomas, mediante microdisección, y su amplificación por PCR, permitió comparar

las secuencias de las regiones ITS y detectar la existencia de una inserción de una

adenina en la región ITS2 que sólo se observó en las secuencias procedentes del

cromosoma B. Este fue el punto de partida de la presente tesis doctoral, con la que

hemos pretendido ampliar estos resultados preliminares analizando la estructura y

expresión de la región ITS2 a los niveles de partes corporales, individuo y población.

En primer lugar, realizamos un estudio combinado, citogenético y molecular, de

la expresión del ADNr de los cromosomas B24 de machos y hembras de E.plorans

procedentes de Torrox. El análisis citogenético se hizo mediante tinción argéntica de

células en profase meiótica I, y el molecular mediante el diseño de primers para PCR

que anclaran en la adenina diferencial del ITS2 del cromosoma B, cuyo amplicón

llamamos ITS2_B. Estos primers nos permitieron detectar molecularmente transcritos

procedentes del ADNr del B, tanto en machos como en hembras. Así, de los 29 machos

portadores de cromosomas B analizados, alrededor del 50% mostraron un nucleolo

asociado a la NOR de alguno de sus cromosomas B, confirmando resultados anteriores

en esta población. Además, cuando el macho tenía un B activo, formaba nucleolo en el

20% de las células, en promedio, aunque la variación entre individuos era alta (5-50%).

19

Resumen

La correspondencia entre la tinción argéntica y la amplificación del ITS2_B fue positiva

en todos los machos en los que visualizamos nucleolos en el B, a excepción de tres

casos. En estos tres machos, observamos nucleolo pero no transcritos o viceversa,

sugiriendo que la proporción de células con B-NOR activa es demasiado baja como para

detectar transcritos (en el primer caso) o que los nucleolos se desorganizan

tempranamente y por ello no se detectan transcritos (en el segundo). Al mismo tiempo,

no se detectaron transcritos ITS2_B en machos que no portaban cromosomas B. En las

hembras, la actividad de la NOR del B no puede ser estudiada citogenéticamente,

debido a la dificultad de analizar la meiosis femenina, pero sí pudimos detectar

transcritos ITS2_B en 10 de las 13 hembras portadoras de cromosomas B, así como su

ausencia en hembras sin B. Estos resultados ya han sido publicados (Ruiz-Estévez M,

López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome Ribosomal DNA is

functional in the grasshopper Eyprepocnemis plorans. PLoS ONE 7(5): e36600.

doi:10.1371/journal.pone.0036600).

En E.plorans se han descrito más de 50 variantes de cromosomas B, sólo en la

Península Ibérica. Estas variantes se diferencian en la composición relativa de las dos

secuencias repetitivas de ADN que principalmente componen los Bs (ADNr y ADNsat)

y en su tamaño relativo con respecto al cromosoma X. Para caracterizar mejor esta

variación, hemos realizado un estudio exhaustivo de la distribución de estas dos

secuencias en los cromosomas B encontrados en 17 poblaciones naturales de E.plorans

plorans localizadas en la región mediterránea occidental, incluyendo la Península

Ibérica, las Islas Baleares, Sicilia y Túnez. Los resultados pusieron de manifiesto que en

estas 17 poblaciones hay cuatro tipos de variantes: B1, B2, B5 y B24. El B1 es el más

ampliamente distribuido por lo que se puede considerar que es el tipo ancestral para la

región analizada. Se caracteriza por cantidades similares de ambos tipos de ADN en las

poblaciones de la Península Ibérica, Sicilia y Túnez, y por tener una cantidad un poco

mayor de rDNA en las Islas Baleares. Sin embargo, los otros tres tipos, B2, B24 y B5,

contienen más ADNsat que ADNr en proporciones 2:1, 3:1 y 2:1, respectivamente. El

tamaño del B24 es la mitad del X, y el del B5 llega ser dos tercios. Para el B1 y el B2,

encontramos variabilidad para el tamaño entre poblaciones. Así, el tamaño del B1 es

aproximadamente la mitad del X en las Islas Baleares, mientras que en poblaciones de

las provincias de Alicante, Murcia y Albacete (todas ellas de la Península Ibérica) su

tamaño es dos tercios del X. Igualmente, el B2 es aproximadamente un tercio del tamaño

del X en poblaciones de Granada, mientras que en Málaga su tamaño es la mitad.

Además, encontramos evidencia de que los cromosomas B de esta especie siguen

abriéndose nuevos caminos evolutivos, al encontrar una nueva variante (B2i) en Maro

(Málaga) que presumiblemente surgió a través de una inversión paracéntrica que

cambió las posiciones relativas del ADNr y parte del ADNsat. (Manuscrito aceptado en

Cytogenetic and Genome Research).

Tras conocer las diferencias estructurales de las diferentes variantes de Bs,

decidimos ampliar el estudio de la expresión del ADNr del B a otras variantes, tales

como B1, B2 y B5, además de volver a estudiar el B24 tres años después del anterior

estudio. Bajo la hipótesis de que los cromosomas B son de reciente aparición en

20

E.plorans, deberíamos esperar que todas las variantes tuvieran la capacidad de expresar

su ADNr pues no habría habido tiempo de que ocurrieran mutaciones que los

silenciaran. Para someter a prueba esta hipótesis, analizamos la expresión del B, a los

niveles citogenético y molecular, en machos procedentes de 11 poblaciones españolas:

cuatro procedentes de la provincia de Málaga (Algarrobo, Nerja, Torrox y Fuengirola),

dos de la provincia de Granada (Salobreña y Otívar), una de la de Murcia (Cieza), una

de Alicante (San Juan), una de Albacete (Mundo), y dos de la isla de Mallorca

(S’Albufereta y S’Esgleieta). Los resultados mostraron no sólo expresión del ADNr

localizado en el cromosoma B24 de Torrox, sino también en el B1 de Mundo, San Juan y

S’Esgleieta, y en el B2 de Otívar, Salobreña y Algarrobo, pero en estas dos variantes la

proporción de células con B-NOR activa era mucho menor que la anteriormente

reportada para B24. Por el contrario, no detectamos expresión de la variante B5. Además,

detectamos que en machos con menos de un 10% de células con nucleolo en el B no es

posible detectar transcritos ITS2_B, y que la probabilidad de detectar molecularmente la

actividad de la NOR del B parece ser independiente del tamaño del nucleolo de dicho

cromosoma. Estos resultados ya han sido publicados (Ruiz-Estévez M, López-León

MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is active in different B

chromosome variants of the grasshopper Eyprepocnemis plorans. Genetica 141(7-

9):337-345, doi: 10.1007/s10709-013-9733-6).

La puesta a punto del procedimiento molecular para detectar la presencia de

transcritos ITS2_B nos permitió abordar el estudio de la estabilidad mitótica de los

cromosomas B de E. plorans. Para ello, nos planteamos analizar si el cromosoma B está

presente en las diferentes partes del cuerpo de los individuos con cromosomas B. Hasta

ahora se sabía que los cromosomas B de esta especie son mitóticamente estables en

espermatocitos y células somáticas de los ciegos gástricos, mostrando el mismo número

en ambos casos. Pero no se conocía qué pasaba en el resto del cuerpo, debido a la

imposibilidad de observar cromosomas condensados en células en interfase. En nuestro

estudio, hemos detectado molecularmente la presencia del cromosoma B (es decir, de la

secuencia ITS2_B, específica del B) en 8 partes del cuerpo diferentes con tejido

somático en ambos sexos (cabeza, ganglio cerebral, antena, músculo alar, pata saltadora,

ciegos gástricos, túbulos de Malphigi y glándula accesoria en machos) y también en

ovariolas en hembras y testículos en machos, tras amplificar el marcador ITS2_B y

también un marcador SCAR puesto a punto previamente, para reforzar el diagnóstico.

Además, analizamos el número de copias de ITS2_B que tienen los cromosomas B24 y

B2 en machos con diferente número de Bs, para intentar utilizarlo como método que nos

permitiera determinar el número de Bs que tiene un individuo, a partir de su ADN, y así

ver si además ese número se mantenía estable entre diferentes partes del cuerpo. No

obstante, observamos una gran variabilidad para el número de copias de ADNr por

cromosoma B (B-ADNr), incluso entre individuos de la misma población y con el

mismo número de Bs, por lo que no es posible averiguar el número de Bs que tiene un

individuo a través del número de copias de B-ADNr. El análisis mediante FISH de

varios machos con números de copias muy divergentes corroboró la coexistencia en la

población de bandas de ADNr muy diferentes en tamaño en los cromosomas B de

21

Resumen

diferentes individuos, sugiriendo la existencia de posibles eventos de amplificación

diferencial en el B-ADNr mediante sobrecruzamiento desigual durante la meiosis. Sin

embargo, cuando cuantificamos el número de copias de ADNr del B24 en diferentes

partes corporales de machos y hembras, no observamos variabilidad significativa.

(Manuscrito en preparación).

Una vez demostrado que el B está presente en todas las partes del cuerpo, que el

ADNr del B está ocasionalmente activo, y que esta expresión puede detectarse en

testículo mediante análisis citológico o molecular y en otras partes del cuerpo (sin

necesidad de que haya células en división celular) mediante análisis molecular,

quisimos averiguar si dicha expresión muestra variación entre esas partes. Para ello,

analizamos molecularmente la expresión del ITS2_B en 6 partes del cuerpo diferente

(cabeza, músculo alar, testículo, ciegos gástricos, pata saltadora y glándula accesoria) de

machos con B24 donde previamente habíamos observado citológicamente la formación

de nucleolos por parte del B en las gónadas. Los resultados indicaron que el ADNr del

B se expresaba en todas las partes analizados, con niveles de expresión (analizados

mediante qPCR) que variaban entre ellas. La parte del cuerpo con mayor expresión del

B-ADNr era el testículo, seguido por el músculo alar, la glándula accesoria, la pata

saltadora, los ciegos gástricos y la cabeza, en este orden. Esto podría sugerir la

existencia de diferencias entre las partes del cuerpo con respecto al requerimiento de

ARNr, por las demandas metabólicas que tenían en el momento de ser congelados para

su análisis, pudiéndose requerir que, en algunos casos, las células tuvieran que necesitar

incluso transcritos procedentes del B. (Manuscrito en preparación).

La heterocromatina que forma parte de los cromosomas B es constitutiva y ésta

también se localiza en las regiones pericentroméricas de todos los cromosomas A.

Además, hay heterocromatina facultativa en el bivalente S9 y en el cromosoma X. La

Proteína Heterocromática 1 (HP1) es necesaria para el silenciamiento de genes

heterocromáticos, la regulación de la transcripción de genes eucromáticos, la

organización de la cromatina y la conservación de la integridad cromosómica. Por tanto,

realizamos un estudio en el que a través de ARN de interferencia (ARNi) disminuimos

los niveles de expresión de HP1 en E.plorans, y así analizamos el efecto que dicha

disminución tuvo sobre la heterocromatina, la expresión de otros genes y la estructura

de los cromosomas en dicha especie. Los resultados revelaron que los genes

ribosómicos (ARNr) y el de la proteína de choque térmico 70KD (Hsp70) no cambiaron

sus niveles de expresión tras la disminución de HP1, pero sí lo hizo el gen de la

quianasa serina/treonina de punto de control mitótico (Bub1). Este hecho vino

acompañado de varios efectos fenotípicos tales como la condensación anormal de todos

los tipos de cromatina (y no sólo la heterocromatina, que era el efecto esperado), la

existencia de células con puentes cromosómicos, una alta frecuencia de

macroespermátidas, la presencia de menor cantidad de hemolinfa, menor número de

células en división y, finalmente, una reducción drástica de la supervivencia.

(Manuscrito en preparación).

Por último, y para intentar caracterizar en profundidad la variación para el ITS2

en una población de E. plorans, así como el grado en que se expresan las diferentes

22

variantes encontradas, realizamos varios experimentos mediante 454 “amplicon

sequencing” (Next Generation Sequencing, NGS) de la región ITS2 del ADNr de

E.plorans procedentes de la población de Torrox, donde el B predominante es B24.

Además de algunos experimentos preliminares que nos ayudaros a perfeccionar el

diseño experimental, realizamos dos experimentos principales: 1) Amplificación por

PCR de la región ITS2 mediante cebadores anclados en los genes 5.8S y 28S del ARNr,

en ADN genómico (ADNg) y ADN complementario (ADNc) obtenido a partir del ARN

total extraído ambos a partir de diferentes partes del cuerpo de un macho sin B; y 2) El

mismo protocolo fue aplicado a 18 machos (estudio poblacional), con diferentes

números de cromosomas B (0-3). Para optimizar el diseño y abaratar costes, utilizamos

etiquetas de 6 nucleótidos asociadas a la región 5’ de los cebadores que nos permitieron

mezclar, por un lado, las 12 muestras de las diferentes partes del cuerpo, y por otro, las

36 muestras de los 18 machos, y separarlas tras haberlas secuenciado en conjunto (cada

experimento en 1/8 de placa). El análisis de los resultados fue realizado mediante una

serie de scripts escritos en Python (por nosotros). Una de las tareas más complicadas fue

diferenciar la enorme variedad de secuencias resultantes (en cada muestra) de los

errores inherentes a la secuenciación 454, donde cerca del 1% de las secuencias suelen

llevar algún error. Para ello, utilizamos un control interno proporcionado por la parte de

las lecturas que incluía 123 nucleótidos de región codificadora (parte del gen 5.8S y

parte del gen 28S). Para ello, estimamos la proporción de lecturas que llevaban esos 123

nt idénticos a los que se han reportado para otros saltamontes acrídidos (incluyendo E.

plorans y L. migratoria) y asumimos que esas lecturas no estaban sujetas a error. Eso

nos permitió deducir la tasa de error a partir del resto de las lecturas de la misma

muestra. La tasa de error así estimada en el experimento poblacional de E. plorans fue

de 2,28%, por lo que decidimos considerar como válidas todas aquellos tipos de lecturas

cuya frecuencia superase este valor. La selección de tipos de ITS2 en cada muestra, una

vez aplicado el control interno, demostró la existencia de 3 haplotipos (Hap1-Hap3) en

las diferentes partes del cuerpo y 6 haplotipos (Hap1-Hap6) en el estudio de población

(que incluían los 3 anteriores), un valor que contrastó con lo observado en uno de los

experimentos preliminares realizado en L. migratoria, donde había sólo un haplotipo.

Estos 6 haplotipos de E. plorans demuestran que la homogenización del ITS2 en E.

plorans es poco eficiente, en contraste con la de las secuencias codificadoras que era

muy elevada, con el 97,72% de las secuencias siendo idénticas. En los experimentos

preliminares en E. plorans también aparecieron cinco de los seis haplotipos, lo que

aboga también por la credibilidad de este resultado.

Uno de los haplotipos (Hap4) era portador de la inserción de la adenina

mencionada anteriormente, y sólo estaba presente en el ADNg de los individuos con

cromosomas B. No apareció en ninguno de los individuos sin B. Además había

asociación significativa entre el número de lecturas para el Hap4 y el número de Bs.

Todo esto indica que este haplotipo es específico del cromosoma B, y su presencia es la

que habíamos estado detectando con los primers ITS2_B. Los haplotipos más

divergentes se diferencian por hasta cuatro mutaciones, y su estructura secundaria es

muy similar en todos ellos, indicando la energía libre de Gibbs que todos tienen la

23

Resumen

capacidad de expresarse. Y, de hecho, todos estaban presentes en el cDNA, aunque con

diferentes valores de expresividad, destacando, sobre todo, la bajísima expresión del

haplotipo específico del B que nos lleva a concluir que el B está muy silenciado. De

hecho, sólo aparecieron lecturas del Hap4 en el cDNA de 5 de los 12 individuos con B

y, en esos 5 individuos este haplotipo se encontraba en muy baja frecuencia.

Finalmente, las diferencias de expresión de los diferentes haplotipos ITS2 entre

diferentes partes del cuerpo e individuos se repiten, en general apareciendo el Hap1

sobreexpresado y el Hap3 subexpresado, aunque este patrón muestra pequeñas

variaciones entre las partes del cuerpo. En los 18 machos, el patrón con los cuatro

haplotipos restantes se repite entre ellos: Hap3, Hap4 y Hap6 están subexpresados y el

Hap5 está sobreexpresado. Estas diferencias de expresión entre haplotipos, que a la vez

son propias de cada uno de ellos, sugieren que las copias de ARNr no se expresan al

azar. (Manuscrito en preparación).

24

Capítulo 1. Introducción general y Objetivos

25

26

1. El ADN ribosómico

1.1. Estructura, abundancia y función biológica

El ADN ribosómico (ADNr) es una secuencia de ADN repetida en tándem que alberga

los genes para el ARN ribosómico (ARNr) que formará parte de la estructura de los

ribosomas. En animales, cada repetición (cistrón) 45S está formada por los tres genes

ribosómicos 18S, 5,8S y 28S. En la mayoría de eucariotas, estos genes están en lugares

genómicos diferentes de los genes que codifican el ARNr 5S. Los genes del cistrón

ribosómico 45S están separados entre sí por dos espaciadores internos que se

transcriben (ITS1 e ITS2) y flanqueados por dos espaciadores externos transcritos

(ETS) y los espaciadores intergénicos no transcritos (IGS) (Long y David, 1980)

(Figura 1).

Figura 1. Estructura y composición del ADNr. (Extraída de Eickbush y Eickbush, 2007).

El número de repeticiones en el ADNr puede variar desde una copia por genoma

haploide que posee Tetrahymena, hasta cientos de copias, y está correlacionado

positivamente con el tamaño del genoma (Prokopowich y col., 2000). Numerosos

organismos poseen muchas más copias de ADNr de las que necesita para suplir su

requerimiento de producción de ARNr, permaneciendo muchas de ellas

transcripcionalmente inactivas, incluso a altas tasas de crecimiento (Reeder, 1999).

Debido a su alto número de repeticiones, el ADNr produce tal cantidad de transcritos

que el ARNr es el producto génico más abundante en la célula. En Saccharomyces

cerevisiae por ejemplo, aproximadamente 150 copias de ADNr están localizadas en el

cromosoma XII, ocupando aproximadamente el 60% del cromosoma y el 10% de su

genoma (Kobayashi y col., 2011) mientras que los genomas de animales y plantas

pueden contener cientos o miles de copias (Rogers y Bendich, 1987). Los loci de ADNr

pueden también variar, en cuanto al número de repeticiones y localización

cromosómica, dentro del mismo género o incluso dentro de la misma especie. Un

ejemplo de esta variación ha sido descrito por Sánchez-Gea y col. (2000) encontrando

dentro del género Zabrus una gran variabilidad para el número de loci de ADNr, el

número de cromosomas que portaban ADNr y el tamaño de esos loci. En Drosophila

melanogaster, donde las NORs se localizan en los cromosomas sexuales, el fenotipo

27

Introducción general y Objetivos

bobbed (bb) está asociado con un bajo número de copias de ADNr en los

individuos con dicho fenotipo, y cuando el número de copias es inferior al 15% de las

presentes en el fenotipo salvaje, se produce letalidad en embriones en desarrollo (Long

y David, 1980; Lyckegaard y Clark 1991). Este efecto deletéreo se ha descrito también

en vertebrados (Delany y col. 1994), lo que sugiere la necesidad de un número mínimo

de copias de genes ribosómicos para el correcto desarrollo y supervivencia de los

organismos.

Varios mecanismos han sido propuestos para explicar la variación en el número

de copias de los genes ribosómicos, aunque las fuerzas evolutivas responsables de ellos

no han sido encontradas aún (Bik y col., 2013). Estos mecanismos podrían ser la

compensación, la magnificación, la contracción y el entrecruzamiento desigual entre

cromátidas hermanas o entre cromosomas. La compensación ocurre porque no todas las

copias de ADNr están activas a la vez, y por ello la tasa de transcripción de una célula

no tiene por qué ser necesariamente proporcional al número de copias de genes de

ARNr. Un claro ejemplo lo encontramos en Drosophila que aunque posee 200-250

copias de ARNr, sólo son necesarias 35-60 de ellas para mantener una viabilidad normal

en el laboratorio (Ritossa, 1968). La magnificación y la contracción del número de

copias se ha detectado en Daphnia obtusa (McTaggart y col., 2007) y Drosophila

melanogaster (Averbeck y col., 2005), lo que pone en evidencia que el ADNr está

evolucionando dinámicamente. En Xenopus, la magnificación solo ocurre durante la

oogénesis (Rogers y Bendich, 1987), que es cuando hay alto requerimiento energético.

La amplificación de copias ARNr puede ocurrir también en localizaciones

extracromosómicas como en los protozoos (Kafatos y col., 1985), e incluso se ha

sugerido que las múltiples copias de los genomas de cloroplastos y mitocondrias sean

para incrementar la dosis de ARNr de la célula más que para codificar proteínas (Rogers

y Bendich, 1987). Por último, un entrecruzamiento desigual entre genes ARNr de

cromátidas hermanas o diferentes cromosomas produce copias de más en uno de los

implicados, y de menos en el otro, conduciendo a variabilidad intraindividual para el

número de copias de ARNr. Este mecanismo ha sido bien estudiado por Lyckegaard y

Clark (1991) en los cromosomas sexuales de Drosophila melanogaster.

. Los genes ribosómicos 45S y 5S dan lugar a las moléculas de ARNr que

conforman el núcleo de las subunidades ribosómicas (Sollner-Webb y Tower, 1986)

junto con las proteínas ribosómicas. Los ribosomas son orgánulos celulares

imprescindibles compuestos por dos subunidades: la subunidad mayor, que contiene los

genes 5S, 5,8S y 28S, y la subunidad menor que contiene el gen 18S; ambas

subunidades, además, tienen un alto número de proteínas ribosómicas. En ellos ocurre la

síntesis de proteínas en todos los organismos. La biogénesis de ribosomas conlleva una

gran inversión de energía celular, y está estrechamente regulada en cada célula en

respuesta a varios estímulos ambientales que afectan a la síntesis proteica, el

crecimiento celular y la proliferación.

28

1.2. Expresión del ADNr. El nucleolo

Las repeticiones de ADNr se localizan en las constricciones secundarias de los

cromosomas, las cuales se pueden visualizar al microscopio y reciben el nombre de

Regiones Organizadoras Nucleolares (NORs) (Heitz, 1931; McClintock, 1934; Raska y

col., 2006a, 2006b). A pesar de que el alto número de repeticiones de ADNr de los

eucariotas ha sido interpretado como un efecto de la alta demanda de proteínas en

ciertas situaciones, lo cierto es que aproximadamente el 50% esas copias permanecen

transcripcionalmente inactivas en levaduras y humanos (French y col., 2003).

Los genes ribosómicos 45S son transcritos por la ARN polimerasa I (ARN pol I)

como un único precursor del rRNA que es metilado en varias regiones y del que se

escinden los ETS e ITSs dando lugar a los tres ARN ribosómicos, 18S, 5.8S y 28S. El

cuarto ARNr, 5S, es transcrito por la RNA pol III (Highett y col., 1993). El estado de

fosforilación de muchos componentes de la maquinaria de la ARN pol I puede

modificar la actividad y las interacciones de esas proteínas y así modular la

transcripción del ADNr durante el ciclo celular (Sirri y col. 2008). La activación de los

genes de ADNr depende sobre todo del estado en el que se encuentre la célula, el cual es

dependiente a su vez de los requerimientos energéticos que precise el tejido y el

individuo al que pertenece. Cuando se activa la transcripción de los genes ribosómicos

45S se organiza el nucleolo en las NORs (Figura 2).

El nucleolo es una estructura altamente organizada donde los ribosomas están

siendo madurados y ensamblados, lo que implica que se estén importando desde el

citoplasma al núcleo muchas proteínas ribosómicas y factores accesorios de

procesamiento, y exportando al citoplasma las subunidades que conformarán el

ribosoma. Durante el ciclo celular en los eucariotas superiores, la producción de

ribosomas empieza al final de la mitosis, incrementa durante G1, es máxima en G2 y

finaliza durante profase (Gébrane-Younès y col., 1997; Sirri y Hernández-Verdun,

2000). Además de estar implicado en la formación de ribosomas, el nucleolo es un

dominio plurifuncional involucrado en la respuesta al estrés, la biogénesis de partículas

de ribonucleoproteínas independientes a las subunidades ribosómicas y en

enfermedades como el cáncer, las ribosomopatías o las infecciones virales (Olson y col.,

2000; Boisvert y col., 2007; Hiscox, 2007; Pederson y Tsai, 2009). Asimismo, su papel

clave en el mantenimiento de la homeostasis celular y la integridad genómica ha sido

propuesto recientemente (Grummt, 2013).

Cuando el nucleolo de las células animales es visualizado al microscopio

electrónico, se observa una estructura tripartita: una región pequeña y brillante llamada

centros fibrilares, rodeada por un material densamente teñido llamado el componente

denso fibrilar, y el resto del nucleolo contiene lo que aparentemente son gránulos

densamente empaquetados (el componente granular) (Shaw y Jordan, 1995). Muchos

apuntan a que la estructura refleja la compartimentación de la maquinaria relacionada

con la transcripción del ADNr, el procesamiento del ARNr y el ensamblaje de las dos

subunidades ribosómicas (Hernández-Verdun y col., 2010), respectivamente.

Recientemente, Thiry y col., (2011) han mostrado que la organización del nucleolo es

29

Introducción general y Objetivos

cuerpos fibrilares, al igual que ocurre con los nucleolos de Drosophila e insectos

(Knibiehler y col., 1982, 1984). Aun así, las controversias sobre la organización

nucleolar no serán totalmente resueltas hasta que entendamos la función y la

composición molecular de estas tres estructuras descritas.

Al final de la profase, cuando la membrana nuclear ha desaparecido totalmente y

los cromosomas están condensados, el nucleolo ya no es visible pero los bloques que

conformarán el futuro nucleolo están almacenados y mantenidos en diferentes

localizaciones celulares durante la división. Cuando la división celular llega al final y

comienza la telofase, el nucleolo vuelve a ensamblarse en un complejo proceso que se

extiende durante un tiempo relativamente largo del ciclo celular. El ensamblaje depende

de la coordinación entre la activación de la transcripción de ADNr y el reclutamiento y

activación de complejos de procesamiento del ARN (Hernández-Verdun y col., 2002).

Además, la translocación de estos complejos a los sitios de transcripción de ADNr está

unida a la formación de unas estructuras llamadas cuerpos prenucleolares (Stevens,

1965; Ochs y col., 1985).

Figura 2. Célula meiótica en diplotene mostrando un bivalente

cromosómico asociado a dos nucleolos (nu), uno por

cada cromosoma homólogo,debido a la activación del

ADNr, revelado por la técnica de impregnación argéntica.

La regulación de la expresión del ADNr y la organización de nucleolos es muy

compleja, como lo refleja el fenómeno de dominancia nucleolar según la cual no todas

las NORs se encuentran activas en la célula (Pikaard, 2000a; Pikaard, 2000b; Reeder,

1985). Éste fenómeno se observa en híbridos interespecíficos donde frecuentemente las

NORs de un progenitor forman nucleolo mientras que las del otro parental permanecen

30

inactivas, a pesar de que las secuencias de ARNr de los dos parentales son

esencialmente idénticas. La dominancia nucleolar resulta entonces de la transcripción de

un solo set parental de genes de ARNr, y se relaciona con la necesidad que tiene el

genoma de controlar la dosis activa de ARNr (Preuss y Pikaard, 2007). Este fenómeno

de expresión génica diferencial puede ser inestable, parcial o reversible (Volkov y col.,

2007) y se observa ampliamente en la naturaleza, tanto en plantas, como insectos,

anfibios y mamíferos. Este mecanismo epigenético está regulado via ARN de

interferencia (ARNi) (Preuss y col., 2008; Tucker y col., 2010), metilación de citosinas

en el ADN, modificación de histonas y factores de remodelación de la cromatina

(Preuss y Pikaard 2007; Volkov y col., 2007), mientras que la impronta gamética no

parece ser el mecanismo por el cual uno se inactiva el ARNr de uno de los partentales.

La base molecular por la cual se elige qué genes son inactivados, permanece todavía sin

clarificar.

En general, se considera que las repeticiones de ARNr que están inactivas

aparecen en forma de heterocromatina constitutiva, altamente condensadas, mientras

que las repeticiones activas aparecen en forma de eucromatina, dando lugar a zonas

accesibles para la maquinaria de transcripción. Sin embargo, otros autores proponen que

estos dos estados principales en los que existe la cromatina ribosómica podrían derivar

en tres: un estado inactivo similar a la heterochromatina, un estado transcripcionalmente

competente pero inactivo, y un estado transcripcionalmente productivo (Huang y col.,

2006). Las modificaciones post-traducionales, es decir, las modificaciones en el ADN y

en las histonas asociadas, son las que permiten distinguir los dos estados principales de

la cromatina ribosómica. Los promotores de los genes activos están hipometilados y las

histonas asociadas altamente acetiladas, ocurriendo lo contrario para los promotores de

genes inactivos (Santoro y col., 2002; Nemeth y col., 2008). Además, las copias

silenciadas de los promotores de ADNr tienen metilada la histona H3K9 y están

asociadas con la Proteína Heterocromática 1 (HP1), molécula asociada principalmente

(pero no exclusivamente) a la heterocromatina (James y Elgin, 1986). En levaduras

ambos tipos de cromatina están entremezclados, argumentando en contra de que la

activación/inhibición de la transcripción está controlada por dominios cromosómicos y

a favor de la independencia de regulación que tiene cada repetición de ADNr

(Dammann y col., 1995; French y col., 2003).

1.3. El nucleolo como sensor de estrés y daño del ADN Hay varias líneas de investigación que sugieren que el nucleolo tiene un papel en la

detección y la respuesta al estrés causado por una variedad de factores, como falta de

nutrientes, presencia de algún elemento extra en el genoma (por ejemplo, cromosomas

B parasíticos), contaminación ambiental o virus (Langerstedt, 1949; Hudson y

Ciborowski, 1996; Camacho y col., 2000; Hiscox, 2007; Boulon y col., 2010, Grummt

2013). En general, los nucleolos son más pequeños en condiciones de estrés (Olson,

2004) ya que la célula disminuye la transcripción del ADNr, la síntesis de proteínas y

ribosomas, y además protege el genoma al inducir mecanismos de reparación de ADN o

31

Introducción general y Objetivos

apoptosis. Esta hipótesis parte de la base de la gran asociación que hay entre el tamaño

del genoma y el número de copias de ADNr, y defiende que las copias extras presentes

en el ADNr (que no se transcriben) amortiguarían dicho daño, para así asegurar que las

copias no dañadas estuvieran disponibles para la síntesis de ribosomas (Kobayashi,

2008). De forma similar, se ha argumentado que las copias extra pueden facilitar la

reparación del ADNr por recombinación homóloga (Ide y col. 2010).

En levaduras, el cambio morfológico que sufre el nucleolo en respuesta al estrés

va acompañado además de liberación de ARN pol I desde el nucleolo y deacetilación de

la histona H4. Por lo tanto, parece que la respuesta al estrés también hay un mecanismo

de modulación de la estructura nucleolar mediado por la cromatina (Tsang y col., 2003).

En mamíferos hay muchas evidencias de la relación existente entre el daño del ADN

mediado por p53 y el nucleolo, sugiriendo que la estructura nucleolar es un sensor del

daño de ADN (Rubbi y Milner, 2003). Si se deteriora la función nucleolar, se estabiliza

p53 mediante la prevención de su degradación y de esta manera, las células pueden

responder a la actividad nucleolar aberrante mediante la inducción de la detención del

ciclo celular y/o la apoptosis (Mayer y Grummt, 2005). También, el tamaño del

nucleolo es generalmente más grande en células cancerosas, hecho que ha sido

relacionado con la alta proliferación celular que ocurre en este tipo de células. Además,

muchos supresores de tumores y proto-oncogenes afectan a la producción de ribosomas

(Ruggero y Pandolfi, 2003).

1.4. Estudio del nucleolo

Analizar las NORs activas y, por tanto, el número de nucleolos que tiene una célula da

información del requerimiento energético que tiene la célula, y ese número puede variar

entre individuos e incluso entre células del mismo individuo. Además, la evaluación de

la distribución de las NORs activas da información de la tasa de proliferación de

tumores en algunos tipos de lesiones (Derenzini, 2000). El tamaño del nucleolo está

positivamente correlacionado con la tasa de síntesis de ARNr y por tanto de ribosomas

(Mosgoeller, 2004), la cual conlleva el reclutamiento de proteínas necesarias para la

transcripción del ADNr (Derenzini, 2000). No hay relación numérica entre las NORs

que aparecen en metafase y las de interfase: una NOR metafásica puede ser distribuída

en muchas NORs interfásicas, al igual que muchas NORs metafásicas pasan a ser una

durante la interfase (Derenzini y Ploton, 1994).

En el nucleolo se localizan un grupo de proteínas ácidas que son altamente

argirófilas, lo que hace que pueda observarse citogenéticamente con la técnica de

Impregnación Argéntica (Goodpasture y Bloom, 1975; Rufas y col., 1982). Esta técnica

es muy útil, ya que de una manera simple permite medir el tamaño nucleolar e así

indirectamente medir la transcripción de los genes ARNr, ya que lo que tiñe

específicamente es la maquinaria transcripcional de la ARN polimerasa I, incluyendo la

B23, nuclelina, las proteínas UBF y las subunidades de la ARN polimerasa I (Roussel y

col., 1992; Roussel y Hernandez-Verdun, 1994; Roussel y col., 1996). Por tanto, lo que

hace décadas empezó siendo un análisis de la presencia/ausencia de nucleolos o de la

32

variación del tamaño de éste, se ha podido completar a lo largo de los años con el

significado biológico de esas observaciones, en términos de actividad transcripcional

del ADNr.

A lo largo del tiempo se han propuesto dos métodos para analizar los resultados

de la impregnación argéntica: el método de conteo (Crocker y col., 1989) y el método

morfométrico (Derenzini y col., 1989b; Rüschoff y col., 1990). El primer método

consiste en la enumeración de cada nucleolo teñido en cada célula, y si están muy

agregados algunos nucleolos y no se pueden diferenciar, se cuentan como uno. Esto

hace que este método sea subjetivo y poco reproducible. Sin embargo, el segundo

método mide el área ocupada por todas las estructuras teñidas por plata (todos los

nucleolos) y se analiza con un sistema de imágenes (Trerè y col., 1995). Este

procedimiento es más rápido, más preciso, más objetivo y más reproducible que el

método de conteo (para un ejemplo de empleo del método, ver Teruel y col. 2007,

2009).

1.5. Los ITSs (Espaciadores Internos Transcritos) ribosómicos

El ADNr es generalmente procesado post-transcripcionalmente para dar lugar a tres

moléculas maduras de ARNr, 18S, 5.8S y 28S, que resultan de eliminar del transcrito

precursor los ETS, ITS1 e ITS2. Aunque los ITSs no forman parte del ribosoma, se

encargan de señalizar el correcto procesamiento de los transcritos de ARNr. En

eucariotas microbianos, el tamaño del ITS1 varía desde 100 a 400pb, mientras que el

ITS2 desde 200-500pb. Algunos ITSs son inusualmente largos, como los del alga roja

Cyanidioschyzo merolae (Maruyama y col., 2004), donde el tamaño medio de los ITS1

e ITS2 son 862 y 1738pb, respectivamente. Euglena gracilis tiene uno de los ITS1 más

largos, 1188pb (Schnare y col., 1990), y el del dinoflagelado Cochlodinium

polykrikoides contiene una secuencia de 101pb repetida en tándem, dando lugar a un

ITS1 de 813pb (Ki y Han, 2007). Yarrowia y Giardia tiene los ITSs más pequeños

conocidos de los eucariotas microbianas, siendo la suma de los dos ITS en Y. lipolytica

tan solo 150pb (van Heerikhuizen y col., 1985), mientras que los de G. intestinalis

miden tan solo 89pb (Boothroyd y col., 1987). Algunas especies de Microsporidia

directamente no tienen ITS2 (Vossbrinck y Woese, 1986).

Los ITSs son partes no codificantes del ADNr, por lo que sobre ellos la

selección natural no actúa pudiendo, por tanto, acumular mutaciones. Debido a esto, los

ITSs evolucionan rápidamente y su secuencia es más heterogénea en comparación con

la región codificante del ADNr (Matyášek y col., 2012, entre otros), hecho que les hace

ser uno de los marcadores más usados para la identificación de especies (Horton y

Bruns, 2001; Bridge y col. 2005) y en estudios filogenéticos (Alvarez y Wendel, 2003;

Coleman, 2003; Pettengill y Neel, 2008). Esta característica por un lado, y la estructura

secundaria tan conservada por otro, hacen concretamente del ITS2 una herramienta

excepcional para estudios de metagenómica (Seifert, 2009; Blaalid y col., 2012; Schoch

y col., 2012; entre otros). Además, la inclusión de la estructura secundaria en la

reconstrucción filogenética hacen que ésta sea más robusta y cercana a la realidad

33

Introducción general y Objetivos

(Keller y col., 2010). Sin embargo, recientemente el uso de los ITSs para identificar

especies se ha puesto en duda, ya que se han publicado varios estudios en los que se

detecta variabilidad intraespecífica (Kảrén y col., 1997; Kauserud y Schumacher, 2002;

Nilsson y col., 2008; Blaalid y col., 2013) e intragenómica para dichas secuencias en

una amplia variedad de taxones, incluyendo procariotas, plantas, animales y hongos

(Mayol y Rosselló 2001; Feliner y col. 2004; Wörheide y col. 2004; Stage y Eickbush

2007; Stewart y Cavanaugh 2007; Simon y Weiss 2008; James y col. 2009; Pilotti y col.

2009; Alper y col. 2011; Hřibová y col. 2011; Vydryakova y col. 2012; Li y col. 2013).

Algunos autores (Alper y col. 2011; Song y col. 2012) advierten de que el uso de los

ITSs como identificador de especies debe ser evaluado en cada caso, porque la

variabilidad que existe para su secuencia puede sobreestimar la riqueza real de especies

que existe en una comunidad (Lidner y col. 2013).

1.6. Modelos de evolución del ADNr

Para explicar la evolución de familias multigénicas, entre las que se encuentra el ADNr,

se han propuesto varias teorías, destacando la evolución concertada (Zimmer, 1980) y la

evolución mediante nacimiento y muerte (Nei y Hughes, 1992) (Figura 3). En general,

se considera que las familias multigénicas evolucionan siguiendo un patrón de

evolución concertada, por el que se homogenizan las secuencias de ADN de los genes

miembros de la misma familia. Brown y col. (1972) fueron los primeros que

propusieron que las copias de los genes de ARNr evolucionan “horizontalmente”, con

nuevas variantes surgiendo por mutación y dispersándose reemplazando a otras copias.

El principal mecanismo de homogenización es la recombinación desigual entre copias

repetidas (Smith 1973; Szostak y Wu 1980; Kobayashi y col. 1998; Eickbush y

Eickbush, 2007), que genera nuevos genes duplicados con secuencia idéntica y elimina

otros genes duplicados. Se asume que los genes de una familia multigénica son

polimórficos, pero que estos polimorfismos evoluciona a la vez (Nei y col., 1997)

debido a la evolución concertada. Si este proceso continúa, los genes duplicados de una

familia multigénica tienden a tener secuencias de nucleótidos similares, incluso aunque

estén ocurriendo mutaciones. Además de la recombinación, también se ha propuesto

que la conversión génica, es decir, la transferencia unidireccional de una secuencia de

ADN desde una cadena donante a una receptora (Gangloff y col., 1996), es un

mecanismo que homogeniza secuencias. La evolución de de la familia génica de ADNr

es un buen ejemplo de evolución concertada ya que las diferentes unidades suelen tener

secuencias de ADN muy similares en individuos de la misma especie (Ganley y

Kobayashi, 2007; Stage y Eickbush, 2007). Cuando el modelo de evolución concertada

fue propuesto, se creía que incluso los ITSs tenían secuencias de ADN conservadas,

pero hoy en día se sabe que no es así (véase apartado 1.5.).

Aunque se ha pensado durante mucho tiempo que la evolución de las familias

multigénicas se producía siempre por evolución concertada, Nei y Hughes observaron

en 1992 que otras familias, como la del Complejo Mayor de Histocompatibilidad

(MHC) y los genes de Inmunoglobulinas (Ig) de la misma especie no estaban

34

necesariamente más relacionados entre ellos que entre especies diferentes (Gojobori y

Nei, 1984; Hughes y Nei, 1989; Nei y Hughes, 1991; Nei y Hughes, 1992; Ota y Nei,

1994), por lo que propusieron el modelo de evolución por nacimiento y muerte. En este

modelo, los genes duplicados pueden aparecer por varios mecanismos, como son la

duplicación en tándem y por bloques, y tras una fuerte selección purificadora, unos

genes divergen y se hacen funcionales y otros se convierten en pseudogenes debido a

mutaciones deléteras o son eliminados del genoma. El resultado es una familia

multigénica con una mezcla de grupos de genes, unos divergentes y otros altamente

homólogos, acompañados de un sustancial número de pseudogenes. Por tanto, la

presencia de pseudogenes en una familia de genes, los cuales pueden ser tolerados de

manera diferente según el genoma hospedador (Eickbush y col., 1997), sugiere que está

evolucionando por el modelo de nacimiento y muerte. Se ha sugerido que este modelo

podría explicar también los inusuales altos niveles de polimorfismos de los ITSs e IGSs

de algunas especies (superior al 40% en algunos casos). Otro ejemplo de este tipo de

evolución lo encontramos en los genes 5S de los hongos filamentosos (Rooney y Ward,

2005).

Para explicar la diferente asociación de las familias multigénicas con cada uno

de estos dos modelos evolutivos, Nei y col. (1997) propusieron que el ADNr

evolucionaba por evolución concertada debido a que tiene que producir una gran

cantidad del mismo producto, por lo que los genes de esta familia deberían ser

altamente homólogos, mientras que las multifamilias MHC e Ig lo hacen por nacimiento

y muerte ya que tienen la función de defender al hospedador de diferentes tipos de

parásitos, haciendo necesaria una gran cantidad de diversidad. Aunque la evolución

concertada y la evolución por nacimiento y muerte son conceptualmente diferentes,

pueden ser difícilmente distinguibles si se asume que la tasa con la que se produce la

evolución concertada es muy baja (Nei y col., 2000).

Figura 3. Modelos de evolución de las familias multigénicas

(extraído de Nei y col., 1997): Evolución concertada (izquierda)

y modelo de nacimiento y muerte (derecha)

35

Introducción general y Objetivos

La evolución del ADNr no tiene que ceñirse estrictamente a estos dos modelos,

sino que pueden existir matices. Así, Ganley y Kobayashi (2007) propusieron un

modelo “de evolución concertada de “rápida homogenización” (Figura 4) para explicar

por qué existía tan poca variación para las secuencias de ADNr a pesar de tener regiones

altamente variables como los IGSs. Este modelo proponía tres fases para homogenizar

un array de secuencias repetidas: 1) Ocurre una mutación en una secuencia de ADNr y,

como éste es altamente redundante, las fuerzas de selección no actúan sobre la

mutación, con lo que puede persistir durante un tiempo; 2) Hay un paso de transición en

el que continuos entrecruzamientos desiguales entre las secuencias repetidas producen

duplicaciones que llevan la mutación, algunas se dispersarán por el genoma tras

sucesivas duplicaciones, y otras serán eliminadas (estocásticamente). Sólo las

mutaciones no deletéreas y toleradas por la selección natural podrán aumentar su

frecuencia hasta un umbral. Quedarán muchos polimorfismos de baja frecuencia que no

han podido superar el umbral porque comprometen la eficacia biológica del portador o

porque son de reciente aparición; 3) La fijación hace que las repeticiones mutadas

toleradas se mantengan en la población, reemplazando a las antiguas repeticiones. Este

modelo es consistente con resultados presentados en estudios previos (Liao y col., 1997;

Ganley y Scott 1998, 2002; Skalicka y col., 2003; Averbeck y Eickbush, 2005; Kovarik

y col., 2005). En resumen, los autores sugieren que debido a que los individuos tienden

a tener arrays homogéneos, los polimorfismos entre individuos de una población son

casos donde la homogenización ha dispersado una mutación a todas las repeticiones del

array en un individuo, creándose así un polimorfismo fijado.

Figura 4. Modelo de “rápida

homogenización” de evolución

concertada (extraído de Ganley

y Kobayashi, 2007).

36

2. Los cromosomas B

2.1. Historia del descubrimiento

Los genomas eucarióticos, además de contener los genes que colaboran con el buen

funcionamiento del organismo en los cromosomas estándar (también llamados A),

pueden albergar también elementos genéticos egoístas que interaccionan con él

procurando maximizar su propia expansión y transmisión, aún a costa de disminuir la

eficacia biológica de los individuos portadores (ver revisión de Burt y Trivers, 2006).

Entre éstos podemos destacar, por ejemplo, los transposones, los

distorsionadores de la segregación, algunos factores citoplasmáticos y los cromosomas

B. Estos últimos fueron los primeros en ser descubiertos hace un siglo por Wilson

(1907) al observar un cromosoma “extra” en el hemíptero Metapodius (ahora llamado

Acanthocepal), y al ver que no se comportaba como los cromosomas A, lo llamó

cromosoma “supernumerario”. Tras este descubrimiento, seguidamente fueron descritos

otros casos en el escarabajo Diabrotica (Stevens, 1908) y en el maíz (Kuwada, 1915). A

lo largo de la historia, muchos han sido los nombres que se le han dado a los

cromosomas B, tales como “fragmentos extras de cromosomas” (Müntzing, 1944;

Östergen, 1945), “cromosomas superfluos” (Hakansson, 1945) y “cromosomas

accesorios” (Hakansson, 1948; Müntzing, 1948) entre otros. Pero fue Randolph en 1928

el primero en acuñar el término de “cromosomas B”, y es el que ha perdurado hasta la

actualidad.

2.2. Características generales y frecuencia

Los cromosomas B se han encontrado formando parte del genoma de más de 2000

especies de plantas, animales y hongos y se estima que el 15% de genomas eucarióticos

llevan Bs (véase las revisiones de Jones y Rees 1982, Jones 1995, y Camacho 2005).

Las especies donde se han descrito cromosomas Bs pertenecen predominantemente a

ciertos grupos taxonómicos, como las Gramíneas, las Liliáceas y los Ortópteros, pero

esto es debido a que son grupos donde se llevan a cabo un elevado número de estudios

citogenéticos. En base a las características de los cromosomas B, son varias las

definiciones que se han dado de estos cromosomas supernumerarios. Así, en 1982 Jones

y Rees los definieron como “cromosomas no homólogos a los cromosomas del

complemento normal (cromosomas A), que no recombinan con ellos y además son

totalmente dispensables”. En 1993, JPM Camacho y JS Parker los definieron durante la

primera “B Chromosome Conference” como “cromosomas dispensables, presentes en

algunos individuos de algunas poblaciones de especies de plantes y animales, que ha

surgido probablemente de los cromosomas A, pero que siguen su propio camino

evolutivo al no recombinar con ellos” (Beuckeboom, 1994a). Además, no hay que

olvidar otra característica muy importante inherente al hecho de que los cromosomas B

no recombinan: no siguen las leyes Mendelianas de segregación, ya que poseen una

segregación meiótica irregular que les hace acumularse en la línea germinal. De ahí le

37

Introducción general y Objetivos

viene el adjetivo de “egoísta”, ya que se transmiten con tasas superiores a las de los

cromosomas As.

La frecuencia con la que los cromosomas B aparecen en las poblaciones

naturales es muy variable ya que depende del grado de tolerancia del genoma

hospedador y de la fuerza del mecanismo de acumulación de los Bs. Los factores

geográficos, históricos y ecológicos tales como la existencia de barreras geográficas que

impiden la migración de individuos portadores de cromosomas B a ciertas poblaciones,

el tiempo trascurrido desde que aparece el B en una población o la permisibilidad de las

condiciones ambientales son otros factores que explican la variación temporal y espacial

que muestra, pudiéndose encontrar poblaciones de la misma especie con y sin

cromosomas B. Los Bs son deletéreos cuando aparecen en un número alto en los

genomas hospedadores, así que por lo general el número de Bs que tiene un individuo

no suele ser mayor de 3 ó 4. Sin embargo, hay estudios donde se han encontrado

excepciones. Así, el mayor número de cromosomas B encontrado en una planta es de

50, en la especie Pachyphytum fittkaui (Crassulaceae). Otros casos de plantas con

muchos cromosomas Bse han descrito en el maíz con 34 Bs (Jones y Rees, 1982), 31 en

Gibasis karwinskyana (Kenton, 1991), 26 en Fritillaria japonica (Noda, 1975) y 22 en

Centaurea scabiosa (Fröst, 1957). En animales también se ha encontrado individuos

con alto número de Bs, como en Apodemus peninsulae donde se han observado hasta 24

Bs (Volobujev y Timina, 1980), 20 en Xylota nemorum (Boyes y Van Brink, 1947) y 16

en Gonista bicolor (Sannomiya, 1974) y en Leiopelma hochstetteri (Green, 1988).

2.3. Tamaño y composición molecular

El tamaño de los cromosomas B es muy variable entre especies. En algunas especies,

como en Reithrodontomys megalotis, los Bs son más pequeños incluso que los As más

pequeños (Peppers y col., 1997). En Megaselia scalaris, el cromosoma B no es más que

un centrómero independiente, siendo el elemento más pequeño que puede ser

considerado un cromosoma (Wolf y col., 1991). En el otro extremo, están los

cromosomas B de Uromys caudimaculatus (Baverstock y col., 1982) y Astyanax

scabripinnins (Mestriner y col., 2000) que son tan grandes como sus cromosomas As

más grandes. También hay casos donde los Bs tienen un tamaño mayor que los As de su

propia especie, como en Alburnus alburnus (Ziegler y col., 2003), aunque parecen ser

isocromosomas. La mayoría de Bs tienen un tamaño medio, aunque incluso dentro de la

misma especie pueden mostrar variación en el tamaño, tal y como se ha observado en

diferentes poblaciones españolas (Henriques-Gil y col., 1984; López-León y col., 1993)

i marroquíes (Bakkali y col. 1999) de Eyprepocnemis plorans. El tamaño del

cromosoma B es una característica que afecta a su estabilidad mitótica (Hewitt, 1979).

Así, los cromosomas B grandes tienden a ser mitóticamente estables, es decir, todas las

células del individuo tienen el mismo número de cromosomas B. Sin embargo, los Bs

pequeños suelen ser mitóticamente inestables.

Tradicionalmente se ha descrito a los cromosomas B como elementos

heterocromáticos, ya que muestran un alto grado de compactación de la cromatina con

38

lo que es posible distinguirlos citogenéticamente de los cromosomas A. Debido a su

naturaleza heterocromática los cromosomas B han sido tradicionalmente considerados

genéticamente inactivos, es decir, que no producían transcritos procedentes de las

secuencias génicas que contenían, frecuentemente ADN ribosómico (ADNr). En este

sentido apuntaron varios estudios, como los realizados en el saltamontes Myrmeleotettix

maculatus (Fox y col., 1974), el ratón Apodemus peninsulae (Ishak y col., 1991), la rata

negra Rattus rattus (Stitou y col. 2000) y los peces Metynnis maculatus (Baroni y col.,

2009) y Haplochromis obliquidens (Poletto y col., 2010). Sin embargo, con el paso de

los años son varios los estudios que han aportado evidencias citogenéticas de la

actividad del ADNr de los cromosomas B como ocurre en los saltamontes Dichroplus

pratensis (Bidau 1986) y Eyprepocnemis plorans (Teruel y col., 2007, 2009) (Figura 5)

o en el ratón Apodemus peninsulae (Boeskorov y col., 1995). Otras evidencias

moleculares indirectas se han encontrado en la rana Leiopelma hochstetteri (Green

1988) y el mosquito Simulium juxtacrenobium (Brockhouse y col., 1989), y directas en

la planta Crepis capillaris (Leach y col. 2005), la avispa Trichogramma kaykai (van

Vugt y col., 2005), el centeno (Carchilan y col., 2007, 2009; Banaei-Moghaddam y col.,

2013), y el ciervo siberiano Capreolus pygargus (Trifonov y col., 2013).

Figura 5. Activación del ADNr del cromosoma

de Eyprepocnemis plorans, tal y como indica la

presencia de nucleolo (marrón) (extraída de

Teruel y col., 2009).

La compactación tan elevada que tienen los cromosomas B se debe a su

composición molecular, ya que están formados mayoritariamente por secuencias de

ADN mediana y altamente repetidas que varían en el tipo de repeticiones y en el

tamaño de éstas (Amos y Dover, 1981; Eickbush y col., 1992). Estas secuencias son

39

Introducción general y Objetivos

ADNs satélites (ADNsat), ADNr y elementos transponibles (transposones), que se

acumulan debido al entrecruzamiento desigual y a la falta de recombinación

(Charlesworth y col., 1986; Stephan 1987). Estudios recientes han revelado que

algunos Bs llevan además genes de histonas (Teruel y col., 2010), secuencias derivadas

de genes de los As (Martis y col., 2012; Banaei-Moghaddam y col., 2013) o secuencias

que codifican para proteínas (Trifonov y col., 2013).

El ADNsat de los Bs puede ser compartido por los As de su misma especie,

como en Crepis capillaris (Jamilena y col., 1994), en Drosophila subsilvestris

(Gutknecht y col., 1995); o por el contrario ser específico del B, como el ADNsat del

cromosoma PSR (Paternal Sex Ratio) de Nasonia vitripennis (Nur y col., 1988). Puertas

en su revisión de 2002 reúne más ejemplos de ADNsat compartido por los Bs y As (en

Zea mays o Secale cereale) y otros de secuencias de ADNsat específicas de los

cromosomas B. En muchos casos, los Bs tienen mayor cantidad de secuencias repetidas

comparado con el genoma del que se originó, sugiriendo que ocurren fenómenos de

amplificación de ADNsat en los Bs en una corta escala de tiempo. Algunos estudios han

sugerido que este hecho podría hacer que un neo-B se estabilizara y llegara a ser

seleccionado positivamente dentro del núcleo (Reed y col., 1994; Leach y col., 1995).

Los cromosomas B pueden acumular transposones provenientes de diversas

fuentes (Beukeboom, 1994a; Camacho y col., 2000) ya que son heterocromáticos y no

recombinan con los otros elementos del genoma. Los transposones que se han descrito

en cromosomas B (veáse Tabla 4.2 de Camacho, 2005) son muy diversos. Algunos

ejemplos son el retrotransposón NATE (NAsonia Transponible Element) que invade el

cromosoma PSR de Nasonia vitripennis (McAllister, 1995; McAllister y Werren, 1997),

el retrotransposón CfT-I responsable de la transposición de ADN cloroplastídico en el

cromosoma B de Brachycome dichromosomatica (Franks y col., 1996) o los

retrotransposones Gypsy, RTE y R2 y el transposon mariner presentes en la especie

Eypepocnemis ploras (Montiel y col. 2012, Montiel y col., in preparation). En los

últimos años, se han descubierto además secuencias específicas de los Bs que proceden

de elementos transponibles (Langdon y col., 2000; Lamb y col., 2007). De esta manera

los transposones son responsables de generar variabilidad en los cromosomas B.

Además, esta transposición de secuencias hacia los Bs puede ocasionar que los genes de

estos cromosomas se vean inactivados, ya sea porque se insertan en medio de un gen, o

porque rompen la estructura del cromosoma (Camacho y col., 2000).

Otra de las secuencias repetidas que forman mayoritariamente parte de los Bs es

el ADNr 45S (Green, 1990). Sin embargo, el gen de ADNr 5S (que suele aparecer en

los genomas separado del cistrón 45S) sólo se ha detectado en algunos cromosomas B,

como son los de la especie Plantago lagopus (Dhar y col., 2002) y el cromosoma B de

Eyprepocnemis plorans de las poblaciones del Cáucaso (Cabrero y col., 2003). La

variación que existe para el número de repeticiones de los cistrones de ADNr 45S

influye significativamente en el tamaño de los cromosomas B (Adam, 1992; Pukkila y

Skrzynia, 1993). Se ha sugerido que las constricciones secundarias (NORs), donde se

localiza el ADNr, son regiones propensas a producir roturas cromosómicas que podrían

ser el origen de un neo-B. Como se dijo en este mismo apartado, se han citado casos de

40

Bs con NORs activas, y es por esto que Teruel y col. (2009) proponen que la cromatina

del ADNr puede encontrarse en tres estados: silenciada, competente o activa.

Además de las secuencias de nucleótidos que componen los cromosomas B, su

organización y función depende también de la existencia de estructuras secundarias y

modificaciones epigenéticas en dichos cromosomas. Así, la naturaleza heterocromática

de los B se atribuye en parte a la presencia de estructuras secundarias en su ADN, como

ocurrre en el cromosoma PSR, donde pequeñas secuencias palindrómicas están

asociadas con intercambios entre repeticiones de dicho cromosoma, sugiriendo que

provocan recombinación entre repeticiones (Reed y col., 1994). También se ha

observado formación de horquillas in vivo en un cromosoma B microdiseccionado de

Leiopelma hochstetteri (Sharbel y col., 1998). Entre las modificaciones epigenéticas, la

metilación y la acetilación son dos de los cambios más frecuentemente descritos. El

primero tiene un papel fundamental en la inactivación de cromosomas sexuales

(Holliday, 1987) y por tanto, también en la inactivación del B, ya que ambos sistemas

tienen muchas similitudes (Camacho y col., 2000). Un ejemplo de este proceso lo

encontramos en repeticiones centroméricas hipermetiladas del B de Brachycome

dichromosomatica, las cuales causan su inactivación (Leach y col., 1995) o en la

inactivación de la NOR del B de Eyprepocnemis plorans (López-León y col. 1991,

1995). El segundo proceso ha sido reportado para Brachycome dichromosomatica, por

Houben y col. (1997b), cuyo cromosoma B está hipoacetilado y podría estar también

ayudando a mantener su inactividad.

2.4. Origen

El origen de los cromosomas B es uno de los aspectos más estudiados de estos

cromosomas. La creencia más extendida es que los Bs proceden de los As de la misma

especie, como un subproducto de la evolución del cariotipo estándar (Jones y Rees,

1982; Camacho y col., 2000). Ya en los años 1970s y 80s se vieron los primeros

indicios de que el ADN encontrado en los Bs de algunas especies era muy similar al

encontrado en los As (véase la revisión de Jones y Rees, 1982). En los años 1990s se

siguió estudiando el origen de los Bs con más profundidad, llevándose a cabo el

aislamiento, clonación y secuenciación de secuencias de ADN repetidas de los Bs.

Algunas resultaron ser específicas de ellos y otras compartidas con los As (véase la

revisión de Beukeboom 1994a; Hackstein y col., 1996). La realidad es que los

cromosomas B pueden surgir a partir de los As de su misma especie (origen

intraespecífico) o tras hibridar con una especie emparentada (origen interespecífico).

Los Bs con origen intraespecífico surgen a partir de cromosomas A, como una copia

extra (polisomía) que se heterocromatiniza rápidamente, adquiriendo así la misma

apariencia y comportamiento meiótico que los Bs (Hewitt, 1973a; Peters, 1981;

Talavera y col., 1990). También, los neo-Bs pueden surgir a partir de fragmentos

céntricos originados tras translocaciones robertsonianas o a partir de la amplificación de

la región paracentromérica de un cromosoma A fragmentado (Keyl y Hägele, 1971).

Así, Dhar y col. (2002) encontraron que la aparición del B de Plantago lagopus podría

41

Introducción general y Objetivos

estar asociada a la amplificación del 5S tras la fragmentación de un cromosoma A.

Otros ejemplos de Bs con origen intraespecífico los encontramos en Crepis capillaris

(Jamilena y col., 1994, 1995) y en el centeno (Houben, 1996; Puertas, 2002), donde los

investigadores encontraron secuencias compartidas por los As y los Bs. Por otro lado,

los cromosomas B también pueden proceder de los cromosomas sexuales, ya que la

polisomía de estos es más tolerada (Hewitt, 1973a). En Leiopelma hochstetteri Green y

col. (1993) y Sharbel y col. (1998) observaron que su cromosoma B parece proceder del

cromosoma sexual heteromórfico W, debido a su parecido en morfología y secuencia.

La teoría de que los cromosomas B se pueden originar además

interespecíficamente tras procesos de hibridación entre especies emparentadas fue

propuesta por primera vez por Battaglia (1964). La evidencia supone la existencia de

secuencias específicas del B de una especie, en los As de una especie emparentada. Esta

teoría ha sido validada en varias ocasiones: McAllister y Werren (1997) reportaron el

caso del cromosoma PSR de Nasonia vitripennis, el cual tiene un transposón cuya

secuencia es más parecida a los copias presentes en especies emparentadas del género

Trichomalopsis que a las presentes en su propio genoma y Sapre y Deshpande (1987)

demostraron la formación espontánea de un cromosoma B tras hibridar dos especies

emparentadas, Coix aquanticus y Coix gigantea. Otras demostraciones empíricas de

esta teoría, es la formación de novo del cromosoma B de Poecilia formosa, que se

origina tras hibridar P. mexicana y P. latipinna (Schartl y col., 1995), y la del neo-B

originado tras introducir una región cromosómica de Nasonia giraulti en N. vitripennis

(Perfectti y Werren, 2001).

2.5. Comportamiento meiótico

Los cromosomas A aparecen formando bivalentes, lo que posibilita que los cromosomas

homólogos recombinen entre ellos para posteriormente migrar cada uno de ellos a un

polo celular durante la primera división meiótica. Este es el principio de la segregación

mendeliana. Sin embargo, los cromosomas B pueden no formar bivalentes y, como

univalentes, pueden sacar ventaja a la hora de transmitirse a los futuros gametos. En

muchos casos, los cromosomas B migran preferentemente al polo que dará lugar al

oocito, consiguiendo así tasas de transmisión mayores del 50%. El comportamiento

meótico de los Bs varía entre individuos y entre especies. Rebollo y col. (1998) vieron

que en la primera metafase meótica los Bs se comportan a veces tan estáticos como los

X, otras veces un poco menos dinámicos, y otras se comportan como un univalente muy

dinámico. Estos autores también vieron otra característica importante del B durante esta

fase como es la reorientación de polo a polo que realiza este univalente, tal y como

ocurre con el cromosoma X de Melanoplus differentialis (Nicklas, 1961). Así, cualquier

polo es susceptible de contener estos univalentes, ya que están migrando de polo a polo

durante la anafase I meiótica de la espermatogénesis.

La acumulación del B puede ser premeiótica, debido a no-disyunción durante las

mitosis embrionarias y el destino preferencial de los productos mitóticos con mayor

número de Bs hacia la línea germinal. Este tipo de acumulación implica que las células

42

que entran en meiosis tienen anormalmente un número alto de cromosomas B en

comparación con los que originariamente contenía el cigoto. Esto fue reportado por

primera vez por Nur (1963) en el saltamontes Calliptamus palaestinensis al observar

que espermatocitos del mismo individuo tenían número variable de Bs. Otros ejemplos

los encontramos en el B de Locusta migratoria, cuya inestabilidad mitótica hace que

las células con alto número de cromosomas B den lugar preferencialmente a las futuras

espermatogonias (Nur, 1969; Kayano, 1971; Viseras y col., 1990).

En muchos casos, la acumulación del B ocurre durante la meiosis femenina

como resultados de la asimetría funcional que existe en la producción de óvulos, ya que

se origina tan sólo uno a partir de cada oogonia. Los cromosomas A tienen la misma

probabilidad de migrar tanto al oocito secundario (futuro óvulo) como al corpúsculo

polar, pero esto no ocurre con los cromosomas Bs. Estos, en sus movimientos de polo a

polo pasan más tiempo en el oocito secundario, por lo que tendrán mayor oportunidad

de permanecer ahí al final de la anafase (Hewitt 1976). Ejemplos de acumulación

meiótica los encontramos en la planta Lillium callosum (Kayano, 1957) y en los

saltamontes Melanoplus femur-rubrum (Lucov y Nur, 1973; Nur, 1977), Myrmeleotettix

maculatus (Hewitt, 1973a, 1976), Heteracris litoralis (Cano y Santos, 1989),

Omocestus burri (Santos y col., 1993) y Eyprepocnemis plorans (Zurita y col., 1998;

Bakkali y col., 2002).

En plantas es frecuente la acumulación del B después de la meiosis, ya que la

formación del grano de polen implica dos divisiones mitóticas tras la meoisis que da

lugar a los núcleos vegetativos y generativos. La acumulación se produce cuando hay

no-disyunción del B en estas mitosis y las dos cromátidas del B migran preferentemente

al núcleo generativo. Este mecanismo se vio por primera vez en el centeno (Hasegawa,

1934), donde además ocurre acumulación del B en la primera mitosis de la megaespora

(Jones, 1995; Puertas, 2002). La acumulación postmeiótica puede ocurrir en la primera

mitosis del grano de polen, como en Festuca pratensis (Bosemark 1954) y Secale

cereale (Jones y Puertas 1993; Jiménez y col., 1997), o en la segunda mitosis tal y como

ocurre en el maíz (Roman, 1948).

Además de los tres tipos de acumulación explicados hasta ahora, existe la

acumulación ameiótica. Este caso se da, por ejemplo, en el cromosoma B (llamado

PSR) de la avispa Nasonia vitripennis, una especie haplodiploide. El PSR causa la

condensación del juego cromosómico paterno en los espermatozoides, haciendo que el

huevo fecundado no sea diploide (hembra), sino haploide (haploide), por lo que

distorsiona la proporción de sexos a favor de los machos. Así, la tasa de transmisión del

PSR es próxima a 1, y es considerado uno de los cromosomas B más parasíticos

(Werren, 1991).

Introducción general y Objetivos

43

2.6. Modelos de mantenimiento de los cromosomas B en las poblaciones

Se han propuesto dos modelos para explicar el mantenimiento de los cromosomas B en

las poblaciones naturales. El modelo “parasítico” o egoísta sostiene que los Bs se

mantienen por sus mecanismos de acumulación, permaneciendo en las poblaciones a

pesar de los efectos deletéreos que suelen causar a los organismos hospedadores

(Östergen, 1945). El modelo “heterótico” propone que los Bs se mantienen debido a los

efectos beneficiosos que confieren a los portadores, en bajo número, y no debido a

mecanismos de acumulación (White, 1973). La mayoría de los sistemas de cromosomas

B que se han analizado en profundidad, hasta ahora, se ajustan mejor al modelo

parasítico (véase revisión en Camacho, 2005). Estos dos modelos llevan implícita la

existencia de un equilibrio entre dos fuerzas contrapuestas. En el parasítico, estas

fuerzas son la acumulación del B, que incrementa su frecuencia, y la selección

fenotípica contra los portadores, que la disminuye. En el heterótico, el equilibrio resulta

de la selección fenotípica a favor de los individuos con pocos B y la que se produce

contra los individuos con muchos B. Sin embargo, estos equilibrios pueden verse

alterados por la incorporación al juego coevolutivo de respuestas defensivas por parte

del genoma hospedador. Así se ha demostrado la existencia de variantes génicas en los

cromosomas A capaces de suprimir la acumulación de los cromosomas B en el

saltamontes Myrmeleotettix maculatus (Shaw y Hewitt, 1985), en el hemíptero

Pseudococcus affinis (Nur y Brett, 1985) y en plantas como el centeno y el maíz (para

revisión, ver Puertas 2002). Esto constituye una clara evidencia de que entre los

cromosomas A y B se produce una “carrera de armamentos” similar a la que se produce

en otros sistemas hospedador-parásito. Una consecuencia de esta carrera de armamentos

es la aparición de cromosomas B neutralizados, es decir, que han perdido su capacidad

de acumulación y se transmiten a la misma tasa que los cromosomas A. La primera

evidencia fue aportada por López-León y col. (1992) al demostrar que los tres tipos de

cromosomas B más ampliamente distribuidos en las poblaciones españolas del

saltamontes Eyprepocnemis plorans (B1, B2 y B5) muestran tasas de transmisión

similares a las de los cromosomas A, es decir, cada B es transmitido a la mitad de los

gametos, como predice la ley mendeliana de la segregación. Posteriormente, Herrera y

col. (1996) demostraron que los cromosomas B neutralizados tienen la capacidad de

acumularse, pero está reprimida en la población natural, presumiblemente por la

selección de variantes génicas en los cromosomas A que suprimen la acumulación del

B. Posteriormente, Zurita y col. (1998) encontraron una nueva variante (B24) en la

población malagueña de Torrox, derivada de un B neutralizado, que se acumulaba con

una tasa media de transmisión de 0,7, lo que indicó que un cromosoma B puede

recuperar la capacidad de acumulación y el comportamiento parasítico corroborando

además la existencia de cromosomas B parásitos y neutralizados en diferentes

poblaciones de E. plorans.

Para explicar este mosaico geográfico de relaciones coevolutivas entre los

cromosomas A y B, Camacho y col. (1997) propusieron un modelo, derivado del

44

parasítico, que no asume que el sistema tenga que conducir necesariamente a un

equilibrio, sino a una sucesión en el tiempo y en el espacio de diferentes relaciones

coevolutivas. Basándose en sus estudios sobre el sistema de cromosomas B del

saltamontes E. plorans, estos autores propusieron que, para invadir nuevas poblaciones,

los cromosomas B necesitan tener acumulación, por lo que comenzarían su andadura

con acumulación (drive). Conforme aumenta su frecuencia, los cromosomas B se

convierten en una carga cada vez mayor para la población, debido a los efectos

deletéreos que suelen causar a los individuos portadores, por lo que cualquier variante

alélica de los cromosomas A que sea capaz de suprimir la acumulación de los B será

favorecida por la selección natural. Finalmente, cuando estos alelos de resistencia (que

suprimen la acumulación del B) se establezcan en la población, los Bs se habrán

convertido en elementos neutros, que se transmiten a la misma tasa que los A. Pero el

juego coevolutivo no termina ahí, ya que los cromosomas B suelen tener elevadas tasas

de mutación (López-León y col., 1993; Bakkali y Camacho, 2004) y los B neutralizados

pueden mutar a nuevas variantes que recuperen la capacidad de acumulación, tal como

ocurrió con B24 en Torrox, una variante parásita que derivó de B2, una variante

neutralizada (Zurita y col., 1998). Por tanto, el ciclo comienza de nuevo cuando surge

una nueva variante parásita (con drive) que, posteriormente es neutralizada, como ha

ocurrido recientemente con B24 en Torrox (Perfectti y col., 2004). Estos cambios

sucesivos de Bs parásitos a neutros y de nuevo a parásitos, prolongan enormemente el

período de vida de los cromosomas B, tal como propusieron Camacho y col. (1997).

2.7. Efectos

La presencia de un B en un genoma hace que éste tenga mayor cantidad de ADN y que

además tenga que usar la maquinaria replicativa del genoma hospedador para replicarse

y transmitirse (Puertas, 2002; Jones y col., 2008). Así, el cromosoma B del pez A.

alburnus supone casi el 10% del tamaño de su genoma (Schmid y col., 2006) y el del

maíz incrementa la cantidad de ADN en el genoma un 4% (Jones y col., 2008). Por

tanto, es lógico pensar que toda esta cantidad extra de material biológico tenga efectos

sobre el genoma hospedador.

La mayoría de cromosomas B son heterocromáticos, y durante mucho tiempo

este hecho ha llevado a pensar que son genéticamente inertes. Sin embargo, cada vez

son más los estudios que revelan la existencia de actividad de genes ribosómicos,

pseudogenes, o de proteínas codificadoras localizados en los Bs. Por tanto, los efectos

encontrados, relacionados con la presencia de cromosomas B, en los individuos pueden

deberse a los productos génicos que provienen del propio B, como ocurre para los

genes de resistencia a la roya que tienen los Bs de Avena sativa (Dherawattana y

Sadanaga, 1973) y los de resistencia a antibióticos localizados en los Bs de Nectria

haematococca (Miao y col., 1991a, b), o bien derivar de su mera presencia en los

genomas, como aluden la mayoría de casos descritos en los que se ha estudiado los

efectos de los cromosomas B (Camacho y col., 2000). Un ejmplo de esta última

situación lo encontramos en la planta liliácea Scilla autumnalis, cuyos Bs tienen

Introducción general y Objetivos

45

influencia sobre la expresión de un gen de los As que codifica para una esterasa,

haciendo que las plantas con B expresen el gen E-1 y las sin B no (Ruiz-Rejón y col.,

1980; Oliver y col., 1982).

Los efectos de los Bs pueden afectar a procesos celulares y fisiológicos tanto en

plantas como animales. Estos efectos normalmente no son visibles fenotípicamente,

salvo en el caso de la planta Haplopappus gracilis, donde los Bs cambian el color de los

aquenios (Jackson y Newmark, 1960), o del maíz, donde las plantas con B tienen las

hojas rayadas (Staub, 1987). En la naturaleza encontramos con mucha más frecuencia

casos donde los Bs afectan negativamente a la vigorosidad, la fecundidad y fertilidad

de los individuos portadores, haciendo referencia a la naturaleza parasítica de estos

elementos genéticos. También es posible encontrar situaciones contrarias donde los

individuos con bajo número de Bs ven incrementado el vigor por el efecto de éstos

(Jones y Rees, 1982).

Otros efectos que se han descrito para los Bs son la alteración de los niveles de

expresión de las NORs de los cromosomas A de E. plorans (Cabrero y col., 1987),

siendo mayor en los individuos 1B que en los 0B, y la variación de la frecuencia de

quiasmas de los cromosomas del genoma hospedador. Atendiendo a éste último efecto,

se ha observado tanto un incremento de quiasmas (en la mayoría de los casos) como una

disminución o ausencia de efecto relacionado con la presencia de cromosomas B (Jones

y Rees, 1982; Bell y Burt, 1990). Como consecuencia de ésto, la existencia de

cromosomas B se interpretó inicialmente como un fenómeno adaptativo que hace que la

población evolucione más rápido debido al incremento de variabilidad genética (John y

Hewitt, 1965; Hewitt y John, 1967). Sin embargo, Bell y Burt (1990) criticaron esta

hipótesis ya que suponía que los Bs, a pesar de ser parásitos, eran seleccionados por sus

efectos favorables sobre el genoma hospedador, y propusieron otra que defendía que el

aumento de número de quiasmas y de la variabilidad genética de la descendencia son

una respuesta del genoma hospedador a la presencia del cromosoma B parásito (teoría

de la recombinación inducible). Camacho y col. (2002) apoyaron esta teoría y además

matizaron que era dependiente del estado del polimorfismo del B en cada población,

siendo mayor el número de quiasmas en los As cuanta más acumulación presentaba el

B.

3. Eyprepocnemis plorans

3.1. La especie

Eyprepocnemis plorans (Orthoptera, Acrididae) es una especie de saltamontes en la que

se han descrito cuatro subespecies: E. plorans plorans (Charpentier, 1825), E. plorans

ornatipes (Walter, 1870), E. plorans ibandana (Giglio-Tos, 1907) y E. plorans

meridionalis (Uvarov, 1921). E. plorans plorans (Figura 6) se distribuye por toda la

región circunmediterránea, llegando hasta el Cáucaso y la Península Arábiga (Dirsh,

1958). En España, se encuentra a lo largo de la costa mediterránea, desde Tarragona

hasta Huelva, adentrándose hacia regiones interiores a lo largo de las cuencas de los

46

principales ríos mediterráneos. Las otras tres subespecies se encuentran on diferentes

lugares del Africa (Dirsh, 1958). La subespecie empleada en el presente trabajo

corresponde a E. plorans plorans, y a ella nos referiremos de ahora en adelante con el

nombre de la especie.

Este saltamontes tiene una única generación anual, desde julio a marzo, con un

máximo de densidad poblacional en el mes de octubre para ambos sexos, siendo mayor

para los machos. En agosto podemos ya encontrar poblaciones de las primeras ninfas.

Es una especie polífaga poco exigente en su dieta, con cierta capacidad gregaria y

elevado poder de dispersión (Hernández y Presa, 1984), que vive preferentemente en

ambientes húmedos y muy cálidos (30°C). Su elevada tasa reproductiva y su capacidad

de descubrir las condiciones bióticas más favorables, le ha hecho en ocasiones una

especie dañina para los cultivos. Una vez recolectados individuos en el medio natural,

esta especie se puede cultivar en el laboratorio e incluso mantener el cultivo de un año

hasta el siguiente.

Figura 6. Espécimen de Eyprepocnemis plorans plorans.

3.2. El genoma

El complemento cromosómico de E. plorans tiene un tamaño aproximado de 10

picogramos, es decir de alrededor de 1010

pb (Ruiz-Ruano y col., 2011) y está formado

por 11 pares de autosomas y un par sexual (Figura 7). El determinismo del sexo es del

tipo XX/X0, con lo que las hembras tienen dos cromosomas X y los machos solo uno.

Todos los cromosomas son acrocéntricos y se clasifican en tres grupos según su tamaño:

cromosomas largos (L1-L2), medianos (M3-M8) y pequeños (S9-S11). El cromosoma X

tiene un tamaño intermedio entre los cromosomas L2 y M3. Todos los autosomas y el

par sexual poseen ADNr, aunque existe variación entre poblaciones, situándose los

bloques mayores en los bivalentes S9, S10, S11 y X. En éstos se puede visualizar las

constricciones secundarias correspondientes a las NORs, y es en estos cromosomas

donde las encontramos recurrentemente activas.

Introducción general y Objetivos

47

Figura 7. Célula en diplotene correspondiente

a un macho de E. plorans de la población de

Torrox (Málaga) sometida a una tinción con orceína

lactopropiónica al 2% . En la foto se aprecia los 11

bivalentes, el cromosoma X y dos Bs.

La gran mayoría de las poblaciones españolas analizadas hasta ahora poseen

cromosomas B (Camacho y col., 1980; Henriques-Gil y col., 1984; Cabrero y col.,

1997; Riera y col., 2004) con la única excepción de las poblaciones situadas en las

cabeceras de los ríos de la cuenca del Segura (Cabrero y col., 1997). También contienen

cromosomas B las poblaciones analizadas en Marruecos (Bakkali, 2001), Italia (López-

Fernández y col., 1992), Grecia (Abdelaziz y col., 2007), Turquía (López-León y col.,

2008), Armenia (López-León y col., 2008), Dagestan (Rusia) (Cabrero y col., 2003),

Tunez y Sicilia (Cabrero y col. 2013), y recientemente los hemos encontrado en Egipto.

Poblaciones de Sudáfrica, pertenecientes a la subespecie E. plorans meridionalis, sin

embargo, no poseen cromosomas B (López-León y col., 2008).

3.3. Los cromosomas B de E. plorans

El sistema de cromosomas B de E. plorans es uno de los más ampliamente estudiados

(véase Camacho, 2003). Los cromosomas B de esta especie se caracterizan por ser

mitóticamente estables en los tejidos gonadales masculinos y en los ciegos gástricos, es

decir, por presentar el mismo número de cromosomas B en cada célula. Otra

característica muy llamativa es que se han descrito más de 50 variantes citológicas de

Bs en esta especie (Henriques-Gil y col., 1984; López-León y col., 1993; Bakkali 2001;

López-León y col., 2008), coexistiendo algunas de ellas en la misma población. Estas

variantes difieren en tamaño y morfología mostrando variación en la proporción relativa

48

de las secuencias que lo componen (López-León y col., 1994; Cabrero y col., 1999). De

todas las variantes de B que existen en E. plorans, B1 es la más ampliamente distribuida

tanto en la Península Ibérica (en poblaciones de Murcia, Alicante e Islas Baleares entre

otras) como en Marruecos, por lo que es considerada la variante ancestral (Henriques-

Gil y Arana, 1990). B2 es la variante más común en Granada y Málaga oriental, B5 es

predominante en Fuengirola (Málaga), y B24 en Torrox (Málaga). El resto de variantes

aparecen con muy baja frecuencia. El número de cromosomas B que porta un individuo

también es variable, pudiendo coexistir en la misma población individuos sin

cromosoma B y otros con diferente número de Bs (se han descrito casos de hasta 6B en

el mismo macho).

Al igual que ocurre en la mayoría de especies, las diferentes variantes de Bs de

E. plorans están formados mayoritariamente por secuencias repetidas presentes también

en los cromosomas A: el ADNsat de 180pb (específico de E. plorans) y el ADNr 45S,

el cual constituye en este cromosoma el mayor bloque de esta secuencia en todo su

genoma. Se han observado diferencias en la composición relativa de estas dos

secuencias en los Bs no sólo entre variantes, sino también entre regiones geográficas.

Así, los Bs de las poblaciones del este de Europa (Cáucaso, Turquía y Grecia) tienen

mucha cantidad de ADNr 45S y poca de ADNsat de 180pb (Cabrero y col., 2003;

López-León y col., 2008), exceptuando el cromosoma B4a de Armenia que no porta

dichas secuencias (López-León y col., 2008). Por el contrario, las poblaciones del oeste

de Europa (España y Marruecos) tienen cromosomas B con aproximadamente la misma

cantidad de ambas secuencias, exceptuando B5 y B24 donde la proporción de ADNsat es

mayor que la de ADNr 45S (Cabrero y col., 1999; Bakkali, 2001; López-León y col.,

2008). Este hecho de diversificación de los Bs por zonas geográficas sugería que el

origen de los Bs de las poblaciones del este y del oeste de Europa es independiente.

Pero Muñoz-Pajares y col. (2011) consiguieron aislar un marcador específico del B

(SCAR) en poblaciones muy distantes como son Marruecos y Armenia cuya secuencia

estaba muy conservada, abogando por el origen común y reciente de todos los

cromosomas B de E.plorans.

El ciclo de vida de los Bs en esta especie sigue el modelo casi-neutro explicado

en el apartado 1.6. propuesto por Camacho y col. en 1997. En E. plorans, las variantes

B1, B2 y B5 se encontrarían en estadio evolutivo de neutralización ya que carecen de

mecanismos de acumulación y muestran tasas de transmisión próximas a 0,5 (López-

León y col., 1992a), debido probablemente a la existencia de genes supresores

localizados en los As. Sin embargo, la variante B24 de la población de Torrox es de

aparición reciente. En esta población, la variante neutral B2 ha sido sustituida por la

variante parasítica B24 (con acumulación) tras mutaciones cromosómicas que han hecho

que la nueva variante tenga más ADNsat y menos ADNr que la anterior. Esta nueva

variante se relacionó con un descenso de la fertilidad de los huevos pero aún así era

transmitido por las hembras con una frecuencia del 70% (Zurita y col., 1998). De

acuerdo con la dinámica evolutiva propuesta para los cromosomas B, la probable

actuación de genes supresores de la acumulación sobre el cromosoma B24 ha eliminado

la inicial capacidad de sobretransmisión de dicho B, neutralizándolo.

49

Introducción general y Objetivos

Los cromosomas B de E. plorans no tienen normalmente efectos sobre la

eficacia biológica de sus portadores, exceptuando la reducción significativa en la

fertilidad de los huevos producida por B24 en su fase parasítica (Zurita y col. 1998).

Estudios realizados en poblaciones de Granada con B2 pusieron de manifiesto que esta

variante no tiene efectos sobre la frecuencia de cópula (López-León y col., 1992b), el

tamaño de la puesta, la fertilidad de los huevos ni la viabilidad desde el embrión hasta

adulto (Camacho y col., 1997). De ahí que se denomine a este tipo de Bs “casi-neutros”.

Debido a las secuencias altamente repetidas que portan, los cromosomas B son

heterocromáticos en esta especie. Durante mucho tiempo se pensó que el B de E.plorans

era genéticamente inactivo, hasta que Cabrero y col. (1987) encontraron un individuo

donde muchas de sus células en diplotene mostraban un nucleolo asociado a la región

distal del cromosoma B2 que se había fusionado con el autosoma más largo del

complemento. Tras este hallazgo, Teruel y col. (2007, 2009) estudiaron, mediante

impregnación argéntica, diplotenes de machos de la población de Torrox, y vieron que

la NOR del B24 aparecía recurrentemente activa. Además, analizaron el área nucleolar

de los diferentes cromosomas con NOR activa y encontraron que, tanto si el B estaba

activo como si no, el área nucleolar total de la célula permanecía constante. También

Teruel (2009) obtuvo las secuencias del cistrón de ADNr de individuos con y sin

cromosoma B, así como la localizada en los cromosomas X y B de E.plorans, previa

microdisección de estos dos tipos cromosómicos. Los resultados condujeron al hallazgo

de la inserción diferencial de una adenina en la ITS2 del ADNr amplificado a partir del

cromosoma B y que, por tanto, no aparecía en el resto de secuencias analizadas

correspondientes a los cromosomas A. Este hallazgo supuso realmente el inicio de la

presente tesis.

Referencias

Abdelaziz M, Teruel M, Chobanov D, Camacho JP, Cabrero J (2007) Physical mapping

of rDNA and satDNA in A and B chromosomes of the grasshopper

Eyprepocnemis plorans from a Greek population. Cytogenet Genome Res

119:143-6

Alper I, Frenette M, and Labrie S (2011) Ribosomal DNA polymorphisms in

the yeast Geotrichum candidum. Fungal Biol 115(12):1259-1269

Alvarez I, Wendel JF (2003) Ribosomal ITS sequences and plant phylogenetic

inference. Mol Phylogenet Evol 29:417-434

Amos A, Dover G (1981) The distribution of repetitive DNAs between regular and

supernumerary chromosomes in species of Glossina (Tsetse): a two-step process

in the origin of supernumeraries. Chromosoma 81:673-690

Averbeck KT, Eickbush TH (2005) Monitoring the mode and tempo of concerted

evolution in Drosophila melanogaster rDNA locus. Genetics 171:1837-1846

Bakkali M (2001) Tesis Doctoral: Evolución de los cromosomas B del saltamontes

Eyprepocnemis plorans en Marruecos. Universidad de Granada.

Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B

chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North

Africa. I. B variants and frequency. Heredity 83:428-434

50

Bakkali M, Perfectti F, and Camacho JP M (2002) The B chromosome polymorphism

of the grasshopper Eyprepocnemis plorans in North Africa. II. Parasitic and

neutralized B1 chromosomes. Heredity 88:14-18

Bakkali M, Camacho, JPM (2004) The B chromosome polymorphism of the

grasshopper Eyprepocnemis plorans in North Africa: III. Mutation rate of B

chromosomes. Heredity 92:428-433

Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization of

Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae

of a small B chromosome bearing inactive NOR-like sequences. Caryologia

62:95-101

Battaglia E (1964) Cytogenetics of B-chromosomes. Caryologia 17:245-299

Bell G, Burt A (1990) B chromosomes: germ-line parasites which induce changes in

host recombination. Parasitology 100:S19-S26

Beukeboom LW (1994a) Bewildering Bs: an impression of the 1st B-chromosome

conference. Heredity 73:328-336

Bidau CJ, Rosato M, Martí DA (2004) FISH detection of ribosomal cistrons and

assortment-distortion for X and B chromosomes in Dichroplus pratensis

(Acrididae). Cytogenet Genome Res 106:295-301

Bik HM, Fournier D, Sung W, Bergeron RD, Thomas WK (2013) Intra-Genomic

Variation in the Ribosomal Repeats of Nematodes. PLoS ONE 8(10): e78230.

doi:10.1371/journal.pone.0078230

Blaalid R, Carlsen TOR, Kumar S, Halvorsen R, Ugland KI, Fontana G, Kauserud H

(2012) Changes in the root-associated fungal communities along a primary

succession gradient analysed by 454 pyrosequencing. Molecular Ecology

21:1897-1908

Blaalid R, Kumar S, Nilsson RH, Abarenkov K, Kirk PM, Kauserud H (2013) ITS1

versus ITS2 as DNA metabarcodes for fungi. Molecular Ecology 21:1897-1908

Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN, Liapunova EA (1995)

Nucleolus organizer regions and B-chromosomes of field mice (Mammalia,

Rodentia, Apodemus). Genetika 31(2):185-192

Boisvert FM, van Koningsbruggen S, Navascues J, Lamond AI (2007) The

multifunctional nucleolus. Nat Rev Mol Cell Biol 8:574-585

Boothroyd JC, Wang A, Campbell DA, Wang CC (1987) An unusually compact

ribosomal DNA repeat in the protozoan Giardia lamblia. Nucleic Acids Res

15:4065-4084

Bosemark NO (1954) On accessory chromosomes in Festuca pratensis. Hereditas

40:346-376

Boulon S, Westman BJ, Hutten S, Boisvert F-M, Lamond AI (2010) The nucleolus

under stress. Mol Cell 40:216-227

Boyes JM, Van Brink JM (1967) Chromosomes of Shyrpidae III. Karyotypes of some

species in the trihes Milesiini and Myoleptini. Chromosoma 22:417-455

Bridge PD, Spooner BM, Roberts PJ (2005) The impact of molecular data in fungal

systematics. Adv Bot Res 42:33-67

Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernumerary

chromosomes evolution in the Simulium vernum group (Diptera: Simulidae).

Genome 32:516-521

Brown DD, Wensink PC, Jordan E (1972) A comparison of the ribosomal DNA’s of

Xenopus laevis and Xenopus mulleri: the evolution of tandem genes. J Mol Biol

63:57-73

51

Introducción general y Objetivos

Burt A, Trivers R (2006) Genes in conflict: the biology of selfish genetic elements.

Belknap Press of Harvard University Press (Cambridge)

Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the

grasshopper Eyprepocnemis plorans on nucleolar organiser regions activity.

Activation of a latent NOR on a B chromosome fused to an autosome. Genome

29:116-121

Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM

(1997) Geographical distribution of B chromosomes in the grasshopper

Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective

historical events. Chromosome Res 5:194-198

Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B

chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity

83:435-439

Cabrero J, Bakkali M., Bugrov,A, Warchalowska-Sliwa E, López-León MD, Perfectti

F, Camacho JPM (2003) Multiregional origin of B chromosomes in the

grasshopper Eyprepocnemis plorans. Chromosoma 112:207-211

Cabrero J, Bakkali M, Navarro-Domínguez B, Ruíz-Ruano FJ, Martín-Blázquez R,

López-León MD, Camacho JPM (2013) The Ku70 DNA-repair protein is

involved in centromere function in a grasshopper species. Chromosome Research

21:393-406

Camacho JPM, Shaw MW, López–León MD, Pardo MC, Cabrero J (1997) Population

dynamics of a selfish B chromosome neutralized by the standard genome in the

grasshopper Eyprepocnemis plorans. Am Nat 149:1030-1050

Camacho JPM, Carballo AR, Cabrero J (1980) The B-chromosome system of the

grasshopper Eyprepocnemis plorans subsp. plorans (Charpentier). Chromosoma

80:163-166

Camacho JPM, Sharbel TF, Beukeboom LW (2000) B chromo- some evolution. Phil

Trans R Soc Lond B 355:163-178

Camacho JPM, Bakkali M, Corral JM, Cabrero J, López-León MD, Aranda I, Martín-

Alganza A, Perfectti F (2002) Host recombination is dependent on the degree of

parasitism. Proc R Soc Lond Ser B 269:2173-2177

Camacho JPM, Cabrero J, López-León MD, Bakkali M, Perfectti F (2003) The B

chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic

conflict. Genetica 117:77-84

Camacho JPM (2005) B chromosomes. In: Gregory TR (ed) The evolution of the

genome. Academic Press, New York, pp 223-286

Cano MI, Santos JL (1989) Cytological basis of the B chromosome accumulation

mechanism in the grasshopper Heteracris littoralis (Ramb). Heredity 62:91-95

Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al (2007)

Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell

19:1738-1749

Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes are

weakly transcribed and might alter the transcriptional activity of A chromosome

sequences. Chromosoma 118:607-616

Charlesworth B, Langley CH, Stephan W (1986) The evolution of restricted

recombination and the accumulation of repeated DNA sequences. Genetics

112:947-962

Coleman AW (2003) ITS2 is a double-edged tool for eukaryote evolutionary

comparisons. Trends in Genetics 19:370-375

52

Crocker J, Boldy DA, Egan MJ (1989) How should we count AgNORs? Proposals for a

standardized approach. The Journal of pathology 158:185-188

Delany ME, Muscarella DE, Bloom SE (1994) Effects of rRNA gene copy number and

nucleolar variation on early development: inhibition of gastrulation in rDNA-

deficient chick embryos. J Hered 85:211-217

Dammann R, Lucchini R, Koller T, Sogo JM (1995) Transcription in the yeast rRNA

gene locus: distribution of the active gene copies and chromatin structure of their

flanking regulatory sequences. Mol Cell Biol 15:5294-5303

Derenzini M, Nardi F, Farabegoli F, Ottinetti A, Roncaroli F, Bussolati G (1989)

Distribution of silver-stained interphase nucleolar organizer regions as a

parameter to distinguish neoplastic from nonneoplastic reactive cells in human

effusions. Acta Cytol 33:491-498

Derenzini M, Ploton D (1990) Interphase nucleolar organizer regions in cancer cells.

International review of experimental pathology 32:149-192

Derenzini M (2000) The AgNORs. Micron 31:117-120

Dhar MK, Friebe B, Koul AK, Gill BS (2002) Origin of an apparent B chromosome by

mutation, chromosome fragmentation and specific DNA sequence amplification.

Chromosoma 111:332-340

Dherawattana A, Sadanaga K (1973) Cytogenetics of a crown rust-resistant hexaploid

oat with 42+ 2 fragment chromosomes. Crop Science 13:591-594

Dirsh VM (1958) Revision of the genus Eyprepocnemis Fieber, 1853 (Orthoptera:

Acridoidea). Proc R Entomol Soc Lond 27:33-45

Eickbush DG, Eickbush TH, Werren JH (1992) Molecular characterization of repetitive

DNA sequences from a B chromosome. Chromosoma 101:575-583

Eickbush TH, Burke WD, Eickbush DG, Lathe WC (1997) Evolution of R1 and R2 in

the rDNA units of the genus Drosophila. Genetica 100(1-3):49-61

Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the

ribosomal RNA genes. Genetics 175(2):477-485

Feliner GN, Larena BG, a Aguilar JF (2004) Fine-scale geographical structure, intra-

individual polymorphism and recombination in nuclear ribosomal internal

transcribed spacers in Armefia (Plumbaginaceae). Ann Bot 93:189-200

Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA transcription of

euchromatic and heterocromatic chromosome regions during grasshopper meiosis.

Chromosoma 45:43-62

Franks TK, Houben A, Leach CR, Timmis JN (1996) The molecular organisation of a B

chromosome tandem repeat sequence from Brachycome dichromosomatica.

Chromosoma 105(4):223-30

French SL, Osheim YN, Cioci F, Nomura M, Beyer AL (2003) In exponentially

growing Saccharomyces cerevisiae cells, rRNA synthesis is determined by the

summed RNA polymerase I loading rate rather than by the number of active

genes. Mol Cell Biol 23:1558-1568

Fröst S (1957) The inheritance of the accessory chromosomes in Centaurea scabiosa.

Hereditas 43:403-422

Gangloff S, Zou H, Rothstein R (1996) Gene conversion plays the major role in

controlling the stability of large tandem repeats in yeast. The EMBO Journal

15:1715-1725

Ganley ARD, Scott B (1998) Extraordinary ribosomal spacer length heterogeneity in a

Neotyphodium endophyte hybrid: Implications for concerted evolution. Genetics

150:1625-1637

53

Introducción general y Objetivos

Ganley ARD, Scott B (2002) Concerted evolution in the ribosomal RNA genes of an

Epichloë endophyte hybrid: Comparison between tandemly-arranged rDNA and

dispersed 5S rrn genes. Fungal Gene Bio 35:39-51

Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal

DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun

sequence data. Genome Research 17:184-191

Gébrane-Younès J, Fomproix N, Hernandez-Verdun D (1997) When rDNA

transcription is arrested during mitosis, UBF is still associated with non-

condensed rDNA. J Cell Sci 110:2429-2440

Gojobori T, Nei M (1984) Concerted evolution of the immunoglobulin VH gene family.

Molecular biology and evolution 1:195-212

Goodpasture C, Bloom SE (1975) Visualization of nucleolar organizer regions in

mammalian chromosomes using silver staining. Chromosoma 53:37-50

Green DM (1988) Cytogenetics of the endemic New Zealand frog, Leiopelma

hochstetteri: extraordinary supernumerary chromosome variation and a unique

sex-chromosome system. Chromosoma 97:55-70

Green DM (1990) Muller's Ratchet and the evolution of supernumerary chromosomes.

Genome 33:818-824

Green DM, Zeyl CW, Sharbel TF (1993) The evolution of hypervariable sex and

supernumerary (B) chromosomes in the relict New Zealand frog, Leiopelma

hochstetteri. Journal of evolutionary biology 6:417-441

Grummt I (2013) The nucleolus, guardian of celular homeostasis and genome integrity.

Chromosoma. doi10.1007/s00412-013-0430-0

Gutknecht J, Sperlich D, Bachmann L (1995) A species specific satellite DNA family of

Drosophila subsilvestris appearing predominantly in B chromosomes.

Chromosoma 103:539-544

Hackstein JHP, Hochstenbach R, Hauschteck-Jungen E, Beukeboom LW (1996) Is the

Y chromosome of Drosophila an evolved supernumerary chromosome?

BioEssays 18:317-323

Hakansson A (1945) Überzählige chromosomen in einer rasse von Godetia nutans.

Hiorth Bot Notiser 2:1-19

Hakansson A (1948) Behaviour ol accessory rye chromosomes in the embryo-sac.

Hereditas 34:35-59

Heitz E (1931) Die Ursache der gesetzmässigen Zahl, Lage, From und Grösse

pflanzlicher Nukleolen. Planta 12:775-844

Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polymorphism in

the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293

Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the

grasshopper Eyprepocnemis plorans. Evolution 44:747-753

Hernández F, Presa JJ (1984) Sobre la biología de Eyprepocnemis plorans (Charpentier,

1825) (Orthoptera: Acrididae), en la huerta de Murcia (S.E. España). Bol Serv

Plagas 10:245-249

Hernandez-Verdun D, Roussel P, Gébrane-Younès J (2002) Emerging concepts of

nucleolar assembly. J Cell Sci 115:2265-2270

Hernandez-Verdun D, Roussel P, Thiry M, Sirri V, Lafontaine DLJ (2010) The

nucleolus: structure/function relationship in RNA metabolism. Wires RNA 1:415-

431

Herrera JA, López-León MD, Cabrero J, Shaw MW, Camacho JPM (1996) Evidence

for B chromosome drive suppression in the grasshopper Eyprepocnemis plorans.

Heredity 76:633-639

54

Hewitt GM, John B (1967) The B-chromosome system of Myrmeleotettix maculatus

(Thunb.) III. The statistics. Chromosoma 21:140-162

Hewitt GM (1973a) The integration of supernumerary chromosomes into the orthopteran

genome. Cold Spring Harbour Symp Quant Bio 38:183-194

Hewitt GM (1976) Meiotic drive for B chromosomes in the primary oocytes of

Myrmeleotettix maculatus (Orthoptera: Acrididae). Chromosoma 56:381-391

Hewitt GM (1979) Grasshopper and crickets. In “Animal Cytogenetics”, vol. 3: Insecta

1 Orthoptera (ed. B. John), 170 pp. Berlin Stuttgart: Gebruder Borntraeger

Highett MI, Beven AF, Shaw PJ (1993) Localization of 5 S genes and transcripts in

Pisum sativum nuclei. J Cell Sci 105:1151-1158

Hiscox JA (2007) RNA viruses: hijacking the dynamic nucleolus. Nat Rev Microbiol

5:119-127

Holliday R (1987) The inheritance of epigenetic defects. Science 238:163-170

Horton TR, Bruns TD (2001) The molecular revolution in ectomycorrhizal ecology:

peeking into the black-box. Molecular Ecology 10:1855-1871

Hřibová E, Čížková J, Christelová P, Taudien S, de Langhe E, Doležel J (2011)

The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use

in molecular phylogeny. PLoS One 6(3):e17863. doi:

10.1371/journal.pone.0017863

Houben A, Kynast RG, Heim U, Hermann H, Jones RN, Forster JW (1996) Molecular

cytogenetic characterisation of the terminal heterochromatic segment of the B

chromosome of rye (Secale cereale). Chromosoma 105:97-103

Houben A, Belyaev ND, Leach CR, Timmis JN (1997) Differences of histone H4

acetylation and replication timing between A and B chromosomes of Brachycome

dichromosomatica. Chromosome Research 5:233-237

Huang S, Rothblum LI, Chen D (2006) Ribosomal chromatin organization. Biochem

Cell Biol 84:444-44

Hudson LA, Ciborowski JJH (1996) Teratogenic and genotoxic responses of larval

Chironomus salinarius group (Diptera: Chironimidae) to contaminated sediment.

Environ Toxicol Chem 15:1375-1381

Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA gene

copies maintains genome integrity. Science 327:693-696

Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional activity of

the B-chromosome of Apodemus peninsulae during pachytene. Chromosoma

100:278-281

Jackson RC, Newmark KP (1960) Effect of supernumerary chromosome on production

of pigment in Haplopappus gracilis. Science 132:1316-1317

James TC, Elgin SC (1986) Identification of a nonhistone chromosomal protein

associated with heterochromatin in Drosophila melanogaster and its gene. Mol

Cell Biol 6:3862-3872

James SA, O’Kelly MJT, Carter DM, Davey RP, Van Oudenaarden A, and Roberts IN

(2009) Repetitive sequence variation and dynamics in the ribosomal DNA array

of Saccharomyces cerevisiae as revealed by whole genome resequencing.

Genome Res 19:626-635

Jamilena M, Ruiz–Rejón C, Ruiz–Rejón M (1994) A molecular analysis of the origin of

the Crepis capillaris B chromosome. J. Cell Sci 107:703-708

Jamilena M, Garrido-Ramos M, Ruiz-Rejón M, Ruiz-Rejón , Parker JS (1995)

Characterisation of repeated sequences from microdissected of Crepis capillaris.

Chromosoma 104(2):113-120

55

Introducción general y Objetivos

Jimenez MM, Romera F, González-Sánchez M, Puertas MJ (1997) Genetic control of

the rate of transmission of rye B chromosomes. III. Male meiosis and

gametogenesis. Heredity 78:636-644

John B, Hewitt GM (1965) The B chromosome system of Myrmeleotettix maculatus

(Thunb.), I. The mechanics. Chromosoma 16:548-578

Jones RN, Rees H (1982) B chromosomes. New York: Academic Press

Jones RN, Puertas MJ (1993) The B-chromosomes of rye (Secale cereale L.).

In: Frontiers in Plant Science Research, eds. KK Dhir and TS Sareen. Delhi:

Bhagwati Enterprises, pp. 81-112 Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol

131:411-434

Jones RN, Viegas W, Houben A (2008) A century of B chromosomes in plants: So

what? Annals of Botany 101:767-775

Kafatos FC, Orr W, Delidakis C (1985) Developmentally regulated gene amplification.

Trends in Genet 1:301-306

Kảrén O, Högberg N, Dahlberg A, Jonsson L, Nylund JE (1997) Inter-and intraspecific

variation in the ITS region of rDNA of ectomycorrhizal fungi in Fennoscandia as

detected by endonuclease analysis. New Phytologist 136:313-325

Kauserud H, Schumacher T (2002) Population structure of the endangered wood decay

fungus Phellinus nigrolimitatus (Basidiomycota). Canadian journal of botany

80:597-606

Kayano H (1957). Cytogenetic studies in Lillium callosum. III. Preferential segregation

of a supernumerary chromosome in EMCs. Proc Jap Acad 33:553-558

Kayano H (1971). Accumulation of B chromosomes in the germ-line of Locusta

migratoria. Heredity 27:119-123

Keller A, Förster F, Müller T, Dandekar T, Schultz J, Wolf M (2010) Including RNA

secondary structures improves accuracy and robustness in reconstruction of

phylogenetic trees. Biology Direct 5:4. doi: 10.1186/1745-6150-5-4

Kenton A (1991) Heterochromatin accumulation, disposition and diversity in Gibasis

karwinskyana (Commelinaceae). Chromosoma 100:467-478

Keyl HG, Hägele K (1971) B-Chromosomen bei Chironomus. Chromosoma 35:403-417

Ki JS, Han MS (2007) Cryptic long internal repeat sequences in the ribosomal DNA

ITS1 gene of the dinoflagellate Cochlodinium polykrikoides (dinophyceae): a 101

nucleotide six-repeat track with a palindrome-like structure. Genes and genetic

systems 82:161-166

Knibiehler B, Mirre C, Rosset R (1982) Nucleolar organizer structure and activity in a

nucleolus without fibrillar centres: the nucleolus in an established Drosophila cell

line. Journal of cell science 57:351-364

Knibiehler B, Mirre C, Navarro A, Rosset R (1984) Studies on chromatin organization

in a nucleolus without fibrillar centres. Cell and tissue research 236:279-288

Kobayashi T, Heck DJ, Nomura M, Horiuchi T (1998) Expansion and contraction of

ribosomal DNA repeats in Saccharomyces cerevisiae: requirement of replication

fork blocking (Fob1) protein and the role of RNA polymerase I. Genes and

development 12:3821-3830

Kobayashi T (2008) A new role of the rDNA and nucleolus in the nucleus--rDNA

instability maintains genome integrity. Bioessays 30:267-272

Kobayashi, T (2011) Regulation of ribosomal RNA gene copy number and its role in

modulating genome integrity and evolutionary adaptability in yeast. Cell Mol Life

Sci 68:1395-1403

56

Kovarik A, Pires JC, Leitch AR, Lim KY, Sherwood AM, Matyasek R, Rocca J, Soltis

DE, and Soltis, PS (2005) Rapid concerted evolution of nuclear ribosomal DNA

in two Tragopogon allopolyploids of recent and recurrent origin. Genetics

169:931-944

Kuwada Y (1915) Übe rdie Chromosomenzahl von Zea Mays L. Bot. Mag. Tôkyô

29:83-89

Langerstedt S (1949) Cytological studies on the protein metabolism of the liver in the

rat. Acta Anat Suppl 9:1–140

Lamb JC, Riddle NC, Cheng YM, Theuri J, Birchler JA (2007) Localization and

transcription of a retrotransposon-derived element on the maize B chromosome.

Chromosome research 15:383-398

Leach CR, Donald TM, Franks TK, Spiniello SS, Hanrahan CF, Timmis JN (1995)

Organisation and origin of a B chromosome centromeric sequence

from Brachycome dichromosomatica.Chromosoma 103(10):708-714

Leach CR, Houben A, Bruce F, Pistrick K, Demidov D et al (2005) Molecular evidence

for transcription of genes on a B chromosome in Crepis capillaris. Genetics

171:269-278

Li Y, Jiao L, and Yao YJ (2013) Non-concerted ITS evolution in fungi,

as revealed from the important medicinal fungus Ophiocordyceps sinensis. Mol

Phylogenet Evol 68(2):373-379

Liao D, Pavelitz T, Kidd JR, Kidd KK, Weiner AM (1997) Concerted evolution of the

tandemly repeated genes encoding human U2 snRNA (the RNU2 locus) involves

rapid intrachromosomal homogenization and rare interchromosomal gene

conversion. EMBO J 16:588-598

Lidner DL, Carlesen T, Henrik Nilsson R, Davey M, Schumacher T, Kauserud H (2013)

Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in

the internal transcribed spacer rDNA region in fungi. Ecol Evol 3(6):1751-1764

Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727-

764

López-Fernández C, Mezzanotte R, Gosálvez J (1992) Autosomal, sex and B

chromosomes in Eyprepocnemis plorans (Orthoptera) viewed with restriction

endonuclease in situ digestion. Heredity 68:365-372

López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region in a B

chromosome inactivated by DNA methylation. Chromosoma 100:134-138

López-León MD, Cabrero J, Camacho JPM, Cano MI, Santos JL (1992a) A widespread

B chromosome polymorphism maintained without apparent drive. Evolution

46:529-539

López-León MD, Pardo MC, Cabrero J, Camacho JPM (1992b) Random mating and

absence of sexual selection for B chromosomes in two natural populations of the

grasshopper Eyprepocnemis plorans. Heredity 69:558-561

López–León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)

Generating high variability of B chromosomes in the grasshopper Eyprepocnemis

plorans. Heredity 71:352-362

López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,

Camacho JPM (1994). Possible origin of a B chromosome deduced from its DNA

composition using double FISH technique. Chromosome Res 2:87-92

López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during

development in the B chromosome NOR of the grasshopper Eyprepocnemis

plorans. Heredity 74:296-302

57

Introducción general y Objetivos

López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov

NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and B

chromosomes between eastern and western populations of the grasshopper

Eyprepocnemis plorans plorans. Cytogenet genome Res 121:260-265

Lucov Z, Nur U (1973) Accumulation of B-chromosomes by preferential segregation in

females of the grasshopper Melanoplus femur-rubrum. Chromosoma 42:289-306

Lyckegaard EM, Clark AG (1991) Evolution of ribosomal RNA gene copy number on

the sex chromosomes of Drosophila melanogaster. Mol Biol Evol 8(4):458-474

Martis MM, Klemme S, Banaei-Moghaddam AM, Blattner FR, Macas J, Schmutzer T,

Scholz U, Gundlach H, Wicker, T, Šimková H, Novák P, Neumann,P,

Kubaláková M, Bauer E, Haseneyer G, Fuchs J, Doležel J, Stein N, Mayer KFX,

Houben A (2012) Selfish supernumerary chromosome reveals its origin as a

mosaic of host genome and organellar sequences. Proc Natl Acad Sci USA

109:13343-13346

Maruyama S, Misumi O, Ishii Y, Asakawa S, Shimizu A, Sasaki T, Matsuzaki M, Shini

T, Nozaki H, Kohara Y (2004) The minimal eukaryotic ribosomal DNA units in

the primitive red alga Cyanidioschyzon merolae. DNA research 11:83-91

Mayol M, Rosselló JA (2001) Why nuclear ribosomal DNA spacers (ITS) tell different

stories in Quercus. Mol Phylogenet Evol 19:167-176

Matyášek R, Renny-Byfield S, Fulneček J, Macas J, Grandbastien MA, Nichols

R, Leitch A, Kovařík A (2012) Next generation sequencing analysis reveals a

relationship between rDNA unit diversity and locus number in Nicotiana diploids.

BMC genomics 13:722. doi: 10.1186/1471-2164-13-722

Mayer C, Grummt I (2005) Cellular Stress and Nucleolar Function. Cell Cycle

4(8):1036-1038

McAllister BF, Werren JH (1997) Hybrid origin of a B chromosome (PSR) in the

parasitic wasp Nasonia vitripennis. Chromosoma 106:243-253

McClintock DJL (1934) The relation of a particular chromosomal element to the

development of the nucleoli in Zea mays. Z Zellforsch Mikrosk Anat 21:294-328

McTaggart SJ, Dudycha JL, Omilian A, Crease TJ (2007) Rates of recombination in the

ribosomal DNA of apomictically propagated Daphnia obtusa lines. Genetics

175:311-320

Mestriner CA, Galetti PM, Valentini SR, Ruiz IR, Abel LD, Moreira-Filho O, Camacho

JPM (2000) Structural and functional evidence that a B chromosome in the

characid fish Astyanax scabripinnis is an isochromosome. Heredity 85:1.9

Miao VP, Covert SF, VanEtten HD (1991a) A fungal gene for antibiotic resistance on a

dispensable (‘B’) chromosome. Science 254:1773-1776

Miao VP, Matthews DE, VanEtten HD (1991b) Identification and chromosomal

locations of a family of cytochrome P-450 genes for pisatin detoxification in the

fungus Nectria haematococca. Mol Gen Genet 226:214-223

Montiel EE, Cabrero J, Camacho JPM, López-León MD (2012) Gypsy, RTE and

Mariner transposable elements populate Eyprepocnemis plorans genome.

Genetica 140:365-374

Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In Olson MOJ, ed. The

Nucleolus. New York: Kluwer. pp 10-20

Müntzing A (1944) Cytological studies of extra fragment chromosomes in rye. I.

Isofragments produced by misdivision. Hereditas 30:231-248

Müntzing A (1948) Accessory chromosomes in Poa alpina. Herediy 2:4941

58

Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,

Perfectti F (2011) A single, recent origin of the accessory B chromosome of the

grasshopper Eyprepocnemis plorans. Genetics 187:853-863

Nei M, Hughes AL (1991) in Evolution at the Molecular Level, eds. Selander R, Clark

A and Whittam T (Sinauer, Sunderland, MA), pp:222-247

Nei M, Hughes AL (1992) in 11th Histocompatibility Workshop and Conference, eds.

Tsuji K, Aizawa M and Sasazuki T (Oxford Univ. Press, Oxford), Vol. 2, pp:27-

38

Nei M, Gu X, Sitnikova T (1997) Evolution by the birth-and-death process in multigene

families of the vertebrate immune system. Proc Natl Acad Sci USA 94(15):7799-

7806

Nei M, Rogozin IB, and Piontkivska H (2000) Purifying selection and birth-and-death

evolution in the ubiquitin gene family. Proc Natl Acad Sci USA 97(20):10866-

10871

Nemeth A, Guibert S, Tiwari VK, Ohlsson R, Langst G (2008) Epigenetic regulation of

TTF-I-mediated promoter–terminator interactions of rRNA genes. EMBO J

27:1255-1265

Nicklas RB (1961) Recurrent pole-to-pole movements of the sex chromosome during

prometaphase I in Melanoplus differentials spermatocytes. Chromosoma 12:97-

115

Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson KH (2008) Intraspecific

ITS variability in the kingdom Fungi as expressed in the international sequence

databases and its implications for molecular species identification. Evolutionary

bioinformatics online 4:193-201

Nur U (1963) A mitotically unstable supernumerary chromosome with an accumulation

mechanism in a grasshopper. Chromosoma 14:407-422

Nur U (1969) Mitotic instability leading to an acumulation of B-chromosomes in

grasshoppers. Chromosoma 27:1-19

Nur U (1977) Maintenance of a "parasitic" B chromosome in the grasshopper

Melanoplus femur–rubrum. Genetics 87:499-512

Nur U, Brett BLH (1985) Genotypes suppressing meiotic drive of a B chromosome in

the mealy bug Pseudococcus obscurus. Genetics 110:73-92

Nur U, Brett BLH (1988) Genotypes affecting the condensation and transmission of

heterochromatic B chromosomes in the mealy bug Pseudococcus affinis.

Chromosoma 96:205-212

Ochs RL, Lischwe MA, Shen E, Caroll RE, Busch H (1985) Nucleologenesis:

composition and fate of prenucleolar bodies. Chromosoma 92:330-336

Oliver JL, Posse F, Martínez-Zapater JM, Enriquez AM, Ruiz-Rejón M (1982) B

chromosomes and E1 isoenzyme activity in mosaic bulbs of Scilla autumnalis.

Chromosoma 85:399-403

Olson MOJ, Dundr M, Szebeni A (2000) The nucleolus: an old factory with unexpected

capabilities. Trends Cell Biol 10:189-96

Olson MOJ (2004) Sensing cellular stress: another new function for the nucleolus? Sci

STKE 2004(224):pe10

Ota T, Nei M (1994) Divergent evolution and evolution by the birth-and-death process

in the immunoglobulin VH gene family. Mol Biol Evol 11(3):469-482

Östergen G (1945) Parasitic nature of extra fragment chromosomes. Bot Notiser 2:157-

163

Pederson T, Tsai RY (2009) In search of nonribosomal nucleolar protein function and

regulation. J Cell Biol 184:771-776

59

Introducción general y Objetivos

Peppers JA, Wiggins LE, Baker RJ (1997) Nature of B chromosomes in the harvest

mouse Reithrodontomys megalotis by fluorescence in situ hybridization (FISH).

Chromosome Research 5:475-479

Perfectti F, Werren JH (2001) The interspecific origin of B chromosomes: experimental

evidence. Evolution 55:1069-1073

Perfectti F, Pita M, De La Vega CG, Gosálvez J, Camacho JPM (2004) Spatio-temporal

dynamics of a neutralized B chromosome in the grasshopper Eyprepocnemis

plorans. Cytogenet genome Res 106:376-385

Peters GB (1981) Germ line polysomy in the grasshopper Atractomorpha similis.

Chromosoma 81:593-617

Pettengill J, Neel M (2008) Phylogenetic patterns and conservation among North

American members of the genus Agalinis (Orobanchaceae). BMC evolutionary

biology 8:264

Pikaard CS (2000a) Nucleolar dominance: uniparental gene silencing on a

multimegabase scale in genetic hybrids. Plant Mol Biol 43:163-177

Pikaard CS (2000b) The epigenetics of nucleolar dominance. Trends in Genetics

16:495-500

Pilotti M, Brunetti B, Tizzani L (2009) Platanus×acerifolia genotypes surviving to

inoculation with Ceratocystis platani (the agent of canker stain): first screening

and molecular characterization. Euphytica 169:1-7

Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African cichlid

fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet 11:1

Preuss S, Pikaard Cs (2007) rRNA gene silencing and nucleolar dominance: insights

into a chromosome-scale epigenetic on/off switch. Biochimica et Biophysica Acta

(BBA) Gene Structure and Expression 1769:383-392

Preuss SB, Costa-Nunes P, Tucker S, Pontes O, Lawrence RJ, Mosher R, Kasschau KD,

Carrington JC, Baulcombe DC, Viegas W, Pikaard CS (2008) Multimegabase

silencing in nucleolar dominance involves siRNA-directed DNA methylation and

specific methylcytosine-binding proteins. Mol Cell 32:673-684

Prokopowich CD, Gregory TR, Crease TJ (2000) The correlation between rDNA copy

number and genome size in eukaryotes. Genome 46:48-50

Puertas MJ (2002) Nature and evolution of B chromosomes in plants: A non-coding but

information-rich part of plant genomes. Cytogenet Genome Res 96:198-205

Randolph IF (1928) Types of supernumerary chromosornes in maize. Anat Rec 41. 102

Raška I, Shaw PJ, Cmarko D (2006a) New Insights into Nucleolar Architecture and

Activity. In: Kwang W Jeon (Ed.), International Review of Cytology. Academic

Press, pp:177-235

Raška I, Shaw PJ, Cmarko D (2006b) Structure and function of the nucleolus in the

spotlight. Current Opinion in Cell Biology 18:325-334

Rebollo E, Martin S, Manzanero S, Arana P (1998) Chromosomal strategies for

adaptation to univalency. Chromosome Res 6:515-532

Reeder RH (1985) Mechanisms of nucleolar dominance in animals and plants. The

Journal of cell biology 101:2013-2016

Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and

vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327

Reed KM, Beukeboom LW, Eickbush DG, Werren JH (1994) Junctions between

repetitive DNAs on the PSR chromosome of Nasonia vitripennis: association of

palindromes with recombination. Journal of molecular evolution 38:352-362

Ritossa FM (1968) Unstable redundancy of genes for ribosomal RNA. Proc Natl Acad

Sci USA 60:509-516

60

Rogers SO, Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy

number and in the intergenic spacer. Plant Molecular Biology 9:509-520

Roman H (1948) Directed fertilization in maize. Proc Natl Acad Sci USA 34:36.

Rooney AP, Ward TJ (2005) Evolution of a large ribosomal RNA multigene family in

filamentous fungi: Birth and death of a concerted evolution paradigm. Proc Natl

Acad Sci 102:5084-5089

Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is an Ag-

NOR protein; this property is determined by its amino-terminal domain

independently of its phosphorylation state. Exp Cell Res 203:259-269

Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins, markers of

proliferation related to ribosomal gene activity. Exp Cell Res 214:465-472

Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNA transcription

machinery is assembled during mitosis in active NORs and absent in inactive

NORs. J Cell Biol 133:235-246

Rubbi CP, Milner J (2003) Disruption of the nucleolus mediates stabilization of p53 in

response to DNA damage and other stresses. The EMBO journal 22:6068-6077

Ruggero D, Pandolfi PP (2003) Does the ribosome translate cancer? Nature Reviews

Cancer 3:179-192

Ruiz-Rejón M, Posse F, Oliver JL (1980) The B chromosome system of Scilla

autumnalis (Liliaceae): Effects at the isozyme level. Chromosoma 79: 341-348

Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,

Camacho JPM (2011) DNA amount of X and B chromosomes in the grasshoppers

Eyprepocnemis plorans and Locusta migratoria. Cytogenet genome Res

134:120-126

Rüschoff J, Plate KH, Contractor H, Kern S, Zimmermann R, Thomas C (1990)

Evaluation of nucleolus organizer regions (NORs) by automatic image analysis: a

contribution to standardization. The Journal of pathology 161:113-118

Sánchez-Gea J, Serrano J, Galián J (2000) Variability in rDNA loci in Iberian species of

the genus Zabrus (Coleoptera: Carabidae) detected by fluorescence in situ

hybridization. Genome 43:22-28

Santoro R, Li J, Grummt I (2002) The nucleolar remodeling complex NoRC mediates

heterochromatin formation and silencing of ribosomal gene transcription. Nature

genetics 32:393-396

Santos JL, Cerro AD, Fernández A, Díez M (1993) Meiotic behaviour of B

chromosomes in the grasshopper Omocestus burri: A case of drive in females.

Hereditas 118:139-143

Sapre AB, Deshpande DS (1987) Origin of B chromosomes in Coix L. through

spontaneous interspecific hybridization. Journal of Heredity 78:191-196

Schartl M, Wilde B, Schlupp I, Parzefall J (1995) Evolutionary origin of a

parthenoform, the Amazon molly Poecilia formosa, on the basis of a molecular

genealogy. Evolution 827-835

Schmid M, Ziegler CG, Steinlein C, Nanda I, Schartl M (2006) Cytogenetics of the

bleak (Alburnus alburnus), with special emphasis on the B chromosomes.

Chromosome Res 14:231-242

Smith GP (1973) Unequal crossover and the evolution of multigene families. Symposia

on Quantitative Biology, Vol. 38, pp:507-513

Schnare MN, Cook JR, Gray MW (1990) Fourteen internal transcribed spacers in the

circular ribosomal DNA of Euglena gracilis. Journal of molecular biology

215:85-91

61

Introducción general y Objetivos

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W,

Bolchacova E, Voigt K, Crous PW (2012) Nuclear ribosomal internal transcribed

spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad

Sci USA 109:6241-6246

Seifert KA (2009) Progress towards DNA barcoding of fungi. Mol Ecol Resour 9

(Suppl.1):83-89

Sharbel TF, Green DM, Houben A (1998) B-chromosome origin in the endemic New

Zealand frog Leiopelma hochstetteri through sex chromosome devolution.

Genome 41:14-22

Shaw MW, Hewitt GM (1985) The genetic control of meiotic drive acting on the B

chromosome of Myrmeleotettix maculatus (Orthoptera: Acrididae). Heredity

54:259-268

Shaw PJ, Jordan EG (1995) The nucleolus. Annu Rev Cell Dev Biol 11:93-121

Simon UK, Weiss M (2008) Intragenomic variation of fungal ribosomal genes is higher

than previously thought. Mol Biol Evol 25(11):2251-2254

Sirri V, Roussel P, Hernandez-Verdun D (2000) The AgNOR proteins: qualitative and

quantitative changes during the cell cycle. Micron 31:121-126

Sirri V, Urcuqui-Inchima S, Roussel P, Hernandez-Verdun D (2008) Nucleolus: the

fascinating nuclear body. Histochem Cell Biol 129:13-31

Skalicka K, Lim KY, Matyásek R, Koukalová B, Leitch AR, Kovarìk A (2003) Rapid

evolution of parental rDNA in a synthetic tobacco allotetraploid line. Am J Bot

90: 988-996

Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA

genes. Annu Rev Genet 55:801-830

Song HX, Gao SP, Jiang MY, Liu GL, Yu XF, Chen QB (2012) The evolution and

utility of ribosomal ITS sequences in Bambusinae and related species: divergence,

pseudogenes, and implications for phylogeny. J Genet 91:129-139

Stage DE, Eickbush TH (2007) Sequence variation within the rRNA gene loci of 12

Drosophila species. Genome Res 17(12):1888-1897

Staub RW (1987) Leaf striping correlated with the presence of B chromosomes in

maize. J Hered 78:71-74

Stephan W (1987) Quantitative variation and chromosomal location of satellite DNAs.

Genet Res 50:41-52

Stevens B (1985) The fine structure of the nucleolus during mitosis in the grasshopper

neuroblast cell. J Cell Biol 24:349-368

Stevens NM (1908) The chromosomes in Diabrotica vittata, Diabrotica soror and

Diabrotica punctata. A contribution to the literature on heterochromosomes and

sex determination. Journal of Experimental Zoology 5:453-470

Stewart FJ, Cavanaugh CM (2007) Intragenomic variation and evolution of the internal

transcribed spacer of the rRNA operon in bacteria. J Mol Evol 65(1):44-67

Stitou S, Zurita F, Díaz de la Guardia R, Jiménez R, Burgos M (2004) Transmission

analysis of B chromosomes in Rattus rattus from Northern Africa. Cytogenet

Genome Res 106: 344-346

Szostak JW, Wu R (1980) Unequal crossing over in the ribosomal DNA of

Saccharomyces cerevisiae. Nature 284:426-430

Talavera M, López-León MD, Cabrero J, Camacho JPM (1990) Male germ line

polysomy in the grasshopper Chorthippus binotatus: extra chromosomes are not

transmitted. Genome 33:384-388

62

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis

plorans. Chromosome Res 15:755-765

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR

expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118:291-301

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry

revealed by histone genes in the migratory locust. Chromosoma 119: 217–225

Thiry M, Lamaye F, Lafontaine DL (2011) The nucleolus: when 2 became 3. Nucleus

2:289-293

Trerè D, Migaldi M, Trentini GP (1995) Higher reproducibility of morphometric

analysis over the counting method for interphase AgNOR quantification.

Analytical cellular pathology: the journal of the European Society for Analytical

Cellular Pathology 8:57

Trifonov VA, Dementyeva PV, Larkin DM, O’Brien PC, Perelman PL, Yang F,

Ferguson-Smith MA, Graphodatsky AS (2013) Transcription of a protein-coding

gene on B chromosomes of the Siberian roe deer (Capreolus pygargus). BMC

biology 11:1-11

Tsang CK, Bertram PG, Ai W, Drenan R, Zheng XF (2003) Chromatin-mediated

regulation of nucleolar structure and RNA Pol I localization by TOR. EMBO J

22:6045-6056

Tucker S, Vitins A, Pikaard CS (2010) Nucleolar dominance and ribosomal RNA gene

silencing. Current Opinion in Cell Biology 22:351-356

Van Heerikhuizen H, Ykema A, Klootwijk J, Gaillardin C, Ballas C, Fournier P (1985)

Heterogeneity in the ribosomal RNA genes of the yeast Yarrowia lipolytica;

cloning and analysis of two size classes of repeats. Gene 39:213-222

van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity and repeat

sequences of the paternal sex ratio chromosome of the parasitoid wasp

Trichogramma kaykai. Chromosoma 114:410-419

Viseras E, Camacho JPM, Cano MI, Santos JL (1990) Relationship between mitotic

instability and accumulation of B chromosomes in males and females of Locusta

migratoria. Genome 33:23-29

Volkov RA, Komarova NY, Hemleben V (2007) Ribosomal DNA in plant hybrids:

inheritance, rearrangement, expression. Systematics and Biodiversity 5:261-276

Volobuev VT, Timina Ni (1980) Unusually high number of B-chromosomes and

mosaicism among them in the Asiatic forest mouse Apodemus peninsulae

(Rodentia, Muridae)]. Tsitol Genet 14(3):43-45

Vossbrinck CR, Woese CR (1986) Eukaryotic ribosomes that lack a 5.8S RNA. Nature

320:287-288

Vydryakova GA, Van DT, Shoukouhi P, Psurtseva NV, Bissett J (2012) Intergenomic

and intragenomic ITS sequence heterogeneity in Neonothopanus nambi

(Agaricales) from Vietnam. Mycology 3:89-99

Werren JH (1991) The paternal sex ratio chromosome of Nasonia. Am Nat 137:392-402

White MJD (1973) Animal Cytology and Evolution. 3rd ed. London: Cambridge

University Press.

Wilson EB (1907) The supernumerary chromosomes of Hemiptera. Science 26: 870-

871

Wolf KW, Mertl HG, Traut W (1991) Structure, mitotic and meiotic behaviour, and

stability of centromere-like elements devoid of chromosome arms in the fly

Megaselia scalaris (Phoridae). Chromosoma 101:99-108

63

Introducción general y Objetivos

Wörheide G, Nichols SA, Goldberg J (2004) Intragenomic variation of the

rDNA internal transcribed spacers in sponges (Phylum Porifera): implications for

phylogenetic studies. Mol Phylogenet Evol 33(3):816-830

Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M (2003) The

giant B chromosome of the cyprinid fish Alburnus alburnus harbours a

retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23-35

Zimmer EA, Martin SL, Beverley SM, Kan YW, Wilson, AC (1980) Rapid duplication

and loss of genes coding for the alpha chains of hemoglobin. Proc Natl Acad Sci

USA 77: 2158-2162

Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism

regeneration for a neutralized selfish B chromosome. Evolution 52:274-277

64

Objetivos

- Objetivos generales:

1. Esta tesis doctoral tiene como objetivo general averiguar si la secuencia del ADN

ribosómico que albergan los cromosomas B del saltamontes Eyprepocnemis plorans

permite diferenciarlo del localizado en los cromosomas A y, en ese caso, averiguar si el

ARNr del B es funcional, en qué grado y en qué partes del cuerpo se expresa, así como

el significado biológico de los transcritos que aportan los cromosomas B. Para ello, nos

hemos propuesto analizar los siguientes objetivos específicos:

- Objetivos específicos:

2. Desarrollar un método molecular para detectar molecularmente los transcritos

procedentes del ADNr de los cromosomas B, diseñando para ello cebadores y

programas de PCR específicos. Para probar el método, analizaremos citogenética y

molecularmente la expresión del ADNr del cromosoma B24 en machos y hembras de la

población de Torrox (Málaga).

3. Caracterizar mediante doble FISH, con sondas de ADNr y ADNsat, los tipos de Bs

existentes en poblaciones de la región mediterránea occidental, con el fin de seleccionar

un grupo de poblaciones con diferentes tipos de cromosomas B (ver objetivo siguiente).

4. Averiguar si otros tipos de cromosomas B, además de B24, expresan su ADNr y con qué

frecuencia. Para ello, analizaremos una serie de poblaciones españolas portadoras de

otras variantes tales como B1, B2 y B5. Bajo la hipótesis de que los Bs son de origen

reciente en esta especie, cabría esperar que todas las variantes mantuviesen la capacidad

de expresar su ADNr. Analizaremos, por tanto, si éste está activo en las otras variantes y

en qué grado se expresa.

5. Averiguar si los cromosomas B están presentes en todas las partes del cuerpo de unmismo individuo. Para ello, utilizaremos el método molecular desarrollado en el objetivo1, y también un marcador molecular específico del B, desarrollado anteriormente.

6. Para averiguar si los cromosomas B de E. plorans son mitóticamente estables, es decir, sise encuentran en el mismo número en todos los tejidos de un mismo individuo,intentaremos cuantificar el número de copias del ADNr específico del cromosoma B endiferentes machos de dos poblaciones diferentes, así como en diferentes partes del cuerpode varios individuos. Para ello, utilizaremos el método molecular anteriormente descritopero, en este caso, cambiando el cebador forward para que el fragmento amplificado seade menor tamaño y se ajuste así a los requerimientos técnicos de la PCR cuantitativa(qPCR).

65

Introducción general y Objetivos

7. Averiguar si el ADNr de los cromosomas B se expresa en grados similares en diferentespartes del cuerpo de los mismos individuos donde previamente hemos visualizadocitológicamente la formación de nucleolos por parte de los cromosomas B.

8. Para intentar averiguar las razones por las que el ADNr de los cromosomas B estánormalmente inactivo, intentaremos disminuir el nivel de expresión de HP1(Heterochromatin Protein 1), mediante la técnica del ARNi (ARN de interferencia), yanalizaremos su incidencia sobre la cantidad de transcritos específicos del ADNr de loscromosomas B, así como sobre la cantidad de ARNm para otras proteínas, y cualesquieraefectos que puedan aparecer a los niveles citogenético y fenotípico.

9. Determinar si los cromosomas B contienen variantes específicas de la región ITS2 del

ADNr, y comparar su grado de expresión con otras variantes del genoma. Para ello,

realizaremos varios experimentos de secuenciación masiva (mediante pirosecuenciación

454 de Roche) de los amplicones previamente obtenidos mediante PCR con cebadores

anclados en las regiones codificadoras adyacentes.

66

Capítulo 2. B-Chromosome ribosomal DNA

is functional in the grasshopper

Eyprepocnemis plorans

67

68

B-Chromosome Ribosomal DNA Is Functional in theGrasshopper Eyprepocnemis ploransMercedes Ruiz-Estevez, Ma Dolores Lopez-Leon, Josefa Cabrero, Juan Pedro M. Camacho*

Departamento de Genetica, Universidad de Granada, Granada, Spain

Abstract

B-chromosomes are frequently argued to be genetically inert elements, but activity for some particular genes has beenreported, especially for ribosomal RNA (rRNA) genes whose expression can easily be detected at the cytological level by thevisualization of their phenotypic expression, i.e., the nucleolus. The B24 chromosome in the grasshopper Eyprepocnemisplorans frequently shows a nucleolus attached to it during meiotic prophase I. Here we show the presence of rRNAtranscripts that unequivocally came from the B24 chromosome. To detect these transcripts, we designed primers specificallyanchoring at the ITS-2 region, so that the reverse primer was complementary to the B chromosome DNA sequenceincluding a differential adenine insertion being absent in the ITS2 of A chromosomes. PCR analysis carried out on genomicDNA showed amplification in B-carrying males but not in B-lacking ones. PCR analyses performed on complementary DNAshowed amplification in about half of B-carrying males. Joint cytological and molecular analysis performed on 34 B-carryingmales showed a close correspondence between the presence of B-specific transcripts and of nucleoli attached to the Bchromosome. In addition, the molecular analysis revealed activity of the B chromosome rDNA in 10 out of the 13 B-carryingfemales analysed. Our results suggest that the nucleoli attached to B chromosomes are actively formed by expression of therDNA carried by them, and not by recruitment of nucleolar materials formed in A chromosome nucleolar organizing regions.Therefore, B-chromosome rDNA in E. plorans is functional since it is actively transcribed to form the nucleolus attached tothe B chromosome. This demonstrates that some heterochromatic B chromosomes can harbour functional genes.

Citation: Ruiz-Estevez M, Lopez-Leon MD, Cabrero J, Camacho JPM (2012) B-Chromosome Ribosomal DNA Is Functional in the Grasshopper Eyprepocnemisplorans. PLoS ONE 7(5): e36600. doi:10.1371/journal.pone.0036600

Editor: Brian P. Chadwick, Florida State University, United States of America

Received March 2, 2012; Accepted April 9, 2012; Published May 3, 2012

Copyright: � 2012 Ruiz-Estevez et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was supported by a grant from the Spanish Ministerio de Ciencia e Innovacion (CGL2009-11917), and was partially performed by FEDERfunds. M. Ruiz-Estevez was supported by a fellowship (FPU) from the Spanish Ministerio de Ciencia e Innovacion. The funders had no role in study design, datacollection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: jpmcamac@ugr.es

Introduction

B chromosomes constitute a bizarre part of the genomes in

about 15% of eukaryote species, being dispensable and frequently

harmful for carrier individuals, despite they sometimes reach high

population frequencies thanks to conspicuous mechanisms for

advantageous transmission (drive). The DNA contained into B

chromosomes is a broad panoply of repetitive sequences, including

satellite and microsatellite DNA, ribosomal DNA (rDNA) and

mobile elements [1]. Recently, the presence of H3 and H4 histone

genes has been shown in the B chromosomes of Locusta migratoria

[2].

The kind of repetitive DNA most frequently found in B

chromosomes is 45S rDNA [1,3,4]. It is located at chromosome

sites named nucleolus organizer regions (NORs) consisting of

tandemly repeated units composed of 18S, 5.8S and 28S rDNA,

separated by two internal transcribed spacers (ITS1 and ITS2)

and flanked by external transcribed spacers (ETS) and non-

transcribed spacers (NTS) [5]. A cytologically visible phenotype

for these genes is the nucleolus, a nuclear membrane-free

compartment where ribosome components are synthesized [6].

It may easily be revealed in both interphase and meiotic cells

by silver impregnation [7]. This technique specifically reveals

the transcriptional machinery of RNA polimerase I, including

the B23, nucleolin, UBF and ARN Pol I subunits proteins [8–10].

The size of the nucleolus is proportional to its biosynthetic activity

[11–17].

B chromosomes were considered genetically inert for long, since

experiments with tritiated uridine revealed its scarce incorporation

into B chromosomes in the grasshoppers Myrmeleotettix maculatus

and Chorthippus parallelus [18] and the mouse Apodemus peninsulae

[19]. In maize, B chromosomes are basically inert [20]. However,

indirect evidence for transcription from B chromosomes was

obtained in the toad Leiopelma hochstetteri [21] and the mosquito

Simulium juxtacrenobium [22]. Recently, evidence for a functional

role of B chromosomes on female sex determination has been

shown in cichlid fishes [23].

Some B chromosomes have been shown to carry a NOR being

able to organize nucleoli. For instance, in the grasshopper

Dichroplus pratensis, a B chromosome was frequently associated to

a nucleolus during meiosis [24], and it was later shown, by

fluorescent in situ hybridization (FISH), that it carries rDNA [25].

In many cases, however, the rDNA located on the B chromosomes

is inactive, as found, for instance, in the black rat Rattus rattus [26]

and the fish species Metynnis maculatus [27] and Haplochromis

obliquidens [28]. Especially puzzling is the case of the plant

Brachychome dichromosomatica, where large B chromosomes carrying

rRNA genes are often associated with a nucleolus at mitotic

prophase cells in root tips and in meiosis of pollen mother cells

[29], but these genes do not silver stain and no transcripts were

PLoS ONE | www.plosone.org 1 May 2012 | Volume 7 | Issue 5 | e3660069

detected coming from them in leaves [30]. On the other hand, the

rare nucleolar association of micro B chromosomes suggests

inactivity of its 45S rDNA [31].

The first molecular evidence for gene activity on B chromo-

somes was found in the plant Crepis capillaris [32], specifically for

rDNA. In the parasitic wasp Trichogramma kaykai, NOR activity of

B chromosomes and presence of rRNA transcripts coming from

the Bs has also been reported [33]. In rye, it has recently been

shown the transcription of B-specific DNA sequences belonging to

high-copy number families with similarity to mobile elements [34].

In the grasshopper Eyprepocnemis plorans, FISH has shown that

most A chromosomes carry rDNA, although the highest amount is

actually found in the B chromosomes [35]. However, in most

cases, NOR activity is only observed in the three smallest

autosomes (9, 10 and 11) and the X chromosome, but not in the

B. Cabrero et al. [36] reported the presence of nucleoli associated

to a B chromosome that had fused to the longest autosome, in

strong contrast to non-fused Bs where such NOR activity had

never been found. It was later shown that rDNA is one of the

principal components of B chromosomes in this species [35], and

we have recently found a natural population where the rDNA in

the B24 chromosome is recurrently active, as deduced from the

presence of nucleoli attached to B chromosomes [37,38]. It was

unknown, however, whether those B-attached nucleoli are formed

in situ by expression of the B chromosome rDNA, or else by

recruitment of nucleolar material coming from other nucleolar

organizer regions (NORs), and therefore without expression of the

B rDNA. The main objective of the present research was to test for

these two alternatives by trying to detect rRNA transcripts that

undoubtedly had come from the B chromosome rDNA. For this

purpose, we used previous information provided by Teruel [39],

who determined the DNA sequence of the ITS1 and ITS2 of

rDNA coming from microdissected B24 chromosomes in E. plorans.

A comparison with the corresponding DNA sequence in the A

chromosomes, obtained from 0B individuals, revealed that most B-

derived ITS2 sequences carried an inserted adenine which was

absent in all A-derived sequences [39]. This difference could thus

be used for identifying the rRNA transcripts coming from the B

chromosome. We then developed a PCR-based molecular method

to detect the B-rRNA transcripts in B-carrying males and, as a

cytological control, analysed the presence of nucleoli attached to B

chromosomes at diplotene. This molecular approach also

demonstrated to be useful to find B-rRNA transcripts in females.

Results

Cytological analysisTable 1 shows the number of B chromosomes observed in the

67 individuals analysed. Silver impregnation of diplotene cells

revealed the presence of nucleoli attached to B chromosomes in 14

out of the 29 B-carrying males collected in 2008 (Figure 1), but not

in the 15 remaining males (Table 2). Therefore, 48.3% of B-

carrying males showed NOR activity in the B chromosomes. This

figure did not differ from that reported by Teruel et al. [38] in a

sample from this same population collected in 2004, where 53% of

36 B-carrying males showed B-NOR activity (contingency

x2 = 0.02, df = 1, P = 0.89). This shows that the frequency of B-

carrying males showing NOR activity in the B chromosomes has

not significantly changed in these four years. As Table 2 shows, the

likelihood of showing NOR activity in a B chromosome increased

with B number, at least from 1–3 Bs, the exception being a single

4B male failing to show active Bs.

In the 14 males showing B-NOR activity, a rather regular

proportion of diplotene cells showed B-attached nucleoli: 23.3% in

1B, 23.7% in 2B and 26.9% in 3B males (Table 3), suggesting that

it does not depend on the number of B chromosomes. The

cytological analysis of the five B-carrying males collected in 2003

and 2004 showed nucleoli attached to Bs in all of them, since they

had been selected from a larger sample previously analysed [39].

The average frequency of diplotene cells showing B-attached

nucleoli in males showing B-NOR expression in the 2008 sample

(24.7% of 284 cells analysed in 14 males), did not differ from the

values previously observed in this same population (23.2% of 69

cells in 1999, 23.3% of 240 cells in 2003 and 19.5% of 380 cells in

2004) [37,38] (contingency x2 = 2.84, df = 3, P = 0.42).

Molecular analysisIn each individual, we performed PCR experiments with the

ITSA and ITSB primers on both genomic (gDNA) and

complementary (cDNA) DNA. The former served as a positive

control for the presence of the B-specific ITS2 with the inserted

adenine (ITS2_B), whereas the cDNA analysis tested the presence

of rRNA transcripts carrying the B-specific ITS2.

The PCR experiments on gDNA showed amplification in all B-

carrying males and females but not in any of the B-lacking ones

(Figure 2). Therefore, this PCR reaction shows the appropriate

specificity to reveal B chromosome (and ITS2_B) presence.

Figure 1. Nucleolus formation by B chromosomes. Silver staineddiplotene cell showing nucleoli (nu) attached to a B bivalent (BB), the Xchromosome and autosomal bivalent no. 9. Bar = 10 m.doi:10.1371/journal.pone.0036600.g001

Table 1. Number of B chromosomes in the 67 individualscollected in the Torrox (Malaga, Spain) population of thegrasshopper Eyprepocnemis plorans.

Number of Bs == 2003 == 2004 RR 2007 == 2008 Total

0 - - 10 10 20

1 - 1 2 19 21

2 1 - 11 5 18

3 1 2 - 4 7

4 - - - 1 1

Total 2 3 23 39 67

doi:10.1371/journal.pone.0036600.t001

A Functional B Chromosome

PLoS ONE | www.plosone.org 2 May 2012 | Volume 7 | Issue 5 | e3660070

Cloning and sequencing of the obtained band revealed that it

corresponded to the expected ITS2_B region (Figure S1).

The PCR analysis on cDNA with the ITSA and ITSB primers

in B-lacking individuals, as a negative control, revealed no

amplification in both males and females (Figure 2), as expected

from the results of the PCR experiments on gDNA. However, the

molecular analysis of all B-carrying individuals (34 males and 13

females), showed that the ITS2_B transcript was present in the

cDNA of 20 of these males (9 with 1B, 4 with 2B and 7 with 3B)

but not in 14 of them (11 with 1B, 2 with 2B and 1 with 4B).

Likewise, 10 B-carrying females (2 with 1B and 8 with 2B) showed

the presence of the 484 bp ITS2_B transcript, whereas 3 females

with 2B failed to show it. The frequency of B-carrying individuals

showing ITS2_B transcripts was thus 58.8% in males and 76.9%

in females.

The joint cytological and molecular analysis performed in 34 B-

carrying males (also including five males collected in 2003 and

2004) revealed that 18 out of the 20 males showing ITS2_B

transcripts also showed nucleoli attached to B chromosomes in

diplotene cells, whereas the two remaining males (no. 43 and 72,

both with 1B) failed to show evidence of B-rDNA expression at the

cytological level. On the other hand, one male (no. 74) failed to

show the presence of the ITS2_B transcript but showed nucleoli

attached to Bs in two out of the 20 cells analysed (see Table 3).

Finally, 13 males showed absence of B-rDNA expression at both

cytological and molecular levels (Table 4). A contingency chi-

square test performed to this 262 table showed a very strong

association between the presence of nucleoli attached to the B

chromosomes and the presence of the ITS2_B transcript

(x21 = 19.69, P,0.0001, with Yates’ correction).

Discussion

A number of evidences have shown that B chromosomes in the

grasshopper Eyprepocnemis plorans are sometimes attached to a

nucleolus, suggesting the possibility of expression of their rDNA.

In addition to previous evidences of NOR activity on B

chromosomes [36–39], our present cytological analysis, by means

of silver impregnation, in the 29 B-carrying males collected in this

same population, in 2008, has shown that the frequency of males

showing NOR activity in B chromosomes has not changed from

2004 to 2008, being close to 50%. In addition, the average

proportion of diplotene cells showing B-NOR activity seemed to

be rather stable (about 20%) from 1999 to 2008. This suggests that

the phenotypic expression of the ‘‘active B-NOR’’ trait shows high

temporal stability in this population. In contrast, expresivity of this

trait is highly variable among individuals, i.e. 5–50% (see Table 3).

Table 2. Frequency of B-carrying males from the 2008 sampleshowing NOR activity in the B chromosomes, as deduced fromthe presence of nucleoli attached to B chromosomes indiplotene cells.

Number of BsMales withinactive Bs

Males withactive Bs Total

% Males withactive Bs

1 13 6 19 31.6

2 1 4 5 80

3 0 4 4 100

4 1 0 1 0

Total 15 14 29 48.3

doi:10.1371/journal.pone.0036600.t002

Table 3. Proportion of diplotene cells showing nucleoli attached to B chromosomes in 14 B-carrying males collected in Torrox in2008 and therefore showing NOR activity in the B chromosome.

No. of cells showing % B-NOR activity

Number of Bs Male no. B-NOR inactivity B-NOR activity Total

1 54 10 10 20 50.0

49 14 6 20 30.0

58 16 4 20 20.0

67 15 5 20 25.0

52 19 1 20 5.0

45 18 2 20 10.0

Total: 92 28 120 23.3

2 74 18 2 20 10.0

61 14 6 20 30.0

63 15 5 20 25.0

55 12 8 20 40.0

Total: 59 21 80 23.7

3 62 15 9 24 37.5

50 13 7 20 35.0

42 17 3 20 15.0

71 16 4 20 20.0

Total: 61 23 84 26.9

Total 212 72 284 24.7

doi:10.1371/journal.pone.0036600.t003

A Functional B Chromosome

PLoS ONE | www.plosone.org 3 May 2012 | Volume 7 | Issue 5 | e3660071

Although nucleoli are usually formed by expression of the

rDNA contained in the NOR to which they are attached [6], in

the case of non-standard genomic elements like parasitic B

chromosomes, the possibility exists that B chromosomes could

recruit nucleolar materials from other NORs without the need to

expressing their own rDNA. Our present results show that it is

possible to detect the presence of rRNA transcripts unequivocally

derived from the B chromosome in males showing nucleoli

attached to the B chromosome at diplotene cells. We designed

primers which specifically amplified a 484 bp region of the ITS2

rDNA in the B chromosome, on the basis of an adenine insertion

being exclusive of the B24 chromosome rDNA [39]. PCR

amplification with these primers was negative on gDNA in all

20 B-lacking individuals (10 males and 10 females) analysed.

However, it was positive on gDNA from all B-carrying individuals

analysed (34 males and 13 females), thus showing the high

specificity of this reaction for the B chromosome rDNA. When the

same assay was performed on cDNA, no amplification was

observed in 0B individuals. In B-carrying individuals, however, the

484 bp fragment was obtained in some individuals, suggesting that

the B chromosome rDNA is facultatively active.

In males, we observed a very high correspondence between the

molecular and cytological analyses, i.e. the presence of the ITS2_B

transcripts, deduced from the PCR amplification of the 484 bp

fragment, and the existence of NOR activity in the B

chromosomes, deduced from the presence of nucleoli attached to

them. Presence of both evidences for B activity was observed in 18

males, and their absence in 13 males (see Table 4). The exceptions

were males no. 43, 72 and 74. In the two former, there were

ITS2_B transcripts but no nucleoli were found attached to the B

chromosomes at diplotene, whereas the reverse situation was

found in male no. 74, i.e. PCR experiments failed to show the

presence of the ITS2_B transcripts but two diplotene cells, out of

the 20 analysed, showed nucleoli attached to B chromosomes. This

indicates that both ways for ascertaining B-NOR activity (i.e.

cytological and molecular) may fail when the expression level is

low. The situation observed in males 43 and 72 could be explained

by early disorganization of nucleoli at diplotene, the existence of a

threshold for silver impregnation preventing nucleolus visualiza-

tion when B-NOR expression is low, or else B activity in an organ

other than testes, since molecular analyses where performed in the

whole body excepting testes. The possibility of differences in B-

NOR expression among tissues of a same individual merits future

research. The absence of PCR amplification in male 74 might be

due to a very low number of ITS2_B transcripts which hampered

the final success of transcript detection. Alternatively, the

possibility exists that the nucleoli attached to the B chromosomes

and the molecular expression of the B rDNA do follow different

temporal schedules, since the nucleoli attached to Bs that were

observed at pachytene-diplotene were formed during leptotene-

zygotene, implying that the B-transcripts might have been

produced several days before nucleolus observation, so that it is

conceivable that a same male may, at a given time, show nucleoli

attached to their B chromosomes at pachytene but not ITS2_B

transcripts since its production had finished several days before.

In females, this correspondence cannot be tested since it is not

possible to analyse B-NOR expression cytologically. But the close

correspondence between cytological and molecular results,

observed in males, allow inferring B-NOR expression in females

through the PCR assay only. This showed the presence of the

484 bp fragment in 10 out of the 13 B-carrying females, suggesting

that the rRNA genes in the B24 chromosome are active in most

females, whereas it is active in only about half of males.

The active or inactive status of the rDNA in the B chromosome

may depend on epigenetic modifications such as DNA methylation

and/or histone methylation or acetylation. In E. plorans, the NOR

activity observed by Cabrero et al. [36] in the B2 chromosome

fused to the longest autosome was later shown to be related with

undermethylation of the rDNA [40]. In addition, it has been

shown that B chromosomes in this species are hypoacetylated for

lysine 9 in the H3 histone [41].

The role of B-derived rRNA transcripts and the mechanism of

transcription of the B repeats remain to be elucidated. A possibility

is that these transcripts might have structural functions in the

organization and regulation of the Bs themselves [42,43]. But, in

E. plorans, B chromosomes in the Torrox population might also

contribute to the total rRNA demanded by the cell, since the

activity of the B-NOR is associated with a decrease in the activity

of the NORs in the A chromosomes, so that total cell nucleolar

area does not change [37,38]. Unless the rDNA located in the B

chromosome would have preserved functionality, an increase in B-

derived rRNA transcripts could lead to an increasing proportion of

abnormal rRNA copies that could be detrimental for the fitness of

B-carrying individuals. This possibility, however, needs further

research to determine the relative amount of the B-rRNA

Figure 2. Amplification of the ITS2_B region with the ITSA andITSB primers on genomic (gDNA) and complementary (cDNA)DNA from representative males with 0–3 B chromosomes(upper panel) and females with 0–2 B chromosomes (lowerpanel). Note the presence of PCR product on gDNA of B-carryingindividuals but absence in the case of B-lacking ones. Also note thepresence of PCR product on cDNA of only some B-carrying individuals.Ø = Negative control (with no DNA). C+ = Positive control (gDNA from1B male).doi:10.1371/journal.pone.0036600.g002

Table 4. Joint cytological and molecular analysis of Bchromosome NOR expression in 34 males of the grasshopperE. plorans.

Nucleolus attached to the Bchromosome

Molecular detection of theITS2_B transcript + 2

+ 18 2

2 1 13

doi:10.1371/journal.pone.0036600.t004

A Functional B Chromosome

PLoS ONE | www.plosone.org 4 May 2012 | Volume 7 | Issue 5 | e3660072

transcripts (in respect to those derived from the A chromosomes)

and whether the B-rRNA transcripts are completely functional.

Given that total cell nucleolar area in B-carrying males does not

change despite B chromosome contribution to nucleolus forma-

tion, Teruel et al. suggested that cell regulation of rRNA demands

should lead to a decrease in the nucleolar area contributed by the

A chromosomes [37,38]. Therefore, the presence of rDNA in the

B chromosome of E. plorans seems to have implications for the

regulation of rDNA expression and its relationship with the

genomic amount of this kind of repetitive DNA. Ide et al. have

recently suggested that the presence of many copies of rDNA,

many of which are transcriptionally inactive, makes genomes less

sensitive to DNA damage, because the extra copies facilitate

recombinational repair [44]. As shown by these authors, the lower

DNA sensivity in yeast strains with high copy number depends on

a lower ratio of transcribed rRNA genes than that in strains with

low copy number whose rRNA genes are up-regulated. On this

basis, the fact that B-NOR activity in E. plorans does not change

total cell nucleolar area [37,38] might be the result of a rigid A

genome control on rDNA expression, perhaps because excessive

activity would decrease individual fitness through a lower

protection against DNA-damaging agents. Similar reasons would

explain why the grasshopper Stauroderus scalaris carries large

amounts of rDNA in all chromosomes but only those in

chromosome 3 are active [45].

The case of nucleolar expression in the B chromosomes of E.

plorans resembles nucleolar dominance, a phenomenon usually

observed in interspecific hybrids, by which the rDNA clusters from

one of the parental species are active whereas those from the other

parental species are inactive [46]. Nucleolar dominance seems to

be reversible since, in some individuals, the silenced rDNA can be

reactivated under certain conditions, e.g. in developmental stages

demanding more ribosomal synthesis [47]. In E. plorans, the rDNA

located in the B2 chromosome is usually silenced [48] whereas that

in the three smallest autosomes and the X chromosome is active in

a variable proportion of diplotene cells in all males [49]. The B24

chromosome arose from B2 and replaced it in the Torrox

population during the 1980’s [50], from where it is currently

expanding towards the west [51] and the east [52]. In the last

years, for unknown reasons, the rDNA in the B24 chromosome has

been derepressed since, in 1999, it showed NOR activity in 31% of

males [37], and this figure increased to about 40% in 2003–2004

[38] and 48.3% in 2008 (this paper, Table 2). Therefore, it seems

that the ‘‘active B-NOR’’ phenotype is increasing in frequency in

this population. Remarkably, however, the proportion of diplotene

cells showing the phenotype in B-carrying males was about the

same in 1B, 2B and 3B males, thus showing no odd-even pattern

for this trait, in contrast to many B chromosome effects (see [53]).

The B24 chromosome thus constitutes excellent material to

analyse the regulation of rDNA expression at intragenomic level,

and the PCR assay described here could contribute significantly to

this task because it permits to analyse B-rDNA expression in every

cell type, tissue and organ at every developmental stage where

RNA can be isolated. Likewise, it permits to test for B-rDNA

expression in other populations harbouring other B variants,

which is crucial for understanding the biological role of these B

chromosomes. B24 showed significant drive in 1992, i.e. when it

was finishing the replacement of B2 in Torrox [50], but a few years

later it had lost drive [54]. The recurrent expression of its rDNA

could thus be a new pathway for B24 evolution in this species, since

it is contributing to an important host function, i.e. rRNA

production. It also suggests that B chromosomes are not as

genetically inert as was previously thought, and they may even

contain some protein-coding genes whose expression can interfere

with important ontogenetic processes such as, for instance, sex

determination [23].

Materials and Methods

Experimental materialA total of 67 males and females of the grasshopper Eyprepocnemis

plorans were collected in Torrox (Malaga, Spain) in 2003, 2004,

2007 and 2008 (Table 1). For cytological analysis, males and

females were anaesthetized before dissecting out testes and

ovarioles, respectively, which were then fixed in freshly prepared

3 1 ethanol-acetic acid and stored at 4uC. Ovarioles were

immersed in 5% colchicine in insect saline solution for 3 hours

prior to fixation. For molecular analysis, body remains were frozen

in liquid nitrogen and stored at 280uC prior to DNA and RNA

isolation.

Cytological analysis of B-NOR expressionThe number of B chromosomes in each individual was

determined in 2% lactopropionic orcein squash preparations.

Cytological evidence for the activity of the B chromosome NOR

was obtained from the presence of nucleoli attached to B

chromosomes in diplotene cells. For this purpose, testis prepara-

tions were submitted to the silver impregnation technique [7]

following the procedure described in [55]. These preparations

were additionally stained with 1% Giemsa to differentiate the

chromatin (blue) from the nucleoli (yellow to deep brown)

(Figure 1). At least twenty diplotene cells per male were analysed.

Cells were photographed with an Olympus digital camera (DP70).

Molecular analysis of B-NOR expressionA total of 44 males (10 with 0B, 20 with 1B, 6 with 2B, 7 with

3B and 1 with 4B) and 23 females (10 with 0B, 2 with 1B and 11

with 2B) were analyzed at the molecular level. Each individual

body was divided into two hemibodies, each of which was used for

genomic DNA and total RNA isolation. Genomic DNA extraction

was performed using GenElute Mammalian Genomic DNA

Miniprep (Sigma), following manufacturer’s recommendations.

Total RNA was extracted with Real Total RNA spin plus

(Real), following manufacturer’s recommendations, except in-

creasing DNase I treatment up to 20 units to ensure complete

removal of any possible contaminating genomic DNA. After a

second cleaning with DNase I, we assessed the quality of the

isolated RNA by electroforesis in a MOPS (3-N-morpholinopro-

panesulfonic acid) denaturing agarose gel, based on the presence

of the 28S and 18S ribosomal RNA bands and the absence of low

molecular weight fragments.

For PCR experiments on genomic (gDNA) and complementary

(cDNA) DNA, a primer pair (ITSA and ITSB) was designed on the

basis of the ITS2 sequences reported by M. Teruel (accession

numbers: JN811827–JN811836 for 0B individuals, and

JN811886–JN811902 for microdissected B chromosomes), who

showed that an adenine insertion was present only in rDNA

obtained from microdissected B chromosomes but was absent in

rDNA sequences from 0B individuals [39]. We thus anchored the

reverse (ITSB) primer in the ITS2 region including this adenine.

PCR reaction with the ‘‘forward ITSA (59 TGGAGCCGTAC-

GACGAAGTG 39)’’ and ‘‘reverse ITSB (59CGTTGTACGAAA-

GAGTTTGAG 39)’’ primers was adjusted to yield a 484 bp DNA

fragment from the desired ITS2 region, only in presence of the

inserted adenine in the template (complementary to the underlined

T in the ITSB primer). PCR mixture consisted of 200 mM dNTPs,

10 mM each primer, 20 ng genomic DNA and one unit of Taq

polymerase (New England, BioLabs) with 16 buffer in a final

A Functional B Chromosome

PLoS ONE | www.plosone.org 5 May 2012 | Volume 7 | Issue 5 | e3660073

volume of 25 ml. PCR conditions were the following: an initial

denaturation at 94uC for 5 min and 30 cycles of 94uC for 30 s,

62,5uC for 40 s, 72uC for 45 s and final extension of 72uC for

7 min. PCR products were visualized in an electrophoresis 1.5%

agarose gel and the amplified fragment was cloned into TOPO

TA vector (Invitrogen) and subsequently sequenced in both

directions (Macrogen). Searching for sequence homology in

databases was performed using BLAST (Basic Local Alignment

Search tool) at NCBI site. Alignments were performed with

Bioedit software (version 7.0.9.0).

Complementary DNA (cDNA) was synthesized from total RNA

with SuperScript III First-Strand Synthesis SuperMix (Invitrogen),

following manufacturer’s protocol, and it was used as template for

PCR experiments with the ITSA and ITSB primers. PCR

reactions on cDNA contained 2000 mM dNTPs, 10 mM of each

primer, 1U Taq polymerase (New England, BioLabs) and 30 ng

cDNA. PCR conditions were as follows: initial denaturation at

94uC for 5 min, 30 cycles of 94uC for 30 s, 62,5uC (males) and

62,7uC (females) for 40 s, 72uC for 45 s and a final extension of

72uC for 7 min. Analysis of PCR products, cloning of amplified

fragments, DNA sequencing and homology search in the

databases were performed as for genomic DNA (see above).

Supporting Information

Figure S1 Nucleotide sequence of the DNA amplified with the

ITS2A and ITS2B primers.

(DOC)

Acknowledgments

We thank Marıa Teruel for providing some materials.

Author Contributions

Conceived and designed the experiments: MRE MDLL JC JPMC.

Performed the experiments: MRE JC MDLL. Analyzed the data: MRE

MDLL JC JPMC. Contributed reagents/materials/analysis tools: MDLL

JC. Wrote the paper: MRE MDLL JC JPMC.

References

1. Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of

the genome. New York: Academic Press. pp 223–286.

2. Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry

revealed by histone genes in the migratory locust. Chromosoma 119: 217–225.

3. Green DM (1990) Muller’s Ratchet and the evolution of supernumerary

chromosomes. Genome 33: 818–824.

4. Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol

131: 411–434.

5. Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem

49: 727–764.

6. Carmo-Fonseca M, Mendes-Soares L, Campos I (2000) To be or not to be in the

nucleolus. Nat Cell Biol 2: E107–E112.

7. Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining

procedure for the localization of nucleolus and nucleolar organizer under lightand electron microscopy. Arch Biol 93: 267–274.

8. Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is anAg-NOR protein; this property is determined by its amino-terminal domain

independently of its phosphorylation state. Exp Cell Res 203: 259–269.

9. Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins,

markers of proliferation related to ribosomal gene activity. Exp Cell Res 214:465–472.

10. Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNAtranscription machinery is assembled during mitosis in active NORs and absent

in inactive NORs. J Cell Biol 133: 235–246.

11. Caspersson T (1950) Cell growth and cell function, a cytochemical study. New

York: WW Norton and Co, Inc.

12. Busch H, Daskal Y, Gyorkey F, Smetana K (1979) Silver staining of nucleolar

granules in tumor cells. Cancer Res 39: 857–863.

13. Okabe Y, Nakamura S, Okumura H, Matano S, Kobayashi K, et al. (1991) The

relation of argyrophilic proteins of nucleolar organizer regions (AgNORs) to the

proportions of Ki-67 or DNA polymerase a9-reacting cells in non-Hodgkin’slymphomas. Anticancer Res 11: 2031–2035.

14. Thiele J, Fischer R (1993) Bone marrow tissue and proliferation markers: resultsand general problems. Virchows Arch A 423: 409–416.

15. Busch H (1997) Nucleolar and nucleolonemal proteins of cancer cells. J Tumor

Marker Oncol 12: 5–68.

16. Nakamoto K, Ito A, Watabe K, Koma Y, Asada H, et al. (2001) Increased

expression of a nucleolar Nop5/Sik family member in metastatic melanoma

cells: evidence for its role in nucleolar sizing and function. Am J Pathol 159:1363–1374.

17. Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In Olson MOJ, ed.The Nucleolus. New York: Kluwer. pp 10–20.

18. Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA transcription ofeuchromatic and heterocromatic chromosome regions during grasshopper

meiosis. Chromosoma 45: 43–62.

19. Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional

activity of the B-chromosome of Apodemus peninsulae during pachytene.Chromosoma 100: 278–281.

20. Carlson WR (1986) The B chromosome of maize. CRC Crit Rev Plant Sci 3:201–226.

21. Green DM (1988) Cytogenetics of the endemic New Zeland frog, Leiopelma

hochstetteri: extraordinary supernumerary chromosome variation and a unique

sex-chromosome system. Chromosoma 97: 55–70.

22. Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernumerary

chromosomes evolution in the Simulium vernum group (Diptera: Simulidae).Genome 32: 516–521.

23. Yoshida K, Terai Y, Mizoiri S, Aibara M, Nishihara H, et al. (2011) B

chromosomes have a functional effect on female sex determination in lake

Victoria cichlid fishes. PLoS Genet 7(8): e1002203. doi:10.1371/journal.p-

gen.1002203.

24. Bidau CJ (1986) A nucleolar-organizing B chromosome showing segregation-

distortion in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae).

Can J Genet Cytol 28: 138–148.

25. Bidau CJ, Rosato M, Martı DA (2004) FISH detection of ribosomal cistrons and

assortment-distortion for X and B chromosomes in Dichroplus pratensis

(Acrididae). Cytogenet Genome Res 106: 295–301.

26. Stitou S, Zurita F, Dıaz de la Guardia R, Jimenez R, Burgos M (2004)

Transmission analysis of B chromosomes in Rattus rattus from Northern Africa.

Cytogenet Genome Res 106: 344–346.

27. Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization

of Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae

of a small B chromosome bearing inactive NOR-like sequences. Caryologia 62:

95–101.

28. Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African

cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet

11: 1.

29. Donald TM, Leach CR, Clough A, Timmis JN (1995) Ribosomal RNA genes

and the B chromosome of Brachycome dichromosomatica. Heredity 74: 556–561.

30. Donald TM, Houben A, Leach CR, Timmis JN (1997) Ribosomal RNA genes

specific to the B chromosomes in Brachycome dichromosomatica are not transcribed

in leaf tissue. Genome 40: 674–681.

31. Marschner S, Meister A, Blattner FR, Houben A (2007) Evolution and function

of B chromosome 45S rDNA sequences in Brachycome dichromosomatica. Genome

50: 638–644.

32. Leach CR, Houben A, Bruce F, Pistrick K, Demidov D, et al. (2005) Molecular

evidence for transcription of genes on a B chromosome in Crepis capillaris.

Genetics 171: 269–278.

33. van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity

and repeat sequences of the paternal sex ratio chromosome of the parasitoid

wasp Trichogramma kaykai. Chromosoma 114: 410–419.

34. Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes

are weakly transcribed and might alter the transcriptional activity of A

chromosome sequences. Chromosoma 118: 607–616.

35. Lopez-Leon MD, Neves N, Schwarzacher T, Heslop-Harrison JS, Hewitt GM,

et al. (1994) Possible origin of a B chromosome deduced from its DNA

composition using double FISH technique. Chromosome Res 2: 87–92.

36. Cabrero J, Alche JD, Camacho JPM (1987) Effects of B chromosomes of the

grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.

Activation of a latent NOR on a B chromosome fused to an autosome.

Genome 29: 116–121.

37. Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation

during meiosis and NOR activity of a B chromosome in the grasshopper

Eyprepocnemis plorans. Chromosome Res 15: 755–765.

38. Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of

NOR expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118: 291–301.

39. Teruel M (2009) Origen, expresion y efectos fenotıpicos de un parasito

genomico. PhD. Universidad de Granada.

40. Lopez-Leon MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region

in a B chromosome inactivated by DNA methylation. Chromosoma 100:

134–138.

A Functional B Chromosome

PLoS ONE | www.plosone.org 6 May 2012 | Volume 7 | Issue 5 | e3660074

41. Cabrero J, Teruel M, Carmona FD, Jimenez R, Camacho JPM (2007) Histone

H3 lysine 9 acetylation pattern suggests that X and B chromosomes are silenced

during entire male meiosis in a grasshopper. Cytogenet Genome Res 119:

135–142.

42. Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A, et al. (2007)

Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell 19:

1738–1749.

43. Han F, Lamb JC, Yu W, Gao Z, Birchler JA (2007) Centromere function and

nondisjunction are independent components of the maize B chromosome

accumulation mechanism. Plant Cell 19: 524–533.

44. Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA

gene copies maintains genome integrity. Science 327: 693–696.

45. Lopez-Leon MD, Cabrero J, Camacho JPM (1999) Unusually high amount of

inactive ribosomal DNA in the grasshopper Stauroderus scalaris. Chromosome Res

7: 83–88.

46. Pikaard CS (2000) The epigenetics of nucleolar dominance. Trends Genet 16:

495–500.

47. Chen ZJ, Pikaard CS (1997) Transcriptional analysis of nucleolar dominance

in polyploidy plants: biased expression/silencing of progenitor rRNA genes

is developmentally regulated in Brassica. Proc Nat Acad Sci USA 94:

3442–3447.

48. Lopez-Leon MD, Cabrero J, Camacho JPM (1995) Changes in DNA

methylation during development in the B chromosome NOR of the grasshopperEyprepocnemis plorans. Heredity 74: 296–302.

49. Lopez-Leon MD, Cabrero J, Camacho JPM (1995) Changes in NOR activity in

the presence of supernumerary heterochromatin in the grasshopper Eyprepocnemis

plorans. Genome 38: 68–74.

50. Zurita S, Cabrero J, Lopez-Leon MD, Camacho JPM (1998) Polymorphismregeneration for a neutralized selfish B chromosome. Evolution 52: 274–277.

51. Manrique-Poyato MI, Munoz-Pajares AJ, Loreto V, Lopez-Leon MD,

Cabrero J, et al. (2006) Causes of B chromosome variant substitution in thegrasshopper Eyprepocnemis plorans. Chromosome Res 14: 693–700.

52. Manrique-Poyato MI (2010) Dinamica espacial y temporal de los cromosomas Bdel saltamontes Eyprepocnemis plorans. PhD Universidad de Granada.

53. Camacho JPM, Perfectti F, Teruel M, Lopez-Leon MD, Cabrero J (2004) Theodd-even effect in mitotically unstable B chromosomes in grasshoppers.

Cytogenet Genome Res 106: 325–331.

54. Perfectti F, Corral JM, Mesa JA, Cabrero J, Bakkali M, et al. (2004) Rapidsuppression of drive for a parasitic B chromosome. Cytogenet Genome Res 106:

338–343.55. Cabrero J, Lopez-Leon MD, Bakkali M, Camacho JPM (1999) Common origin

of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:

435–439.

A Functional B Chromosome

PLoS ONE | www.plosone.org 7 May 2012 | Volume 7 | Issue 5 | e3660075

Figure S1. Nucleotide sequence of the DNA amplified with the ITS2A and ITS2B primers.

1 TGGAGCCGTACGACGAAGTGGCGGCGGTTTGTGCTTGCACGACGCCGGCCGCCACACACA

61 TTTGGAACAGGGCCTGTCAAAGGGCCCAGTCCCGCCTATGCAACAGCAGGCTTTGCCTGA

121 CAAGCAAATGTATGAAAAAAGATCACCCAGGACGGTGGATCACTCGGCTCGTGGGTCGAT

181 GAAGAACGCAGCAAATTGCGCGTCGACATGTGAACTGCAGGACACATGAACATCGACGTT

241 TCGAACGCACATTGCGGTCCATGGATTCCGTTCCCGGGCCACGTCTGGCTGAGGGTCGGC

301 TACGTATACTGAAGCGCCAAGGCGTTTCGGAGACTTGGGAGCGTCGTGGTACGCCCGTCG

361 TGCCGCGTCTCCTCAAATGTGGAGTGCGCGCCCGTCGCTCGGGCGGTTCGCATACCGGTA

421 CTGTGTCTCGGTAGCGTGCACAGCTGCCCGGCGGTGCGGCGCGCTCAAACTCTTTCGTAC

481 AACG

76

Capítulo 3. B1 was the ancestor B

chromosome variant in the western

mediterranean area in the grasshopper

Eyprepocnemis plorans

77

78

E-Mail karger@karger.com

Original Article

Cytogenet Genome Res DOI: 10.1159/000356052

B 1 Was the Ancestor B Chromosome Variant in the Western Mediterranean Area in the Grasshopper Eyprepocnemis plorans

J. Cabrero a M.D. López-León a M. Ruíz-Estévez a R. Gómez b E. Petitpierre c

J.S. Rufas d B. Massa e M. Kamel Ben Halima f J.P.M. Camacho a

a Departamento de Genética, Facultad de Ciencias, Universidad de Granada, Granada , b Departamento de Ciencia y Tecnología Agroforestal, E.T.S. de Ingenieros Agrónomos, Universidad de Castilla La Mancha, Albacete , c Departament de Biologia, Laboratorio de Genetica, Universitat de les Illes Balears, Palma de Mallorca , and d Unidad de Biología Celular, Departamento de Biología, Facultad de Ciencias, Universidad Autónoma de Madrid, Madrid , Spain; e Dipartimento Scienze agrarie e forestali, Palermo , Italy; f Institut Supérieur Agronomique,Université de Sousse, Sousse , Tunisia

B chromosomes are dispensable supernumerary ele-ments frequently found in many eukaryote genomes in addition to the standard (A) chromosomes. They are mostly composed of repetitive DNAs such as ribosomal DNA (rDNA), satellite DNA (satDNA) and mobile ele-ments [Camacho, 2005]. The grasshopper Eyprepocnemis plorans is an example that harbors all these components [López-León et al., 1994; Montiel et al., 2012]. In addition to the 22 + X0/XX standard chromosomes, more than 50 B chromosome variants have been described in the Ibe-rian Peninsula on the basis of size and C-banding pattern [Henriques-Gil et al., 1984; Henriques-Gil and Arana, 1990; López-León et al., 1993; Bakkali et al., 1999], all of them being mostly made up of the same repetitive DNAs, i.e. rDNA and a 180-bp tandem repeat satDNA, thus sug-gesting their common descent [Cabrero et al., 1999].

B chromosomes are frequently polymorphic with many species showing 2 or more variants. For instance, Hewitt [1979] called attention on 10 grasshopper species showing more than one kind of B chromosomes, and Jones and Rees [1982], in their seminal B chromosome review, found more than 60 plant and animal species with 2 or more types of B chromosomes. Further cases have been found since then, the review of which is beyond the scope of the present study.

Key Words

B chromosome · Eyprepocnemis plorans · FISH · Ribosomal DNA · Satellite DNA

Abstract

We analyzed the distribution of 2 repetitive DNAs, i.e. ribosom-al DNA (rDNA) and a satellite DNA (satDNA), on the B chromo-somes found in 17 natural populations of the grasshopper Ey-prepocnemis plorans plorans sampled around the western Mediterranean region, including the Iberian Peninsula, Bale-aric Islands, Sicily, and Tunisia. Based on the amount of these repetitive DNAs, 4 types of B variants were found: B 1 , showing an equal or higher amount of rDNA than satDNA, and 3 other variants, B 2 , B 24 and B 5 , bearing a higher amount of satDNA than rDNA. The variants B 1 and B 2 varied in size among popu-lations: B 1 was about half the size of the X chromosome in Bale-aric Islands, but two-thirds of the X in Iberian populations at Alicante, Murcia and Albacete provinces. Likewise, B 2 was about one-third the size of the X chromosome in populations from the Granada province but half the size of the X in the populations collected at Málaga province. The widespread geographical distribution of the B 1 variant makes it the best candidate for being the ancestor B chromosome in the whole western Mediterranean region. © 2013 S. Karger AG, Basel

Accepted: June 19, 2013 by M. Schmid Published online: November 7, 2013

Juan Pedro M. Camacho Departamento de Genética, Facultad de Ciencias Universidad de Granada, Avda. Fuentenueva s/n ES–18071 Granada (Spain) E-Mail jpmcamac   @   ugr.es

© 2013 S. Karger AG, Basel1424–8581/13/0000–0000$38.00/0

www.karger.com/cgr

Dow

nloa

ded

by: J

. Cam

acho

- 5

9611

Fac

Edu

caci

on y

Hum

anid

ades

150.

214.

61.5

6 -

11/7

/201

3 10

:02:

50 A

M

79

B1: the western-mediterranean ancestral variant

Cabrero et al. Cytogenet Genome ResDOI: 10.1159/000356052

2

On the basis of its widest distribution, Henriques-Gil et al. [1984] and Henriques-Gil and Arana [1990] suggested that B 1 was the ancestor variant for B chromosomes in the Iberian Peninsula, since it was found in populations from almost the whole Mediterranean coast, excepting the Granada and Western Málaga provinces, where it had been replaced by B 2 , and Fuengirola, where it had been replaced by B 5 . In addition, B 2 was replaced by B 24 in the Torrox population [Zurita et al., 1998]. A comparison with B chro-mosomes found in eastern Mediterranean (Greece and Turkey) and Caucasian (Armenia and Dagestan) popula-tions showed that B chromosomes from these latter popula-tions were mostly composed of rDNA, with much smaller amounts of satDNA than western B chromosomes [López-León et al., 2008]. However, nothing was known about pop-ulations between these 2 extremes. Here, we analyze B chro-mosomes from Sicily and Tunisia in addition to 15 Spanish populations and conclude that the B 1 chromosome is the most widespread variant in the whole western Mediterra-nean region (including Sicily and Tunisia), which suggests that it was probably the ancestral B variant in this region.

Materials and Methods

Adult males of the grasshopper E. plorans plorans were col-lected at Palermo (Sicily, Italy) and Chott Mariem (Sousse, Tuni-sia) as well as in 15 Spanish locations: S’Albufereta and S’Esgleieta (Mallorca, Balearic Islands), San Juan (Alicante), Bullas and Cieza (Murcia), Mundo River (Albacete), Otivar and Salobreña (Grana-da), Maro, Nerja, Torrox, Algarrobo, Torre del Mar, Torremoli-nos, and Fuengirola (Málaga province).

Testes were fixed in 3: 1 ethanol:acetic acid and stored at 4   °   C un-til use. The number of B chromosomes in each male was determined by squashing 2 testis follicles in 2% lacto-propionic orcein and visu-alizing primary spermatocytes at prophase or metaphase under an optical microscope. This allowed selection of B-carrying males from each population, in which we then performed 2-color fluorescent in situ hybridization (FISH) on chromosome preparations obtained by squashing of 2 testis follicles in 50% acetic acid. We used 2 DNA probes, one for rDNA and the other for the 180-bp tandem repeat satDNA, which are the 2 major constituents of B chromosomes. The technique employed was essentially that described in Cabrero et al. [1999]. Chromosome preparations were analyzed under a BX41 Olympus epifluorescence microscope, and photographs were cap-tured with a DP70 cooled camera. Images were composed and opti-mized for brightness and contrast with the GIMP freeware.

Results and Discussion

Dual-color FISH analysis with rDNA and satDNA probes showed that the B chromosomes found in all nat-ural populations sampled were mostly made up of these

2 tandem repeat DNAs, with the exception of the small short arm ( fig. 1 ), in consistency with previous observa-tions [Cabrero et al., 1999]. Comparative analysis of the FISH pattern and relative size of the X and B chromo-somes from the same cell allowed classifying B variants into 4 types ( fig. 1 ; table 1 ). The first type, B 1 , is character-ized by the presence of similar amounts of both DNA types (see Bs from San Juan, Bullas, Mundo and Cieza in the Iberian Peninsula, and those from Sicily and Tunisia), or else a slightly higher amount of rDNA (see Bs from S’Albufereta and S’Esgleieta in the Balearic Islands). The relative size of the B compared to that of the X chromo-some also differed between Balearic and Iberian Bs, the former being about half the size of the X chromosome (likewise those in Tunisia), whereas the Iberian Bs, and those from Sicily, were about two-thirds the X chromo-some size. The differences between these 2 types of B 1 chromosomes could simply be explained by changes in the amount of satDNA.

The remaining B variants observed showed a higher amount of satDNA than rDNA. The second type, B 2 , shows satDNA and rDNA in about a 2: 1 ratio, and its size is about one-third that of the X chromosome in Salobreña and Otívar (Granada province), but about half the size of the X chromosome in Maro, Nerja, Algarrobo, Torre del Mar and Torremolinos (Málaga province). Again, size differences for B 2 chromosomes between populations could be explained by changes in the amount of the satDNA, although we cannot rule out the possibility of changes in the amount in rDNA, since the ratio between the 2 types of repetitive DNA remains roughly stable be-tween the 2 types of B 2 . The third type, B 24 , is about half the size of the X chromosome and carries satDNA and rDNA in a 3: 1 ratio. It was present in Torrox and Algar-robo (Málaga) populations, and it arose from the B 2 vari-ant [Henriques-Gil and Arana, 1990; Zurita et al., 1998] after amplification of the satDNA region. The fourth type, B 5 , is about two-thirds the size of the X chromosome and carries satDNA and rDNA in about a 2: 1 ratio. It was only found in Fuengirola (Málaga). It could have arisen from B 1 (which is the prevalent B variant in populations surrounding Fuengirola) [Henriques-Gil and Arana, 1990] by amplification of the satDNA region. The former inferences about the size of the B chromosomes are based on the assumption that the size of the X does not vary among populations, since B chromosome size estima-tions were relative to X chromosome size.

When B variants are placed in a map of the western Mediterranean region ( fig. 2 ), it is evident that B 1 is pres-ent in all geographical zones analyzed (Sicily, Tunisia,

Dow

nloa

ded

by: J

. Cam

acho

- 5

9611

Fac

Edu

caci

on y

Hum

anid

ades

150.

214.

61.5

6 -

11/7

/201

3 10

:02:

50 A

M

80

B 1 Was the Ancestor B Variant in Western E. plorans

Cytogenet Genome ResDOI: 10.1159/000356052

3

Balearic Islands, and Iberian Peninsula). Bearing in mind that it is also present in Moroccan populations [Cabrero et al., 1999], we can conclude that B 1 is the most widely distributed B chromosome variant in the western Medi-terranean region. In natural populations to the east of Sic-ily and Tunisia (e.g. Greece and Turkey), B chromosomes are mostly composed of rDNA, with considerably smaller amounts of satDNA than Western B chromosomes [Ab-delaziz et al., 2007; López-León et al., 2008], so that, under the criteria employed here, they are rather different B types.

The B 1 variant was considered the ancestral B chromo-some type in the Iberian Peninsula because it shows the widest geographical distribution along the Mediterra-nean coast, from Tarragona to Huelva [Henriques-Gil et al., 1984; Henriques-Gil and Arana, 1990]. Our present results suggest that B 1 was the ancestral B variant for the whole western Mediterranean region. Recent molecular analysis of a 1,510-bp SCAR (sequence-characterized am-plified region) marker specific to the B chromosomes has

shown extremely scarce variation in its DNA sequence between Bs from both western (Spain and Morocco) and eastern (Greece, Turkey and Armenia) Mediterranean re-gions, which, for a dispensable chromosome, probably implies a very recent origin for these B chromosomes [Muñoz-Pajares et al., 2011]. Two additional facts point to the recent origin of B chromosomes in the Iberian Pen-insula, both assuming that B chromosomes invaded the Iberian Peninsula through coastal populations in which B chromosomes are universally present. First, B chromo-somes are absent around the headwaters of the Spanish Segura River basin, because abrupt geographical barriers have impeded the advance of B-carrying individuals [Ca-brero et al., 1997; Manrique-Poyato et al., in preparation]. Second, the Otívar population, by the Verde River in the Spanish Granada province, is located 10 km from the coast and has been invaded by B chromosomes in the last 35 years [Camacho et al., submitted], whereas B invasion had been completed prior to 1977 in 4 other populations closer to the coast [Camacho et al., 1980]. The fact that B

Fig. 1. Dual-color FISH patterns for the rDNA and satDNA probes found in X and B chromosomes from 17 natural E. plorans populations. X and B chromosomes depic-ted for each population are from the same diplotene cell. Given that X and B chromo-somes show positive heteropycnosis dur-ing this meiotic stage, their relative sizes can be compared. Note that B size in re-spect to X size varies among populations, the B being about half the size of the X in S’Albufereta, S’Esgleieta, Nerja, and Algar-robo (B 2 ), about one-third in Salobreña and Otívar, and about two-thirds in San Juan, Mundo, Cieza, Algarrobo (B 24 ), Tor-rox, and Fuengirola populations. Note also that the relative amount of rDNA and satDNA varies among B types, being al-most equal for the B 1 types, except for a slightly larger amount of rDNA in S’Albufereta and S’Esgleieta. The other variants show relatively smaller amounts of rDNA: one-third in B 2 and B 5 and one-fourth in B 24 . A = Alicante; Ab = Albacete; Ba = Balearic Islands; Gr = Granada; Ma = Málaga; Mu = Murcia. Scale is variable for the different cells used, but the X chromo-some in E. plorans is about 5 μm long.

Dow

nloa

ded

by: J

. Cam

acho

- 5

9611

Fac

Edu

caci

on y

Hum

anid

ades

150.

214.

61.5

6 -

11/7

/201

3 10

:02:

50 A

M

81

B1: the western-mediterranean ancestral variant

Cabrero et al. Cytogenet Genome ResDOI: 10.1159/000356052

4

invasion continues at current times and the recent origin of these B chromosomes suggest the possibility that B 1 spread across the western Mediterranean populations could occur in recent historical times, presumably aided by the increase of Mediterranean commerce, since E. plorans is very common in most Mediterranean cultiva-tions and can be easily transported in plants [Cabrero and Camacho, pers. observation].

It is remarkable that most of the changes that B chro-mosomes have experienced in the south of the Iberian Peninsula, giving birth to the B 24 and B 5 variants, have mainly implied changes in the amount of satDNA. It has been shown that the replacement of B 2 by B 24 in the Tor-rox population was based on significant drive for B 24 but absence of it for B 2 [Zurita et al., 1998]. Cabrero et al. [1999] thus suggested that the replacement of ancestral

Table 1. Geographical location of the 17 populations analyzed, relative size of their B chromosomes in respect to the X chromosome, relative proportions of rDNA and satDNA in the B chromosomes, and B chromosome type

Population Province Country Latitude Longitude Altitude, m B/X length rDNA/satDNAa Type

Chott Mariem Sousse Tunisia 35°52′44′′N 10°35′55′′E 6 1/2 rDNA = satDNA B1

Micciulla Palerm Italy 38°06′20′′N 13°19′12′′E 97 2/3 rDNA = satDNA B1

4/5 rDNA = satDNA B1iso

S’Albufereta Balearic Islands Spain 39°51′41′′N 3°05′43′′E 1 1/2 rDNA > satDNA B1

S’Esgleieta Balearic Islands Spain 39°39′12′′N 2°38′33′′E 103 1/2 rDNA > satDNA B1

San Juan Alicante Spain 38°23′45′′N 0°25′19′′E 22 2/3 rDNA = satDNA B1

Bullas Murcia Spain 38°02′30′′N 1°40′06′′W 636 2/3 rDNA = satDNA B1

Cieza Murcia Spain 38°13′58′′N 1°24′58′′W 165 2/3 rDNA = satDNA B1

Mundo Albacete Spain 38°28′01′′N 1°47′22′′W 436 2/3 rDNA = satDNA B1

Salobreña Granada Spain 36°44′20′′N 3°35′31′′W 2 1/3 rDNA < satDNA B2

Otívar Granada Spain 36°48′57′′N 3°40′59′′W 234 1/3 rDNA < satDNA B2

Maro Málaga Spain 36°45′34′′N 3°50′42′′W 114 1/2 rDNA < satDNA B2

1/2 rDNA < satDNA B2i

Nerja Málaga Spain 36°44′44′′N 3°53′56′′W 6 1/2 rDNA < satDNA B2

Torrox Málaga Spain 36°44′24′′N 3°57′26′′W 30 2/3 rDNA < satDNA B24

Algarrobo Málaga Spain 36°44′48′′N 4°02′49′′W 5 1/2 rDNA < satDNA B2

2/3 rDNA < satDNA B24

Torre del Mar Málaga Spain 36°45′15′′N 4°06′15′′W 15 1/2 rDNA < satDNA B2

Torremolinos Málaga Spain 36°37′50′′N 4°30′12′′W 53 1/2 rDNA < satDNA B2

Fuengirola Málaga Spain 36°31′59′′N 4°38′29′′W 3 2/3 rDNA < satDNA B5

a The predominant repetitive DNA in each B chromosome is shown in bold.

Fig. 2. Map of the western Mediterranean region showing the geo-graphical distribution of the different B chromosome types found. Note the presence of the B 1 variant in all regions analyzed here and also in Morocco as previously shown by Cabrero et al. [1999].

Dow

nloa

ded

by: J

. Cam

acho

- 5

9611

Fac

Edu

caci

on y

Hum

anid

ades

150.

214.

61.5

6 -

11/7

/201

3 10

:02:

50 A

M

82

B 1 Was the Ancestor B Variant in Western E. plorans

Cytogenet Genome ResDOI: 10.1159/000356052

5

variants (e.g. B 2 by B 24 or B 1 by B 5 ) could be facilitated by a higher relative amount of satDNA in respect to rDNA. This could be valid for western Mediterranean Bs, where a relative increase in satDNA has been observed in the new variants in respect to the ancestral ones. In eastern Mediterranean Bs, however, this is less clear since Bs are mostly made up of rDNA, with very small amounts of satDNA, and this has not impeded their successful spread-ing to all regions analyzed [see López-León et al., 2008].

The appearance of new B chromosome variants in the progeny of controlled crosses, where none of the parents carried them, provides an estimate of the mutation rate of B chromosomes, since it can be safely assumed that this new variant arose by mutation of one of the Bs in the par-ents. Two different estimates point to the high mutability of B chromosomes in E. plorans , with rates ranging from 0.05 to 0.21% in Spanish populations [López-León et al., 1993] and from 0.21 to 9.6% in Moroccan populations [Bakkali and Camacho, 2004]. This explains how a young B chromosome system like this has given rise to so many different B types. Only in the Iberian Peninsula, Hen-riques-Gil et al. [1984] characterized 14 different B vari-ants, and López-León et al. [1993] found additional vari-ants. Including also the variants reported by Bakkali et al. [1999] in Morocco, Abdelaziz et al. [2007] in Greece, and

López-León et al. [2008] in Turkey, Armenia, and Dages-tan, more than 50 variants have hitherto been described in this species. Here we show a new B variant in the Maro population (B 2i ) which presumably arose through a para-centric inversion changing the relative positions of the rDNA and part of the satDNA. Inversion is a frequent chromosome mutation affecting B chromosomes [López-León et al., 1993; Bakkali and Camacho, 2004]. The high incidence of mutations in the B chromosomes opens new evolutionary pathways to B chromosome polymorphism since some of the new variants can show higher transmis-sion rates than their ancestor B and thus replace it, as documented for B 24 in the Torrox population [Zurita et al., 1998].

Acknowledgements

We thank Karl Meunier for language revision and Camillo Cusimano, Tommaso and Andrea La Mantia for their help in the collection of specimens in Sicily. This study was supported by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL2009-11917) and Plan Andaluz de Investigación (CVI-6649), and was partially performed by FEDER funds. M.R.-E. was sup-ported by a FPU fellowship from the Spanish Ministerio de Ciencia e Innovación.

References

Abdelaziz M, Teruel M, Chobanov D, Camacho JPM, Cabrero J: Physical mapping of rDNA and satDNA in A and B chromosomes of the grasshopper Eyprepocnemis plorans from a Greek population. Cytogenet Genome Res 119: 143–146 (2007).

Bakkali M, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepoc-nemis plorans in North Africa. III. Mutation rate of B chromosomes. Heredity 92: 428–433 (2004).

Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM: The B chromosome poly-morphism of the grasshopper Eyprepocnemis plorans in North Africa. I. B variants and fre-quency. Heredity 83: 428–434 (1999).

Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM: Geo-graphical distribution of B chromosomes in the grasshopper Eyprepocnemis plorans , along a river basin, is mainly shaped by non-selective historical events. Chromosome Res 5: 194–198 (1997).

Cabrero J, López-León MD, Bakkali M, Camacho JPM: Common origin of B chromosome vari-ants in the grasshopper Eyprepocnemis plorans . Heredity 83: 435–439 (1999).

Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome, pp 223–286 (Academic Press, New York 2005).

Camacho JPM, Carballo AR, Cabrero J: The B-chromosome system of the grasshopper Ey-prepocnemis plorans subsp. plorans (Char-pentier). Chromosoma 80: 163–166 (1980).

Henriques-Gil N, Arana P: Origin and substitu-tion of B chromosomes in the grasshopper Ey-prepocnemis plorans . Evolution 44: 747–753 (1990).

Henriques-Gil N, Santos JL, Arana P: Evolution of a complex polymorphism in the grasshop-per Eyprepocnemis plorans . Chromosoma 89: 290–293 (1984).

Hewitt GM: Grasshopper and crickets, in John B (ed): Animal Cytogenetics, vol. 3, Insecta 1 Or-thoptera (Gebrüder Borntraeger, Berlin 1979).

Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982).

López-León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL: Generating high variability of B chromosomes in Eyprepocne-mis plorans (grasshopper). Heredity 71: 352–362 (1993).

López-León MD, Neves N, Schwarzacher T, Hes-lop-Harrison JS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2: 87–92 (1994).

López-León MD, Cabrero J, Dzyubenko V, Bu-grov A, Karamysheva T, et al: Differences in ribosomal DNA distribution on A and B chromosomes between eastern and western populations of the grasshopper Eyprepocne-mis plorans plorans . Cytogenet Genome Res 121: 260–265 (2008).

Montiel EE, Cabrero J, Camacho JPM, López-León MD: Gypsy, RTE and Mariner trans-posable elements populate Eyprepocnemis plorans genome. Genetica 140: 365–374 (2012).

Muñoz-Pajares AJ, Martínez Rodriguez L, Teruel M, Cabrero J, Camacho JPM, Perfectti F: A single, recent origin of the accessory B chro-mosome of the grasshopper Eyprepocnemis plorans. Genetics 187: 853–863 (2011).

Zurita S, Cabrero J, López-León MD, Camacho JPM: Polymorphism regeneration for a neu-tralized selfish B chromosome. Evolution 52: 274–277 (1998).

Dow

nloa

ded

by: J

. Cam

acho

- 5

9611

Fac

Edu

caci

on y

Hum

anid

ades

150.

214.

61.5

6 -

11/7

/201

3 10

:02:

50 A

M

83

B1: the western-mediterranean ancestral variant

84

Capítulo 4. Ribosomal DNA is active in

different B chromosome variants of the

grasshopper Eyprepocnemis plorans

85

86

Ribosomal DNA is active in different B chromosome variantsof the grasshopper Eyprepocnemis plorans

Mercedes Ruız-Estevez • Ma Dolores Lopez-Leon •

Josefa Cabrero • Juan Pedro M. Camacho

Received: 16 June 2013 / Accepted: 31 August 2013

� Springer Science+Business Media Dordrecht 2013

Abstract B chromosomes are considered to be geneti-

cally inert elements. However, some of them are able to

show nucleolus organizer region (NOR) activity, as

detected by both cytological and molecular means. The

grasshopper Eyprepocnemis plorans shows a B chromo-

some polymorphism characterized by the existence of

many B variants. One of them, B24, shows NOR activity in

about half of B-carrying males in the Torrox population.

Molecular data have suggested the recent origin for B

chromosomes in this species, and on this basis it would be

expected that NOR activity was widespread among the

different B variants. Here we test this hypothesis in four

different B chromosome variants (B1, B2, B5, and B24)

from 11 natural populations of the grasshopper E. plorans

covering the south and east of the Iberian Peninsula plus

the Balearic Islands. We used two different approaches: (1)

the cytological observation of nucleoli attached to the distal

region of the B chromosome (where the rDNA is located),

and (2) the molecular detection of the rDNA transcripts

carrying an adenine insertion characteristic of B chromo-

some ITS2 sequences. The results showed NOR expression

not only for B24 but also for the B1 and B2 variants.

However, the level of B-NOR expression in these latter

variants, measured by the proportion of cells showing

nucleoli attached to the B chromosomes, was much lower

than that previously reported for B24. This suggests the

possibility that structural or genetic background conditions

are enhancing the expressivity of the rDNA in the B24

variant.

Keywords B chromosome � Eyprepocnemis

plorans � Nucleolus � Nucleolus organizer region �PCR � Ribosomal DNA � Transcript

Introduction

B chromosomes are dispensable supernumerary elements

appearing in about 15 % of eukaryotic genomes. They do

not recombine with standard (A) chromosomes and usually

show drive mechanisms, which provide them with trans-

missional advantages. They are mostly composed of

repetitive DNA of several kinds, with predominance of

ribosomal DNA (rDNA), satellite DNA (satDNA) and

mobile elements (for review, see Camacho 2005). Other

multigenes families have been reported as constituents of B

chromosomes as in the case of histones genes, present in B

chromosomes of the two grasshopper species Locusta mi-

gratoria (Teruel et al. 2010) and Rhammatocerus brasili-

ensis (Oliveira et al. 2011). In the ascomycetous fungus

Nectria haematococca, supernumerary chromosomes have

a lower G?C content compared to the other chromosomes

and are enriched in repeat sequences and unique and

duplicated genes (Coleman et al. 2009). In some canid

species, the presence of cancer-associated genes has been

shown, and at least one of them (the proto-oncogene cKIT)

has been shown to be transcribed and translated into

functional KIT protein (Graphodatsky et al. 2005; Yudkin

et al. 2007; Becker et al. 2011). Recent research has also

shown that rye B chromosomes are rich in gene-derived

sequences, many of them being derived from A chromo-

somes 3R and 7R, but they also accumulate large amounts

of specific DNA repeats and insertions of organellar DNA

(Martis et al. 2012).

M. Ruız-Estevez � Ma. D. Lopez-Leon � J. Cabrero �J. P. M. Camacho (&)

Departamento de Genetica, Facultad de Ciencias, Universidad de

Granada, 18071 Granada, Spain

e-mail: jpmcamac@ugr.es

123

Genetica

DOI 10.1007/s10709-013-9733-6

87

rDNA transcription in B chromosome variants

One of the repetitive DNAs most frequently harboured

by B chromosomes in many species is rDNA. It is com-

posed of repeat units containing the genes for 18S, 5.8S

and 28S ribosomal RNAs (rRNAs), separated by two

internal transcribed spacers (ITS1 and ITS2) and flanked by

external transcribed spacers (ETS) and nontranscribed

spacers (NTS) (Long and David 1980). The chromosome

location of these genes is known as the nucleolus organizer

regions (NORs), and their phenotype, the nucleolus, is

cytologically apparent either spontaneoulsy or after using a

variety of techniques, the simplest one being silver

impregnation (Rufas et al. 1982). This technique reveals

the transcriptional machinery of the RNA polimerase I,

including the B23, nucleolin, UBF proteins and RNA pol I

subunits (Roussel et al. 1992; Roussel and Hernandez-

Verdun 1994; Roussel et al. 1996). It has been shown that

nucleolus size is positively correlated with the rate of

rRNA synthesis (Mosgoeller 2004), indicating the recruit-

ment of the proteins needed for rDNA transcription (Der-

enzini 2000).

The heterochromatic nature of most B chromosomes

appeared to suggest their genetic inertness. In fact, several

studies performed in the grasshopper Myrmeleotettix

maculatus (Fox et al. 1974), the mouse Apodemus pen-

insulae (Ishak et al. 1991), the black rat Rattus rattus

(Stitou et al. 2000), and the fish Metynnis maculatus

(Baroni et al. 2009) and Haplochromis obliquidens (Poletto

et al. 2010), pointed to the inactivity of B chromosome

rDNA. However, evidence of NOR activity in B chromo-

somes was found in some species such as the grasshopper

Dichroplus pratensis (Bidau 1986) and the mouse A. pen-

insulae (Boeskorov et al. 1995). At molecular level, indi-

rect evidence of transcription from B chromosome DNA

was reported in the frog Leiopelma hochstetteri (Green

1988) and the mosquito Simulium juxtacrenobium

(Brockhouse et al. 1989). But the direct presence of rRNA

transcripts coming from a B chromosome has been repor-

ted in the plant Crepis capillaris (Leach et al. 2005), the

parasitic wasp Trichogramma kaykai (van Vugt et al. 2005)

and rye (Carchilan et al. 2009). Other B specific-repetitive

DNA sequences have been found transcriptionally active in

the B chromosome of rye (Carchilan et al. 2007).

Eyprepocnemis plorans is a grasshopper species carry-

ing a wide variety of B chromosomes in addition to its

standard genome of 22 ? X0/XX chromosomes. More

than 50 variants have been differentiated on the basis of

size, C-banding pattern and the relative amounts of their

two main repetitive DNA components, i.e. rDNA and sat-

DNA (Lopez-Leon et al. 1993; Lopez-Leon et al. 1994;

Bakkali et al. 1999; Cabrero et al. 1999). Almost all A

chromosomes in this species carry rDNA, the largest rDNA

clusters being proximally located in the chromosomes X, 9,

10 and 11, although none of these rDNA clusters is as large

as that in the B chromosome (Cabrero et al. 1999, 2003).

NOR activity is mostly found in one or more of the above

mentioned A chromosomes, and very rarely in the B

chromosomes (Cabrero et al. 1987; Lopez-Leon et al.

1995). In fact, no NOR activity was found in B chromo-

somes of E. plorans prior to the finding of a B2 chromo-

some fused to the longest autosome where a nucleolus was

frequently attached to the rDNA of the B chromosome

(Cabrero et al. 1987). Remarkably, in the Torrox popula-

tion (Malaga, Spain) the B24 variant recurrently showed

NOR activity in many males collected for several years

(Teruel et al. 2007, 2009). In this population, we detected

the presence of transcripts that specifically came from the

rDNA contained in the B chromosome named ITS2_B

(Ruiz-Estevez et al. 2012). This was carried out by means

of a pair of specific primers, one of them being anchored in

the 30 extreme of the ITS2 region where the B chromosome

rDNA carries an adenine insertion apparently absent in 0B

individuals (Teruel et al. submitted). Except for the fused

B2 mentioned above, nothing more is known about the

potential of B variants other than B24 to express their

rDNA. Under the hypothesis that B chromosomes in E.

plorans are young (Munoz-Pajares et al. 2011), we predict

that most, if not all B variants should potentially conserve

the capability to express their rDNA, since there has not

been time enough for the occurrence of silencing mutations

to inactivate it. To test this hypothesis, we analyze here the

expression of the rDNA contained in four different B

chromosome variants (B1, B2, B5, y B24) from 11 natural

populations collected in the south and east of the Iberian

Peninsula and the Balearic Islands by means of cytological

and molecular approaches.

Materials and methods

Biological samples and characterization of B variants

Adult males of the grasshopper E. plorans were collected

from 11 Spanish populations. In 2010, we sampled the

Algarrobo, Nerja (Malaga province), and Salobrena (Gra-

nada) populations. In 2011, we sampled Torrox and Fu-

engirola (Malaga), Cieza (Murcia), San Juan (Alicante),

Mundo (Albacete), S’Albufereta and S’Esgleieta (Mallor-

ca, Balearic Islands). In 2012, we sampled the Otıvar

population (Granada). The 2010 and 2012 samples were

analyzed by both cytological and molecular techniques,

whereas the 2011 sample was only analyzed cytologically

because of an accidental defrosting of the freezer where the

bodies were stored.

Testes were fixed in 3:1 ethanol:acetic acid for cyto-

logical studies and stored at 48 C until use. Bodies were

divided into two hemibodies, frozen in liquid nitrogen, and

Genetica

12388

stored at -80� C for DNA and RNA isolation. Determi-

nation of B chromosome number in each male was per-

formed by squashing two testis follicles in 2 % lacto-

propionic orcein and visualizing primary spermatocytes at

prophase or metaphase under an Olympus microscope. The

type of B variant was determined by the double fluorescent

in situ hybridization (FISH) technique described in Cabrero

et al. (1999).

Cytological analysis of rRNA gene expression in B

chromosomes

Testis follicle preparations of B-carrying males were silver

stained as indicated in Rufas et al. (1982) to visualize the

nucleoli attached to autosomal bivalents and X and B

chromosome univalents at diplotene cells. We stained these

preparations with 1 % Giemsa to easily differentiate

chromatin (blue-green) from nucleoli (brown). For this

purpose, we selected at least 20 diplotene cells per male,

which were photographed with an Olympus digital camera

(DP70). When the B-NOR was active, we measured the

area of the nucleolus attached to the B as well as the area of

the X chromosome as a reference to obtain a relative

measure of B-nucleoli area which could be compared

between individuals and populations with different B

chromosome variants. We measured areas with the ImageJ

and a GPL3 licensed Python program (pyFIA) (Ruiz-Ru-

ano et al. 2011), and calculated an index of B nucleolus

area by dividing it by the X chromosome area. For this

analysis, we also measured B nucleolus area in the indi-

viduals from the Torrox population reported in Ruiz-Est-

evez et al. (2012). Chromosome preparations were

analysed with a BX41 Olympus epifluorescence micro-

scope and photographs were taken with an associated DP70

cooled camera. Figures were composed and optimized for

bright and contrast with The Gimp freeware. Statistical

analysis was performed by contingency Chi square and

Student t tests with the STATISTICA 8.0 software (Stat-

Soft, Inc. 2007).

Molecular analysis of rRNA gene expression in B

chromosomes

Genomic DNA (gDNA) and total RNA were isolated from

frozen hemibodies using ‘‘GenElute Mammalian Genomic

DNA Miniprep Kit’’ (Sigma) and ‘‘Real Total RNA Spin

Plus kit’’ (Durviz), respectively, following manufacturer’s

recommendations. RNA was submitted to an additional

20U DNase (REALSTAR kit, Durviz) post-treatment to

eliminate any gDNA contamination. Quantity and quality

(absorbance 260:280 nm = 1.9–2) of gDNA and RNA

were measured with Tecan’s Infinite 200 NanoQuant and in

a denaturing agarose gel to ensure the absence of RNA

degradation. Complementary DNA (cDNA) was obtained

with random hexamers using SuperScript III First-Strand

Shyntesis SuperMix Kit (Invitrogen). PCR amplification of

the ITS2_B sequence was performed in an Eppendorf

Mastercycler ep Gradient S (Eppendorf) using ITSA (for-

ward) and ITSB (reverse) primers (Ruiz-Estevez et al.

2012) with gDNA, as a positive control for the presence of

the ITS2_B, and cDNA to test the presence of rRNA

transcripts carrying the ITS2_B. PCR reaction mixtures for

both gDNA and cDNA were performed in 25 ll containing

200 mM dNTPs, 10 mM each primer, 20 ng gDNA/30 ng

cDNA, 1X buffer and one unit of Taq polymerase (New

England, BioLabs). PCR conditions were the following: an

initial denaturation at 94 �C for 5 min and 30 cycles of

94 �C for 30 s, 66,4 �C (Algarrobo, Salobrena and Nerja)

or 62 �C (Otıvar) for 40 s, 72 �C for 45 s and final

extension of 72 �C for 7 min. All PCR experiments on

cDNA included a control reaction to exclude the possibility

of gDNA contamination of the original RNA samples. PCR

products were visualized in 1.5 % electrophoresis agarose

gels and the amplified fragment was cloned into the TOPO

TA vector (Invitrogen) and subsequently sequenced

(Macrogen). We analyzed the sequences with Bioedit

software version 7.1.3.0 (Hall 1999), and used BLAST

(Basic Local Alignment Search tool) at the NCBI site to

search for sequence homology with the sequences reported

by Teruel et al. (submitted) (accession numbers: JN811827

to JN811902).

Results

Silver impregnation analysis showed the sporadic expres-

sion of the rDNA contained in the B chromosome, mani-

fested by the presence of nucleoli attached to the distal

region of the B chromosome (Fig. 1). This constituted our

cytological test for the analysis of B-NOR expression.

Table 1 shows that 202 out of the 352 males analyzed

carried B chromosomes. The cytological analysis of

B-NOR activity was performed in 156 of these males after

selecting a representative sample of B-carrying males from

each population. A total of 18 males from seven popula-

tions showed B-NOR activity, in frequencies ranging from

7.69 % in S’Esgleieta to 28.57 % in San Juan, with an

11.66 % average for the 11 populations (Table 1). Spe-

cifically, we found the presence of nucleoli attached to B

chromosomes in two males from San Juan, three from

Mundo, one from S’Esgleieta, three from Torrox, three

from Otıvar, four from Salobrena and two from Algarrobo.

In the males from Otıvar, Salobrena Nerja and Algar-

robo, we also performed the molecular analysis of B-NOR

activity (Fig. 2). We obtained a PCR product for the

ITS2_B transcript (454 bp lenght) in the cDNA of five

Genetica

12389

rDNA transcription in B chromosome variants

males: two out of the 20 males analyzed from Salobrena

(10 %), one out of the 30 males analyzed from Otıvar

(3.33 %), and two out of 13 males analyzed from Algar-

robo (15.38 %), but in none of the 19 males analyzed from

Nerja. On average, 7.18 % (SE = 3.44) of the males in the

four populations provided molecular evidence for B-NOR

expression. A contingency Chi square test, comparing the

total number of males carrying the ITS2_B transcript (5)

and those lacking it (79), with the number of males

showing nucleoli attached to the B chromosomes (9) and

those lacking these nucleoli (70), in these same four pop-

ulations, showed the absence of significant differences for

B-NOR activity obtained by the cytological and molecular

methods (v2 = 1.53, df = 1, P = 0.22).

The correspondence between cytological and molecular

data was not complete. Table 2 shows the cytological and

molecular results in the eleven males which showed

B-NOR activity by one or the other method. The ITS2_B

transcript was detected in only three out of the nine males

showing nucleoli attached to the B chromosomes, whereas

the reverse was found in the m11 male from Salobrena and

the m20 male from Algarrrobo. In order to look for pos-

sible explanations, we investigate here whether the degree

of B_NOR expression could influence its molecular

detectability. For this purpose, we quantified the proportion

of diplotene cells showing nucleoli attached to the Bs and

also the area of these nucleoli relative to the X chromo-

some area. We used the X chromosome as reference

instead of the B chromosome itself because the X is

expected to show much lower size variation between

populations. Table 3 shows the proportion of diplotene

cells with B-nucleoli in the nine males showing B-NOR

activity, as well as the presence of ITS2_B transcript in

their cDNA. The results show that molecular detection only

worked in three males showing B-nucleoli in 8 % or more

of their cells. The six males where molecular detection of

B-NOR activity failed showed B-nucleoli in 4–8 % of their

diplotene cells. This suggests the existence of a threshold

for molecular detection which might be about 8 % of

diplotene cells with B-nucleoli.

B-nucleolus area was measured in the same nine males,

but no clear association with molecular detection was

apparent (Table 4). Excepting male m24 from Otıvar, the

remaining males showed values close to 0.5, meaning that

the B-nucleoli had, on average, about 50 % the area of the

X chromosome. Out of the eight males fitting this pattern,

only three showed ITS2_B transcripts in their cDNA,

Fig. 1 Diplotene cell from an Algarrobo male showing a nucleolus

attached to the B chromosome (B = B chromosome; X = X

chromosome; nu = nucleolus). Bar = 5 lm

Table 1 Number of B-lacking and B-carrying males found in each population

Population B-lacking

males

B-carrying

males

B variant B-NOR

inactive

B-NOR

active

Total % Males with

B-NOR active

S’Albufereta (Ba) 10 10 B1 10 0 10 0

S’Esgleieta (Ba) 12 13 B1 12 1 13 7.69

San Juan (A) 3 7 B1 5 2 7 28.57

Mundo (Ab) 17 19 B1 16 3 19 15.79

Cieza (Mu) 20 7 B1 7 0 7 0

Salobrena (Gr) 10 21 B2 14 4 18 22.22

Otıvar (Gr) 45 70 B2 27 3 30 10

Nerja (Ma) 14 21 B2 19 0 19 0

Torrox (Ma) 3 11 B24 8 3 11 27.27

Algarrobo (Ma) 13 13 B2 and B24 10 2 12 16.67

Fuengirola (Ma) 3 10 B5 10 0 10 0

Total/mean 150 202 138 18 156 11.66

SE 3.37

A sample of B-carrying males was analyzed by silver staining to investigate B-NOR activity inferred from the presence of nucleoli attached to B

chromosomes. SE standard error

Genetica

12390

whereas the exceptional male did not show these tran-

scripts despite bearing nucleoli as large as the X chromo-

some area. This is because its B-nucleoli appear in only

7 % of the cells.

In order to get a more general picture on these param-

eters, we also measured B-nucleoli area in the same dip-

lotene cells where Ruiz-Estevez et al. (2012) reported, for

the first time at molecular level, the expression of the B

chromosome NOR in the Torrox population. Table 5

shows the proportion of cells with B-nucleoli and

B-nucleolus area measured in 14 males. The only male

failing molecular detection (m74) showed the lowest pro-

portion of cells with B-nucleoli (10 %), and yielded the

second smallest B-nucleoli (38 % the size of the X chro-

mosome). Another male (m45) also showed B-nucleoli in

only 10 % of diplotene cells, but it showed B-nucleoli

almost as large as the X chromosome and their ITS2_B

transcripts were molecularly detected. This might suggests

that the threshold for molecular detection of B-NOR

activity is about 10 %, with slight modifications depending

on the size of the B-nucleoli formed. However, molecular

detection was possible in m52 which showed only 5 % of

cells with B-nuceloli of size similar to that observed in

m74. Since we performed the cytological analysis of tissue

only from the testes whereas the molecular detection was

done in cDNA obtained from hemibodies (which contain a

mixture of transcripts from many tissues), this exception

observed in Torrox, and some of those mentioned above for

the other populations, could be due to differential expres-

sion of the B chromosome rDNA among tissues.

A comparison of the average values for these two

parameters between the Torrox population (Table 5) and

the three other populations (Tables 3, 4) showed that the

average area of B-nucleoli was similar in the two kinds of

population (Student t test: t = 0.46, df = 21, P = 0.65)

but, on the contrary, the proportion of cells showing

B-nucleoli was significantly higher in Torrox (t = 3.64,

df = 21, P = 0.0015). This higher expression level per

male explains the higher success of molecular detection of

B-NOR activity in Torrox (13 out of 14 males, i.e.[90 %),

in respect to the remaining populations (3 out of 9 males,

i.e. 33 %), and is consistent with the fact that B-NOR

Fig. 2 Representative results of PCR amplification of the ITS2_B

region. The gel shows the ladder, blank, positive control (C?) of the

ITS2_B (454 bp) and selected examples of B-carrying individuals

from Otıvar, Salobrena and Algarrobo showing different amplification

patterns: absence of ITS2_B transcripts (cDNA-), presence of

ITS2_B transcripts (cDNA?) and positive control for the presence of

the ITS2_B region in the genomic DNA of every B-carrying

individual (gDNA)

Table 2 Correspondence between cytological (nucleoli attached to

the Bs) and molecular (presence of ITS2_B transcripts in the cDNA)

analysis of B-NOR activity in males of the grasshopper E. plorans

Population Male Cytological Molecular

Otıvar’12 m15 ? ?

Otıvar’12 m24 ? -

Otıvar’12 m27 ? -

Salobrena’10 m15 ? -

Salobrena’10 m6 ? ?

Salobrena’10 m11 - ?

Salobrena’10 m17 ? -

Salobrena’10 m10 ? -

Algarrobo’10 m17 ? ?

Algarrobo’10 m20 - ?

Algarrobo’10 m4 ? -

Total 11 9 5

Table 3 Calculation of the

proportion of cells with active

and inactive B-NOR, based on

the presence or absence of

B-nucleoli, in the nine males

showing nucleoli attached to the

B chromosomes

The result of the molecular

detection experiment, showing

the presence of ITS2_B

transcripts, is indicated in the

last column on the right. SE

standard error

Population Male Cells with

B-nucleoli

Cells without

B-nucleoli

Total Proportion of

cells with

B-nucleoli

Molecular

detection

Otıvar’12 m15 2 22 24 0.08 ?

Otıvar’12 m24 2 25 27 0.07 -

Otıvar’12 m27 1 20 21 0.05 -

Salobrena’10 m15 1 25 26 0.04 -

Salobrena’10 m6 5 18 23 0.22 ?

Salobrena’10 m17 2 24 26 0.08 -

Salobrena’10 m10 1 19 20 0.05 -

Algarrobo’10 m17 4 28 32 0.13 ?

Algarrobo’10 m4 1 25 26 0.04 -

Total/mean (SE) 9 19 206 225 0.08 (0.02)

Genetica

12391

rDNA transcription in B chromosome variants

expression was observed in 48 % of B-carrying males from

Torrox (Ruiz-Estevez et al. 2012) but only in about 10 %

of those analyzed here from the other populations (calcu-

lated from Table 1, excluding the Torrox males).

Discussion

Our present results have shown that the expression of the

rDNA contained in the B chromosomes of the grasshopper

E. plorans, which had been previously detected in the

Torrox population for the B24 variant (Teruel et al. 2007,

2009; Ruiz-Estevez et al. 2012), also takes place in other

populations and B variants. The populations where B-NOR

activity was detected belong to a broad range of Spanish

regions including the South (Torrox, Otıvar, Salobrena and

Algarrobo) and the East (Mundo and San Juan) of the

Iberian Peninsula, as well as Balearic Islands (S’Esgleieta).

It is remarkable that no B-NOR activity was detected in

any of the 19 B-carrying males analyzed from Nerja, even

though this population is located at only eight Km east of

Torrox. However, it was observed in Algarrobo at about

10 km west of Torrox. The different B variants (B2 in

Nerja and B24 in Torrox) analyzed in both populations

Table 4 Relative B-nucleolus area in the nine males showing the presence of nucleoli attached to the B chromosomes in diplotene cells and its

correspondence with molecular detection of ITS2_B transcripts

Population Male Cell no. B-nucleolus

area (a.u.)

X chrom.

area (a.u.)

Relative B-nucleolus

area

Mean relative

B-nucleolus area

Molecular

detection

Otıvar’12 m15 22 10,159 26,305 0.39 0.51 ?

4 2,205 3,569 0.62

m24 22 13,034 10,219 1.18 1.11 -

27 8,608 9,226 0.93

m27 1 1,754 5,408 0.32 0.32 -

Salobrena’10 m15 11 10,588 18,253 0.58 0.58 -

m6 18 1,246 6,335 0.2 0.43 ?

1 5,049 7,975 0.63

20 2,441 5,313 0.46

22 7,081 14,284 0.5

7 3,696 10,073 0.37

m17 21 2,268 10,817 0.21 0.59 -

7 7,199 7,465 0.96

m10 8 8,433 27,573 0.31 0.31 -

Algarrobo’10 m17 10 4,510 15,752 0.29 0.45 ?

1 5,413 11,268 0.48

23 1,835 7,007 0.26

28 2,014 2,602 0.77

m4 22 5,694 9,860 0.58 0.58 -

Total/mean (SE) 9 19 0.54 (0.06)

SE standard error; a.u. arbitrary units

Table 5 Proportion of cells showing B-nucleoli and relative area of

the B-nucleolus in respect to the X chromosome area in the same cell

in 14 males from the Torrox population collected in 2008 and

reported by Ruiz-Estevez et al. (2012)

Male Proportion of

cells with

B-nucleoli

Relative

B-nucleolus

area

Molecular

detection

m54 0.50 0.53 ?

m49 0.30 0.40 ?

m58 0.20 0.42 ?

m67 0.25 0.34 ?

m52 0.05 0.41 ?

m45 0.10 0.96 ?

m74 0.10 0.38 -

m61 0.30 0.40 ?

m63 0.25 0.68 ?

m55 0.40 0.42 ?

m62 0.38 0.58 ?

m50 0.35 0.57 ?

m42 0.15 0.54 ?

m71 0.20 0.43 ?

Mean (SE) 0.25 (0.04) 0.50 (0.04)

Molecular detection of ITS2_B transcripts in these males. SE standard

error

Genetica

12392

might account for the different level of B-NOR expression

observed. However, B-NOR expression for B2 has been

observed in the nearby population of Algarrobo and in the

two eastern populations of Salobrena and Otıvar.

The frequency of males expressing the B-NOR varied

among the populations analyzed here (0–28.57 %) (see

Table 1), although the differences did not reach signifi-

cance (v2 = 13.57, df = 10, P = 0.19). Remarkably, all

these frequences were lower than that observed in Torrox

in 2008 (48 %) (Ruiz-Estevez et al. 2012). This suggests

that B chromosomes in other populations than Torrox are

mostly silenced, with only sporadic rDNA activity. The

ultimate reasons for B-NOR activity still remain obscure,

but rDNA methylation (Lopez-Leon et al. 1991) and/or H3

acethylation in the B chromosome (Cabrero et al. 2007) are

probably involved.

Remarkably, NOR activity has hitherto been detected in

three of the main B chromosome variants studied in the

present work, i.e. B1 (Mundo, San Juan, and S’Esgleieta),

B2 (Algarrobo, Otıvar and Salobrena) and B24 (Torrox), but

not in B5 (Fuengirola). B chromosomes in E. plorans

appear to be of recent origin (Munoz-Pajares et al. 2011),

and the widespread geographical distribution of B-NOR

expression on several B variants suggests that this func-

tional feature of these B chromosomes is an ancestral

condition. Most B chromosome variants also share their

molecular composition, being mostly made of two repeti-

tive DNAs, i.e. rDNA and a 180 bp tandem repeat DNA,

on which basis Cabrero et al. (1999) suggested the common

origin of all these B variants. The most widespread B

chromosome variant in the Iberian Peninsula is B1, for

which reason it is considered the ancestral B variant

(Henriques-Gil et al. 1984). The fact that this B variant

expresses the NOR in both the Iberian Peninsula (Mundo

population) and Balearic Islands (S’Esgleieta population)

is consistent with the ancestral condition of both the B1

variant and the B-NOR expression.

The B24 variant emerged a few decades ago in Torrox, a

population surrounded by populations where the most

frequent B chromosome was B2 and were devoid of B24

(Henriques-Gil and Arana 1990). B24 replaced B2 in this

population (Zurita et al. 1998) and has recently spread

towards the west (Algarrobo population) (Manrique-Poyato

et al. 2006) and also towards the east (Nerja population)

(Manrique-Poyato et al. submitted). The increase in

B-NOR expression observed in the B24 chromosome of

Torrox (and not in the other B variants) could thus be a

consequence of the molecular changes underwent by B2 in

Torrox to become into B24. The structural difference

between B2 and B24 is mainly due to changes in the relative

amount of the two main repetitive DNAs making up these

B chromosomes, with amplification of the 180 bp tandem

repeat DNA and deletion of part of the rDNA. Change in

rDNA amount could be a good candidate to trigger the

higher B-NOR activity in B24. Accordingly, higher tran-

scription rates have been observed in yeast for low copy

ribosomal DNA strains comparing with high copy strains

(Ide et al. 2010). However, other structural changes could

increase B-NOR activity, as previously shown for a centric

fusion between the B2 chromosome and the longest auto-

some in the Salobrena population (Cabrero et al. 1987). In

this last case, the centric fusion involved the loss of the

minute small arm of the B chromosome, and this could

imply the activation of the B-NOR. However, B24 has a

short arm similar to that shown by B2, suggesting different

causes in both cases.

Another factor presumably influencing the activity of

rRNA genes on different B variants is the level of occu-

pancy of the B-NOR by transposable elements with specific

site insertion in ribosomal RNA genes, which might inhibit

or hinder the transcription of B-rRNA genes. Indeed, the

28S rRNA genes show higher occupancy for the non-LTR

retrotransposon R2 in B24 than B2 (Montiel et al. in prep-

aration). However, R2 ability to limit rDNA expression

depends jointly on its copy number and its distribution

within the NOR since R2-free large rDNA blocks are

preferentially expressed (Eickbush et al. 2008; Zhou and

Eickbush 2009). The higher NOR activity for B24 might

thus be due to a higher clustering of R2 copies in this

variant than in others. Alternatively, this could be a sec-

ondary effect of R2 strategy for expression on the basis of

the increase in copy numbers from B2 to B24 (Montiel et al.

in preparation). The presence in E. plorans B-NORs of

other transposable elements specifically targeting rDNA,

such as R1 retrotransposons or pokey DNA transposon,

(Eickbush 2002; Penton et al. 2002) could also influence

B-NOR expression.

The molecular detection of the ITS2_B transcripts log-

ically depends on the degree of the B-NOR expression. At

cytological level, this dependence is mainly manifested by

the proportion of diplotene cells showing nucleoli associ-

ated to the distal region of the B (where the rDNA is

located). In fact, molecular detection of the ITS2_B tran-

script is unlikely under a threshold of about 10 % diplotene

cells with B-nucleoli (see Table 3). However, the likeli-

hood of molecular detection of B-NOR activity appears to

be independent of the size of the B-nucleoli (see Table 4).

This is because most B-nucleoli have an area about half the

size of the X chromosome, and this area is independent of

the number of cells displaying nucleoli.

The existence of males where B-NOR activity was

detected cytologically but not molecularly, and vice versa,

might be explained by the fact that we performed cyto-

logical detection on spermatocytes but molecular detection

in hemibodies including a random representation of many

different tissues, and suggests the possibility that B-NOR

Genetica

12393

rDNA transcription in B chromosome variants

expression varies between different tissues within a same

individual. This is an interesting question to explore in

future research.

The existence of a residual level of rRNA gene

expression in the B chromosomes from most E. plorans

populations indicates that some of the rRNA transcripts in

B-carrying males are B-derived. The possible biological

role of the B-derived transcripts will logically depend on

both their functionality and their abundance. We unknow

whether they are fully functional, but the low frequency of

males showing them, in most populations, suggests that

these parasitic B chromosomes are mostly repressed.

Acknowledgments We thank FJ Ruız-Ruano and T. Lopez for

technical assistance, and Karl Meunier for language revision. This

study was supported by a grant from the Spanish Ministerio de

Ciencia e Innovacion (CGL2009-11917) and Plan Andaluz de In-

vestigacion (CVI-6649), and was partially performed by FEDER

funds. M Ruız-Estevez was supported by a FPU fellowship from the

Spanish Ministerio de Ciencia e Innovacion.

References

Bakkali M, Cabrero J, Lopez-Leon MD, Perfectti F, Camacho JPM

(1999) The B chromosome polymorphism of the grasshopper

Eyprepocnemis plorans in North Africa I. B variants and

frequency. Heredity 83:428–434

Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic

characterization of Metynnis maculatus (Teleostei: Characifor-

mes): the description in Serrasalminae of a small B chromosome

bearing inactive NOR-like sequences. Caryologia 62:95–101

Becker SED, Thomas R, Trifonov VA, Wayne RK, Graphodatsky AS,

Breen M (2011) Anchoring the dog to its relatives reveals new

evolutionary breakpoints across 11 species of the Canidae and

provides new clues for the role of B chromosomes. Chromosome

Res 19:685–708

Bidau CJ (1986) A nucleolar-organizing B chromosome showing

segregation-distortion in the grasshopper Dichroplus pratensis

(Melanoplinae, Acrididae). Can J Genet Cytol 28:138–148

Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN,

Liapunova EA (1995) Nucleolus organizer regions and B-chro-

mosomes of field mice (Mammalia, Rodentia, Apodemus).

Genetika 31(2):185–192

Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernu-

merary chromosomes evolution in the Simulium vernum group

(Diptera: Simulidae). Genome 32:516–521

Cabrero J, Alche JD, Camacho JPM (1987) Effects of B chromo-

somes of the grasshopper Eyprepocnemis plorans on nucleolar

organizer regions activity. Activation of a latent NOR on a B

chromosome fused to an autosome. Genome 29:116–121

Cabrero J, Lopez-Leon MD, Bakkali M, Camacho JPM (1999)

Common origin of B chromosome variants in the grasshopper

Eyprepocnemis plorans. Heredity 83:435–439

Cabrero J, Bugrov A, Warchałowska-Sliwa E, Lopez-Leon MD,

Perfectti F, Camacho JPM (2003) Comparative FISH analysis in

five species of Eyprepocnemidine grasshoppers. Heredity

90:377–381

Cabrero J, Teruel M, Carmona FD, Jimenez R, Camacho JPM (2007)

Histone H3 lysine 9 acetylation pattern suggests that X and B

chromosomes are silenced during entire male meiosis in a

grasshopper. Cytogenet Genome Res 119:135–142

Camacho JPM (2005) B chromosomes. In: Gregory TR (ed) The

evolution of the genome. Academic Press, New York,

pp 223–286

Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al

(2007) Transcriptionally active heterochromatin in rye B chro-

mosomes. Plant Cell 19:1738–1749

Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B

chromosomes are weakly transcribed and might alter the

transcriptional activity of A chromosome sequences. Chromo-

soma 118:607–616

Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann

CC et al (2009) The genome of Nectria haematococca:

contribution of supernumerary chromosomes to gene expansion.

PLoS Genet 5(8):e1000618. doi:10.1371/journal.pgen.1000618

Derenzini M (2000) The AgNORs. Micron 31:117–120

Eickbush TH (2002) R2 and related site-specific non-long terminal

repeat retrotransposons. In: Craig NL, Craigie R, Gellert M,

Lambowitz AM (eds) Mobile DNA II. ASM Press, Washington,

DC, pp 813–835

Eickbush DG, Ye J, Zhang X, Burke WD, Eickbush TH (2008)

Epigenetic regulation of retrotransposons within the nucleolus of

Drosophila. Mol Cell Biol 28:6452–6461

Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA

transcription of euchromatic and heterocromatic chromosome

regions during grasshopper meiosis. Chromosoma 45:43–62

Graphodatsky AS, Kukekova AV, Yudkin DV et al (2005) The proto-

oncogene C-KIT maps to canid B-chromosomes. Chromosome

Res 13:113–122

Green DM (1988) Cytogenetics of the endemic New Zeland frog,

Leiopelma hochstetteri: extraordinary supernumerary chromo-

some variation and a unique sex-chromosome system. Chromo-

soma 97:55–70

Hall TA (1999) BioEdit: a user-friendly biological sequence align-

ment editor and analysis program for Windows 95/98/NT. Nucl

Acids Symp Ser 41:95–98

Henriques-Gil N, Arana (1990) Origin and substitution of B

chromosomes in the grasshopper Eyprepocnemis plorans. Evo-

lution 44:747–753

Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex

polimorphism in the grasshopper Eyprepocnemis plorans. Chro-

mosoma 89:290–293

Ide S, Miyazzaki T, Maki H, Kobayashi T (2010) Abundance of

ribosomal RNA gene copies maintains genome integrity. Science

327:693–696

Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of

transcriptional activity of the B-chromosome of Apodemus

peninsulae during pachytene. Chromosoma 100:278–281

Leach CR, Houben A, Bruce F, Pistrick K, Demidov D et al (2005)

Molecular evidence for transcription of genes on a B chromo-

some in Crepis capillaris. Genetics 171:269–278

Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev

Biochem 49:727–764

Lopez-Leon MD, Cabrero J, Camacho JPM (1991) A nucleolus

organizer region in a B chromosome inactivated by DNA

methylation. Chromosoma 100:134–138

Lopez-Leon MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM,

Santos JL (1993) Generating high variability of B chromosomes

in Eyprepocnemis plorans (grasshopper). Heredity 71:352–362

Lopez-Leon MD, Neves N, Schwarzacher T, Heslop-Harrison JS,

Hewitt GM et al (1994) Possible origin of a B chromosome

deduced from its DNA composition using double FISH tech-

nique. Chromosome Res 2:87–92

Lopez-Leon MD, Cabrero J, Camacho JPM (1995) Changes in NOR

activity in the presence of supernumerary heterochromatin in the

grasshopper Eyprepocnemis plorans. Genome 38:68–74

Genetica

12394

Manrique-Poyato MI, Munoz-Pajares AJ, Loreto V, Lopez-Leon MD,

Cabrero J et al (2006) Causes of B chromosome variant

substitution in the grasshopper Eyprepocnemis plorans. Chro-

mosome Res 14:693–700

Martis MM, Klemme S, Ali Mohammad Banaei-Moghaddam AM

et al (2012) Selfish supernumerary chromosome reveals its origin

as a mosaic of host genome and organellar sequences. Proc Natl

Acad Sci USA 109(33):13343–13346

Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In:

Olson MOJ (ed) The Nucleolus. Kluwer, New York, pp 10–20

Munoz-Pajares AJ, Martınez-Rodrıguez L, Teruel M et al (2011) A

single, recent origin of the accessory B chromosome of the

grasshopper Eyprepocnemis plorans. Genetics 187:853–863

Oliveira NL, Cabral-de-Mello RochaMF, Loreto V, Martin C, Moura

RC (2011) Chromosomal mapping of rDNAs and H3 histone

sequences in the grasshopper Rhammatocerus brasiliensis

(acrididae, gomphocerinae): extensive chromosomal dispersion

and co-localization of 5S rDNA/H3 histone clusters in the A

complement. Mol Cytogenet 4:24

Penton EH, Sullender BW, Crease TJ (2002) Pokey, a new DNA

transposon in Daphnia (Cladocera: Crustacea). J Mol Evol

55(6):664–673

Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the

African cichlid fish Haplochromis obliquidens harbour 18S

rRNA gene copies. BMC Genet 11:1

Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR

proteins, markers of proliferation related to ribosomal gene

activity. Exp Cell Res 214:465–472

Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992)

Nucleolin is an Ag-NOR protein; this property is determined by

its amino-terminal domain independently of its phosphorylation

state. Exp Cell Res 203:259–269

Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The

rDNA transcription machinery is assembled during mitosis in

active NORs and absent in inactive NORs. J Cell Biol

133:235–246

Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver

staining procedure for the localization of nucleolus and nucleolar

organizer under light and electron microscopy. Arch Biol

93:267–274

Ruiz-Estevez M, Lopez-Leon MD, Cabrero J, Camacho JPM (2012)

B-Chromosome Ribosomal DNA is functional in the grasshop-

per Eyprepocnemis plorans. PLoS ONE 7(5):e36600. doi:10.

1371/journal.pone.0036600

Ruiz-Ruano FJ, Ruiz-Estevez M, Rodrıguez-Perez J, Lopez Pino JL,

Cabrero J, Camacho JPM (2011) DNA amount of X and B

chromosomes in the grasshoppers Eyprepocnemis plo-

rans and Locusta migratoria. Cytogenet Genome Res

134:120–126

StatSoft, Inc. (2007) STATISTICA (data analysis software system),

version 8.0. www.statsoft.com

Stitou S, Dıaz de la Guardia R, Jimenez R, Burgos M (2000) Inactive

ribosomal cistrons are spread throughout the B chromosomes of

Rattus rattus (Rodentia, Muridae). Implications for their origin

and evolution. Chromosome Res 8(4):305–311

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus sizevariation during meiosis and NOR activity of a B chromosome in

the grasshopper Eyprepocnemis plorans. Chromosome Res

15:755–765

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative

analysis of NOR expression in a B chromosome of the

grasshopper Eyprepocnemis plorans. Chromosoma 118:291–301

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromo-

some ancestry revealed by histone genes in the migratory locust.

Chromosoma 119:217–225

van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR

activity and repeat sequences of the paternal sex ratio chromo-

some of the parasitoid wasp Trichogramma kaykai. Chromosoma

114:410–419

Yudkin DV, Trifonov VA, Kukekova AV et al (2007) Mapping of

KIT adjacent sequences on canid autosomes and B chromo-

somes. Cytogenet Genome Res 116:100–103

Zhou J, Eickbush TH (2009) The pattern of R2 retrotransposon

activity in natural population of Drosophila simulans reflects the

dynamic nature of rDNA locus. PLoS Genet 5:e1000386

Zurita S, Cabrero J, Lopez-Leon MD, Camacho JPM (1998)

Polymorphism regeneration for a neutralized selfish B chromo-

some. Evolution 52:274–277

Genetica

12395

rDNA transcription in B chromosome variants

96

Capítulo 5. B chromosomes in

Eyprepocnemis plorans are present in all

body parts analyzed and show extensive

variation for rDNA copy number

97

98

B chromosomes in Eyprepocnemis plorans are present in all body parts

analyzed and show extensive variation for rDNA copy number

Mercedes Ruíz-Estévez, Mª Dolores López-León, Josefa Cabrero Hurtado, Juan Pedro

M Camacho*

Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071

Granada, Spain

Short title: Mitotic stability of B chromosomes

Key words: B chromosomes, FISH, mitotic stability, qPCR, rDNA

99

Abstract

B chromosomes in the grasshopper Eyprepocnemis plorans are considered to be

mitotically stable because all cells analyzed in meiotic (primary spermatocytes and

oocytes) or mitotic (embryos, ovarioles and gastric caecum) cells within a same

individual show the same number of them. Nothing is known, however, the body parts

containing somatic tissues with no mitotic activity in adult individuals, which constitute

the immense majority of their body. The development of two B-specific molecular

markers has provided the opportunity to test for B chromosome presence in any body

part, even those lacking cell division activity. Therefore, we focused on two main

objectives: i) ascertaining whether B chromosomes are present in 8 different somatic

body parts from both sexes (head, cerebral ganglion, antennae, wing muscles, hind legs,

gastric caecum, Malphigian tubules and male accessory gland) as well as ovarioles in

females and testes in males, by means of PCR analysis, and ii) elucidating the number

of B chromosomes that an individual carries through quantifying its B-rDNA copy

number by qPCR. Our results indicated the amplification of both B-specific markers in

all analyzed body parts from B-carrying males, but not in those from B-lacking males.

However, we failed in our second objective due to high variation found between males

for the estimated number of rDNA units present in the B chromosomes. These results

demonstrate the presence of B chromosomes in all body parts of individuals and

suggest the occurrence of high variation in the rDNA content of the B chromosomes

carried by different individuals from a same population, presumably due to unequal

crossovers during meiosis.

Introduction

Supernumerary (B) chromosomes are dispensable extra chromosomes representing

specific kind of selfish genetic elements, appearing in about 15% of eukaryotic

genomes. They do not recombine with the standard (A) genome, are rich in repetitive

DNA such as satellite DNA, ribosomal DNA (rDNA) and mobile elements, and show

drive mechanisms guaranteeing their maintenance in natural populations (for review,

see Camacho 2005). Since mitotical instability constitutes the drive mechanism in many

B chromosome systems, the number of B chromosomes in the germ line becomes

higher than that in the somatic line (for review, see Jones, 1995), a thorough knowledge

of mitotic stability of B chromosomes is necessary in order to understand their

biological role. Of course, a decay of B chromosome numbers in somatic tissues could

actually make them less harmful for the host genome. In fact, the presence of higher B

frequency in the germ line than in the somatic line constitutes a common drive

mechanism for B chromosomes in both plants (e.g. Crepis capillaris, see Rutishauser

and Röthlisberger, 1966) and animals (e.g. Locusta migratoria, see Kayano, 1971). In

extreme cases, B chromosomes are apparently restricted to the germ line, as is the case

100

of the plants Aegilops mutica (Mochizuki, 1957; Ohta, 1986) and A. speltoides

(Mendelson and Zohari, 1972) where Bs are absent from roots but present in flowers.

The classical cytological analysis depends on the availability of tissues showing

mitotic (or meiotic) activity. In grasshoppers, B chromosome presence has traditionally

been analyzed in testes, ovarioles and gastric caecum, in adult as well as embryos. This

has shown that B chromosomes are mitotically stable (and thus show the same number

in all cells analyzed from a same individual) in Myrmeleotettix maculatus (John and

Hewitt 1965), Phaulacridium vittatum (Jackson and Cheung, 1967), Eyprepocnemis

plorans (Camacho et al., 1980) and Dichroplus pratensis (Bidau et al., 2004), but

mitotically unstable (thus showing different B numbers among cells within a same

individual) in Locusta migratoria (Nur, 1969; Kayano, 1971; Pardo et al., 1995),

Camnula pellucida (Nur 1969), and Dichroplus elongatus (Remis et al., 2004). In no

case it is known whether B chromosomes are eliminated from some somatic body parts.

In one of the species showing mitotically stable B chromosomes, E. plorans, we

have recently developed two molecular markers specific to B chromosomes, which

represent an opportunity to test for B presence in all kinds of somatic body parts

through PCR tests. These were a SCAR marker constituting part of the external spacer

of the 45S rDNA (Muñoz-Pajares et al., 2011), and an adenine insertion in the ITS2

region of the rDNA from the B chromosomes (ITS2_B marker) (Teruel, 2009; Ruiz-

Estévez et al., 2012; Teruel et al., submitted). These molecular markers have allowed us

to test the two following hypotheses: 1) Are B chromosomes present in all body parts?

2) Is B chromosome composition similar in all males from a same population, so that

the number of rDNA units in an individual could serve to infer the number of Bs it

carries? In this work, we test both hypotheses by analyzing, with these molecular

markers, the presence of B chromosomes in 10 different body parts, and estimating the

number of rDNA units in individuals from two natural populations carrying different B

variants.

Materials and methods

Biological material preparation

We collected 41 males and 7 females of E.plorans in Torrox (Málaga, Spain), and 12

males in Salobreña (Granada, Spain). They were anesthetized and dissected under

binocular microscope to take out a portion of the gonads, which was fixed in 3:1

ethanol-acetic acid (ovarioles were pretreated with 0,075% colchicine for 2h prior to

fixation) and stored at 4ºC. We froze in liquid nitrogen the whole bodies of 28 males

from Torrox and all of those from Salobreña, which were used in B-rDNA copy number

estimation. The remaining individuals were used in both B-rDNA copy number and B

presence analyses in different body parts, for which we froze them in different parts

(antenna, cerebral ganglia, head, hind leg, wing muscle, gonad, Malpighian tubules,

101

Mitotic stability of B chromosomes

gastric caeca and male accessory gland) in liquid nitrogen, and stored at -80ºC. The

number of B chromosomes of each male was determined by squashing two testis

follicles in 2% lacto-propionic orcein. In females, we performed C-Banding on squash

preparations of two ovarioles in 50% acetic acid (Camacho and Cabrero, 1983).

Genomic DNA (gDNA) was extracted from every tissue by using the “GenElute

Mammalian Genomic DNA Miniprep Kit” (Sigma) following manufacturer’s

recommendations, and DNA quality and quantity was measured with Tecan'sInfinite

200 NanoQuant.

B presence in the body parts

B chromosome presence was assessed in all body parts by PCR analysis of the SCAR

and ITS2_B markers, whose PCR products have 1510 bp and 484 bp, respectively,

following the protocols described in Muñoz-Pajares et al. (2011) and Ruiz-Estévez et al.

(2012). PCR products were visualized by electrophoresis in 1.5% agarose gels, the

amplified fragments were cloned into TOPO TA vector (Invitrogen) and subsequently

sequenced (Macrogen) to confirm sequence identity. We analyzed DNA sequences with

Bioedit software version 7.1.3.0 (Hall, 1999), and used BLAST (Basic Local Alignment

Search tool) at the NCBI site to search for sequence homology with the sequences

reported by Muñoz-Pajares et al. (2011) (accession number: FR681612) and Teruel et

al. (submitted) (accession numbers: JN811827-JN811902).

B-rDNA copy number estimation at the individual and body part levels

On the basis of the ITS2_B marker sequence, we designed a new F primer anchored

closer to the R one, in order to obtain a smaller PCR product appropriate for qPCR (we

named qITS2_B this shorter marker). To estimate rDNA copy number in the B

chromosome, we performed quantitative PCR (qPCR) on genomic DNA (gDNA) from

every individual and the results were analysed by means of the “Linear Regression

PCR” software (LingRegPCR; Feng et al., 2008). We previously compared this method

with the “Linear Regression of Efficiency” method (LRE; Rutledge et al., 2008), which

uses lambda gDNA as Calibrator Factor, and observed that LinRegPCR showed higher

reproducibility in most of the replicate runs, and had three advantages: 1) the

Calibration Factor carries your target sequence, 2) the software performs specific

quality checks in every single amplification curve, and 3) it gives a statistically analyzed

mean amplification efficiency value (Sommeregger et al., 2013). Reaction mixtures

contained 5µl 2X SensiMixTM

SYBR Mastermix (SensiMixTM

SYBR Kit, Bioline),

0.7µM each forward (ITSD: 5’ ACTTGGGAGCGTCGTGGTA 3’) and reverse primer

(ITSA: 5’ CGTTGTACGAAAGAGTTTGAG 3’) and 25ng gDNA, in a final volume of

15µl. Reactions were made in triplicate and, in each run, we included a negative control

without gDNA to ensure that the reagents were free of contaminating DNA. qPCR

102

program consisted of an initial denaturation at 95ºC for 10 min, 40 cycles of 94ºC for 30

s, 63ºC for 15 s, 72ºC for 15 s, and a final dissociation step to identify the unique and

specific amplification of the target sequence. The program was run in a Chromo4

(BioRad) thermal cycler and the Opticon Monitor v3.1 software was used to export the

raw data.

Fluorescent in situ hibridization (FISH)

We performed FISH on chromosome preparations obtained by squashing of two testis

follicles in 50% acetic acid, using a 1113 bp DNA probe from E.plorans 18S ribosomal

DNA (rDNA). This fragment was obtained using the 18S-E and 1100R primers

designed by Timothy et al (2000) with the following PCR conditions: an initial

denaturation at 94ºC for 3 min and 30 cycles of 94ºC for 30 s, 45ºC for 1 min, 72ºC for

2 min, and final extension of 72ºC for 7 min. Probe labeling and FISH protocol

employed was essentially that described in Cabrero et al. (1999). rDNA array size was

analysed under the BX41 Olympus epifluorescence microscope and photographs were

captured with a DP70 cooled camera. Images were composed and optimized for bright

and contrast with The Gimp freeware.

Statistical analyses

For statistical analysis, we first tested whether the variables assayed fitted a normal

distribution with the Kolmogorov-Smirnov test and, when necessary, they were log

transformed. Parametric analyses were then performed: Student t-test, one-way

ANOVA and mixed-model ANOVA were performed with the Statistica 6.0 software

(Statsoft Inc.).

Results

Analysis of B chromosome presence

The cytological analysis in the gonads of the individuals collected for the study of B

chromosome presence in different body parts showed that two females and seven males

lacked B chromosomes, whereas five females and six males carried them. After PCR

analysis, the two molecular markers of B chromosome presence (SCAR and ITS2_B)

showed amplification in all body parts analyzed (antenna, cerebral ganglia, head, hind

leg, wing muscle, testes, ovaries, Malpighian tubules, gastric caecum and male

accessory gland) on gDNA from B-carrying individuals, but not from B-lacking

individuals (Fig. 1).

103

Mitotic stability of B chromosomes

Fig. 1 Agarose electrophoresis gels showing the presence of the 1510 bp SCAR (a) and

the 484 bp ITS2_B fragments (b) after PCR amplification in the gDNA from the

different body parts in representative B-carrying males (m1 +B and m2 +B in a) and

females (f1 +B and f2 +B in b), and its absence in a B-lacking male (m3 0B in a) and

female (f3 0B in b) (he: head; ga: ganglion; an: antenna; Mt: Malphigian tubules; cae:

gastric caeca; tes: testis; le: hind leg; ag: accessory gland; ov: ovariole; wm: wing

muscles).

B-rDNA copy number estimation in male bodies

The estimation of rDNA copy number (qITS2_B) for the B24 chromosome was

performed on 28 males from the Torrox population, 5 of which lacked B chromosomes

and the remaining 23 carrying them (8 with 1B, 8 with 2B and 7 with 3B) (Table 1).

Surprisingly, there were 142 qITS2_B copies on average in B-lacking males, suggesting

the presence of a few copies in the standard A chromosomes. In the B-carrying males,

however, the number of qITS2_B copies was much higher,ranging from 557 (in a 2B

male) to 6434 (in a 3B male). This high variation was observed even between males

carrying the same number of B chromosomes (see Table 1). The number of qITS2_B

copies per B chromosome was calculated by subtracting the 142 copies observed in 0B

males and then dividing the remaining copies between the number of B chromosomes in

the same male. The estimated number of copies per B chromosome thus ranged from

208 to 3970, and there were not significant differences between 1B (mean= 1778, N= 8,

SD= 1311), 2B (mean= 1354, N= 8, SD= 683) and 3B males (mean= 1352, N= 7, SD=

638) for this parameter (One-way ANOVA: F= 0.53, df= 2, 20, P= 0.60). The average

copy number in the 23 B-carrying males was 1501 (SD= 921).

104

Table 1 Number of qITS2_B copies per genome in different

males from Torrox and number of copies corresponding to

one B24 in each male. The numbers in red correspond to the

males where the FISH was also performed.

Id Bs qITS2_B Discounting

0B copies

qITS2_B

per B

chromosome

TII'08 m70 0 165

TII'08 m53 0 178

TII'12 m8 0 98

TII'12 m12 0 114

TII'12 m32 0 153

Mean 142

TII'08 m49 1 567 425 425

TII'12 m1 1 934 792 792

TII'12 m3 1 966 824 824

TII'12 m5 1 969 827 827

TII'08 m66 1 1881 1739 1739

T0'12 m2 1 2513 2371 2371

TII'08 m69 1 3420 3278 3278

TII'08 m24 1 4112 3970 3970

TII'12 m2 2 557 415 208

T03 m8 2 1613 1471 736

TII'12 m14 2 1912 1770 885

TII'12 m13 2 2720 2578 1289

TII'08 m63 2 3837 3695 1848

TII'08 m55 2 3866 3724 1862

TII'12 m11 2 4078 3936 1968

TII'12 m9 2 4217 4075 2038

T04 m110 3 1540 1398 466

TII'08 m62 3 2343 2201 734

T0'12 m1 3 3534 3392 1131

TII'08 m50 3 3732 3590 1197

TII'08 m42 3 5780 5638 1879

TII'08 m71 3 6020 5878 1959

T'04 m105 3 6434 6292 2097

We also estimated the number of qITS2_B copies for the B2 chromosome in 12 males

from the Salobreña population (3 with 0B, 5 with 1B and 4 with 2B). B2 chromosomes

showed higher amounts of qITS2_B copies, ranging from 4818 to 13658 (Table 2), with

average (8595; SD= 3075) being almost six times larger than the figure observed in

Torrox (t= 10.18, df= 30, P<0.000001). However, there were not significant differences

in copy number estimations per B between 1B (mean= 8387, N= 5, SD= 2874) and 2B

(mean= 8856, N= 4, SD= 3746) males (t= 0.21, df= 7, P= 0.42).

105

Mitotic stability of B chromosomes

Table 2 Number of qITS2_B copies per genome in different

males from Salobreña and number of copies corresponding to

one B2 in each male.

Id Bs qITS2_B Discounting

0B copies

qITS2_B per B

chromosome

Sal'10 m7 0 81

Sal'08 m3 0 89

Sal'10 m23

Mean

0 96

89

Sal'10 m1 1 4907 4818 4818

Sal'10 m11 1 7195 7106 7106

Sal'10 m25 1 7698 7609 7609

Sal'10 m10 1 10237 10148 10148

Sal'10 m16 1 12343 12254 12254

Sal'10 m8 2 10779 10690 5345

Sal'10 m13 2 13081 12992 6496

Sal'10 m2 2 19938 19849 9925

Sal'10 m19 2 27405 27316 13658

In order to test the reliability of this result, we performed FISH analysis in six

males (three from each population) with disparate qITS2_B copy number estimations

(highlighted in red in Tables 1 and 2). Even though FISH is not a quantitative technique,

it was apparent that the B chromosomes with higher copy numbers showed larger FISH

signals with rDNA probe (Fig. 2).

Fig. 2 FISH with a 18S rDNA probe (green) and DAPI counterstaining (blue) for X

(left) and B (right) chromosomes from three males collected at Torrox (upper panel) and

three other collected at Salobreña (lower panel). In each male, the X chromosome came

from the same cell as the B chromosome, and is included here for size comparison. Note

that the differences between males for the size of the rDNA cluster in the B

chromosome are parallel to the difference in the number of rDNA units per B

chromosome.

106

No qITS2_B copy number variation among body parts

In order to analyze whether the huge variation in the number of qITS2_B copies was

generated during ontogeny, we analyzed six somatic body parts (antenna, head, gastric

caecum, wing muscle, hind leg and Malphigian tubules) in the same 13 males and 7

females from Torrox where we performed the B presence analysis. Copy number was

transformed to natural logarithms and thus showed a normal distribution (Kolmogorov-

Smirnov test: P>0.20). A mixed-model ANOVA showed the absence of significant

differences in qITS2_B copy numbers among sexes or body parts, but it depended

significantly on the number of B chromosomes, and there was significant interaction

between sex and B number because the sample of males showed higher B frequency

(Table 3). This result indicates the absence of significant variation for the number of

qITS2_B copies during ontogeny of the somatic line.

Table 3 Mixed-model ANOVA of qITS2_B copies in 7 females and 13 males of E.

plorans, with sex and number of B chromosomes (Bs) as fixed factors, and body part

(b.part) as random factor. Six somatic body parts were analyzed in both sexes:

antenna, head, gastric caecum, wing muscle, hind leg and Malphigian tubules.

Effect df MS df MS F P value

{1}sex *Fixed 1 0.68 4.70 0.30 2.23 0.198932

{2}Bs *Fixed 3 68.32 12.91 0.40 169.18 <0.000001

{3}b.part *Random 5 2.56 1.26 0.31 8.36 0.201124

1*2 Fixed 1 16.57 4.14 0.33 50.79 0.001805

1*3 Random 5 0.30 5.94 0.32 0.94 0.517548

2*3 Random 15 0.41 5.74 0.36 1.15 0.465627

1*2*3 Random 5 0.35 67.00 0.77 0.45 0.809379

Discussion

Eyprepocnemis plorans is a grasshopper in which B chromosomes have profusely been

cytologically analyzed in a few body parts showing cell division activity, i.e. testes,

ovarioles and gastric caecum in adults, and ten-day old embryos. The absence of

intraindividual variation for the number of B chromosomes in these body parts indicates

that these Bs are mitotically stable (Camacho et al., 1980; Henriques-Gil et al., 1986).

However, what happens in the rest of the body parts remained unknown. Our present

results clearly indicate that B chromosomes are present in all eight somatic body parts

analyzed (antenna, cerebral ganglion, head, hind leg, wing muscle, Malpighian tubules,

gastric caecum and male accessory gland) in addition to the gonads in both sexes. No

such comprehensive analysis of intraindividual presence of B chromosomes had

hitherto been done in any organism. This leads to the inference that B chromosomes in

the grasshopper E. plorans are present in all body parts, and that they are not eliminated

107

Mitotic stability of B chromosomes

from any somatic body part, thus behaving in a regular way during the mitotic

development of individuals. Knowing this is very important to assess the possible

harmful effects of B chromosomes at the level of the different phenotypic traits, and

allows us to conclude that B chromosomes in this species can potentially exert effects

on every organ or tissue.

Our analysis of copy number for the qITS2_B sequence has revealed several

interesting facts. First, we hitherto believed that this sequence is B-specific because, by

conventional PCR analysis, it was amplified only in B-carrying genomes (Ruíz-Estévez

et al., 2012). However, qPCR has shown the possible presence of a few copies (142 on

average) in the A genome (i.e. in B-lacking individuals). This is suggestive for the

presence of the adenine insertion, on which the R primer was based, in at least one of

the A chromosomes, presumably those from which the B chromosome arose. This needs

further research. Second, the copy number estimations showed a very high range of

variation among B-carrying individuals (208-3970 per B24, and 4818-13658 per B2).

These non-overlapping ranges for both B variants clearly show the dynamic nature of

the rDNA present in the E. plorans B chromosomes, and support previous suggestions

that B24 derived from B2, and that this implied loss of rDNA (Henriques-Gil and Arana

1990; Zurita et al., 1998; Cabrero et al., 1999). Third, the analysis of six somatic body

parts in 7 females and 13 males from Torrox has shown that the number of qITS2_B

copies increases significantly with B chromosome number, but there was not significant

variation among body parts, thus suggesting that ontogeny does not contribute

significantly to increase B chromosome variation for rDNA amount in the somatic line.

The origin of such an extensive variation for rDNA amount in the B

chromosomes of E. plorans, a fact observed in the two natural populations analyzed,

most likely have something to do with meiosis since it is clearly a population fact which

does not occur in somatic body parts within individuals (see above). It has been shown

that B chromosomes in this species do form bivalents when two or more of them are

present during meiotic prophase, and chiasmata are exclusively observed at two

positions (Henriques-Gil et al., 1984). Most frequently, chiasmata are interstitially

located between two C-bands, composed of a 180 bp tandem repeat (López-León et al.,

1994, 1995), but chiasmata can also be observed at distal locations, i.e. where the rDNA

is located. The mean chiasma frequency estimated by Henriques-Gil et al. (1984) was

0.49 and 0.08 for interstitial and distal locations on the B1 chromosome, whereas these

figures were 0.54 and 0.04 for the B2 one. This gives a chance for unequal crossover to

generate changes in the amount of rDNA carried by B chromosomes of different

individuals from the same population.

A corollary of our present results is that the number of qITS2_B copies can not

be used to ascertain how many B chromosomes there are in a given individual due to

the extensive variation shown by the B chromosomes carried by different individuals.

At cytological level, most B chromosomes observed in different individuals appear to

be the same, but detailed FISH analysis has shown that those found in different

individuals show conspicuous differences in the size of the rDNA FISH signal on the B

chromosome, and that they are roughly correlated with the number of qITS2_B copies

108

estimated by qPCR (see Fig. 2). Previous differential amplification of rDNA has been

reported in barley translocation and duplication lines (Subrahmanyam et al., 1994). It is

also conceivable that extensive variation in rDNA amount can be masked by the high

degree of compaction that the B chromosomes show during cell division, especially at

meiotic stages where they are usually observed.

Our present results have not detected significant differences in the number of

qITS2_B copies among six somatic body parts, suggesting that a B chromosome

essentially carries the same number of copies in all cells within a same individual. This

contrasts with previous observations by Fox (1970) suggesting differential nuclear DNA

replication among different tissues in Schistocerca gregaria and Locusta migratoria,

and with copy number differences for ribosomal genes found among tissues of the same

individual of several plant species (Rogers and Bendich, 1989). But the fact that B

chromosomes sometimes contribute some rDNA transcripts to cells (Ruiz-Estévez et al.,

2012, 2013) opens the possibility that this behavior might differ among tissues, with

varying effects depending on whether these transcripts are fully functional or not. This

is an interesting topic for future research.

In conclusion, we show here how B chromosome presence in the different body

parts from the same individual can be investigated by means of B-specific molecular

markers. We have applied this approach to a mitotically stable B chromosome, and it

has showed that B chromosomes are present in all body parts analyzed. This approach is

even more crucial for mitotically unstable B chromosomes, since it can reveal whether

B chromosome mitotic instability leads to their elimination from any somatic tissue

with the consequent relief of B chromosome harboring and the attenuation of its

harmful effects. Moreover, we have revealed by qPCR and FISH that there is extensive

variation in B-rDNA copy number, for which reason the molecular approach was not

useful for estimating the number of B chromosomes in an individual, or whether all

body parts within an individual carry the same number of B chromosomes.

References

Bidau CJ, Rosato M, Martí DA (2004) FISH detection of ribosomal cistrons and

assortment-distortion for X and B chromosomes in Dichroplus

pratensis (Acrididae). Cytogenet Genome Res 106:295–301. doi:

10.1159/000079302

Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999) Common origin of B

chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity

83:435-439

Camacho JPM, Carballo AR, Cabrero J (1980) The B chromosome system of the

grasshopper Eyprepocnemis plorans sub. Plorans (Charpentier). Chromosoma

80:163-166

Camacho JPM, Cabrero J (1983) Karyological differences between two species of

grasshoppers genus Acrotylus (Acrididae: Oedipodinae). Caryologia 36 (2): 121-

127

109

Mitotic stability of B chromosomes

Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of the

genome. New York: Academic Press. pp 223–286

Feng J, Zeng R, Chen J (2008) Accurate and efficient data processing for quantitative

real-time PCR using a tripartite plant virus as a model. BioTechniques 44:901-

912

Fox DP (1970) A non-doubling DNA series in somatic tissues of the

locusts Schistocerca gregaria (Forskål) and Locusta migratoria (Linn.).

Chromosoma 29:446-61

Hall, TA (1999) BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucl. Acids Symp Ser 41:95-98

Henriques-Gil N, Arana P, Santos JL (1984) Factors affecting the meiotic pairing

behaviour of B chromosomes in the grasshopper Eyprepocnemis plorans. Can. J.

Genet. Cytol. 26: 664-668.

Henriques-Gil N, Jones GH, Cano MI, Arana P, Santos JL (1986) Female meiosis

during oocyte maturation in Eyprepocnemis plorans (Orthoptera: Acrididae).

Can J Genet Cytol 28:84-87

Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the

grasshopper Eyprepocnemis plorans. Evolution 44:747-753

Jackson WD, Cheung DSM (1967) Distortional meiotic segregation of a supernumerary

chromosome producing differential frequencies in the sexes in the short-horned

grasshopper Phaulacridium vittatum. Chromosoma 23(1):24-37

John B, Hewitt GM (1965) The B-chromosome system of Myrmeleotettix maculatus

(Thunb.). I. The mechanics. Chromosoma 16(5): 548-578

Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol 131:

411-434

Kayano H (1971) Accumulation of B chromosomes in the germ-line of Locusta

migratoria. Heredity 27:119–123

Lima-de-Faria A (1959) Differential uptake of tritiated thymidine into hetero- and

euchromatin in Melanoplus and Secale. J Biophys Biochem Cytol 6:457–466

López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,

Camacho JPM (1994). Possible origin of a B chromosome deduced from its

DNA composition using double FISH technique. Chromosome Res. 2:87–92.

López-León MD, Vázquez P, Hewitt GM, Camacho JPM (1995). Cloning and sequence

analysis of an extremely homogeneous tandemly repeated DNA in the grasshopper

Eyprepocnemis plorans. Heredity 75:370-375.

Mendelson D, Zohary D (1972) Behaviour and transmission of supernumerary

chromosomes in Aegilops speltoides. Heredity 2:329-339

Mochizuki A (1957) B chromosomes in Aegilops mutica Boiss. Wheat Inform. Serv.

5:9-11

Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,

Perfectti F (2011). A Single, recent origin of the accessory B chromosome of the

grasshopper Eyprepocnemis plorans.Genetics 187:853–863

Nur U (1969) Mitotic instability leading to an accumulation of B-chromosomes in

grasshoppers. Chromosoma 27(1):1-19

Ohta S (1986) A study on B chromosomes in Aegilops mutica Boiss. 1. Distribution

within individuals and transmission. Jpn J Genet 6:608-609

Pardo MC, Lopez-Leon

MD, Viseras

E, Cabrero

J, Camacho

JPM (1995) Mitotic

instability of B chromosomes during embryo development in Locusta

migratoria. Heredity 74:164–169. doi:10.1038/hdy.1995.24

110

Remis MI, Vilardi JC (2004) Mitotically unstable B chromosome polymorphism in

the grasshopper Dichroplus elongatus. Cytogenet Genome Res 106(2-4):359-

364

Rogers SO, Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy

number and in the intergenic spacer. Plant Molcelular Biology 9:509-520

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome

Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS

ONE 7(5): e36600. doi:10.1371/journal.pone.0036600

Ruíz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is

active in different B chromosome variants of the grasshopper Eyprepocnemis

plorans. Genetica 141:337-345

Rutishauser A, Röthlisberger E (1966) Boosting mechanism of B chromosomes in

Crepis capillaris. Chromosomes Today 1:28–30

Rutledge RG, Stewart D (2008) A kinetic-based sigmoidal model for the polymerase

chain reaction and its application to high-capacity absolute quantitative real-time

PCR.BMC Biotechnol 8:47

Sommeregger W, Prewein B, Reinhart D, Mader A, and Kuner R (2013) Transgene

copy number comparison in recombinant mammalian cell lines: critical

reflection of quantitative real-time PCR evaluation. Cytotechnology 65:811–818

Subrahmanyam NC, Bryncelsson T, Hagberg P, Hagberg A (1994) Differential

amplification of rDNA repeats in barley translocation and duplication lines: role

of a specific segment. Hereditas 121:157-170

StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.

www.statsoft.com

Taylor JH (1960) 464 Asynchronous duplication of chromosomes in cultured cells of

Chinese hamster. J Biophys Biochem Cytol 7:455–464

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis

plorans. Chromosome Res 15:755–765

Teruel M (2009) Origen, expresión y efectos fenotípicos de un parásito

genómico. PhD. Universidad de Granada

Timothy D, Littlewood J, Olson PD (2000) Small subunit rDNA and the

platyhelminthes: signal, noise, conflict and compromise. In: Interrelationships of

the Platyhelminthes (eds. D.T.J. Littlewood & R.A. Bray). CRC Press. UK. 380

pp

Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism

regeneration for a neutralized selfish B chromosome. Evolution 52:274–277

111

Mitotic stability of B chromosomes

112

Capítulo 6. Ribosomal DNA on a B

chromosome shows differential expression

level in several body parts of the grasshopper

Eyprepocnemis plorans

113

114

Ribosomal DNA on a B chromosome shows differential expression

level in several body parts of the grasshopper Eyprepocnemis plorans

Mercedes Ruiz-Estévez1, Jozef Vanden Broeck

2, Francisco Perfectti

1, Mª Dolores

López-León1, Josefa Cabrero

1, Juan Pedro M. Camacho

1*

1 Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071

Granada, Spain

2 Animal Physiology and Neurobiology, Zoological Institute, K.U. Leuven,

Naamsestraat, 59, B-3000 Leuven, Belgium

Short title: rDNA differential expression in body parts

Keywords: B chromosome, rDNA, differential expression, qRT-PCR

115

Abstract

Ribosomal DNA (rDNA) plays a main role in ribosome biogenesis, a central process in cellular biology influencing cell growth and development. rDNA is also one of the two

main repeated DNA sequences composing the supernumerary (B) chromosomes of the

grasshopper Eyprepocnemis plorans. The heterochromatic nature of these B

chromosomes suggested their genetic inertness, but the activity of their rDNA detected

by cytological and molecular methods have completely changed this view. Here we test,

by means of qRT-PCR for a target sequence specific to B chromosomes, whether the B-

rDNA is active in six different body parts of nine B-carrying males where B-rDNA

activity had previously been detected. We found that B-rRNA transcripts were present

in RNA extracted from all six body parts analyzed (head, hind leg, wing muscle, testis,

accessory gland and gastric caecum) and that their frequency increases with B

chromosome number. There were also significant differences in relative quantification

(RQ) values between the six body parts analyzed, with three of them (testis, accessory

gland and wing muscle) showing three times higher RQ than the three other,

presumably due to higher rRNA requirements in the moment at which they were frozen.

It was remarkable that two of the body parts showing higher contribution of rRNA by

the B chromosome (testis and accessory gland) are involved in male reproduction,

whereas the third (wing muscle) is important for survival. The possible meanings of

these apparently beneficial effects on males are discussed in the light of the current

theories of B chromosome evolution.

Introduction

In eukaryotes, 45S ribosomal DNA (rDNA) is one of the most abundant tandem

repetitive DNAs in the genome. Each cistron contains three ribosomal (rRNA) genes,

18S, 5.8S and 28S, separated by the Internal Transcribed Spacers 1 and 2 (ITS1 and

ITS2) and flanked by the External Transcribed Spacers (ETSs) and the Intergenic

Spacer (IGS) (Long and David, 1980). After transcription, the rRNA gene products will

form part of the two ribosome subunits and the ITSs are eliminated during transcript

maturation (Sollner-Webb y Tower, 1986). The rDNA array is placed at the secondary

constrictions of the chromosomes, where the Nucleolar Organizer Regions (NORs) are

located (Heitz, 1931; McClintock, 1934).

Activation of rDNA transcription is dependent on cell status, with high energetic

requirements being accompanied by high transcription rates. However, only about 50%

of the rDNA repeats are usually transcribed (Reeder, 1999) at a given moment. The

phenotypic visualization of rRNA transcription is the nucleolus, which appears attached

to the NORs. The size of the nucleolus is positively correlated with the rate of rRNA

synthesis (Mosgoeller, 2004). Since the nucleolus is constituted by acidic and highly

argyrophilic proteins, a simple silver impregnation technique is enough to visualize

them (Rufas at al., 1982). This technique specifically reveals the transcriptional

116

machinery of the RNA polimerase I, including the B23, nucleolin, UBF proteins and

RNA pol I subunits (Roussel at al., 1992; Roussel and Hernandez-Verdun 1994;

Roussel at al., 1996).

Eyprepocnemis plorans is a grasshopper species which possesses an extra

amount of rDNA located in supernumerary (B) chromosomes. This species shows a

standard (A) genome composed by 22 + X0/XX chromosomes, and a high variety of B

chromosomes, i.e. dispensable chromosomes which do not recombine with A

chromosomes and do not follow Mendelian rules (for review, see Camacho at al., 2003;

Camacho, 2005). B chromosomes are mainly composed of repetitive DNA sequences,

such as ribosomal DNA (rDNA), satellite DNA (satDNA) and transposable elements.

Due to the heterochromatic nature of B chromosomes, they were considered for long as

genetically inert elements. Activity of the B-rDNA in E.plorans was first reported by

Cabrero at al. (1987) in a male carrying the B chromosome fused to the longest

autosome. Teruel at al. (2007) later showed that this was not a unique case, by finding

recurrent B-NOR activity in the Torrox population, a fact that has been corroborated by

detecting B-specific ITS2 rDNA transcripts (Ruiz-Estévez at al., 2012), based on a

characteristic adenine insertion being found only in ITS2 sequences obtained from

microdissected B chromosomes (Teruel et al., submitted). More recently, it has been

shown that B chromosomes belonging to other variants also show B-NOR activity in

several Spanish populations although at rates lower than that observed in Torrox (Ruiz-

Estévez at al., 2013). All previous studies of B-rDNA activity in E.plorans have been

performed cytogenetically in testes and molecularly in samples of the whole body

without distinguishing among body parts, so it was impossible to know whether B

activity was a general characteristic or else there are differences among cell types. Here,

our main aim is to answer the questions: Is B-rDNA expression a phenomenon

occurring in all body parts of a male? If the answer is yes, is there differential

expression between body parts?

The first example of differential rDNA expression was detected in

Plasmodium berghei, where different rRNA “types” were transcribed depending on the

stage of the life cycle (Gunderson at al., 1987). Previous results have shown that 18S

transcription is regulated in different cell and tissue types, depending on the protein

synthesis required by the individual (Hanna at al., 1998). Differential rDNA expression

between tissues has recently been detected in abalone Haliotis tuberculata (Van

Wormhoudt at al., 2011). However, the possibility of B-rDNA differential expression

among body parts has not yet been analyzed in any animal. However, differential

expression of B chromosome sequences between plant tissues has recently been reported

in rye, in a study focused on pseudogene-like fragments residing in a B chromosome

(Banaei-Moghaddam at al., 2013).

Here we analyze molecularly the differential rDNA expression of the B24

chromosome in several body parts (head, hind leg, wing muscle, testis, accessory gland

and gastric caecum) of males where previously we had detected active B-NORs in the

gonads by silver impregnation. We detected the presence of B-rDNA transcripts in all

body parts analyzed and the relative quantity of B-specific transcripts varied among

them.

117

rDNA differential expression in body parts

Materials and methods

Biological samples

A sample of 23 males of the grasshopper Eyprepocnemis plorans was collected in the

Torrox population (Málaga, Spain). At the laboratory, they were anesthetized and

dissected to remove a portion of each testicle which was then fixed in freshly prepared

3:1 ethanol–acetic acid and stored at 4°C for cytological analysis. At the same time, we

dissected, under a stereomicroscope, different body parts (head, hind leg, wing muscle,

testes, accessory gland and gastric caecum), which were frozen in liquid nitrogen and

stored at -80ºC for molecular studies. Determination of B number in each male was

performed by squashing two testis tubules in 2% lacto-propionic orcein. rDNA

expression of the B chromosome was first analyzed by submitting testis follicles to

silver impregnation following the protocol described in Rufas at al. (1982), with an

additional 1% Giemsa stain step to differentiate the chromatin (blue-green) from the

nucleoli (brown). In both techniques, we visualized primary spermatocytes at prophase

or metaphase I under an Olympus microscope (DP70). At least 20 diplotene cells per

male were visualized to analyze B-rDNA expression, manifested by the presence of

nucleoli attached to the B chromosomes.

Total RNA extractions and complementary DNA (cDNA) synthesis

Total RNA extractions from frozen body parts were performed using Lipid Tissue Mini

Kit (Qiagen) following manufacturer’s recommendations. After extraction, we

submitted the RNA to another 20U DNase post-treatment (RNase-Free DNase Set,

Qiagen) to discard any genomic DNA contamination. Quantity and purity of the RNA

were measured with a NanoDrop spectrophotometer (version 3.1.2., NanoDrop

Technologies, Inc. Wilmington, DE. USA), and the quality was checked in a denaturing

agarose gel to ensure the absence of nucleic acid degradation. We reverse-transcribed

100 ng per sample of total RNA (PrimeScript™ RT reagent Kit, Perfect Real Time,

Takara) using a combination of random and oligo dT primers. The resulting cDNA was

diluted in RNase-DNase free water 1:10 (work solution).

B-rDNA expression in different body parts

Target and housekeeping genes primers

B-rDNA expression analysis was performed in the six body parts of 9 males showing

active B-NOR in the testis. For this purpose, we amplified in the cDNA the qITS2_B

target sequence, which is part of the ITS2_B, a DNA sequence being specific to B

chromosomes (Teruel et al., submitted; Ruiz-Estévez et al., 2012), but with primers

designed to yield a short sequence of only 152 bp, which is more appropriate for qPCR.

118

qIT2_B was amplified using the same reverse primer as the ITS_B sequence and a new

forward primer (ITSD: 5’ ACTTGGGAGCGTCGTGGTA 3’), designed using the

Primer 3 v.0.4.0 software. To amplify the housekeeping genes (HKGs), we used the

primers provided by Van Hiel et al. (2009) and Chapuis at al. (2011) for Tubulin

(TubA1), Armadillo (Arm), Actin (Act), GAPDH, Ubiquitin (Ubi), Elongation Factor

1α (EF1α), Ribosomal Protein 49 (RP49) and CG13220. Primers for both target and

HKGs were tested by quantitative retrotranscription-polymerase chain reaction (qRT-

PCR) with different conditions (see below). PCR products were visualized in a 1.5%

agarose gel, cleaned with Gen EluteTM PCR Clean-Up Kit (Sigma), sequenced by

Macrogen Inc, and analyzed with BioEdit software (version 7.1.3.0.) (Hall 1999) before

searching for sequence homologies at the NCBI site using BLAST (Basic Local

Alignment Search tool).

Housekeeping reference genes validation and relative quantification of B-rDNA

expression

After ensuring the specificity of the HKGs primers, we determined the most stable

HKGs in our samples carrying out a geNorm analysis. Standard curves were used to

determine the efficiency of the selected HKGs. Then we estimated the relative

expression level of qITS2_B in the body parts performing qRT-PCR. The reaction

mixtures contained 5µl 2X SensiMixTM

SYBR Mastermix (SensiMixTM

SYBR Kit,

Bioline), 0.7µM each forward and reverse primer and 5ng cDNA, in a final volume of

15µl. We performed two types of qRT-PCRs due to the need of different PCR

conditions, one for HKGs and other for target gene amplifications, since the latter

required fine tuning of the reverse primer and high melting temperature to avoid

unspecific amplification. We amplified the same calibrator sample (comprising cDNA

synthesized from RNA of different body parts) in each run to ensure that data resulting from the experimental samples were comparable. qRT-PCR assays were run in the

Chromo4 Real Time PCR thermocycler (BioRad), and PCR conditions were the

following: an initial denaturation at 95ºC for 10 min, 40 cycles of 94ºC for 30 s, 60ºC for

30 s (HKGs) or 73.2ºC for 15 s (target sequence), 72ºC for 15 s, and a melting curve step

to check the specificity of the reaction. We included a negative control without cDNA to

ensure that the reagents were free of contaminating DNA. Where possible, reagents were

combined in mixed solutions to minimize the number of manipulations, and each sample

was amplified in triplicate and the entire experiment was done in duplicate. Opticon

Monitor v3.1. software was used to export the qRT-PCR raw data from the Chromo4

instrument and Relative Quantification (RQ) of the transcript was obtained following the

“Efficiency calibrated mathematical method for the relative expression ratio in real-time

PCR” (Roche Applied Science, Technical Note No. LC 13/2001).

119

rDNA differential expression in body parts

Statistical analysis

To compare RQ levels between the six body parts analyzed from nine males with two

replicates, we performed a generalized randomized block design, with individual as a

random block and body part as a fixed factor. The statistical analysis was made in R (R

Development Core Team, 2008) by means of a linear mixed-effects model (LMM), with

post-hoc multiple comparisons by Tukey contrasts.

Results and discussion

To analyze the relative B-rDNA expression between body parts, by qRT-PCR, we chose

9 males with active B-NOR, i.e., showing nucleoli attached to a B chromosome in

diplotene cells (Fig. 1). Four of these males carried 1B, three 2B, one 3B and one 4B.

Fig. 1 Diplotene cell from a Torrox male carrying 3B chromosomes, one of them

showing an attached nucleolus (B= B chromosome; X= X chromosome; nu= nucleolus).

Bar= 5µm.

Total RNA extracted from the body parts of the 9 males and subsequently

DNase retreated showed high purity as was indicated by the absorbance ratio 260:280

nm (=1.9-2). Some of the HKGs showed two peaks (unspecific amplification) in the

melting curve graph (results not shown), for which reason they were rejected as

reference genes. After sequencing and confirming the three remaining HKGs (RP49,

Tub1A and Armadillo), the geNorm analysis determined that Tub1A and Armadillo were

the most stable HKGs in our samples. HKGs and target primers showed amplification

efficiency values of 95-105%. The target sequence qITS2_B had homology with the

ITS2

120

sequences reported by Teruel at al. (submitted) for this species (accession numbers:

JN811827 to JN811902).

We obtained amplification of the qITS2_B sequence in the cDNA of each body

part of the nine males (see Table S1), with the single exception of the gastric caecum of

one of the 1B males. This suggests that the expression of the rDNA of the B

chromosome takes place in all body parts analyzed, and is not restricted to the gonads

only.

The RQ values for qITS2_B expression showed significant differences between

the body parts of the 9 males (LMM: F= 8.21, df= 5, 92, P<0.0001), with three of them

(testis, male accessory gland and wing muscle) showing RQ values about three times

higher than those of the three remaining ones (hind leg, gastric caecum and head) (Figure

2). Multiple post-hoc comparisons, by means of Tukey contrasts, indicated that the

differences between these two kinds of body parts were significant (Table S2).

M ean M ean±S E M ean±1,96*S E

H H L W M T A G G C0,0

0,5

1,0

1,5

2,0

2,5

3,0

RQ

Fig. 2 Expression levels of the qITS2_B in six body parts of 9 males carrying active B24

chromosomes. (H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG=

Accessory gland, GC= Gastric caecum).

It is conceivable that this differential expression of the B-rDNA between body

parts could have something to do with higher demands for rRNA in them, at least at the

moment at which they were frozen. It has been shown in E.plorans testis that total cell

nucleolar area (NA) did not show intraindividual significant difference between cells

showing active B-NORs and those showing inactive ones, suggesting that total cell

121

rDNA differential expression in body parts

demands for rRNA are tightly regulated, irrespectively of how many chromosomes are

contributing rRNA (Teruel at al., 2007, 2009). Therefore, it is possible that some tissues

at certain moments of higher metabolic activity (in terms of protein synthesis) could take

advantage of the rRNA produced in the nucleoli organized by the B chromosome.

Differential expression of the qITS2_B (i.e. B-rDNA) could be due to structural

and/or epigenetic changes in the DNA or chromatin, among other causes. For instance,

differential amplification of B-rDNA repeats in some tissues could result in different

rDNA copy number between tissues, and the differential expression could simply be

dependent on copy number. Differential amplification of rDNA repeats has been

reported in barley (Subrahmanyam at al., 1994), but this possibility has not been tested in

E.plorans. In the second case, epigenetic systems are memory mechanisms that are

inherited between generations and establish gene function. The most known epigenetic

marks (DNA methylation and histone modification) are involved in the expression of

some genes and transcription factors specific to cell or tissue types (Shen and Maniatis,

1980; Cho at al., 2001; Imamura at al., 2001; Hattori at al., 2004b, 2007; Nishino at al.,

2004). It has been shown that each cell or tissue type has its own methylation pattern

(Ohgane at al., 1998; Shiota at al., 2002; Strichman-Almashanu at al., 2002) in

association with tissue-specific function. In the mice, for instance, there are

hypomethylated regions in the liver in genes specifically expressed in that tissue, and

this methylation profile is different from the ones in kidney and spleen (Yagi at al.,

2008). Some studies on human promoter regions have suggested that DNA methylation

status is correlated with transcription activity of some genes (Weber at al., 2005, 2007).

On the other hand, histone modifications or the presence of specific histone variants

influence the interactions between the transcription factors and the chromatin fiber

(Ruthenburg at al., 2007). In mammals, embryonic development requires a tissue-

specific expression of different genes, and it is regulated by enhancers showing histone

modifications (Cotney at al., 2012). Furthermore, histone modification has been reported

to affect DNA methylation in a locus-specific manner (Ikegami at al., 2007). In this

context, B chromosomes in E. plorans have shown to be differentially methylated in the

B-rDNA region, which explained their usual lack of NOR activity (López-León et al.,

1991, 1995). In addition, they are differentially hypoacetylated for lysine 9 in the H3

histone (Cabrero et al. 2007). It would thus be interesting to investigate whether B-rDNA

is subject to differential degrees of epigenetic silencing mechanisms in the body parts

analyzed here.

Taken together, our results have revealed that the rDNA of the B24 chromosome

is active not only in the gonad, but also in somatic body parts; with significantly higher

expression levels in testis, accessory gland and wing muscle, thus implying the B

chromosome’s apparent contribution to grasshopper reproduction and survival. This is

puzzling for B chromosomes behaving as true parasites in females, where they show

meiotic drive (Herrera et al., 1996) and significantly reduce egg fertility (Zurita et al.,

1998). The biological meaning of B chromosomes contribution of rRNA in male body

parts will logically depend on whether the rRNA sequences provided by the B are fully

functional and on the proportion they represent within the total rRNA molecules

122

produced by the A chromosomes in the same body parts. The latter proportion appears

to be low since the frequency of B-carrying males showing B-NOR activity is usually

lower than 50% and, within these males, the proportion of cells showing nucleoli

produced by the B chromosome is not higher than 29% (Teruel et al., 2007, 2009; Ruíz-

Estévez et al., 2012, 2013).

Our recent analysis of the ITS2 region and part of the coding regions in the 5.8S

and 28S rRNA genes, by means of 454 amplicon sequencing (Ruíz-Estévez et al., in

preparation), suggests that the rRNA sequences produced by the B chromosome are

fully functional. Therefore, if the B chromosome is contributing functional rRNA to

cells, we could argue that its parasitic role is diminished (by tending to be beneficial to

males) because it is actually promoting host reproduction through its contribution of

rRNA in testes and male accessory gland, as well as escape from predators through

flight, by its contribution of rRNA in wing muscle. In strictly vertical parasites, like B

chromosomes, the parasite fitness is completely linked to host fitness (Muñoz et al.,

1998), and any contribution of a B chromosome to host survival and reproduction

logically also benefits the parasite itself. In any case, it would be interesting to measure

the transcendence of this molecular contribution of the B chromosome to male fitness, a

task to be undertaken in future research.

Acknowledgements We thank Karl Meunier for language revision. This study was supported

by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL2009-11917) and Plan

Andaluz de Investigación (CVI-6649), and was partially performed by FEDER funds. M Ruíz-

Estévez was supported by a FPU fellowship from the Spanish Ministerio de Ciencia e

Innovación. The authors also gratefully acknowledge the KU Leuven Research Foundation (GOA/11/02) and the Research Foundation of Flanders (Belgium) for financial support.

References

Banaei-Moghaddam AM, Meier K, Karimi-Ashtiyani R, and Houben A (2013)

Formation and expression of pseudogenes on the B chromosome of rye. The Plant

Cell 25:2536–2544

Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the

grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.

Activation of a latent NOR on a B chromosome fused to an autosome. Genome

29:116–121

Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007) Histone H3 lysine

9 acetylation pattern suggests that X and B chromosomes are silenced during

entire male meiosis in a grasshopper. Cytogenet Genome Res 119:135–142

Camacho JPM., Cabrero J, López-León MD, Bakkali M, and Perfectti F (2003) The B

chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic

conflict. Genetica 117:77-84

Camacho JPM (2005) B Chromosomes. In: Gregory TR, ed., The Evolution of the

Genome. San Diego: Elsevier, pp. 223Y286

123

rDNA differential expression in body parts

Chapuis MP, Tohidi-Esfahani D, Dodgson TBlondin L, Ponton F, Cullen D, Simpson SJ, Sword GA (2011) Assessment and validation of a suite of reverse transcription-

quantitative PCR reference genes for analyses of density-dependent behavioural plasticity in the Australian plague locust. BMC Mol Biol 12:7 Cho J, Kimura H, Minami T, Ohgane J, Hattori N, Tanaka S, and Shiota K (2001) DNA

methylation regulates placental lactogen I gene expression. Endocrinology

142:3389-3396

Cotney J, Leng J, Oh S, DeMare LE, Reilly SK, Gerstein MB, and Noonan JP (2012)

Chromatin state signatures associated with tissue-specific gene expression and

enhancer activity in the embryonic limb Genome Res 22:1069-1080

Gunderson JH, Sogin ML, Wollett G, Hollingdale de la Cruz VF, Waters AP,

McCutchan TF (1987) Structurally distinct, stagespecific ribosomes occur in

Plasmodium. Science 238:933-937

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–98

Hannan KM, Hannan RD, Rothblum LI (1998) Transcription by RNA polymerase I.

Front Biosci 3:376-398

Hattori N, Nishino K, Ko Y, Hattori N, Ohgane J, Tanaka S, and Shiota K (2004b)

Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and

trophoblast stem cells. J Biol Chem 279:17063-17069

Hattori N, Imao Y, Nishino K, Hattori N, Ohgane J, Yagi S, Tanaka S, and Shiota K

(2007) Epigenetic regulation of Nanog gene in embryonic stem and trophoblast

stem cells. Genes Cells 12:387-396

Heitz E (1931) Die Ursache der gesetzmässigen Zahl, Lage, From und Grösse

pflanzlicher Nukleolen. Planta 12:775-844

Herrera JA, López-León MD, Cabrero J, Shaw MW, and Camacho JPM (1996)

Evidence for B chromosome drive suppression in the grasshopper Eyprepocnemis

plorans. Heredity 76:633-639

Ikegami K, Iwatani M, Suzuki M, Tachibana M, Shinkai Y, Tanaka S, Greally J, Yagi

S, Hattori N, and Shiota K (2007) Genome-wide and locus-specific DNA

hypomethylation in G9a deficient mouse embryonic stem cells. Genes Cells 12: 1-

11

Imamura T, Ohgane J, Ito S, Ogawa T, Hattori N, Tanaka S, and Shiota K (2001) CpG

island of rat sphingosine kinase-1 gene: Tissue-dependent DNA methylation

status and multiple alternative first exons. Genomics 76:117–125

Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727-

764

López-León MD, Cabrero J, and Camacho, JPM (1991) Meiotic drive against an

autosomal supernumerary segment promoted by the presence of a B chromosome

in females of the grasshopper Eyprepocnemis plorans. Chromosoma 100:282-287

López-León MD, Vázquez P, Hewitt GM, and Camacho JPM (1995) Cloning and

sequence analysis of an extremely homogeneous tandemly repeated DNA in the

grasshopper Eyprepocnemis plorans. Heredity 75:370-375

McClintock DJL (1934) The relation of a particular chromosomal element to the

development of the nucleoli in Zea mays. Z. Zellforsch. Mikrosk. Anat. 21:294-

328

Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In: Olson MOJ, ed., The

Nucleolus. New York: Kluwer, pp. 10-20

124

Muñoz E, Perfectii F, Martín-Alganza A, and Camacho JPM (1998) Parallel effect of a

B chromosome and a mite decreasing female fitness in the grasshopper

Eyprepocnemis plorans. Proc R Soc Lond Ser B. 265:1903-1909

Nishino K, Hattori N, Tanaka S, and Shiota K (2004) DNA methylation-mediated

control of Sry gene expression in mouse gonadal development. J Bio Chem 279:

22306–22313

Ohgane J, Aikawa J, Ogura A, Hattori N, Ogawa T, and Shiota K (1998) Analysis of

CpG islands of trophoblast giant cells by restriction landmark genomic scanning.

Dev Genet 22:132–140

R Development Core Team (2008). R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-

900051-07-0. www.R-project.org.

Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and

vertebrates. Prog Nucleic Acid Res Mol Biol 62:293-327

Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is an Ag-

NOR protein; this property is determined by its amino-terminal domain

independently of its phosphorylation state. Exp Cell Res 203:259–269

Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins, markers of

proliferation related to ribosomal gene activity. Exp Cell Res 214:465–472

Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNA transcription

machinery is assembled during mitosis in active NORs and absent in inactive

NORs. J Cell Biol 133:235–246

Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for

the localization of nucleolus and nucleolar organizer under light and electron

microscopy. Arch Biol 93:267–274

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome

Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS

ONE 7(5):e36600. doi:10.1371/journal.pone.0036600

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is

active in different B chromosome variants of the grasshopper Eyprepocnemis

plorans. Genetica. doi: 10.1007/s10709-013-9733-6

Ruthenburg AJ, Li H, Patel DJ, Allis CD (2007) Multivalent engagement of chromatin

modifications by linked binding modules. Nature Reviews Mol Cell Bio 8:983–

994

Shen C, and Maniatis T (1980) Tissue-specific DNA methylation in a cluster of rabbit

beta-like globin genes. Proc Natl Aca. Sci 77: 6634–6638

Shiota K, Kogo Y, Ohgane J, Imamura T, Urano A, Nishino K, Tanaka S, and Hattori N

(2002) Epigenetic marks by DNA methylation specific to stem, germ and somatic

cells in mice. Genes Cells 7:961–969

Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA

genes. Annu Rev Genet 55:801-830

StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.

www.statsoft.com

Strichman-Almashanu LZ, Lee RS, Onyango PO, Perlman E, Flam F, Frieman MB, and

Feinberg AP (2002) A genome-wide screen for normally methylated human CpG

islands that can identify novel imprinted genes. Genome Res. 12:543–554

Subrahmanyam NC, Bryngelsson T, Hagberg P, Hagberg A (1994) Differential

amplification of rDNA repeats in barley translocation and duplication lines: role

of a specific segment. Hereditas 121:157–170

125

rDNA differential expression in body parts

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis

plorans. Chromosome Res 15:755–765

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR

expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118:291–30

Van Hiel MB, Van Wielendaele P, Temmerman L, Van Soest S, Vuerinckx K, Huybrechts R, Broeck JV, Simonet G (2009) Identification and validation of

housekeeping genes in brains of the desert locust Schistocerca gregaria under

different development conditions. BMC Mol Biol 10:56. doi:

10.1186/1471-2199-10-56

Van Wormhoudt A, Gaume B, Le Bras Y, Roussel V, Huchette S (2011) Two different

and functional nuclear rDNA genes in the abalone Haliotis tuberculata: tissue

differential expression. Genetica 139:1217–1227

Weber M, Davies J, Wittig D, Oakeley E, Haase,M, Lam W, and Schübeler D (2005)

Chromosome-wide and promoter-specific analyses identify sites of differential

DNA methylation in normal and transformed human cells. Nat Genet 37:853–862

Weber M, Hellmann I, Stadler M, Ramos L, Pääbo S, Rebhan M, and Schübeler D (2007) Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet 39:457–466

Yagi S, Hirabayashi K, Sato S, Li W, Takahashi Y, Hirakawa Y, Wu G, Hattori N,

Hattori N, Ohgane J, Tanaka S, Liu XS, and Shiota K (2008) DNA methylation

profile of tissue-dependent and differentially methylated regions (T-DMRs) in

mouse promoter regions demonstrating tissue-specific gene expression. Genome

Res 18:1969-1978 Zurita S, Cabrero J, López-León MD, and Camacho JPM (1998) Polymorphism

regeneration for a neutralized selfish B chromosome. Evolution 52:274–277

126

Supporting Information

Table S2 Multiple post-hoc comparisons among the six body parts by means of

Tukey contrasts. Z and P values are placed above and below diagonal, respectively.

H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG= Accessory gland, GC=

Gastric caecum. Significant P values are in bold-type letter.

H HL WM T AG GC

H 0.216 3.463 4.022 3.818 0.286

HL 0.99994 3.362 3.94 3.729 0.073

WM 0.00704 0.01007 0.579 0.367 3.289

T <0.001 0.00111 0.99245 0.211 3.867

AG 0.0018 0.00262 0.99913 0.99994 3.656

GC 0.99974 1 0.01285 0.00157 0.00346

Table S1 Relative Quantification values of the qITS2_B in 6 different body

parts of the nine E.plorans males analyzed. These males carried active B24 in

the gonads. H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG=

Accessory gland, GC= Gastric caecum.

RQ values of qITS2_B in different body parts of

E.plorans

Id Nº Bs H HL WM T AG GC

TII'10 m12 1 1.529 1.611 1.044 0.164 0.004 0.136

TII'11 m9 1 0.222 0.033 1.425 3.588 3.636 0.076

T0'11 m7 1 0.323 0.248 1.943 1.698 0.470 0.501

TII'11 m1 1 0.080 0.006 0.244 0.450 1.042 0.000

T0'11 m4 2 0.148 0.250 0.338 0.718 0.253 1.305

TII'11 m8 2 - 0.007 3.366 2.099 1.181 0.007

TII'11 m4 2 0.078 0.803 2.525 3.710 3.669 0.101

TII'10 m16 3 0.210 1.044 1.364 2.828 3.212 1.741

TII'10 m14 4 1.250 1.016 2.914 1.651 2.802 1.370

Mean 0.480 0.558 1.685 1.879 1.808 0.582

127

rDNA differential expression in body parts

128

Capítulo 7. HP1 knockdown is associated

with abnormal condensation of almost all

chromatin types

129

130

HP1 knockdown is associated with abnormal condensation of almost

all chromatin types

Mercedes Ruiz-Estévez, Mohammed Bakkali, Josefa Cabrero, Juan Pedro M. Camacho,

María Dolores López-León

Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071

Granada, Spain

Short title: HP1 knockdown affects both eucromatin and heterochromatin.

Keywords: Heterochromatin protein 1; RNAi; eucromatin; heterochromatin;

Eyprepocnemis plorans; qRT-PCR.

131

HP1 knockdown affects both eucromatin and heterochromatin

Abstract

Heterochromatin protein 1 (HP1) is a highly conserved family of eukaryotic proteins

required for heterochromatic gene silencing and euchromatic gene transcription

regulation. In addition, HP1 is involved in chromatin organization and protection of

chromosome integrity during cell division. Here, we present a cytological and molecular

analysis of the effects HP1 knockdown in Eyprepocnemis plorans, a grasshopper

species polymorphic for supernumerary heterochromatic chromosomes. Our results

revealed contrasting effects of HP1 knockdown on gene activity. While the Bub1 gene

decreased in expression level in HP1 knockdown animals, NOR activity, rRNA and,

contrarily to previous reports in Drosophila, Hsp70 gene expression remained

unchanged. Furthermore, HP1 knockdown resulted in abnormal chromatin

condensation, chromosomal bridges, higher frequency of macroespermatids, loss of

muscle mass and hemolymph amount as well as a low number of dividing cells and

survival reduction. All these phenotypes are very likely due to the characteristic pattern

of chromatin condensation disruption observed for almost all kinds of chromatin.

Introduction

Heterochromatin protein 1 (HP1) is a eukaryotic non-histone chromosome-associated

protein initially identified in Drosophila melonogaster (James and Elgin, 1986).

Although HP1 preferentially binds to the constitutive heterochromatin of centromeres

and telomeres, it has also been observed binding to euchromatic regions (Fanti et al .,

2003). It has been identified in organisms ranging from yeast to humans and was found

to be a highly conserved protein (Wang et al., 2000) that interacts with many other

proteins (Essenberg and Elgin, 2000), suggesting an essential role in genome

organization and function. Accordingly, HP1 was initially described as a

heterochromatin assembly and maintenance protein, but different lines of evidence have

recently established its high versatility and involvement in a wide range of processes

such as nuclear assembly, chromatin organization, activation of replication origins,

DNA replication timing, chromosome segregation, telomere maintenance, DNA damage

response, and DNA repair or gene expression modulation (Eissenberg and Elgin, 2000;

Fanti et al., 2008; Dinant and Luijsterburg, 2009; Vermaak and Malik, 2009; Hayashi et

al., 2009; Schwaiger et al., 2010). At the chromosomal level, HP1 plays a significant

role due to its crucial involvement in chromatid cohesion, chromosome segregation, and

the protection of chromosome integrity during cell division (Nonaka et al., 2002; Fanti

et al., 1998), the latter ensuring cell cycle progression (De Lucia et al., 2005).

Besides its association with heterochromatic and euchromatic domains, HP1 is

required for telomere function by preserving its stability (Fanti and Pimpinelli, 2008).

Hence, HP1 mutations in Drosophila are associated with telomeric fusions,

chromosome breakage and elimination, and abnormal cell division (Kellum et al .,

1995). Loss-of-function HP1 mutants have been reported to have impaired development

132

or embryo lethality. For instance, Aucott et al. (2008) disrupted the murine Cbx1 gene

for HP1- protein in mice and reported perinatal lethality due to defective development

of the cerebral neocortex and the neuromuscular junctions. Likewise, in Caenorhabditis

elegans, double hpl-1/hpl-2 mutants showed larval lethality (Schott et al., 2006) and, in

D. melanogaster, HP1 depletion has a sex dependent deleterious effect leading to

lethality in male flies (Liu et al., 2005).

Most species possess multiple HP1 isoforms that differ in their genome

distribution and functionalities. For instance, mammals and D. melanogaster have three

main different isoforms (HP1α, HP1β and HP1γ, and HP1a, HP1b and HP1c,

respectively), whereas in C. elegans there are only two isoforms (HPL-1 and HPL-2).

Drosophila HP1a and HP1b (and mammalian HP1α and β) bind to heterochromatin and

both heterochromatin and euchromatin, respectively, whereas HP1c (and HP1γ)

localizes exclusively in euchromatin and telomeres (Motamedi et al., 2008; Canudas et

al., 2011). However, this chromatin specificity does not seem to be strict, as distinct

isoforms have been found to bind to the same chromatin domain but at different

moments of the cell cycle (Hayakawa et al., 2003). Although HP1 is mainly known as a

key component of heterochromatin where it promotes gene silencing, this protein seems

more versatile as it also modulates euchromatic and heterocromatic genes, up-down

regulating their transcriptional activities (for review, see Vermaak and Malik, 2009). In

fact, in euchromatic genes, HP1 mainly acts as a positive regulator (Piacentini et al.,

2009; Kwon and Workman, 2011). Due to this multifunctionality, HP1 depletion or loss

of function affects a large set of genes, including those for ribosomal RNA (rRNA)

(Horáková et al., 2010; Larson et al., 2012), the budding uninhibited by benzimidazoles

1 (Bub1) (De Lucia et al., 2005) and the 70 kilodatons heat shock protein (Hsp70)

(Kwon and Workman 2011).

rRNA genes are located at specific chromosome sites named nucleolus

organizing regions (NORs), which contain the ribosomal DNA (rDNA). The phenotype

resulting from the expression of these genes is the nucleolus, which can be revealed

cytologically at interphase and first meiotic prophase by means of the silver

impregnation technique (Rufas et al., 1982). Bub1 (budding uninhibited by

benzimidazole kinase protein) codes a component of the spindle assembly checkpoint

(SAC) whose mutations cause chromatin bridges extending between the separating

groups of chromosomes and an extensive chromosome fragmentation in anaphase cells

(Basu et al., 1999). Depletion of BUB1 in Schizosaccharomyces pombe resulted in an

increase in the frequency of chromosome mis-segregation, whereas in Saccharomyces

cerevisiae the result was higher chromosome loss accompanied by slower growth

(Bernard et al., 1998; Warren et al., 2002). Furthermore, germline mutations that reduce

the amount of BUBR1 (found in higher eukaryotes) produce aneuploidy, shorten

lifespan, and cause cancer and premature aging phenotypes in both mice and humans

(Baker et al., 2013). It has been reported that this gene is down-regulated in the absence

of HP1 (De Lucia et al., 2005). The same occurs with the Hsp70 gene, where Kwon and

Workman (2011) reported that reduced dosage of HP1α caused lower levels of heat

shock mRNA. Experiments performed in D. melanogaster showed that after a heat

133

HP1 knockdown affects both eucromatin and heterochromatin

shock, mutant larvae that lack HP1 showed lower Hsp70 transcription levels compared

with wild-type larvae (Piacentini et al., 2003).

Heterochromatin is the main component of a kind of additional dispensable

chromosome, called supernumerary or B chromosome, which forms part of the genomes

of many eukaryotic species (for review, see Camacho 2005). The heterochromatic

nature of these chromosomes has led to considered them genetically inert for a long

time (Ishak et al., 1991, Stitou et al. 2000, Baroni et al., 2009, Poletto et al., 2010), but

some evidences of B-NOR activity (Bidau et al. 1986, Boeskorov et al. 1995) and

molecular B-transcripts detection (Leach et al., 2005, van Vugt et al., 2005, Carchilan et

al., 2009, Ruiz-Estévez et al., 2012; Banaei-Moghaddam et al., 2013) have recently

been reported.

Eyprepocnemis plorans is a paradigm model for studies on supernumerary

chromosomes. This grasshopper species has a standard (A) genome composed of 22

autosomes plus X0/XX sex chromosomes, with constitutive heterochromatin mostly

located in the vicinity of centromeric regions (Camacho et al., 1991). As in other

grasshoppers, the ninth autosome pair in order of decreasing size (S9) behaves as the

typical heteropycnotic megameric bivalent during meiosis (Corey, 1938). Although

extensive variation for B chromosomes has been reported in this species (see

Henriquez-Gil et al., 1984, López-León et al., 1993, Bakkali et al., 1999), all B variants

were heterochromatic and mainly composed of two kinds of repetitive DNA sequences:

a 180 bp tandem repeat DNA (satDNA) and 45S rDNA (Cabrero et al., 1999). Prior to

the observation of a nucleolus attached to a B chromosome fused to the longest

autosome in E. plorans (Cabrero et al., 1987), the supernumerary chromosomes in this

species were perceived as junk and devoid of genes. The presence of rDNA (López-

León et al., 1994) and the cytological absence of nucleoli attached to B chromosomes

(López-León et al., 1995) indicated the silenced nature of these B chromosomes.

However, recurrent expression of B chromosome rDNA (B-rDNA) has recently been

shown in a Spanish population (Teruel et al., 2007, 2009; Ruiz-Estévez et al., 2012).

Furthermore, a recent study of a wide range of Spanish populations has revealed a

residual expression level of B-rDNA in most Spanish populations (Ruiz-Estévez et al.,

2013). With these precedents, E.plorans provides an exceptional arena to study the

consequences of HP1 knockdown, since effects can be differentially assessed at the

level of euchromatin, constitutive heterochromatin (pericentromeric regions of all A

chromosomes and B chromosomes) and facultative heterochromatin (the S9 autosome

and the X chromosome) genomic regions. Furthermore, the three above mentioned

genes, which could putatively be affected by HP1 knockdown, are worth analyzing in E.

plorans because: 1) rRNA genes reside in constitutive heterochromatin in both A and B

chromosomes, 2) Bub1 is related with cell division, and its changes in expression level

could differentially affect the different kinds of chromatin in E.plorans, and 3) the

amount of HSP70 protein decreases in individuals carrying B chromosomes (Teruel et

al., 2011).

In the present work, we explore the effect of HP1 knockdown in E. plorans at

the cytological and molecular levels. Our cytological results suggest that all kinds of

134

chromatin were affected by the HP1 gene knockdown, with general chromatin

decondensation in meiotic cells following a characteristic chromatin-type depending

sequence of events. In addition, HP1 knockdown had opposing effects on the three

genes analyzed, with Bub1 decreasing in gene activity but rRNA and Hsp70 gene

expressions not changing significantly. The overall cytological and physiological effects

of HP1 gene knockdown included the presence of chromosomal bridges, bivalent

decondensation, increased macrospermatid frequency, low number of dividing cells, and

reduced survival.

Materials and methods

Biological samples

We collected 17 males of the grasshopper species E. plorans from a Spanish population

at Jete (Granada, Spain). We chose this population because no nucleolar activity had

previously been observed in the B chromosomes from this population, which makes it a

good material for trying to activate the rDNA in the B chromosome through HP1 gene

knockdown. After anesthesia, a hind leg was taken from each male and the wound was

disinfected with absolute ethanol. After recovery from anesthesia, animals were placed

in culture cages and fed normally to perform the RNAi experiment. The remaining hind

leg and testes of each animal were processed after HP1 gene silencing. We chose hind

leg muscles as the experimental tissue because grasshoppers can loss one of their hind

legs with no effect on viability, and this allowed us to carry out pre- and post-treatment

analyses on the same animals. Legs were frozen in liquid nitrogen and stored at -80ºC

for DNA and RNA extraction and testes were fixed in freshly prepared 1:3 acetic acid-

ethanol and stored at 4ºC for cytological analyses.

Molecular analyses

Nucleic acid isolation and genotyping

Total RNA and genomic DNA (gDNA) were extracted from the hind leg muscle using

the RNeasy Lipid Tissue Mini Kit (Qiagen) and the GenElute Mammalian Genomic

DNA Miniprep Kit (Sigma), respectively. After RNA extraction, the samples were

submitted to a second DNase I treatment (REAL Star Kit, Durviz), to ensure the

absence of contaminating gDNA traces. RNA quantity was measured using

Tecan'sInfinite 200 NanoQuant and its quality assessed in a denaturing agarose gel. For

each sample, 100 ng RNA was retrotranscribed into complementary DNA (cDNA)

using the combination of random and oligo dT primers of the PrimeScript™ RT reagent

-Perfect Real Time- Kit (Takara) and following manufacturer’s recommendations. For

each analysis, a negative control devoid of reverse transcriptase was included to test for

contaminating DNA. The presence of B chromosomes in males was determined by PCR

135

HP1 knockdown affects both eucromatin and heterochromatin

amplification of the B specific SCAR marker in genomic DNA following the protocol

described in Muñoz-Pajares et al. (2011).

HP1 gene amplification, dsRNA synthesis and delivery

The HP1 sequence of E. plorans was identified using tblastn searches of insect HP1α

protein sequences against our local E. plorans transcriptome library. The retrieved DNA

sequences were confirmed using blastx searches against the nr database at the NCBI.

Specific primers to amplify a 194 bp fragment of the E .plorans HP1 gene were

designed using the Fast PCR software (Kalendar et al. 2009). PCR reaction mixture

contained 30 ng cDNA, 200 mM dNTPs, 10 mM each forward (5’

GGCGGCGACGCCCAGTTGGTTTGTTGCTTT 3’) and reverse (5’

CGCGGGCGACCCATCAGGTCTCACATGCAC 3’) primers, and 1 unit of Taq

polymerase (New England, BioLabs) in a final volume of 25 µl. The PCR was

performed in an Eppendorf Mastercycler ep gradient S (Eppendorf) thermocycler using

the following conditions: initial denaturation for 5 min at 94ºC, 30 cycles of 15 s at

94ºC, 15 s at 60ºC and 15 s at 72ºC, followed by a final extension of 5 min at 72ºC.

PCR products were visualized in a 1.5% agarose gel, cleaned with Gen EluteTM PCR

Clean-Up Kit (Sigma) and sequenced by Macrogen Inc.

To obtain double stranded RNA (dsRNA), a transcription promoter was inserted

at the ten nucleotides of the 5’ end of each primer (which do not form part of the gene)

and HP1 sense and anti-sense RNA was obtained following the recommended Ambion-

Lifetechnologies T7 RNA polymerase transcription protocol (as in Cabrero et al., 2013).

One week after leg removal, animals were injected with 5 μg dsRNA at the testes level

of the abdomen. Nine males were treated with the dsRNA and the remaining eight were

injected with insect saline solution and used as control. After 11 days from the first

injection (dffi), a second injection was carried out to ensure efficient HP1 knockdown.

HP1 silencing analysis

After the RNAi treatment period, males were anesthetized and their testes and the

remaining hind leg were processed. Testis fixation, gDNA and total RNA extraction

from each leg and cDNA synthesis were carried out as described above, and the

resulting cDNA was diluted in RNase-DNase free water at a 1:10 ratio.

To determine the most stable reference genes for our gene expression analyses, a

geNorm analysis was carried out in order to test the housekeeping genes (HKGs)

suggested in Van Hiel et al. (2009) and in Chapuis et al. (2011). Standard curves were

used to determine the efficiency of each HKG. The expression level of the HP1 gene

was estimated before (pre-injection) and after (post-injection) the RNAi experiment,

both for the dsRNA-injected and control males, using quantitative retrotranscription-

polymerase chain reaction (qRT-PCR). The reaction mixtures contained 5µl 2X

SensiMixTM SYBR Mastermix (SensiMixTM SYBR Kit, Bioline), 0.7 µM each

136

forward and reverse primer and 5ng cDNA (pre- or post- injection), in a final volume of

15µl. PCR conditions were as follows: an initial denaturation at 95ºC for 10 min, 40

cycles of 94ºC for 30 s, 62ºC for 15 s, 72ºC for 15 s. A final dissociation step was

always added at the end of each qRT-PCR experiment to identify the unique and

specific amplification of the target sequence. Reactions were carried out in triplicate in a

Chromo4 Real Time PCR thermocycler (BioRad) and, for each run, we included a

negative control without cDNA to ensure that the reagents were free of contaminating

DNA. The data were exported using the Opticon Monitor v3.1 software (Biorad) and

Relative Quantification (RQ) values from the different transcripts were obtained

following the “Efficiency calibrated mathematical method for the relative expression

ratio in real-time PCR” (Roche Applied Science, Technical Note No. LC 13/2001).

Analysis of rDNA, Bub1 and Hsp70 genes expression patterns after HP1 knockdown

qRT-PCR was also performed to estimate the expression levels of the rRNA, Bub1 and

Hsp70 genes from pre- and post-injection male samples. The primers used for

amplifying Bub1 (forward: 5’ CGATGGTTTAGGAGGGTGAA 3’; reverse: 5’

GGCTGAAAATGACCCTGAAA 3’) and Hsp70 (forward:

5’GTGTTGGTGGGTGGGTCAACTCG 3’; reverse: 5’

ACGTCAAGCAGCAGCAGGTCC 3’) were designed using the Primer3 software. For

the rDNA, we amplified the ITS2 sequence by means of two different primer pairs: 1)

those anchoring in the differential region of the ITS2 (forward: 5’

ACTTGGGAGCGTCGTGGTA 3’; reverse: 5’ CGTTGTACGAAAGAGTTTGAG 3’)

which yield an amplicon specific to the B chromosome (qITS2_B) and it is a part of the

ITS2_B (Ruiz-Estévez et al., 2012); 2) the ITS3-4 primers anchored in the 5’8S and 28S

rRNA genes (forward: 5’GCATCGATGAAGAACGCAGC 3’; reverse:

5’ATATGCTTAAATTCAGCGGG 3’). With the first primer pair we could assess

changes in the expression of the rDNA in the B chromosomes, and with the second pair

we could detect general changes for rRNA gene expression in all (A and B)

chromosomes. The HKGs, reaction mixtures and conditions were the same as above,

with the exception of the annealing step: 60ºC for ITS3-4, Bub1 and Hsp70, and 73.5ºC

for qITS2_B.

Cytological techniques

Chromosome analyses were carried out to evaluate the effect of HP1 gene knockdown

on chromatin organization, chromosomal behaviour and NOR expression. Meiotic

preparations were obtained from testis follicles as described in Cabrero et al., (1999).

Chromosome preparations were analyzed using a BX41 Olympus epifluorescence

microscope and cell images were taken using a DP70 digital camera. Images were

composed and optimized for bright and contrast with The Gimp freeware.

137

HP1 knockdown affects both eucromatin and heterochromatin

Silver Stain

To visualize the nucleoli and measure their areas in diplotene and zygotene cells,

respectively, we silver stained meiotic preparations of testis follicles from males at 17-

28 days from the first injection (dffi). For this purpose, we used the method described in

Rufas et al. (1982) and, to differentiate the nucleoli (brown) from the chromatin (blue),

a final 5% Giemsa staining step was performed. To search for anomalies in nucleoli

appearance and to check whether the B chromosome showed any NOR activity we

analyzed 20 diplotene cells from the control males and all the available cells from the

experimental males. In addition, the total nucleolus area per cell was measured and

analyzed in 20 zygotene cells from experimental and control males using the ImageJ

software (Schneider et al., 2012) and the GPL3 licensed Python pyFIA software (Ruiz-

Ruano et al., 2011).

C-Banding

This technique was performed on chromosome preparations from males at 21-30 dffi,

following the protocol described in Camacho et al. (1991), with the following slight

modifications: Ba(OH)2 for 3.5 min and 5% Giemsa. This assay was performed in

order to analyze possible effects of HP1 knockdown on heterochromatin organization

and chromosome behaviour during meiosis. We also scored 200 spermatids, classifying

them into three groups: normal, micro- and macrospermatids. We also scored the

frequency of abnormal meiotic cells in preparations submitted to these two last

techniques.

Fluorescent in situ hybridization (FISH)

Meiotic cells were permeabilized by submitting preparations to 100 µl of 50 μg/ml

pepsine in 0.01 N HCl for 10 min at 37ºC. After three vigorous washes in distilled

water, slides were dehydrated through a series of 70%, 90% and 100% ethanol for 3, 3

and 5 min, respectively, and they were stored at 60ºC overnight. RNase treatment,

paraformaldehyde fixation and FISH assay were performed as described in Cabrero et

al. (2003). We used fluorescein-labelled (GGTTA)7 and (TAACC)7 synthetic

deoxyoligomers as telomeric probes (Meyne et al., 1995).

Immunofluorescence analysis

Fixation of testis follicles and squash preparations were performed as described in

Cabrero et al. (2007a). Immunofluorescence analysis of the Ku70 protein was

performed following the methods described in Cabrero et al. (2007b; 2013), using H-

308 (Santa Cruz Biotechnology Inc., CA, USA), a rabbit antibody rose against

aminoacids 302-609 of the human Ku70.

138

Statistical Analyses

Normality of all variable distributions was tested by the Shapiro-Wilk test, and

parametric Student t tests were used for those fitting a normal distribution, whereas non-

parametric (Mann-Whitney and contingency chi square) tests were used for those

variables failing to show a normal distribution. All tests were performed using the

STATISTICA 8.0 software (StatSoft, Inc. 2007) (www.statsoft.com).

Results

HP1 knockdown was effective in RNAi males

PCR analysis using the B-specific SCAR primers showed the presence of seven B-

carrying and one B-lacking (no. 4) males in the control group, and eight B-carrying and

one B-lacking (no. 29) males in the dsRNA injected group. PCR amplification of HP1

in the 17 males yielded a 194 bp fragment which was sequenced and tested by

alignment to the E. plorans HP1α sequence from our transcriptome library. The

alignment confirmed that the 194 bp fragment was part of the HP1α gene (Fig. S1).

Seven days after the first injection (dffi), RNAs from three experimental and

three control males were analyzed by qRT-PCR using RP49 and Armadillo as HKGs.

The average post-/pre-injection ratio of HP1 expression was 1.16 in the control males

and 0.87 in the experimental ones (Table 1), but this difference was not significant

(Mann-Whitney U test; U=4. Z= -0.22. P= 0.83). For this reason, we performed a

second injection to the 11 remaining males at 11 dffi.

Table 1. Levels of HP1 transcript at 7 days from first injection (dffi). Control=

control males; Exp= experimental males; SE= Standard Error.

Male type Male no.

Pre-

injection

Post-

injection Post-/Pre-

Mean

(SE)

Control 13 1.05 1.03 0.98

1.16 (0.67) 2 3.64 1.02 0.28

24 0.6 1.33 2.23

Exp 20 0.53 0.69 1.32

0.87 (0.25) 30 3.41 1.48 0.43

6 0.68 0.57 0.84

After this second injection, the remaining males became weaker as the days

passed. To avoid loss of material, the weakened males were processed once they

showed symptoms of possible death. Only two out of the 11 males (no. 12 and 14) did

not show the former symptoms. Table 2 shows the dffi at which these 11 males were

processed and their pre- and post-dsRNA injection levels of HP1 expression. In this

139

HP1 knockdown affects both eucromatin and heterochromatin

case, a significant decrease in HP1 transcription level was detected in experimental

males in respect to the control ones (Mann-Whitney test; Z=-2.56, P= 0.01) (Fig. 1).

Table 2. Post-/pre-injection ratio of HP1 transcript levels and dffi in which the 11

double injected males were processed. Control= control males; Exp= experimental

males; Dffi= days from the first injection; SE= Standard Error.

Male type Male no. Dffi

Pre-

injection Post-injection

Post-

/Pre-

ratio

Mean

(SE)

Control 5 21 0.70 0.17 0.24

0.5 (0.22)

8 21 1.46 0.10 0.07

4 25 0.39 0.17 0.44

25 27 0.25 0.14 0.58

18 28 0.24 0.28 1.16

Exp 29 17 0.38 0.07 0.18

0.06

(0.03)

15 21 0.52 0.03 0.06

14 21 0.29 0.01 0.04

11 24 0.55 0.02 0.03

3 25 0.74 0.02 0.03

12 28 0.29 0.01 0.04

Fig. 1 Levels of HP1 transcripts in control and experimental (exp) males after one (1) or

two (2) injections and analyzed at 7 or 17-28 dffi, respectively. Bars represent Standard

Error (SE).

140

Influence of HP1 knockdown on the activity of other genes

We analyzed the pre- and post-injection expression levels of three of the genes reported

elsewhere as putatively depending on HP1, i.e. rRNA, Bub1 and Hsp70. As Table 3 shows,

Bub1 showed a significant decrease in expression in HP1 RNAi treated animals, but no

significant effect was noticed for the two other genes.

Table 3. ITS3-4, qITS2_B, Bub1 and Hsp70 Post-/Pre-injection transcription levels in

control and experimental males where the HP1 was knocked down. Control= control

males; Exp= experimental males; Dffi= days from the first injection; SE= Standard

Error.

Male type

Male

no. Dffi

ITS3-4

Post-/Pre-

qITS2_B

Post-/Pre-

Bub1 Post-

/Pre-

Hsp70 Post-

/Pre-

Control 5 21 0.62 0,00 0.76 6.29

8 21 0.82 0.38 0.52 1.04

4 25 1.74 4.77 0.53 0.68

25 27 0.45 2.28 1.24 0.19

18 28 2.18 3.42 0.61 0.73

Mean 1.16 2.17 0.73 1.79

SE 0.34 0.90 0.13 1.13

Exp 29 17 1.17 0.29 0.45 0.55

15 21 1.55 0.81 0.91 1.17

14 21 0.71 0 0.4 0.35

11 24 1.09 0.16 0.46 1.24

3 25 1.08 0.45 0.5 0.64

12 28 1.93 4.8 0.39 0.72

Mean 1.26 1.09 0.52 0.78

SE 0.17 0.75 0.08 0.14

Z-value 0.55 0.73 2.01 0.37

P-value 0.58 0.47 0.04 0.72

To test for the possible association between HP1 and the large centromeric KU70

foci observed in metaphase and anaphase cells of E. plorans, which was speculated about

in Cabrero et al. (2013), immunofluorescence with the anti-KU70 antibody used by these

authors was performed to detect the presence of KU70 at the centromeres of HP1

knockdown males. Fig. S2 shows how HP1 knockdown did not abolish KU70 association

with the centromeric regions of the E. plorans chromosomes. Our results thus suggest the

absence of a centromere-related functional relationship between these two proteins.

Physiological effects of HP1 knockdown

HP1 knockdown was associated with a succession of four remarkable physiological and

phenotypic effects: i) An initial extreme decay of activity, so that males were unable to

141

HP1 knockdown affects both eucromatin and heterochromatin

jump after mechanical stimulus, ii) signs of imminent death, suggesting that HP1 is a

vital protein in E. plorans, iii) once sacrificed, experimental males showed

conspicuously smaller muscle mass in the leg and much less hemolymph, compared to

the pre-injection leg, and also to control males and, iv) they also had fewer dividing

cells in the testes compared to control males.

Cytological effects of HP1 knockdown

Overall, a lower proportion of dividing cells was observed in experimental males with

respect to control males, which suggests an effect of HP1 knockdown on cell cycle

progression.

For the silver stain analysis, we obtained 18 diplotene cells from the male no. 29,

20 cells from no. 15, 11 from no. 14, 5 from no. 11, 3 from no. 13, none from no. 3, and

20 from each control male. While apparently normal nucleoli were associated with the

autosomes S9, S10 and S11 and the X chromosome, no nucleolus was attached to the B

chromosomes either in experimental or control males (Fig. 2 a, b), which suggests the

inactivity of the rDNA of B chromosomes irrespectively of HP1 expression level.

Fig. 2 Normal (a) and abnormal (b-i) spermatocytes from experimental HP1 knockdown

males. Three types of abnormal cells were observed: i) cells with only the S9 bivalent

less condensed (b, c), ii) cells showing a progressive disruption of all chromatin types

condensation (d-f) and iii) cells showing chromatin bridges between chromosomes (g-i).

Arrows in b and c show the poorly condensed S9 bivalent. Bars are equivalent to the X

chromosome size (5µm). SS= Silver Stain, CB= C-Banding, X= X chromosome, B= B

chromosome.

142

Furthermore, the total area of the nucleoli analyzed in zygotene cells indicated

that there was no significant difference between experimental and control males (t-test=

0.27, df= 9, P= 0.79) (Table 4), suggesting that HP1 knockdown had no direct

implications on the total nucleolar area per cell.

Table 4. Mean total cell nucleolus area in control and HP1

knocked down RNAi males. The analysis was carried out in 20

zygotene cells per male. Control= control males; Exp=

experimental males; Dffi= days from the first injection; px=

pixel; SE= Standard Error.

Male type Male no. Dffi

Mean of total nucleoli area

per cell (px)

Control 5 21 15248.80

8 21 13315.15

4 25 9008.15

25 27 13142.90

18 28 14691.50

Mean 13081.30

SE 1094.07

Exp 29 17 7691.30

15 21 17608.40

14 21 16141.00

11 24 10662.80

3 25 14104.05

12 28 15436.88

Mean 13607.40

SE 1524.16

t-value 0.27

P-value 0.79

After C-banding, the normal pattern of C-bands on the pericentromeric region of

all A chromosomes and on the whole B chromosomes (Fig. 2c) was observed in 100%

of the cells from the control males, but only in 24.3% of cells from the experimental

males. In the latter case, we recorded three types of abnormal cells (Table 5): i) 7.3% of

the diplotene cells showed the S9 bivalent less condensed than the other bivalents, thus

losing its megameric condition (Fig. 2 b,c), ii) 8.6% of the cells showed generalized

abnormal chromatin condensation affecting the facultatively heterochromatic A

chromosomes (i.e. the X and megameric S9 chromosomes) and the constitutively

heterochromatic pericentromeric regions (reduced to small C-bands) and the B

chromosome (Fig. 2d-f), and iii) 59.8% of the cells showed chromatin bridges between

chromosomes (Fig. 2g-i).

143

HP1 knockdown affects both eucromatin and heterochromatin

Table 5. Percentage of the different types of meiotic cells found in the experimental

males. Dffi= days from the first injection; N= number of analyzed cells; SE= Standard

Error; abnormal cell type I= S9 bivalent less condensed; abnormal cell type II=

generalized abnormal chromosome condensation; abnormal cells type III=

chromosomes with chromatin bridges.

Male

no. Dffi N

%

normal

cells

%

abnormal

cells type I

%

abnormal

cells type

II

%

abnormal

cells type

III

29 17 195 25.83 9.03 4.58 60.56

14 21 199 33.67 5.53 7.04 53.77

15 21 206 23.79 12.62 2.91 60.68

11 24 74 15.69 3.27 2.61 78.43

3 25 153 32.89 11.84 9.21 46.05

12 28 174 13.79 1.72 25.29 59.2

Mean (SE) 166.8 (20.2) 24.3 (3.4) 7.3 (1.8) 8.6 (3.5) 59.8 (4.4)

A score of about 200 spermatids per male in four experimental and four control

males (Table 6) showed that the frequency of macrospermatids (Fig. 3) was higher in

experimental males (contingency χ2= 11.73, df= 1, P= 0.0006), but no significant

difference was detected for the frequency of microspermatids (χ2= 0.19, df= 1, P=

0.6643).

Table 6. Number of macro-, micro-, and normal spermatids in

control and experimental HP1 knockdown males.

Control Experimental Total

Macrospermatids 45 90 135

Microspermatids 6 8 14

Normal spermatids 756 797 1553

Fig. 3 The three types of

spermatids found in the

experimental and control

males: Macrospermatids

(M), microspermatids (m)

and normal spermatids (n).

144

The FISH analysis performed with the telomeric probe in both experimental and

control males resulted in a similar pattern, with telomeric signals in the two

chromosome ends, even when chromosome bridges were formed (Fig. S3). Although,

we can not discard that a slight and not detectable telomeric sequence loss could have

occurred in the HP1 knockdown males, we can conclude that telomeric DNA sequences

remain in the chromosomes of the cytologically abnormal cells observed.

Discussion

The HP1α knockdown performed through RNAi, based on dsRNA, led to a statistically

significant reduction of HP1 transcript levels and also resulted in a significant reduction

in Bub1 gene expression, loss of chromosome integrity, abnormal chromatin

condensation, and some remarkable phenotypic and physiological effects. However, no

changes for rRNA and Hsp70 gene expressions were observed. Our results are

consistent with the Bub1 gene downregulation observed in the absence of HP1 by De

Lucia et al., (2005) in Drosophila, and support the essential role of these two genes in

chromosome behaviour and integrity (Fanti et al., 1998; Basu et al., 1999). Accordingly,

75.7% of the meiotic cells in dsRNA treated individuals were aberrant (see Table 5),

with phenotypes including less condensation of the S9 bivalent alone or else of all

chromosomes, and the presence of chromatin bridges between chromosomes.

HP1 knockdown individuals showed an unique altered pattern of chromosome

condensation, with 7.3% of the diplotene cells showing abnormal low condensation of

the megameric S9 bivalent alone, and an additional 8.6% of cells showing a disruption

of normal chromatin condensation of all the chromosomes, including the S9

(megameric), the X and the B chromosomes, which in normal cells are positively

heteropycnotic. This result implies an effect of HP1 knockdown on the condensation

level of different chromatin types which is first noted at the facultative heterochromatin

of the S9, (see Fig 2b, c), then at the euchromatin of all the chromosomes (see Fig. 2d),

followed by the facultative heterochromatin of the sex chromosome and most of the

constitutive heterochromatin of A (pericentromeric regions) (see Fig. 2e) and B

chromosomes (see Fig. 2f). Hence, abnormal cells showed less condensed S9 bivalents,

reduced pericentromeric C bands and unidentifiable X and B chromosomes due to poor

level of chromatin condensation and lack of positive heteropycnosis. In consistency

with these results, HP1 knockdown causes decondensation of the X chromosome in

Drosophila males (Spierer et al., 2005). There was, however, a small pericentromeric

region which was highly condensed in both normal and abnormal cells, presumably due

to centromeric proteins protection.

The observed chromatin-type dependent pattern of abnormal condensation of the

chromosomes in HP1 knockdown E. plorans further demonstrates that HP1 has effects

that go beyond the heterochromatin and broadens the well known role of HP1 in

chromatin assembly (Eissenberg and Elgin, 2000). The interruption of chromatin

145

HP1 knockdown affects both eucromatin and heterochromatin

condensation during meiotic prophase I might account for the effects induced by HP1

knockdown in E. plorans. Alternatively, a failure in the maintenance of the condensed

state of chromatin leading to chromosome decondensation, could not be ruled out, but

the ultimate molecular regulatory mechanisms remain to be unveiled.

It has been shown that chromosome bridges can result from telomere-telomere

fusions produced by HP1 inactivation (Fanti et al., 1998) and the missregulation in the

expression of telomere-related genes as Bub1(Basu et al 1999). The molecular basis for

the chromosome bridges in E. plorans does not seem to be related with a complete loss

of telomeric DNA sequences, given that FISH experiments showed the presence of

telomeric sequences in the experimental male chromosomes (see Fig. S3). Alternatively,

this abnormal chromosome behaviour might also be the consequence of an impaired

HP1-telomere interaction due to HP1 knockdown. Indeed, it is known that HP1 is an

important structural component of the centromere and telomere heterochromatin and is

involved in the control of telomere elongation and behaviour, interfering with hTERT-

Telomere interactions (Fanti et al., 1998; Savitsky et al., 2002; Sharma et al., 2003).

The observation of aberrant chromosome configurations during cell division

allows predicting possible failures in chromosome segregation leading to impaired

cytokinesis and the subsequent production of polyploidy cells. Indeed, bridges between

all non-homologous chromosomes (see Fig. 2) were frequently observed, suggesting

generalized missegregation and cytokinesis arrest. This might explain the significant

increase in the frequency of macrospermatids observed in HP1 knockdown males as

compared to control ones. Segregation failure of specific chromosomes is not likely to

occur in this case because this would predict an increase in the frequency of

microspermatids, but it was not observed.

In contrast to the repressive effect of HP1 knockdown on the Bub1 gene, which

is in agreement with the results reported by De Lucia et al. (2005) in Drosophila, we did

not observe any effect of HP1 knockdown either on rRNA or on Hsp70 genes

transcriptional level. HP1 plays a role in the transcriptional regulation of rRNA genes in

some species, and our result is in agreement with the species-dependent effects that

have been previously observed. For instance, in mice, HP1β colocalizes with RNA pol I

and modulates transcriptional activity of rRNA genes, so that reduced levels of HP1β

are correlated with reduced levels of the large subunit of the RNA pol I (Horáková et

al., 2010). In Drosophila, however, HP1 has a predominantly repressive role on rRNA

gene activity, so that HP1 loss leads to a transcriptional enhancement of these genes

(Larson et al., 2012). In E. plorans, qRT-PCR amplification revealed no effect of the

HP1α knockdown, neither on the ITS3-4 or the ITS2-B transcripts levels (see Table 3).

Accordingly, we neither observed significant changes in NOR expression at the S9, S10,

S11 and X chromosomes of the silver stained diplotene cells. B chromosomes also

lacked NOR activity in both RNAi and control males, as previously reported in this

population (López-León et al., 1995), suggesting that the rDNA in the B chromosomes

is inactive due to other reasons than HP1 knockdown. In addition, the mean of total cell

nucleolus area, a parameter found to be related with the level of rRNA gene expression

146

(for review, see Teruel et al., 2007), did not differ between RNAi and control males (see

Table 4). These results indicate that HP1 knockdown in E. plorans did not influence

rRNA gene expression. A possible explanation is that a putative increase in transcription

level of these genes in injected males could have been counteracted by an opposite

downregulation effect derived from the aging symptoms induced by HP1 depletion.

Perhaps the NOR activity increase could have derived from decrease in heterochromatin

amount (Larson et al., 2012). Alternatively, the apparent absence of effect of HP1

knockdown on rRNA gene activity could have something to do with the so-called

“chromatin states of rRNA genes” (Lucchini and Sogo, 1998; Hamperl et al., 2013),

since constitutive heterochromatin, where these genes are immersed in E. plorans,

appears to be the last chromatin compartment to be affected in RNAi males. Whatever

the case, our results is a further prove that the effect of HP1 knockdown may be

different depending on the HP1 variant and/or the species considered (Serrano et al.,

2009; Lee et al., 2013).

Our experiments also failed to detect any effect of HP1 knockdown on the

expression of the Hsp70 gene. This result apparently contradicts the decrease in Hsp70

mRNA associated with reduced levels of HP1 and the enhancing effect that HP1

overexpression has on Hsp70 gene expression (Piacentini et al., 2003). Yet our result

might also be another proof in favour of the gene and species dependent roles of HP1.

The lack of effect of HP1 knockdown on the activity of two out of the three

genes analyzed in this work might be puzzling, especially since they were reported to

interact with HP1 in other species. However, with HP1 having potentially species-

dependent effects, it is conceivable that, in E. plorans, any real interaction between HP1

and these two genes might be shadowed by the effect of HP1 knockdown on other genes

that also interact with rRNA and Hsp70 genes (for instance if HP1 knockdown down-

regulates a gene at the same time as it up-regulates its activator, and vice versa). Such

possibility is especially plausible for genes that have a wide range of gene interactions

so that impairment of their activity results in a global maladjustment of many genes

activity. A DNA microarray profiling of differentially regulated genes for the three

different HP1 variants present in Drosophila suggests that HP1 is indeed a wide-range

acting protein (see Lee et al., 2013). This would also explain the potentially species-

dependent effect of the HP1 knockdown on gene activity, since the effect of the wide-

acting HP1 knockdown on a gene would depend on the entire network of affected genes

and on the position and interactions of that gene within its network which is also

species-dependent.

Although HP1 is generally considered a heterochromatin marker protein, it can

affect both heterocromatin and euchromatin gene expression, producing both global and

gene specific effects (for review, see Vermaak and Malik, 2009). Accordingly, the HP1

dsRNA-knockdown performed in E. plorans males caused major phenotypic and

physiological effects on treated individuals decreasing their mobility and vitality (as

reflected by their lethargy and inability to jump in response to mechanical stimulus),

muscle mass, hemolymph amount, cell divisions and survival. These are all phenotypic

147

HP1 knockdown affects both eucromatin and heterochromatin

signs that fit a scenario of gradual debilitation that ultimately leads to death. Lethality

related to HP1 inactivation has been reported in Drosophila melanogaster at larval

stages, so that individuals with a 90% reduction of HP1α rarely reach the adult stage

(Liu et al., 2005). Nonetheless, similar effect on survival has not been found in

Caenorhabditits elegans where HLP-1 and HLP-2 deficient nematodes are viable

(Studencka et al., 2012).

A deleterious effect of HP1 knockdown in E. plorans could be produced by loss

or impairment of heterochromatin formation. In fact, a relationship between HP1α and

myogenic gene expression in myoblasts has been observed in mice in such a way that its

depletion produces anomalous skeleton muscle differentiation (Sdek et al., 2013).

Moreover, Larson et al., (2012) pointed out that the maintenance of normal level of

heterocromatin in chromosomes is an essential requirement to conserve muscle integrity

and lifespan, and one of the causes of why aged Drosophila individuals die is

sarcopenia (muscle degeneration). This fact has also been observed in C. elegans

(Herndon et al., 2002). Even the premature aging observed in human progeric

syndromes is correlated with loss of heterochromatin (Liu et al., 2011). Modification of

heterochromatin organization might not be the sole cause for the observed deleterious

effect. Changes in euchromatin organization and misregulation of euchromatic genes

might also be contributing. In fact, our results point towards euchromatin

decondensation in HP1 knockdown cells, which further supports that HP1 is a wide-

interacting protein that promotes up and down regulation of heterocromatic as well as

euchromatic genes. Furthermore, this protein family is mainly located at centromeric

heterochromatin but its association with euchromatin has also been reported (Piacentini

et al., 2009). In addition, alterations in DNA damage response (Dinant and Luijsterburg,

2009; Luijsterburg et al., 2009) could also be responsible for the deleterious effects

shown by HP1 knockdown in E. plorans individuals.

HP1 is necessary for proper chromosome condensation dynamics, adequate

heterochromatinization and chromosome segregation. We conclude that HP1 is a wide

acting gene whose knockdown, and the consequent reduction of its transcript level,

results in abnormal condensation of almost all chromatin types with the consequent

gene mis-expression, chromosome bridges, cell division anomalies and, ultimately, a

wide range of phenotypic and physiological changes leading to death. The specific

effect observed in a given cell will probably depend on the cell cycle stage at which the

HP1 knockdown takes effect.

Acknowledgements

We thank T. López for technical assistance and Karl Meunier for language revision. This study

was supported by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL2009-

11917) and Plan Andaluz de Investigación (CVI-6649), and was partially performed by FEDER

funds. M Ruíz-Estévez was supported by a FPU fellowship from the Spanish Ministerio de

Ciencia e Innovación. M. Bakkali wishes to thank the Spanish Ministerio de Ciencia e

Innovación both for the grant (BFU2010-16438) and for the Ramón y Cajal Fellowship.

148

References

Aucott R, Bullwinkle J, Yu Y et al (2008) HPI- is required for development of cerebral

neocortex and neuromuscular junctions. J Cell Biol 183: 597-606

Baker DJ, Dawlaty MM, Wijshake T et al (2013) Increased expression of BubR1

protects against aneuploidy and cancer and extends healthy lifespan. Nat Cell

Biol 15(1):96-102

Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B

chromosome polymorphism of the grasshopper Eyprepocnemis plorans in

North Africa I. B variants and frequency. Heredity 83:428-434

Banaei-Moghaddam AM, Meier K, Karimi-Ashtiyani R, Houben A (2013) Formation

and expression of pseudogenes on the B chromosome of rye. The Plant Cell,

Vol. 25: 2536–2544

Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization of

Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae

of a small B chromosome bearing inactive NOR-like sequences. Caryologia

62:95–101

Basu J, Bousbaa H, Logarinho E et al (1999) Mutations in the essential splindle

checkpoint gene Bub1 cause chromosome missegregation and fail to block

apoptosis in Drosophila. J Cell Biol 146(1):13-28

Bernard P (1998) Fission yeast bub1 is a mitotic centromere protein essential for the

spindle checkpoint and the preservation of correct ploidy through mitosis. J Cell

Biol 143:1775–1787

Bidau CJ (1986) A nucleolar-organizing B chromosome showing segregation-distortion

in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae). Can J

Genet Cytol 28:138–148

Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN, Liapunova EA (1995)

Nucleolus organizer regions and B-423 chromosomes of field mice (Mammalia,

Rodentia, Apodemus). Genetika 31(2):185-192

Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the

grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.

Activation of a latent NOR on a B chromosome fused to an autosome. Genome

29:116–121

Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999) Common origin of B

chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity

83:435-439

Cabrero J, Bugrov A, Warchalowska-Sliwa E, López-León MD, Perfectti F, Camacho

JPM (2003) Comparative FISH analysis in five species of Eyprepocnemidine

grasshoppers. Heredity 90:377-381

Cabrero J, Teruel M, Carmona FD, Camacho JPM (2007a) Histone H2AX

phosphorylation is associated with most meiotic events in grasshopper.

Cytogenet Genome Res 116:311-315.

Cabrero J, Palomino-Morales RJ, Camacho JPM (2007b) The DNA-repair Ku70 protein

is located in the nucleus and tail of elongating spermatids in grasshoppers.

Chromosome Res 15:1093-1100

Cabrero J, Bakkali M, Navarro-Dominguez B et al (2013) The Ku70 DNA-repair

protein is involved in centromere function in a grasshopper species.

Chromosome Res 21: 393-406

149

HP1 knockdown affects both eucromatin and heterochromatin

Camacho JPM, Cabrero J, Viseras E, López-León MD, Navas-Castillo J, Alché JD

(1991) G-banding in two species of grasshoppers and its relationship to C, N

and fluorescence banding techniques. Genome 34:638-643. doi:10.1139/g91-

097

Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of the

genome. New York: Academic Press. pp 223–286

Canudas S, Houghtaling BR, Bhanot M et al (2011) A role for heterochromatin protein

1 at human telomeres. Genes and Development 25:1807-1819

Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes are

weakly transcribed and might alter the transcriptional activity of A chromosome

sequences. Chromosoma 118:607–616

Chapuis MP, Tohidi-Esfahani D, Dodgson T et al (2011) Assessment and validation of

a suite of reverse transcription-quantitative PCR reference genes for analyses of

density-dependent behavioural plasticity in the Australian plague locust BMC

Mol Biol 12:7

Corey HI (1938) Heteropycnotic elements of orthopteran chromosomes. Arch Biol

49:159-172

De Lucia F, Ni JQ, Vaillant C, Sun FL (2005) HP1 modulates the transcription of cell-

cycle regulators in Drosophila melanogaster. Nucleic Acids Res 33(9):2852-

2858

Dinant C and Luijsterburg MS (2009) The emerged role of HP1 in the DNA damage

response. Mol Cell Biol 29(4):6335-6340

Eissenberg JC and Elgin SC (2000) The HP1 protein family: getting a grip on

chromatin. Curr Opin Genet Dev 10:204-210

Fanti L, Giovinazzo G, Berloco M, Pimpinelli S (1998) The heterochromatin protein 1

prevents telomere fusions in Drosophila. Mol Cell 2(5):527-538

Fanti L, Berloco M, Piacentini L, Pimpinelli S (2003) Chromosomal distribution of

heterochromatin protein 1 (HP1) in Drosophila: a cytological map of

euchromatic HP1 binding sites. Genetica 117:135-147

Fanti L and Pimpinelli S (2008) HP1: a functionally multifaceted protein. Curr Opin

Genet Dev 18(2):169-174. doi:10.1016/j.gde.2008.01.009

Hamperl S, Wittner M, Babl V, Perez.Fernandez J, Tschochner H, Griesenbeck J (2013)

Chromatin states at ribosomal DNA loci. Biochimica et Biophysica Acta

1829:405-417

Hayakawa T, Haraguchi T, Masumoto H, Hiraoka Y (2003) Cell cycle behaviour of

human HP1 subtypes: Distinct molecular domains of HP1 are required for the

centromeric localization during interphase and metaphase. J Cell Sci 116:3327-

3338

Hayashi MT, Takahashi TS, Nakagawa T, Nakayama J, Masukata H (2009) The

heterochromatin protein Swi6/HP1 actives replication origins at the

pericentromeric region and silent mating-types locus. Nat Cell Biol 11:357-362

Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polimorphism in

the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293

Herndon LA, Schmeissner PJ, Dudaronek JM et al (2002) Stochastic and genetic factors

influence tissue-specific decline in ageing C. elegans. Nature 419(6909):808-

814

Horáková AH, Bártová E, Galiová G, Uhlírová R, Matula P, Kozubek S (2010)

SUV39h-independent association of HP1 beta with fibrillarin-positive nucleolar

regions. Chromosoma 119(3):227-241. doi:10.1007/s00412-009-0252-2

150

Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional activity of

the B-chromosome of Apodemus peninsulae during pachytene. Chromosoma

100:278–281

James TC and Elgin SC (1986) Identification of a non histone chromosomal protein

associated with heterochromatin in Drosophila melanogaster and its gene. Mol

Cell Biol 6:3862-3872

Kellum R, Raff JW, Alberts BM (1995) Heterochromatin protein 1 distribution during

development and during the cell cycle in Drosophila embryos. Journal of cell

science 108(4):1407-1418

Kwon SH and Workman JL (2011) The changing faces of HP1:

From heterochromatin formation and gene silencing to euchromatic gene

expression: HP1 acts as a positive regulator of transcription. Bioessays

33(4):280-289. doi:10.1002/bies.201000138

Larson K, S J Yan, Tsurumi A et al (2012) Heterochromatin formation promotes

longevity and repress ribosomal RNA synthesis. PLoS Genetics 8(1): e1002473.

doi:10.1371/journal.pgen.1002473

Leach CR, Houben A, Bruce F et al (2005) Molecular evidence for transcription of

genes on a B chromosome in Crepis capillaris. Genetics 171:269–278

Lee DH, Li Y, Shin DH et al (2013) DNA microarray profiling of genes differentially

regulated by three heterochromatin protein 1 (HP1) homologs in Drosophila.

Biochem Biophys Res Commun 434(4):820-828

Liu LP, Ni JQ, Shi YD, Oakeley EJ, Sun FL (2005) Sex-specific role of Drosophila

melanogaster HP1 in regulating chromatin structure and gene transcription.

Nature Genetics 37:1361-1366

Liu GH, Barkho BZ, Ruiz S et al (2011) Recapitulation of premature ageing with iPSCs

from Hutchinson-Gilford progeria syndrome. Nature 472(7342):221-5

López-León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)

Generating high variability of B chromosomes in Eyprepocnemis plorans

(grasshopper). Heredity 71:352-362

López-León MD, Neves N, Schwarzacher T, Heslop-Harrison JS, Hewitt GM, Camacho

JPM (1994) Possible origin of a B chromosome deduced from its DNA

composition using double FISH technique. Chromosome Res 2: 87-92

López-León MD, Cabrero J, Camacho JPM (1995) Changes in NOR activity pattern in

the presence of supernumerary heterochromatin in the grasshopper

Eyprepocnemis plorans. Genome 38:68-74

Lucchini R and Sogo JM (1998) The Dynamic Structure of Ribosomal RNA Gene

Chromatin. In: M.R. Paule (Ed.), Transcription of Ribosomal RNA Genes by

Eukaryotic RNA Polymerase I, 1st ed., Springer, pp: 255–276

Luijsterburg MS, Dinant C, Lans H et al (2009) Heterochromatin protein 1 is recruited

to various types of DNA damage. J Cell Biol 185(4):577-586

Meyne J, Hirai H, Imai HT (1995) FISH analysis of the telomere sequences of bulldog

ants (Myrmecia: Formidae). Chromosoma 104: 4-18

Motamedi MR, Hong EJ, Li X et al (2008) HP1 proteins form distinct complexes and

mediate heterochromatic gene silencing by nonoverlapping mechanisms. Mol

Cell 32(6):778-790

Muñoz-Pajares J, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM, Perfectti

F (2011) A single, recent origin of the accessory B chromosome of the

grasshopper Eyprepocnemis plorans. Genetics 187: 853-863

Nonaka N, Kitajima T, Yokobayashi S et al (2002) Recruitment of cohesion to

heterocromatin regions by Swi6/HP1 in fission yeast. Nat Cell Biol 4:89-93

151

HP1 knockdown affects both eucromatin and heterochromatin

Piacentini L, Fanti L, Berlocc M, Perrini B, Pipinelli S (2003). Heterochromatin protein

1 (HP1) is associated with induced gene expression in Drosophila euchromatin.

J Cell Biol 161:707- 714

Piacentini L, Fanti L, Negri R et al (2009) Heterochromatic protein 1 (HP1a) positively

regulates euchromatic gene expression through RNA transcript association and

interaction with hnRNPs in Drosophila. PLoS Genetics 5(10):e1000670.

doi:10.1371/journal.pgen.1000670

Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African cichlid

fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet

11:1

Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for

the localization of nucleolus and nucleolar organizer under light and electron

microscopy. Arch Biol 93:267–274

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome

Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS

ONE 7(5): e36600. doi:10.1371/journal.pone.0036600

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is

active in different B chromosome variants of the grasshopper Eyprepocnemis

plorans. Genetica. doi: 10.1007/s10709-013-9733-6

Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López Pino JL, Cabrero J,

Camacho JPM (2011) DNA Amount of X and B Chromosomes in the

grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet

Genome Res 134:120–126

Savitsky M, Kravchuk O, Melnikova L, Georgiev P (2002) Heterochromatin Protein 1

is involved in control telomere elongation in Drosophila melanogaster. Mol and

Cel Biol 22:3204-3218

Schott S, Coustham V, Simonet T, Bedet C, Palladino F (2006) Unique and redundant

functions of C. elegans HP1 proteins in post-embryonic development.

Developmental Biology 298:176-187

Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of

image analysis. Nature Methods 9: 671-675

Schwaiger M, Kohler H, Oakeley EJ, Stadler MB, Schübeler D (2010) Heterochromatin

protein (HP1) modulates replication timing of Drosophila genome. Genome

Research 20:771-780

Sdek P, Oyama K, Angelis E, Chan SS, Schenke-Layland K, MacLellan WR (2013)

Epigenetic regulation of myogenic gene expression by heterocromatic protein 1

alpha. PLoS ONE 8(3): e58319. doi:10.1371/journal.pone.0058319

Serrano A, Rodríguez-Corsino M, Losada A (2009) Heterochromatin Protein 1 (HP1)

do not drive pericentromeric cohesin enrichment in human cells. PLoS One

4(4): e5118. doi:10.1371/journal.pone.0005118

Sharma GG, Hwang KK, Pandita et al (2003) Human heterochromatin protein 1

isoforms HP1Hs alpha and HP1Hs beta interfere with hTERT-telomere

interactions and correlate with changes in cell growth and response to ionizing

radiation. Mol and Cel Biol 23(22):8363-8376

Spierer A, Seum C, Delattre M, Spierer P (2005) Loss of the modifiers of variegation

Su(var)3–7 or HP1 impacts male X polytene chromosome morphology and

dosage compensation. J Cell Sc.118:5047–5057

Stitou S, Díaz de la Guardia R, Jiménez R, Burgos M (2000) Inactive ribosomal cistrons

are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae).

Implications for their origin and evolution. Chromosome Res 8(4):305-311

152

StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.

www.statsoft.com

Studencka M, Wesolowski R, Opitz L, Salinas-Riester G, Wisniewski JR, Jedrusik-bode

M (2012) Transcriptional repression of Hox genes by C. elegans HP1/HPL and

H1/HIS-24. PLoS Genet 8(9): e1002940.doi:10.1371/journal.pgen.1002940

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper

Eyprepocnemis plorans. Chromosome Res 15:755–765

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR

expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118:291–301

Teruel M, Sørensen JG, Loeschcke V, Cabrero J, Perfectti F, Camacho JP (2011) Level

of heat shock proteins decreases in individuals carrying B-chromosomes in the

grasshopper Eyprepocnemis plorans. Cytogenet Genome Res 132(1-2):94-99

Van Hiel MB, Van Wielendaele P, Temmerman L et al (2009)

Identification and validation of housekeeping genes in brains of the desert

locust Schistocerca gregaria under different developmental conditions. BMC

Mol Biol 10:56. doi: 10.1186/1471-2199-10-56

Van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity and repeat

sequences of the paternal sex ratio chromosome of the parasitoid wasp

Trichogramma kaykai. Chromosoma 114:410–419

Vermaak D and Malik HS (2009) Multiple roles for heterochromatin protein 1 genes in

Drosophila. Annu Rev Genet 43:467-492

Wang G, Ma A, Chow CM et al (2000) Conservation of heterochromatin protein 1

function. Mol Cell Biol 20(18):6970-6983

Warren CD (2002) Distinct chromosome segregation roles for spindle checkpoint

proteins. Mol Biol Cell 13:3029–3041

153

HP1 knockdown affects both eucromatin and heterochromatin

Supporting Information

Fig. S1 The HP1α gene contig from our E. plorans transcriptome library. The region

used for dsRNA is noted in red colour.

5’TAGAAGCTGGAGCACAGTTTCATCCCGCCAACCCTTCTTTGGCGCCGAAA

AATTCCTGAAGCTTCGAATCAGTTAAAGAAAGAGAAGATTTGTAGCTGTTT

GAAACCCTTTTCGCTACGAGTCGCAACATGTCAAAAATGGAAGGGCCAAAT

CGGAAGACAAAAGATAAGGATGCTGCAGGAAATAATGCAGATGGGGAAGA

GCCAGAGGAAGAGTACTCAGTTGAGAAAGTACTGGACAAGAGAATACGAA

ATGGCAAAGTGGAGTACTTATTGAAGTGGAAGGGGTATTCAAATGAAGATA

ACACGTGGGAACCAGAGGAGAATCTCGACTGCCCGGACCTCATCAGCGAAT

ACGAGTCGAAGAGGGCGGAGAGCAAGAAGGGTGGCAGCGGCAGTGACACA

GGGTCGACTGGTGTGAAGAAAGAAGACCGTAAGCGCAAGTCGAGTGCTGTC

ACCGAGGAGAAGAAAGGTTCCAGCAAGAAGAAGCACACTGAGGAAGATAA

CAAACCAAGGGGTTTTGAACGTGGTTTGGAACCAGAGAAGATTATTGGGGC

CACAGATTCAAGTGGAGAGCTAATGTTCCTAATGAAATGGAAAGGCACTGA

CGAAGCAGACCTCGTGCCTTCGAGCCAGGCCAATGTGAAGTGTCCGCAGAT

TGTGATAAAGTTCTACGAAGAGCGACTGACCTGGCACACCTCGAGCCACGA

TGAGGAGGAAGGTGGCAAAGGCGAGGGGGCGGCCTAAGTGTGGACACGGT

TGACACTCGCAGTGCACTGCAGCAGAGTTACTTCTTCTGGCTCCATAACTAG

TTCTAAGACAAATTCCCTTTAAATATTTTAGATCGGTTTTCACTTTTGATCCA

TAATGTTCACACAACGTACACCAGAGTGATTTTTATTTGAGCTGAGCACTTG

GAAGTGTGAAATTGAGACTGCACTAAATTTTTCAGTGTTGACGTTTTTGACC

GTGTTCCCGTAGGCTGCAAAATAAATCACACAGAATAGTAGCTTTAGGGTA

AGGAATACAATGACTGAAGAGTGACTTTTAAGAGGAGGTAGTGGTCAGAGA

TTCTGAATTGATTGAGGTCTTCTGGAAGTTCTTCATTTGTGCTGCATTTCTTT

TTTTGTTTCCCTTAGATTTGCCATATTTGCAATTTTAAGTGTTTGAAGTAGCA

GTGTTGATGTTAATTGTGGGTAGTCAATAAATCGATGGTGGAAAGGTAAAA

GGTTGTAATCCCTATTAGAATACATTGGGGTTACAACCTTTTACCTTTCAAC

CGTCGAAATCGTCTGATTAACTGTAATATTGTATCACCCATTTGGAGAGATG

ACATGTGAAAAATCTTGTGTGTTTATTCTGTAGTCCCCATCACATAGTTCCA

CTTTTGCATGTGATAATTGTCC 3’

154

Fig. S2 Metaphase I cell submitted to immunofluorescence with a Ku70 antibody (red)

merged with DAPI staining to show chromatin, from a male injected with RNAi for

HP1. Note the presence of one centromeric Ku70 focus per homologous chromosome,

and the distal associations between different bivalents (arrows). Ku70 was present in

both RNAi and control males.

Fig. S3 Metaphase I cell submitted to FISH with telomeric probe (green) merged with

DAPI (blue) from an RNAi male. Note the presence of apparently normal telomeric

signals in all bivalents, and how several signals are mixed together in the chromatin

bridges (arrow).

155

HP1 knockdown affects both eucromatin and heterochromatin

156

Capítulo 8. High variation of ITS2 rDNA

region and non-random expression of rDNA

units in a grasshopper genome

157

158

High variation of ITS2 rDNA region and non-random expression of

rDNA units in a grasshopper genome

Mercedes Ruiz-Estévez*, Francisco Ruiz-Ruano*, Josefa Cabrero, Mohammed Bakkali,

Francisco Perfectti, Mª Dolores López-León, Juan Pedro M. Camacho

Departamento de Genética, Universidad de Granada, 18071 Granada, Spain

*: These authors contributed equally to this work

Short title: High variable and non-randomly expressed rDNA

Key words: 454 amplicon sequencing, B chromosomes, cDNA, concerted evolution,

gDNA, gigantic genomes, homogenization, rDNA expression, rDNA, tagged PCR

159

Abstract

Concerted evolution is an evolutionary pattern by which some repetitive DNA arrays

show little or no intraspecific genetic diversity. One of the repetitive DNAs best fitting

concerted evolution is ribosomal DNA (rDNA), but the recent finding of extensive

intragenomic variation for rDNA non-coding regions in some organisms has challenged

the efficiency of concerted evolution as homogenizing mechanism. Here we analyze

intragenomic variation in the ITS2 rDNA region in two grasshopper species with

gigantic genomes (2-3 fold the human genome), by means of tagged PCR 454 amplicon

sequencing, and found highly contrasting patterns in them. The use of short coding

regions (5.8S and 28S rDNA) flanking the ITS2 proved to be an appropriate internal

control for haplotype selection. Whereas Locusta migratoria showed very high

homogenization, with a single ITS2 haplotype in 98.52% of the reads obtained, six

different haplotypes coexisted in a single population of Eyprepocnemis plorans,

suggesting efficient homogenization in the former but poor in the latter. In E. plorans,

one of the ITS2 haplotypes (Hap4) was specific to B chromosomes. The simultaneous

analysis of genomic DNA (gDNA) and complementary DNA (cDNA) allowed the

analysis of relative expression efficiency (REE) for the different haplotypes, and

showed different expression profiles between body parts which were consistent at

population level. Remarkably, Hap5 showed the highest REE and also carried the most

conserved flanking 5.8-28S coding regions, whereas Hap4 showed the lowest

conservation of the accompanying coding region and showed the lowest REE. The

meaning of these results in the context of B chromosome silencing and genomic

homogenization of rDNA arrays is discussed.

Introduction

Among a high variety of repetitive DNA sequences making up eukaryote genomes

(Britten and Kohne, 1968), ribosomal DNA (rDNA) is one of the most abundant tandem

repeats, and this facilitates synthesizing massive numbers of ribosomes during rapid

growth periods (Eickbush and Eickbush, 2007). Each 45S cistron of this multigene

family is constituted by three rRNA genes (18S, 5.8S and 28S) separated by two

internal transcribed spacers (ITS1 and ITS2) and preceded by the external transcribed

spacer (ETS) and the intergenic spacer (IGS) (Long and David, 1980). For many years,

it was believed that every copy in the rDNA arrays showed an identical sequence

(Goffeau et al., 1996), because natural selection would constrain the evolution of the

coding regions (Nei et al., 1997). But the finding of high sequence resemblance among

rDNA units also in the non-coding regions, suggested the existence of a mechanism for

their active homogenization. Brown et al. (1972) first proposed that the rRNA gene

copies evolved “horizontally”, with novel variants arising by mutation and spreading to

other units. This homogenization process was later called “concerted evolution”

(Zimmer et al., 1980), and it was suggested to occur through unequal crossover and

160

gene conversion (Dover, 1982). Although the role of unequal crossover is universally

accepted, that of gene conversion has generated some doubts (Eickbush and Eickbush,

2007).

Concerted evolution was first though to fit all kinds of repetitive DNA

sequences, but some multigene families have been shown to best fit an alternative

evolutionary model, namely the birth-and-death model proposed by Nei and Hughes

(1992) for the Major Histocompatibility Complex (MHC) loci. This model has gained

later support for other gene families (Ota and Nei, 1994; Nei et al., 1997; Date et al.,

1998; Michelmore and Meyers 1998; Sitnikova and Nei, 1998; Gu and Nei, 1999; Nei

et al., 2000; Zhang et al., 2000; Rooney et al., 2002; Rooney and Ward, 2005). One of

the main differences between the birth-and-death and concerted evolution models is the

presence of pseudogenes in the first case (Eickbush et al., 1997).

In some organisms, including prokaryotes, plants, animals, and fungi, extensive

intragenomic variation has been reported for the ITS regions (Mayol and Rosselló,

2001; Feliner et al., 2004; Wörheide et al., 2004; Stage and Eickbush, 2007; Stewart and

Cavanaugh, 2007; Simon and Weiss, 2008; James et al., 2009; Pilotti et al., 2009; Alper

et al., 2011; Hřibová et al., 2011; Matyášek et al., 2012; Song et al., 2012; Vydryakova

et al., 2012; Li et al., 2013). This has suggested caution in using these genomic regions

in studies of species richness in environmental studies (Lidner et al., 2013), or in trying

to use them as universal barcodes (Alper et al., 2011; Song et al., 2012).

The absolute level of sequence variation in the rDNA repeated arrays can be

analyzed by Whole Genome Shotgun Sequencing, but only when the studied genomes

are relatively small. Using this approach, Ganley et al. (2007) determined that the level

of rDNA copy variation was extremely low in five fungi species, even in the IGS

region. They proposed a model of rapid homogenization based on concerted evolution,

where a polymorphism in an individual represents a mutation which the homogenization

mechanism has spread to all repeats in the array, thus becoming fixed. Another

appropriate method for thorough analysis of rDNA intragenomic variation is Next

Generation Sequencing (NGS) (Margulies et al., 2005; Sogin et al., 2006; Keller et al.,

2008; Meyer et al., 2008; Van Tassell et al., 2008; Druley et al., 2009; Wang et al., 2011;

Song et al., 2012; Lindner et al., 2013; Zavodna et al., 2013). Although NGS analysis

provides information that exceeds the traditional methods (e.g. Sanger sequencing) in

several orders of magnitude, some recent studies have revealed that the results from the

NGS platforms (454 and Illumina) are comparable to the traditional ones (Hřibová et

al., 2011; Matyášek et al., 2012). At the same time, other studies have detected much

higher polymorphism for NGS compared to Sanger sequencing (Tedersoo et al., 2010;

Kautz et al., 2013). These studies have also highlighted the need to control for

sequencing errors in order to avoid false positives (Gilles et al., 2011; Brodin et al.,

2013; et al., 2013; Niklas et al., 2013).

Eukaryotes show extensive variation among species for both genome size and

the amount of ribosomal DNA (rDNA). Although these two parameters are positively

correlated, there is no simple explanation for this relationship (Prokopowich et al.,

161

High variable and non-randomly expressed rDNA

2003) since only part of the rDNA copies are usually active (Reeder 1999). Even more

puzzling is the finding of extensive intraspecific variation in the amount of rDNA

without changes in the number of protein-coding genes. The grasshopper

Eyprepocnemis plorans shows dramatical variation in the number of rDNA units among

populations, from only two chromosome pairs carrying rDNA in Dagestan to all

chromosomes carrying it in Morocco (López-León et al., 2008). The genome of this

species is about three times larger than the human genome and, in some Spanish

populations, may carry more than 40,000 rDNA units in individuals carrying

supernumerary (B) chromosomes (Montiel et al., submitted), a figure being among the

largest ever found. B chromosomes in this species are very rich in a 180 bp satDNA and

45S rDNA (Cabrero et al., 1999). Recently, Montiel et al. (submitted) have estimated

that B-lacking males from the Torrox (Málaga, Spain) population (the one analyzed

here) carry 15,000 rDNA units which, by fluorescent in situ hybridization (FISH) can be

observed in seven A chromosome pairs (Cabrero et al., 2003). The most conspicuous

rDNA clusters are located in the three smallest autosomes (9, 10 and 11) as well as in

the X chromosome (X0/XX sex determinism). But the largest rDNA cluster is located

on the B chromosome (López-León et al., 1994; Cabrero et al., 1999). In most males, all

rDNA-carrying A chromosomes can eventually be visualized organizing a nucleolus

during meiotic prophase, but NOR activity in the B chromosomes is rarely observed

(Cabrero et al., 1997; López-León et al., 1995; Ruíz-Estévez et al., 2013), except in the

Torrox population (Teruel et al., 2007; 2009; Ruiz-Estévez et al., 2012).

The grasshopper Podisma pedestris, a species with a gigantic genome (18.15

Gb), also shows extensive intraspecific variation in the number of rDNA repeats

(Veltsos et al., 2009) which show high sequence heterogeneity, suggesting low

efficiency of concerted evolution (Keller et al., 2006, 2008). To investigate whether this

is a general property of grasshoppers or if it is a characteristic of large genomes, we

performed tagged PCR and 454 amplicon sequencing to analyze variation for the ITS2

region in two other grasshopper species (Locusta migratoria and Eyprepocnemis

plorans) showing genomes not as large as P. pedestris (5.56 Gb and 10.26 Gb,

respectively; see Ruiz-Ruano et al., 2011), and differing in the number of rDNA clusters

visualized by FISH, with only three chromosome pairs in L. migratoria and seven in E.

plorans (Cabrero et al., 2003; Teruel et al., 2010). Since preliminary experiments

showed extensive ITS2 variation in the latter species, we performed additional

experiments to characterize intragenomic ITS2 variation at body part and population

levels by analyzing both genomic DNA (gDNA) and complementary DNA (cDNA)

from the same individuals. This allowed us to detect the presence of a B-specific

haplotype and analyzing relative expression level among haplotypes which revealed

strong silencing of the rDNA contained in the B chromosome.

162

Materials and methods

Biological samples and karyotypic characterization

We collected 21 adult males of the grasshopper E.plorans in the Torrox population

(Málaga, Spain) and one Locusta migratoria male from our B-lacking laboratory

culture. They were anesthetized prior to dissection to take out the testes which were

fixed in freshly prepared 3:1 ethanol:acetic acid and stored at 4ºC for cytological

analysis. The bodies of 18 E.plorans males were divided into two somatic hemibodies

for separate extraction of DNA and RNA. One male was dissected under a binocular

microscope into six body parts (head, hind leg, wing muscle, testis, accessory gland and

gastric caecum). These hemibodies, the mentioned body parts, and body remains of one

L.migratoria male and two E.plorans males were frozen in liquid nitrogen and stored at

-80º C until DNA and RNA extraction.

Determination of the number of B chromosomes in each E. plorans male was

performed by squashing two testis follicles in 2% lacto-propionic orcein and visualizing

primary spermatocytes at first meiotic prophase or metaphase, under a BX41 Olympus

microscope coupled to a DP70 digital camera.

gDNA and RNA extractions, cDNA synthesis and B-NOR activity analysis

Genomic DNA (gDNA) and total RNA extractions from frozen hemibodies and

dissected body parts were performed using “GenElute Mammalian Genomic DNA

Miniprep Kit” (Sigma) and “Real Total RNA Spin Plus kit” (Durviz), respectively,

following manufacturer’s recommendations. We submitted total RNA to a second 20U

DNase treatment (REALSTAR kit, Durviz) after extraction to eliminate any traces of

gDNA contamination. Quantity and quality (absorbance 260:280 nm = 1.9-2) of gDNA

and RNA were measured with Tecan's Infinite 200 NanoQuant and in a denaturing

agarose gel to ensure the absence of RNA degradation. Complementary DNA (cDNA)

was obtained with random hexamers using SuperScript III First-Strand Synthesis

SuperMix Kit (Invitrogen). B-NOR activity was analyzed by Silver Impregnation of

testis follicles following the protocol reported by Rufas et al. (1982) and by PCR

amplification of the ITS2_B sequence (preferentially found in the B-rDNA) following

the protocol described in Ruiz-Estévez et al. (2012).

Tagged PCR and amplicon NGS sequencing

We amplified the ITS2 region in four separated 454 runs in: 1) gDNA from a L.

migratoria male, 2) gDNA from a 1B E.plorans male, 3) gDNA and cDNA of the six

body parts from a 0B E.plorans male, and 4) gDNA and cDNA from 18 E.plorans

males with different number of B chromosomes. The ITS2 amplicons in 1) and 2) were

sequenced as part of 1/4 of plate along with other PCR products not analyzed here, and

samples 3) and 4) were sequenced in 1/8 of a plate each. We used forward ITS3 (5’

GTCGATGAAGAACGCAGC 3’) and reverse ITS4

163

High variable and non-randomly expressed rDNA

(5’ATATGCTTAAATTCAGCGGG 3’) primers (anchored in the 5.8S and the 28S

genes, respectively) with 6mer-length tags in the 5’ end of both primers. For each

different sample we used a specific combination of both forward and reverse tagged

primers to separate them in silico. We designed six tags using EDITTAG (Faircloth and

Glenn, 2012), five of them with an edit distance of 5 and one with 4 (Table S1) and we

amplified 36 samples (18 gDNAs and 18 cDNAs). We ordered 12 tagged primers and

combined them to obtain 12 and 36 tagged amplicon samples in the body part and

population experiments, respectively. By doing this in our laboratory, costs were

diminished.

PCR reactions contained 20ng gDNA or 30ng cDNA, 0,4µM of each forward

and reverse tagged primer (Tables S2 and S3), 0,2 mM dNTPs, 5µl of 5X Phusion HF

Buffer and 0,4U Phusion® High-Fidelity DNA Polymerase (Thermo Scientific) in a

final volume of 25µl. PCR amplification of the ITS2 sequence was performed in an

Eppendorf Mastercycler ep Gradiente S (Eppendorf) with the following conditions:

initial denaturation for 30 s at 98ºC, 30 cycles of 15 s at 98ºC, 30 s at 60ºC and 10 s at

72ºC, followed by a final extension of 7 min at 72ºC. The results were visualized by

electrophoresis in a 1.5% agarose gel, and the bands of about 350 bp were excised, and

purified with the GenElute Gel Extraction Kit (Sigma-Aldrich). We performed two

separated reactions with the same combination of tags for each sample to reduce PCR

bias, and mixed the product in equimolar amounts for sequencing in a 454 GS FLX

Titanium equipment (Roche Diagnostics).

Data analysis

We used a series of custom scripts written in Python to count the number of reads in

each sample for the different types of sequences found. We performed it in five

consecutive steps: 1) We searched in the first half of the read the sequence of both

forward and reverse primers in the complete read collection by performing a local

alignment with the Smith-Waterman algorithm implemented in the EMBOSS suite

(Rice et al., 2000). We only considered reads with high identity with at least one primer

in any orientation. 2) We then made a local alignment for the tagged primers used in the

experiment in order to eliminate those reads showing more than three differences in the

sequence of both primers (F and R), and the remaining reads were assigned to every

sample according to tag combination (see tables S2 and S3). 3) After correcting some

sequencing errors with the Acacia software (Bragg et al., 2012), we created a file with

sequence types and number of reads, and then we searched for chimeric sequences with

UCHIME (Edgar et al., 2011) with default options of the de novo algorithm. 4) We

aligned the sequences using MAFFT v7 (Katoh and Standley, 2013) with LINSI options

and manually eliminated tags and primers with Geneious v4.8 (Drummond et al., 2009).

5) Since the 454 reads included partial sequences of the 5.8S and 28S rRNA genes,

summing up 123 nt, in addition to the ITS2 region, we used this partial coding region as

an internal control for sequencing errors, as a means to avoid false positives in

identifying genuine ITS2 haplotypes in the gDNA. For this purpose, we assumed that all

164

variation found in these 123 nt were sequencing errors, since natural selection does not

allow much variation in them. The proportion of reads carrying any variation in respect

to the majoritary coding sequence type was thus an estimate of the maximum error rate

(ER) of the experiment. In order to select haplotypes in the different samples of an

experiment, we calculated ER in the whole experiment and then applied it to every male

in order to avoid discarding haplotypes very frequent in only one or few males. The

reads were then classified into one or more ITS2 haplotypes surpassing the ER

threshold.

Whole-Genome Shotgun Sequencing-NGS

To analyze the diversity of ITS2 in the genome without possible biases induced by the

PCR amplification, we used a library generated in our laboratory of gDNA sequences

obtained from an individual collected in Torrox with two B24 chromosomes in 1/8 of

454 GS FLX Plus. We mapped the reads showing at least 90% identity with the E.

plorans ITS2 (accession number JN811827) using the Roche’s GS Mapper software and

selected those with the complete ITS2 that were found more than two times.

Secondary structure and genetic diversity analyses

We predicted the ITS2 secondary structure of each haplotype and its stability measured

by Gibbs’ free energy with MFold v2.3 (Zuker, 2003) with a folding temperature of

30ºC, and the folds were represented with VARNA (Darty et al., 2009). We performed

the sequence diversity analysis with DNAsp v5 (Librado and Rozas, 2009). A minimum

spanning tree (MST) was built with the different haplotypes based on pairwise

differences, with Arlequin v3.5.1.3. (Excoffier and Lischer, 2010) and was edited with

HapStar v0.7 (Teacher and Griffiths, 2011). An additional haplotype from

Eyprepocnemis plorans meridionalis, a B-lacking subspecies located in South Africa,

was included for anchoring the haplotype network.

Statistical analyses

Read counts failed to fit a normal distribution (tested by the Shapiro Wilk’s test) and

thus we used non-parametric tests such as Kruskal-Wallis ANOVA, Wilcoxon matched

pairs test and Friedman two-way ANOVA. All analyses were performed with

STATISTICA Software v8 (StatSoft, Inc. 2007).

Results

Preliminary analysis of ITS2 variation

We first performed ITS2 amplicon sequencing on gDNA from two individuals, one L.

migratoria male, and a 1B E. plorans male. The L.migratoria experiment yielded 2,366

165

High variable and non-randomly expressed rDNA

reads; 2318 (97.97% ) were identical for the 5.8-28S coding region thus suggesting ER=

2.03%. For the ITS2 region, there were 2,331 (98.52%) identical reads , and six other

types showed frequencies being 0.25% or lower thus not surpassing the ER threshold.

Therefore, we conclude that L.migratoria showed a single haplotype for the ITS2

region.

The 1B E. plorans male yielded 10,672 reads matching the ITS2 sequence of

this species (accession numbers: JN811827 to JN811902), but only 76.41% of them

showed a conserved 5.8-28S coding region. This could be the result of either high rate

of sequencing error or else to the presence of degenerate rDNA copies in the B

chromosome. Since it was impossible to ascertain the true cause, we did not apply the

ER threshold to this male. The analysis of the ITS2 sequence types observed in these

reads showed only four types with frequencies higher than 5%: Hap1 (10.39%), Hap2

(30.15%), Hap3 (5.93%) and Hap4 (10.48%), the remaining types (about 600 non-

singleton reads, and more than 1700 including singletons) showing frequency 0.41% or

lower. Out of them, Hap4 was the only one including the adenine insertion typical of the

ITS2_B variant (Ruiz-Estévez et al., 2012; Teruel et al., submitted).

As another test for ITS2 variation found, we performed Whole Genome Shotgun

454 sequencing on gDNA from a 2B E. plorans male from the same population and

found 27 complete ITS2 sequences. Haplotype characterization showed five haplotypes

including the four formerly found (Hap1-Hap4) and a new haplotype (Hap5, which had

appeared in the 1B male analyzed by amplicon sequencing in 0.46% of non-singleton

reads). On the basis of these results, we designed two amplicon NGS experiments to

analyze the ITS2 variation (on gDNA) with coverage higher than 1x, as well as the

expression degree of the different haplotypes (on cDNA), at both body part and

population levels.

Body part experiment

The 454 amplicon sequencing experiment including both gDNA and cDNA extracted

from six different body parts (head, hind leg, wing muscle, testis, accessory gland and

gastric caecum) from a 0B male yielded 46,572 reads in the gDNA matching the ITS2

sequence. Bearing in mind that 0B males from the Torrox population carry about 15,000

rDNA units, we actually got 3x coverage for the ITS2 in the gDNA reads. 97.4% of

these reads were identical for the 5.8-28S coding region thus indicating ER= 2.6%.

Only three ITS2 sequence types surpass this ER threshold in frequency, the remaining

516 types showing very low frequency (1.08% or less). The three most frequent types

corresponded to Hap1-Hap3 previously found, and they collectively represented 94.92%

of total reads. After discarding this 5.08% of reads, about half of the remainder

(50.79%) corresponded to Hap1, 26.98% to Hap2, and 22.24% to Hap3. Remarkably,

the Hap4 haplotype, with the adenine insertion typical of the ITS2_B, was not found in

this B-lacking male.

In the cDNA, these three haplotypes appeared in 49,683 reads, 65.18% of which

166

corresponded to Hap1, 27.28% to Hap2, and 7.54% to Hap3. The proportion of reads

found for a given ITS2 haplotype in the cDNA divided by the proportion of reads found

in the gDNA (cDNA/gDNA ratio) is an indicator of its expression efficiency. Dividing

the efficiencies of the three haplotypes in a body part by the highest of them, we

calculated the relative expression efficiency (REE) for the different haplotypes, which

showed different patterns among body parts (Fig. 1).

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

Head Caecum Access.gland Wing muscle Hind leg Testis

Hap1Hap2Hap3

Fig. 1 Relative expression efficiency of the three ITS2 haplotypes in six body parts of a

0B male of the grasshopper E. plorans. Note that Hap1 showed the highest efficiency

(defined as the cDNA/gDNA ratio of read counts) in four somatic body parts, whereas

Hap3 showed the lowest efficiency in all body parts, although differences between body

parts were lower in testis. In general, the different body parts analyzed showed different

expression profiles for the three haplotypes. Remarkably, the patterns were almost

identical in the two most important muscles of the grasshopper, i.e. the wing and hind

leg muscles.

Population experiment

With these antecedents, we wanted to get an idea on ITS2 variation and expression at

population level, for which purpose we designed an ITS2 amplicon sequencing

experiment on 18 E.plorans males from the same population (Torrox). Six of these

males lacked B chromosomes (0B) and the remaining 12 males carried different number

of B chromosomes. The total sample obtained included 150,685 reads, of which,

130,742 matched the ITS2 sequence (66,617 gDNA and 64,125 cDNA reads). This

implied about 4x coverage in the gDNA.

The 5.8-28S coding region was identical in 97.72% of reads (ER= 2.28%), in

high contrast with the ITS2 region where the most frequent haplotype included only

35.79% of total reads. After applying this ER threshold to each male gDNA sample

separately, only six ITS2 haplotypes (Hap1-Hap6) appeared in more than 2.28% of

reads from one or more males (see counts in Table 1). We therefore discarded the

remaining hundreds of minority sequence types because many of then could be the

167

High variable and non-randomly expressed rDNA

product of sequencing errors. Hap1-Hap5 had also been found in the preliminary

experiments (see above) and Hap6 surpassed ER in four males. As a whole, the 62,322

reads for these six haplotypes comprised about 93.6% of all gDNA reads. They included

445-9,182 reads per male, with 3,462 reads on average (SE= 535). A total of 63,040

reads for these six haplotypes were obtained from the cDNA, with 3,502 per male on

average (SE= 363). The number of total amplicons obtained from gDNA and cDNA in

each male did not show significant differences (Wilcoxon test, T= 83, N=18, P= 0.91)

suggesting that the experiment worked similarly for both kinds of DNA.

Table 1. Read counts in the gDNA and cDNA from the 18 males analyzed.

gDNA cDNA

Id Bs Hap1 Hap2 Hap3 Hap4 Hap5 Hap6 Total Hap1 Hap2 Hap3 Hap4 Hap5 Hap6 Total

51 0 1151 745 337 0 4 44 2281 2477 907 718 0 1 41 4144

53 0 2224 1502 1202 0 1626 175 6729 1560 1929 231 0 1569 0 5289

57 0 1088 1031 641 0 123 51 2934 1168 276 478 0 525 14 2461

65 0 2354 2139 884 0 245 111 5733 2425 1887 125 0 308 0 4745

70 0 976 724 556 0 551 48 2855 778 904 199 0 785 0 2666

80 0 2290 1467 768 0 0 165 4690 2852 1812 183 0 2 0 4849

24 1 1013 965 329 801 6 46 3160 0 258 0 0 3 0 261

44 1 2347 1502 1018 524 0 183 5574 421 2618 229 0 0 8 3276

46 1 300 420 215 104 0 8 1047 727 1733 146 0 0 10 2616

48 1 1376 1060 313 406 0 61 3216 2254 604 84 0 0 18 2960

49 1 181 86 136 17 25 5 450 238 1619 315 26 720 5 2923

54 1 455 338 136 143 0 9 1081 3076 1214 658 90 0 53 5091

66 1 928 849 283 387 0 66 2513 490 429 163 0 195 0 1277

69 1 1427 804 375 348 3 61 3018 1413 960 313 0 689 0 3375

55 2 421 257 238 418 0 17 1351 2417 868 351 0 1 15 3652

63 2 2617 1476 648 4117 324 113 9295 5242 908 328 94 277 28 6877

50 3 938 257 191 503 0 26 1915 2096 302 275 63 0 12 2748

62 3 1584 702 675 1437 0 82 4480 2426 578 673 132 0 21 3830

Total 23670 16324 8945 9205 2907 1271 62322 32060 19806 5469 405 5075 225 63040

Exploration of variation for haplotype counts in gDNA by means of Factor

Analysis arranged the haplotypes into two main factors, one of them explaining 65.8%

of variance and including Hap1, Hap2, Hap3 and Hap6, and the other explaining 18.4%

of variance and including only Hap4 (Supplementary Table S4, Figure S1). This

analysis suggests a remarkable difference between Hap4 and the other haplotypes.

Given that most haplotype counts failed to fit a normal distribution, we used non

parametric Kruskal-Wallis ANOVA with the number of B chromosomes (0, 1, 2, and 3)

as independent variable and read counts for each haplotype in the gDNA as dependent

variable. Only Hap4 showed significant association with the number of B chromosomes

(H= 13.76, df= 3, P=0.0033). Bearing also in mind that we have not found this

haplotype in any of the B-lacking males, these results suggest that Hap4 is specific to B

chromosomes.

168

All six haplotypes showed a conserved secondary structure composed of three

arms (helix I, helix II and helix III) differing in size (see fig. 2), in coincidence with that

previously described for this species (Teruel et al., submitted). Thermal stability (dG=

Kcal/mol) was also highly conserved, ranging from -93.15 for Hap1 to -87.17 for Hap2,

with -92.57 on average (SE=1.47).

Fig. 2 Secondary structure of Hap1 and the five other ITS2 haplotypes (Hap2-Hap6)

found in E.plorans after analyzing 18 males from the Torrox population. Note that, in

respect to Hap1, Hap6 carries a hemicompensatory change in position 97, which is also

present in Hap3. But the latter also carries a hemicompensatory change in position 151

and a non compensatory change in position 153. These two latter changes are also

present in Hap2, but it lacks the change in position 97. Hap4 carries an adenine insertion

around positions 169-171, whereas Hap5 carries a CAA repetitive insertion of this triplet

in positions 168-170.

The minimum spanning tree showing the relationships among the six ITS2

haplotypes indicated that Hap1 is the haplotype most similar to the E. p. meridionalis

outgroup (Fig. 3), thus suggesting that it can be the ancestral haplotype for the Torrox

population, as is also suggested by its central position in the tree. The coexistence of six

different haplotypes in a single population, with up to four mutational events between

the most divergent ones, suggests that rDNA sequence homogenization shows low

efficiency for the ITS2 region in this species, specifically much lower than that

observed for the 5.8-28S coding region.

169

High variable and non-randomly expressed rDNA

Fig. 3 Minimum spanning tree showing the relationships between the six ITS2

haplotypes found in 18 E. plorans males from Torrox, based on their DNA sequences.

The nature of these mutational changes is indicated in Figure 2 and, in brief, they were

substitutions, excepting an indel of one nucleotide in Hap4, another of three nucleotides

in Hap5 and another of 15 nucleotides in the E. p. meridionalis haplotype.

Differential expression among haplotypes

The degree of expression for each haplotype can be assessed by comparing the

proportions of reads found in gDNA and cDNA. For this analysis, we first calculated

the proportion of read counts for each haplotype per male in order to give similar weight

to each male. We then calculated an index of absolute expression efficiency (AEE) for

each haplotype as the quotient between the cDNA and gDNA proportions in each male.

Finally, we calculated the relative expression efficiency (REE) in each male by dividing

each haplotype AEE by the highest of haplotype AEEs in the same male. We them

compared REEs between haplotypes by means of Friedman two-way ANOVA, in

different subsets of males since Hap4 was only present in the 12 B-carrying males and

Hap5 was present only in 5 B-lacking and 4 B-carrying males. A first analysis excluding

Hap4 and Hap5 showed significant differences between Hap1-Hap3 and Hap6 (χ2=

26.25, N= 18, df= 3, P<0.00001; Kendall coefficient of concordance: W= 0.49). When

Hap4 was included in the analysis (B-carrying males only), the differences were also

highly significant (χ2= 28.39, N= 12, df= 4, P<0.00001; Kendall coefficient of

concordance: W= 0.59). When Hap5 was included, instead of Hap4, the differences

were also significant (χ2= 19.36, N= 9, df= 4, P<0.00067; Kendall coefficient of

concordance: W= 0.54). Only four males carried the six haplotypes, but the Friedman

analysis still yielded significant differences among haplotypes even in this small sample

(χ2= 15, N= 4, df= 5, P<0.01036; Kendall coefficient of concordance: W= 0.75). These

analyses, as a whole, showed that Hap5 had the highest efficiency; in fact, it was the

most efficient haplotype in six out of the nine males carrying it. Hap1 and Hap2 were

the second and third in REE, but did not differ between them. However, Hap3 and Hap6

showed significantly lower REE values, and Hap4 showed the lowest value suggesting

strong repression (Figure 4). This result indicates that haplotypes are not randomly

expressed but, on the contrary, some selection for expression is taking place, the most

170

apparent being the active repression of Hap4 and the overexpression of Hap5. An

indirect manifestation of such selection is the fact that nucleotide diversity per male for

the ITS2 region was significantly higher in gDNA than cDNA (Wilcoxon test: T= 3, N=

18, P= 0.0003), indicating that only a subset of haplotypes are expressed.

0.00

0.20

0.40

0.60

0.80

1.00

Hap1 Hap2 Hap3 Hap4 Hap5 Hap6

Fig. 4 Relative Expression Efficiency of the six ITS2 haplotypes (Hap1-Hap6) found in

18 E.plorans males from Torrox. Error bars indicate ±1.96*SE. Values shown for Hap1-

Hap3 and Hap6 are based on N=18, that for Hap4 on N= 12 (B-carrying males) and

Hap5 on N= 9.

In all 12 males carrying B chromosomes, we analyzed at least 20 diplotene cells

submitted to silver impregnation that, in grasshoppers, reveals nucleoli attached to the

chromosome regions containing the rDNA. In all five B-carrying males where we found

454 reads for Hap4 in the cDNA, we could visualize some diplotene cells showing a

nucleolus attached to the B chromosome region containing the rDNA.

A comparative analysis of sequence conservation for the 5.8-28S coding region,

flanking the ITS2 reads, showed significantly higher conservation in the cDNA than in

gDNA, the proportion of reads carrying a conserved coding sequence of 99.03% and

98.24%, respectively (Wilcoxon: T= 33, N= 18, P= 0.022). A comparison among the

cDNA of the six haplotypes showed that this proportion was 100% only in Hap4, the

remaining haplotypes showing lower averages: 99.53% for Hap5, 99.33% for Hap2,

99.20% for Hap3, 98.46% for Hap1 and 96.89% for Hap6. A similar analysis in the

gDNA reads showed that Hap5 showed the highest conservation of adjacent coding

sequences (in 99.28% of reads), followed by Hap6 (98.98%), Hap3 (98.64%), Hap1

(98.22%), Hap2 (98.07%) and Hap4 (98.01%). This suggests that the ITS2 haplotype

being accompanied by the most conserved 5.8-28S regions in gDNA (Hap5) showed the

highest REE, whereas that being accompanied by the least conserved coding regions

(Hap4) showed the lowest REE, thus suggesting nonrandom expression of rRNA genes.

171

High variable and non-randomly expressed rDNA

Discussion

The huge amounts of DNA sequences provided by the 454 amplicon sequencing

experiments performed here yielded about 3x and 4x coverages for the body part and

population experiments, respectively. The resulting reads included many different

sequence types, some of which could be the product of PCR or sequencing errors.

Avoiding these errors is a repeated concern in the recent literature. Brodin et al. (2013)

concluded that most sequencing errors are introduced by PCR prior to sequencing. To

minimize this problem, we used the Phusion polymerase whose error rate is very low

(4.4x10-7

). The most frequent errors inherent to 454 pyrosequencing appear to be

associated with the presence of homopolymers, and tend to occur at sequence ends

(Gilles et al., 2011; Niklas et al., 2013). Although average error rate rarely surpasses

1%, it may reach 50% for indels in homopolymers. To cope with this problem, Gilles et

al. (2011) recommended the use of internal controls to correct for errors.

Our experiment provides an internal control for sequencing errors since the reads

obtained included a 123 nt sample of the coding 5.8-28S rDNA at both ends of the ITS2

region, which also limits the incidence of errors in the latter by setting it centrally in the

read. The most abundant haplotype for this coding region was identical in E. plorans

and L. migratoria (and other acridid species, Ruiz-Ruano et al., in preparation), and was

highly conserved in both species. The error rate estimations based on this internal

control were about 2.03% in L. migratoria and 2.28-2.6% in E. plorans. This allowed

accurate haplotype selection for the ITS2 region in the latter species, safely discarding

false positives among the hundreds of different sequence types found. Additional

evidence that Hap1-Hap5 were genuine haplotypes comes from their presence in our

preliminary experiments and in PCR-cloning-Sanger experiments by Teruel et al.

(submitted). Matyášek et al. (2012), in a similar experiment analyzing the coding and

ITS1 regions of rDNA in several Nicotiana species, by means of 454 amplicon

sequencing, considered only those haplotypes showing frequencies higher than 5%. In

E. plorans, the application of this filter would have left only Hap1-Hap4, thus excluding

Hap5 whose frequency was 4.5% in the population experiment and reaches 12% in a

Moroccan population, and Hap6 which surpasses the 5.8-28S threshold in a Spanish

population (Ruíz-Ruano et al., in preparation). Therefore, we suggest that using a partial

coding 5.8-28S sequence as internal control is a good method for filtering against 454

sequencing errors.

The existence of six different ITS2 haplotypes in E. plorans from a single

population is a clear indication of a remarkable intragenomic variation for this rDNA

region in this species, in clear contrast with the case of L. migratoria, where a single

haplotype was found. One of the E. plorans haplotypes (Hap4) has shown to be specific

to B chromosomes, since it was not found in any of the B-lacking individuals analyzed,

and read counts for it were significantly associated with the number of B chromosomes.

This haplotype was unique in showing the adenine insertion characteristic of the

ITS2_B sequence on which previous molecular detection of B-specific transcripts was

based (Ruiz-Estévez et al., 2012). We cannot rule out that some of the minority

172

sequence types found in B-carrying males, also carrying this adenine insertion, could be

genuine variants located in the B chromosomes, but this needs additional research.

The secondary structure of ITS2 plays an important role in defining the cleavage

sites for release of rRNA during its maturation (Musters et al., 1990; van der Sande et

al., 1992). The secondary structure of the six haplotypes found in E. plorans was much

conserved, in consistency with previous findings by Teruel et al. (submitted), and Gibbs'

free energy was very similar among the five haplotypes, suggesting that all of them

have the capability for expression, and all of them were actually found in the cDNA. In

respect to Hap1, the other haplotypes showed sequence changes including

hemicompensatory changes in Hap2, Hap3 and Hap6, non-compensatory changes in

Hap2 and Hap3, and indels in Hap4 (A) and Hap5 (CAA) (see Fig. 2). The most

frequent haplotype (Hap1) was also the ancestral haplotype for this population, given its

connection with the ITS2 sequence found in the subspecies E. p. meridionalis in the

MST, and is also the most frequent haplotype in B-lacking individuals from other

E.p.plorans populations in the Mediterranean area (Ruiz-Ruano et al., in preparation).

The existence of up to 4 mutational events among the most divergent haplotypes

suggests that homogenization is poorly efficient in this species.

The simultaneous analysis of haplotype frequency in gDNA and cDNA of the

same individuals allowed the analysis of haplotype efficiency in expression,

demonstrating that it differs among body parts within a same individual, and also

between individuals. To our knowledge, this is the first study performing this kind of

combined analysis. Although a preliminary result, it was remarkable that the two main

muscle tissues (wing muscle and hind leg), which provide the two most important

movements of grasshopper activity (flight and jump) showed the same pattern (see Fig.

1). In addition, two other somatic body parts (head and male accessory gland) showed

the same tendency of Hap1 overexpression and Hap3 underexpression, in consistency

with observations at the population level. However, the fifth somatic body part (gastric

caecum) was different in showing more expression for Hap2 than for Hap1, with Hap3

being almost completely repressed. The significance of these differences among somatic

body parts is unknown, although it is clear that its evolutionary transcendence is

irrelevant since only the testis is associated with the germ line. Although we did not

analyze germ cells alone, the expression in testis suggests that the observed differences

among haplotypes are less apparent since all three haplotypes showed about similar

proportions in gDNA and cDNA (see Fig. 1).

In the population experiment, we also observed significant underexpression of

Hap3, in concordance with findings in the somatic body parts and consistent with the

fact that the cDNA of the 18 males was obtained from testis-lacking hemibodies. It has

been suggested that rDNA homogenization might have something to do with its activity

(Lim et al., 2000; Dadejová et al. 2007). Since only the homogenization associated with

the germ line is significant for concerted evolution, the simultaneous analysis of gDNA

and cDNA in germ cells could serve to test this hypothesis. Even though our results are

not conclusive to this respect, they suggest that the most abundant haplotypes (Hap1

and Hap2) tend to show high REE, whereas other less abundant haplotypes (e.g. Hap3

173

High variable and non-randomly expressed rDNA

and Hap6) are less present in the cDNA (i.e. low REE). However, Hap5 is exceptional

for showing the highest REE in six out the nine males where it was present, perhaps

because it is a young haplotype as also evidenced by its highest homogeneity for the

adjacent coding regions.

The case of Hap4 was special since it is exclusive of the B chromosome, and it is

extremely underexpressed with only five of the 12 B-carrying males showing cDNA

reads, in much lower proportions than in gDNA. Remarkably, these five males showed

the presence of nucleoli attached to B chromosomes in silver stained diplotene cells,

indicating that the rDNA contained in the B chromosomes is able to yield its phenotype,

i.e. the nucleolus. Our results also indicate that B chromosome rDNA is completely

silenced in some males and is still highly silenced in those males carrying B

chromosomes being able to yield a nucleolus. In fact, a survey in 11 natural populations

harboring four different B chromosome variants showed B-NOR expression in 18 males

from seven populations, representing 11.66% of all 156 males analyzed (Ruíz-Estévez

et al., 2013). This frequency is much lower than the 48% observed in the Torrox

population (Ruíz-Estévez et al., 2012).

Our present results also indicate that the rRNA produced in the nucleoli yielded

by the B chromosome is enriched in rDNA coding regions being linked to the B-specific

ITS2 (Hap4). It would thus be interesting to know about the possible functionality of

this rRNA since cells tightly regulate the total amount of nucleolar area (Teruel et al.,

2007, 2009) and this implies that the rRNA copies produced by the B chromosome go in

detriment of copies produced by the A chromosomes. As commented above, our

analysis of secondary structure and Gibbs free energy appears to indicate that the ITS2

region produced by the B chromosome (Hap4) is as functional as that transcribed from

other chromosomes, although this is important only in terms of ITS2 elimination from

the transcript. However, the higher degree of sequence conservation for the 5.8-28S

coding regions in the cDNA, compared to that in gDNA, suggests some selection for

expression of rDNA units with higher sequence conservation for expression. This kind

of non-random expression of rDNA units is consistent with the observation by Flavell et

al. (1988) that unmethylated cytosines are not distributted at random in the rDNA but is

related to the activity of the NOR in which they reside. Recently, Zhou et al. (2013)

have proposed a model by which a genome containing copies of the R2 retrotransposon

in the 28S rDNA selects transcription domains in the region containing the fewest R2

insertions, which is also consistent with non-random expression of rDNA units. The fact

that Hap4 (the B-specific haplotype) was the only one associated with 100% of

completely conserved flanking coding regions in the cDNA, suggests that this selection

is more stringent when the rDNA is transcribed from the B chromosome. This suggests

that B copies are fully functional. In the E. plorans genome, R2 retroelements are

preferentially located in B chromosomes, but Bs actually constitute a sink for R2 since

the rDNA of the B chromosomes is rarely active and, as shown here, its most

representative ITS2 haplotype (Hap4) is highly repressed. The fact that the few Hap4

copies escaping silencing (thus observed in the cDNA) show the flanking coding

regions completely conserved suggests that the genome is extremely careful about

174

which rDNA copies are active, especially in a genome with so much rDNA only

needing to express a small proportion of it.

How is haplotype differential expression possible bearing in mind that, at least in

Arabidopsis thaliana, the units of rRNA regulation are NORs (i.e. the rDNA clusters

located in every chromosome) rather than individual rRNA genes (Lewis et al., 2004)?

In previous analysis by means of silver impregnation, we showed the interdependence

of NOR expression among several chromosomes in E. plorans (Teruel et al., 2009). If

the unit of regulation is the NOR, the differential expression among haplotypes is only

possible if haplotypes are not distributed at random in the different chromosomes

carrying rDNA. The analysis of the ITS2 sequences obtained by microdissection and

PCR-cloning from individual chromosomes (Teruel et al., submitted) shows that 42 out

of 72 sequences analyzed matched five of the six haplotypes analyzed here, with Hap1

being the most ubiquitous haplotype found in at least the chromosomes 8, 9, X and B,

whereas Hap2 was found only in chromosome 11 and Hap4 was exclusive to the B

chromosome. Although more ITS2 sequences need to be individually analyzed from

each chromosome, this preliminary result suggests some structuring in ITS2 haplotype

distribution among chromosomes. This is presumably a consequence of poor non-

homologous homogenization of the ITS2 region in E. plorans, although this fact does

not apply to the 5.8-28s coding regions which are highly homogenized, presumably due

to higher surveillance by natural selection (Eickbush and Eickbush, 2007; Ganley and

Kobayashi, 2007). As commented above, this highly contrasts with the L. migratoria

genome where both coding and ITS2 rDNA regions show high levels of homogenization.

Genome size in E. plorans contains about 10 Gb, i.e. almost twice that in L. migratoria

(Ruiz-Ruano et al., 2011). In addition, E. plorans in the Torrox population harbors rDNA

clusters in seven A chromosome pairs (Cabrero et al., 2003) plus the B chromosome

(Cabrero et al., 1999), with about 15,000 rDNA units in the A chromosomes and about

3,000 in the B24 chromosome (Montiel et al., in preparation). In L. migratoria, however,

only three A chromosome pairs carry rDNA (Teruel et al., 2010). Although no

estimation of rDNA copy number has been done in the latter species, the FISH signals

obtained for rDNA in E. plorans are conspicuously larger than those in L. migratoria

(compare Fig. 1a in Teruel et al., 2010 with Fig. 1c in Teruel et al., 2007).

At first sight, it might appear that the fact that the E. plorans genome needs to

homogenize much higher amounts of rDNA units than that in L. migratoria could make

this task more difficult in the former thus justifying its poorer homogenization for the

ITS2 region. Although the fact that another grasshopper species, Stauroderus scalaris,

carries even more rDNA than E. plorans (López-León et al., 1999) in an even larger

genome (15.98 Gb; Belda et al., 1991) but shows an ITS2 rDNA region even more

homogenized than that in L. migratoria (Ruiz-Ruano et al., in preparation) suggests that

there must be other causes than rDNA quantity for the ITS2 variation found in E.

plorans. A possibility is the recent expansion of rDNA through different A

chromosomes across the Mediterranean area (López-León et al., 2008). As these authors

showed, E. plorans populations from the Caucasus (Dagestan) carry rDNA in only two

175

High variable and non-randomly expressed rDNA

A chromosomes (9 and 11). However, a growing number of A chromosomes harboring

rDNA was observed from east to west: 9, 10 and 11 (Armenia), 1, 9-11 and X (Turkey),

9-11 and X (Greece), 1, 4-11 and X (Spain), and 1-11 and X (Morocco). The analysis of

microdissected A and B chromosomes (Teruel et al., submitted) suggests that, if the

haplotype structuration already existed in rDNA arrays from chromosomes 9 and 11

before intragenomic spread, the rDNA in chromosome 9 appears to have been more

expansive, since this chromosome (along with chromosomes 8, X and B) contained

Hap1, which is the most frequent haplotype in B-lacking individuals from all E. plorans

plorans populations across the Mediterranean region (Ruiz-Ruano et al., in preparation),

whereas chromosome 11 was the only one carrying Hap2. In addition, there was an east-

west gradient for the proportion of rDNA in B chromosomes, with those from the east

being almost exclusively made up of rDNA whereas those from western populations

(Spain and Morocco) also containing high amount of a 180 bp satellite DNA (López-

León et al., 2008).

The significant positive correlation found between genome size and the amount

of rDNA in plants and animals (Prokopowich et al., 2003) might suggest some

optimization for both genomic parameters. But a massive intragenomic spread of rDNA,

such as that occurred in E. plorans, could break this relationship impeding efficient

homogenization among non-homologous chromosomes, especially for a genome which,

prior to such spread, only had to homogenize the rDNA units in two non-homologous

chromosomes (9 and 11), a situation appearing to be ancestral in this species since it is

similar in the South African subspecies E. plorans meridionalis (López-León et al.,

2008). The possibility that homogenization between homologous chromosomes works

well in this species is contradicted by the existence of six different haplotypes since, if

chromosomes 9 and 11 would have been properly homologously homogenized, prior to

intragenomic rDNA spread, we would expect a maximum of two different haplotypes,

one coming from chromosome 9 and other from chromosome 11, assuming poor non-

homologous homogenization. Alternatively, this variety of haplotypes could be the

result of population mixture prior to the recent expansion of this species through the

Western Mediterranean area which led to the spread of a same type of B chromosome

(B1), given that this B variant was the ancestor for all B chromosome types found in

Spain, Morocco, Balearic Islands, Tunisia and Sicily (Cabrero et al., 2013). Perhaps a

recent event like this has not provided the genome enough time for an efficient

homogenization. In any case, bearing huge amounts of not completely homogenized

rDNA is not a problem for a genome as long as it is able to select conserved coding

regions for expression, irrespective of whether they are accompanied by ITS2 regions of

one haplotype or another, or even if they are located in a B chromosome.

Acknowledgements

We thank Tatiana López for technical assistance and Karl Meunier for language revision. This

study was supported by grants from the Spanish Ministerio de Ciencia y Tecnología (CGL2009-

11917) and Plan Andaluz de Investigacion (CVI-6649), and was partially performed by FEDER

176

funds. M Ruíz-Estévez was supported by a FPU fellowship from the Spanish Ministerio de

Ciencia e Innovación.

References

Alper I, Frenette M, Labrie S (2011) Ribosomal DNA polymorphisms in the yeast

Geotrichum candidum. Fungal Biol 115(12):1259-1269

Belda JE, Cabrero J, Camacho JP, Rufas JS (1991) Role of C-heterochromatin in

variation of nuclear DNA amount in the genus Chorthippus (Orthoptera,

Acrididae). Cytobios 67:13–21

Bragg L, Stone G, Imelfort M, Hugenholtz P, Tyson GW (2012) Fast, accurate error-

correction of amplicon pyrosequences using Acacia. Nature Methods 9:425–426

doi:10.1038/nmeth.1990

Britten RJ, Kohne DE (1968) Repeated sequences in DNA. Hundreds of thousands of

copies of DNA sequences have been incorporated into the genomes of higher

organisms. Science 161(3841):529-540

Brodin J, Mild M, Hedskog C, Sherwood E, Leitner T, Andersson B, Albert J (2013)

PCR-Induced transitions are the major source of error in cleaned Ultra-Deep

Pyrosequencing Data. PLoS ONE 8(7): e70388

doi:10.1371/journal.pone.0070388

Brown DD, Wensink PC, Jordan E (1972) A comparison of the ribosomal DNA’s of

Xenopus laevis and Xenopus mulleri: the evolution of tandem genes. J Mol Biol

63:57-73

Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM

(1997) Geographical distribution of B chromosomes in the grasshopper

Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective

historical events. Chromosome Res 5:194-198

Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B

chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity

83:435-439

Cabrero J, Perfectti F, Gómez R, Camacho JPM, López-León MD (2003a) Population

variation in the A chromosome distribution of satellite DNA and ribosomal

DNA in the grasshopper Eyprepocnemis plorans. Chromosome Res 11: 375-381

Dadejová M, Lim KY, Soucková-Skalická K, Matyásek R, Grandbastien MA, Leitch A,

Kovarík A (2007) Transcription activity of rRNA genes correlates with a

tendency towards intergenomic homogenization in Nicotiana allotetraploids.

New Phytologist 174:658-668

Darty K, Denise A, Ponty Y (2009) VARNA: Interactive drawing and editing of the

RNA secondary structure. Bioinformatics 25:1974

Date A, Satta Y, Takahata N, Chigusa SI (1998) Evolutionary history and mechanism of

the Drosophila cecropin gene family. Immunogenetics 47:417-429

Dover GA (1982) Molecular drive: a cohesive mode of species evolution. Nature

299:111–117

Druley TE, Vallania FL, Wegner DJ, Varley KE, Knowles OL, Bonds JA, Robison SW,

Doniger SW, Hamvas A, Cole FS (2009) Quantification of rare allelic variants

from pooled genomic DNA. Nature Methods 6:263-265

Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M (2009) Geneious v4. 8.

Biomatters Ltd., Auckland, New Zealand

Edgar RC, Haas BJ, Clemente JC, Quince C and Knight R.UCHIME improves

177

High variable and non-randomly expressed rDNA

sensitivity and speed of chimera detection (2011) Bioinformatics 27(16): 2194–

2200. doi:10.1093/bioinformatics/btr381

Eickbush TH, Burke WD, Eickbush DG, Lathe WC (1997) Evolution of R1 and R2 in

the rDNA units of the genus Drosophila. Genetica 100(1-3):49-61

Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the

ribosomal RNA genes. Genetics 175(2):477-485

Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: A new series of programs to

perform population genetics analyses under Linux and Windows. Mol Ecol

Resources 10:564–567. doi:10.1111/j.1755-0998.2010.02847.x.

Faircloth BC, Glenn TC (2012) Not all sequence tags are created equal: designing and

validating sequence identification tags robust to indels. PloS One 7:e42543. doi:

10.1371/journal.pone.0042543

Feliner GN, Larena BG, Aguilar JF (2004) Fine-scale geographical structure, intra-

individual polymorphism and recombination in nuclear ribosomal internal

transcribed spacers in Armefia (Plumbaginaceae). Ann Bot 93:189-200

Flavell RB, O’Dell M, Thompson WF (1988) Regulation of cytosine methylation in

ribosomal DNA and nucleolus organizer expression in wheat. Journal of

Molecular Biology 204:523-534

Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal

DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun

sequence data. Genome Research 17:184-191

Gilles A, Meglécz E, Pech N, Ferreira S, Malausa T, Martin JF (2011) Accuracy and

quality assessment of 454 GS-FLX Titanium pyrosequencing. Bmc Genomics

12:245

Goffeau A, Barrell BG, Bussey H, Davis RW, Dujon B, Feldmann H, Galibert F,

Hoheisel JD, Jacq C, Johnston M, Louis EJ, Mewes HW, Murakami Y,

Philippsen P, Tettelin H, Oliver SG (1996) Life with 6000 genes. Science

274(5287):546:563-7

Gu X, Nei M (1999) Locus specificity of polymorphic alleles and evolution by a birth-

and-death process in mammalian MHC genes. Mol Biol Evol 16:147-156

Hřibová E, Čížková J, Christelová P, Taudien S, de Langhe E, and Doležel J (2011)

The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and

use in molecular phylogeny. PLoS One 6(3):e17863. doi:

10.1371/journal.pone.0017863

James SA, O’Kelly MJT, Carter DM, Davey RP, Van Oudenaarden A, Roberts IN

(2009) Repetitive sequence variation and dynamics in the ribosomal DNA array

of Saccharomyces cerevisiae as revealed by whole genome resequencing.

Genome Res 19:626-635

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7:

improvements in performance and usability. Molecular Biology and Evolution

30:772-780

Kautz S, Rubin BE, Russell, JA, Moreau CS (2013) Surveying the microbiome of ants:

Comparing 454 pyrosequencing with traditional methods to uncover bacterial

diversity. Applied and Environmental Microbiology 79:525-534

Keller I, Chintauan-Marquier IC, Veltsos P, Nichols RA (2006) Ribosomal DNA in the

grasshopper Podisma pedestris: escape from concerted evolution. Genetics

174:863-874

Keller I, Veltsos P, Nichols RA (2008) The frequency of rDNA variants within

individuals provides evidence of population history and gene flow across a

grasshopper hybrid zone. Evolution 62:833-844

178

Lewis MS, Cheverud JM, Pikaard CS (2004) Evidence for nucleolus organizer regions

as the units of regulation in nucleolar dominance in Arabidopsis thaliana

interecotype hybrids. Genetics 167:931-939

Li Y, Jiao L, Yao YJ (2013) Non-concerted ITS evolution in fungi, as revealed from

the important medicinal fungus Ophiocordyceps sinensis. Mol Phylogenet Evol

68(2):373-379

Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA

polymorphism data. Bioinformatics 25:1451-1452

Lim KY, Kovarik A, Matýăsek R, Bezdĕk M, Lichtenstein CP, Leitch AR (2000) Gene

conversion of ribosomal DNA in Nicotiana tabacum is associated with

undermethylated, decondensed and probably active gene units. Chromosoma

109:161-172

Lidner DL, Carlesen T, Henrik Nilsson R, Davey M, Schumacher T, Kauserud H (2013)

Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in

the internal transcribed spacer rDNA region in fungi. Ecol Evol 3(6):1751-1764

Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727-

764

López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,

Camacho JPM (1994). Possible origin of a B chromosome deduced from its

DNA composition using double FISH technique. Chromosome Res 2:87-92

López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during

development in the B chromosome NOR of the grasshopper Eyprepocnemis

plorans. Heredity 74:296-302

López-León MD, Cabrero J, Camacho JPM (1999) Unusually high amount of inactive

ribosomal DNA in the grasshopper Stauroderus scalaris. Chromosome Res

7:83-88

López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov

NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and

B chromosomes between eastern and western populations of the grasshopper

Eyprepocnemis plorans plorans. Cytogenet Genome Res 121:260-265

Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J,

Braverman MS, Chen YJ, Chen Z (2005) Genome sequencing in

microfabricated high-density picolitre reactors. Nature 437:376-380

Matyášek R, Renny-Byfield S, Fulneček J, Macas J, Grandbastien MA, Nichols

R, Leitch A, Kovařík A (2012) Next generation sequencing analysis reveals a

relationship between rDNA unit diversity and locus number in Nicotiana

diploids. BMC genomics 13:722. doi: 10.1186/1471-2164-13-722

Mayol M, Rosselló JA (2001) Why nuclear ribosomal DNA spacers (ITS) tell different

stories in Quercus. Mol Phylogenet Evol 19:167-176

Meyer F, Paarmann D, D’Souza M, Olson R, Glass EM, Kubal M, Paczian T, Rodriguez

A, Stevens R, Wilke A, et al. (2008) The metagenomics RAST server - a public

resource for the automatic phylogenetic and functional analysis of

metagenomes. BMC Bioinformatics 9:386

Michelmore RW, Meyers BC (1998) Clusters of resistance genes in plants evolve by

divergent selection and a birth-and-death process. Genome Res 8:1113-1130

Musters W, Boon K, Van der Sande CA, Van Heerikhuizen H, Planta RJ (1990)

Functional analysis of transcribed spacers of yeast ribosomal DNA. The EMBO

journal 9:3989

Nei M, Hughes AL (1992) in 11th Histocompatibility Workshop and Conference, eds.

Tsuji K, Aizawa M and Sasazuki T (Oxford Univ. Press, Oxford), Vol. 2, pp:27-

179

High variable and non-randomly expressed rDNA

38

Nei M, Gu X, Sitnikova T (1997) Evolution by the birth-and-death process in multigene

families of the vertebrate immune system. Proc Natl Acad Sci USA

94(15):7799-780

Nei M, Rogozin IB, and Piontkivska H (2000) Purifying selection and birth-and-death

evolution in the ubiquitin gene family. Proc Natl Acad Sci USA 97(20):10866-

10871

Niklas N, Pröll J, Danzer M, Stabentheiner S, Hofer K, Gabriel C (2013) Routine

performance and errors of 454 HLA exon sequencing in diagnostics. BMC

Bioinformatics 14:176

Ota T, Nei M (1994) Divergent evolution and evolution by the birth-and-death process

in the immunoglobulin VH gene family.Mol Biol Evol 11(3):469-482

Pilotti M, Brunetti B, Tizzani L (2009) Platanus×acerifolia genotypes surviving to

inoculation with Ceratocystis platani (the agent of canker stain): first screening

and molecular characterization. Euphytica 169:1-7

Prokopowich CD, Gregory TR, Crease TJ (2000) The correlation between rDNA copy

number and genome size in eukaryotes. Genome 46:48-50

Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and

vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327

Rice P, Longden I, Bleasby A (2000). EMBOSS: the European molecular biology open

software suite. Trends in Genetics 16:276-277

Rooney AP, Piontkivska H, Nei M (2002) Molecular evolution of the nontandemly

repeated genes of the histone 3 multigene family.

Mol Bio and Evo 19(1):68-75

Rooney AP, Ward TJ (2005) Evolution of a large ribosomal RNA multigene family in

filamentous fungi: Birth and death of a concerted evolution paradigm. Proc Natl

Acad Sci 102:5084-5089

Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for

the localization of nucleolus and nucleolar organizer under light and electron

microscopy. Arch Biol 93:267-274

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome

Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS

ONE 7(5): e36600. doi:10.1371/journal.pone.0036600

Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is

active in different B chromosome variants of the grasshopper Eyprepocnemis

plorans. Genetica 141:337-345

Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,

Camacho JPM, (2011) DNA amount of X and B chromosomes in the

grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet

genome Res 134:120-126

Simon UK, Weiss M (2008) Intragenomic variation of fungal ribosomal genes is higher

than previously thought. Mol Biol Evol 25(11):2251-2254

Sitnikova T, Nei M (1998) Evolution of immunoglobulin kappa chain variable region

genes in vertebrates. Mol Biol Evol 15(1):50-60

Sogin ML, Morrison HG, Huber JA, Welch DM, Huse SM, Neal PR, Arrieta JM, Herndl

GJ (2006) Microbial diversity in the deep sea and the underexplored “rare

biosphere”. Proc Natl Acad Sci USA 103:12115-12120

Song HX, Gao SP, Jiang MY, Liu GL, Yu XF, Chen QB (2012) The evolution and utility

of ribosomal ITS sequences in Bambusinae and related species: divergence,

pseudogenes, and implications for phylogeny. J Genet 91:129-139

180

Stage DE, Eickbush TH (2007) Sequence variation within the rRNA gene loci of 12

Drosophila species. Genome Res 17(12):1888-1897

StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.

www.statsoft.com

Stewart FJ, Cavanaugh CM (2007) Intragenomic variation and evolution of the internal

transcribed spacer of the rRNA operon in bacteria. J Mol Evol 65(1):44-67

Teacher AGF, Griffiths DJ (2011) HapStar: Automated haplotype network layout and

visualisation. Mol Ecol Res 11:151-153

Tedersoo L, Nilsson RH, Abarenkov K, Jairus T, Sadam A, Saar I, Bahram M, Bechem

E, Chuyong G, Kõljalg U (2010) 454 Pyrosequencing and Sanger sequencing of

tropical mycorrhizal fungi provide similar results but reveal substantial

methodological biases. New Phytologist 188:291-301

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper

Eyprepocnemis plorans. Chromosome Res 15:755–765

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR

expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118:291–301

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry

revealed by histone genes in the migratory locust. Chromosoma 119: 217–225

Van der Sande CA, Kwa M, van Nues RW, van Heerikhuizen H, Raué HA, Planta RJ

(1992) Functional analysis of internal transcribed spacer 2 of Saccharomyces

cerevisiae ribosomal DNA. Journal of molecular biology 223:899-910

Van Tassell CP, Smith TP, Matukumalli LK, Taylor JF, Schnabel RD, Lawley CT,

Haudenschild CD, Moore SS, Warren WC, Sonstegard TS (2008) SNP

discovery and allele frequency estimation by deep sequencing of reduced

representation libraries. Nature Methods 5:247-252

Veltsos P, Keller I, Nichols RA (2009) Geographically localised bursts of ribosomal

DNA mobility in the grasshopper Podisma pedestris. Heredity 103:54-61

Vydryakova GA, Van DT, Shoukouhi P, Psurtseva NV, Bissett J (2012) Intergenomic

and intragenomic ITS sequence heterogeneity in Neonothopanus nambi

(Agaricales) from Vietnam. Mycology 3:89-99

Wang T, Pradhan K, Ye K, Wong LJ, Rohan TE (2011) Estimating allele frequency from

next-generation sequencing of pooled mitochondrial DNA samples. Front Genet

2:51

Wörheide G, Nichols SA, Goldberg J (2004) Intragenomic variation of the

rDNA internal transcribed spacers in sponges (Phylum Porifera): implications

for phylogenetic studies. Mol Phylogenet Evol 33(3):816-830

Zavodna M, Grueber CE, Gemmell NJ (2013) Parallel Tagged Next-Generation

Sequencing on Pooled Samples–A New Approach for Population Genetics in

Ecology and Conservation. PloS One 8:e61471. doi:

10.1371/journal.pone.0061471

Zimmer EA, Martin SL, Beverley SM, Kan YW, Wilson, AC (1980) Rapid duplication

and loss of genes coding for the alpha chains of hemoglobin. Proc Natl Acad Sci

USA 77: 2158-2162

Zhan J, Dyer KD, Rosenberg HF (2000) Evolution of the rodent eosinophil associated

RNase gene family by rapid gene sorting and positive selection. Proc Natl Acad

Sci USA 97:4701–4706

Zhou J, Eickbush MT, Eickbush TH (2013) A Population Genetic Model for the

Maintenance of R2 Retrotransposons in rRNA Gene Loci. PLoS Genet

181

High variable and non-randomly expressed rDNA

9(1):e1003179. doi:10.1371/journal.pgen.1003179

Zuker M (2003) Mfold web server for nucleic acid folding and hybridization

prediction. Nucleic Acids Research 31:3406-3415

Supporting Information

Table S1 Sequence and edit distances of the six tags of the ITS2 primers.

Tag Sequence Distance

1 AACAGC 5

2 AGGCTA 5

3 CCATTG 5

4 CTCGAA 5

5 TGTACG 5

6 AGAATA 4

Table S2 Tag combinations of the primers used to amplify each sample in the

comparison between individuals (F: forward; R: reverse).

gDNA cDNA

Male Nº B F R F R

51 0 6 5 2 3

53 0 1 6 2 4

57 0 2 6 2 5

65 0 6 3 2 1

70 0 3 6 4 3

80 0 6 4 2 2

49 1 5 5 1 4

54 1 5 3 1 2

24 1 3 4 5 1

44 1 4 6 3 1

46 1 5 6 3 2

48 1 6 6 3 3

66 1 4 2 3 5

69 1 4 4 4 5

55 2 5 4 1 3

63 2 6 2 4 1

62 3 6 1 1 5

50 3 5 2 1 1

182

Table S3 Tag combinations of the primers used to amplify each sample in the

comparison between body parts (F: forward; R: reverse).

0B

Source Body part F R

gDNA

Head 1 1

Hind leg 1 2

Wing muscle 1 3

Testis 1 4

Accessory gland 1 5

Caecum 5 1

cDNA

Head 2 1

Hind leg 2 2

Wing muscle 2 3

Testis 2 4

Accessory gland 2 5

Caecum 5 2

Table S4 Factor Analysis performed with the read counts

for the six ITS2 haplotypes found in the gDNA of

E.plorans males. (Expl. Var= Explained variance; Prp.

Totl= Proportion of total variance).

gHap2 -0.911316 -0.048614

gHap3 -0.950261 0.193937

gHap4 -0.265602 -0.875889

gHap5 -0.578536 0.491940

gHap6 -0.950417 0.030487

Expl.Var 3.949.135 1.103.900

Prp.Totl 0.658189 0.183983

183

High variable and non-randomly expressed rDNA

F actor Load ings, F actor 1 vs. F actor 2

R ota tion : U nro ta tedExtraction : Pr incipa l com ponents

gH ap1

gH ap2

gH ap3

gH ap4

gH ap5

gH ap6

-1,0 -0 ,9 -0 ,8 -0 ,7 -0 ,6 -0 ,5 -0 ,4 -0 ,3 -0 ,2

F actor 1

-1 ,0

-0 ,8

-0 ,6

-0 ,4

-0 ,2

0,0

0,2

0,4

0,6

Fa

cto

r 2

Fig. S1 The graph shows the position of the five ITS2 haplotypes found in the gDNA

(gHap) of E.plorans, according to the two factors obtained after the Factor Analysis.

184

Capítulo 9. Discusión general

185

186

Discusión general

El objetivo de esta Tesis Doctoral es averiguar si la secuencia del ADN ribosómico

(ADNr) que albergan los cromosomas B del saltamontes Eyprepocnemis plorans

permite diferenciarlo del localizado en los cromosomas A y, en ese caso, averiguar si el

ADNr del B es funcional, en qué grado y en qué partes del cuerpo se expresa, así como

el significado biológico de los transcritos de ARNr que aportan los cromosomas B.

Dado el importante papel de la expresión del ADNr (ARNr) en la síntesis de

ribosomas y, por tanto, de proteínas (Sollner-Webb y Tower, 1986) y teniendo en

cuenta los resultados previos obtenidos por Teruel y col. (2007, 2009) en los que ponían

de manifiesto la activación de la NOR del cromosoma B24, nos propusimos ampliar este

estudio en machos del año 2008 de la misma población, y hacerlo no sólo al nivel

citogenético sino también al molecular. En el análisis citogenético mediante

impregnación argéntica encontramos que el porcentaje de machos portadores de B con

su NOR activa no había cambiado desde 2004, siendo del 50%, y en ellos tampoco

había variado desde 1999 el porcentaje de células con la NOR del B activa,

(aproximadamente 20%) aunque existían diferencias entre machos. Esto sugiere que la

activación del ADNr del B no es un hecho aleatorio, sino que debe estar regulado a

nivel de individuo y de célula. A nivel molecular, la comparación de secuencias de

ADNr procedentes de diferentes cromosomas microdiseccionados de Eyprepocnemis

plorans de Torrox obtenidas por Teruel (2009) permitió detectar la inserción diferencial

de un adenina en las secuencias ITS2 del cromosoma B. Tras diseñar los primers para

detectar los transcritos ARNr que provenían específicamente del B, a los que hemos

denominado ITS2_B, detectamos estos transcritos propios del B en 18 de los 19 machos

en los que citogenéticamente habíamos observado la NOR del B activa. El hecho de que

no los detectáramos en la totalidad de machos analizados puede deberse a que el nivel

de expresión de la NOR es tan bajo que hace improbable la detección de los transcritos

ITS2_B, o también al hecho de que el nucleolo se visualiza en diplotene/paquitene pero

su activación tuvo lugar previamente en leptonene/citogene, con lo que los transcritos

ARNr del B pueden haberse degradado aunque el macho muestre nucleolo. Por otra

parte, en 13 de los 15 machos analizados con la NOR del B inactiva no detectamos

transcritos del B, pudiéndose explicar estas dos excepciones por una disociación

temprana del nucleolo en diplotene, o bien por la existecia de un umbral en la técnica de

impregnación argéntica por debajo del cual no se tiñen los nucleolos, no siendo posible

visualizalos aunque el ADNr del B estuviera activo en ambos casos. En cualquier caso,

las excepciones encontradas también pueden deberse a que el estudio citogenético se

hizo en testículo mientras que el análisis molecular se llevó a cabo en una muestra

compuesta por una mezcla de tejidos del cuerpo entero, a excepción del testículo que se

utilizó exclusivamente para los estudios citogenéticos.

En general, existe una gran correspondencia entre la visualización del nucleolo

del B y la expresión de su ADNr, por lo que este estudio nos permitió desarrollar una

herramienta para detectar molecularmente la activación del ADNr del B. El uso de esta

187

Discusión general

aproximación molecular permite eliminar la duda de si el nucleolo que observamos en

el B es propiamente suyo o por el contrario está reclutando material nucleolar de otras

NORs. El desarrollo de esta estrategia es muy interesante ya que también nos ha

permitido analizar la expresión del ADNr del B en hembras, un material donde es difícil

encontrar en las gónadas células en división meiótica y más aún encontrar células en

profase I donde sea posible visualizar nucleolos. Así, detectamos transcritos de ARNr

del B en 10 de las 13 hembras analizadas, y dada la alta correspondencia

citogenética/molecular observada en los machos, podemos inferir que el ADNr del B

está activo en mayor proporción en las hembras.

Los transcritos de ARNr del B podrían tener una función importante en la

organización y/o regulación de los propios Bs (Carchilan y col. 2007; Han y col. 2007).

En E. plorans los transcritos de ARNr del B son importantes, además, para garantizar la

demanda de rRNA celular ya que se ha observado en la población de Torrox que el área

nucleolar total de la célula no depende del nivel de actividad en la NOR del B24, de

forma que si aumenta la actividad de la NOR del B, disminuye la de los As y viceversa

(Teruel y col. 2007, 2009), lo que indicaba que los transcritos ARNr del B son

funcionales como finalmente hemos demostrado en esta tesis. Ide y col. (2010)

demostraron en sus estudios en levaduras que la baja sensibilidad al daño del ADN en

las cepas con gran número de copias de ADNr depende de la baja tasa de transcripción

de los genes de ARNr. Según esto, la regulación del área nucleolar total observada en E.

plorans sería un mecanismo llevado a cabo por los As para proteger al genoma frente a

agentes dañinos y así no ver disminuida su eficacia biológica.

La reciente activación de la NOR del B24 recuerda al fenómeno de dominancia

nucleolar (Pikaard, 2000a, 2000b) que se da sobre todo en híbridos, en el cual el ADNr

de uno de los parentales permanece activo mientras el otro es inactivado. Este fenómeno

es reversible, con lo que el ADNr inactivo puede reactivarse bajo ciertas circunstancias

como alto requerimiento de síntesis proteica (Chen y Pikaard, 1997). Esta

activación/inactivación se debe a patrones de metilación del ADN o acetilación de

histonas, hechos que se han observado en los Bs de E. plorans, ya que Cabrero y col.

(1987) y López-León y col. (1991) demostraron la actividad NOR e hipometilación de

un B2 que estaba fusionado a un autosoma, y Cabrero y col. (2007) demostraron la

hipoacetilación de las histonas H3 en Bs inactivos.

En E. plorans se han descrito más de 50 variantes de cromosomas B (Henriques-

Gil y col. 1984; López-León y col. 1993; Bakkali y col. 1999; Abdelaziz y col. 2007;

López-León y col. 2008) que derivan unas de otras debido al alto grado de mutaciones

que muestran estos cromosomas, lo que les abre nuevos caminos evolutivos. Henriques-

Gil y col. (1984) y Henriques-Gil y Arana (1990) sugirieron que el B1 era la variante

ancestral en la Península Ibérica, ya que la encontraron en todas las poblaciones

analizadas a excepción de las de Granada y las del oeste de Málaga, donde fue

reemplazada por B2, y en Fuengirola, donde fue reemplazada por B5.

Tras analizar mediante FISH la composición en ADNr y ADNsatélite (ADNsat)

de los cromosomas B de diferentes poblaciones del Mediterráneo occidental, tales como

188

Sicilia, Túnez y 15 poblaciones españolas, encontramos 4 variantes: B1, B2, B5 y B24

formadas mayoritariamente por estos dos tipos de secuencias pero con distinta

proporción de ellas, y distinto tamaño relativo respecto al cromosoma X. Esto sugiere

que diferentes mutaciones cromosómicas han producido amplificaciónes y deleciones

de estas secuencias creando variantes nuevas de B, como ha ocurrido con B5 y B24. En

las variantes B1 y B2, las diferencias en composición y tamaño se ponen de manifiesto

incluso en la misma variante en dos poblaciones diferentes, un hecho lógico si tenemos

en cuenta que son más antiguas que B5 y B24 con lo que han tenido más tiempo de

acumular pequeños cambios.

La determinación de qué variante tiene cada población, nos permitió hacer

algunas inferencias respecto a cuál fue la variante B ancestral y cuándo apareció. El B1

está en toda la región mediterránea occidental (Sicilia, Túnez, Islas Baleares y Península

Ibérica) y también se ha encontrado en Marruecos (Cabrero y col. 1999), por lo que es

la variante de B más ampliamente distribuida en esta región. Se la considera la variante

ancestral en la Península Ibérica porque es la más representada (Henriques-Gil y col.

1984; Henriques-Gil y Arana, 1990), pero tras encontrarla también en poblaciones

distantes de Sicilia y Túnez se puede considerar además que B1 es la variante ancestral

de todo el oeste mediterráneo. Sin embargo, los Bs analizados en zonas del

mediterráneo oriental, como Grecia y Turquía (Abdelaziz y col. 2007; López-León y

col. 2008) tienen mayores proporciones de ADNr que B1, por lo que constituyen tipos

de B diferentes a los analizados en el presente estudio.

Los Bs del mediterráneo occidental y oriental son de reciente aparición (Muñoz-

Pajares y col. 2011) ya que: 1) muestran muy poca variación para la región de 1510 pb

del SCAR (otro marcador molecular del B), 2) hay poblaciones del interior de la

Península aisladas por barreras geográficas, como en la cabecera del Río Segura, que no

tienen B (Cabrero y col. 1997; Manrique-Poyato y col. en preparación), 3) la población

de Otívar que se localiza a 10 km de la costa ha sido colonizada por Bs en los últimos

35 años (Camacho y col. presentado). Si hemos podido observar en cortos periodos de

tiempo cómo el B coloniza nuevas regiones, podría ser que su origen lo pudiéramos

medir en términos de tiempo histórico reciente. Este dato viene apoyado por el hecho de

que E .plorans se encuentra muy frecuente en los cultivos, pudiendo ser transportado

fácil y rápidamente en las plantas que son llevadas por los seres humanos de unas

regiones a otras por intereses comerciales (Cabrero y Camacho, observación personal).

Si fuera cierto que el B se originó recientemente deberíamos esperar que todas

las variantes expresaran su ADNr (y no sólo el B24, como hemos visto), ya que no habría

habido suficiente tiempo para que ocurrieran mutaciones que inactivaran los Bs. El

análisis citogenético y molecular de la expresión del ADNr de B1, B2, B5 y B24 en 11

poblaciones españolas (Nerja, Torrox, Fuengirola, S’Esgleieta, Algarrobo, Salobreña,

Cieza, San Juan, Mundo, S’Albufereta y Otívar) reveló que dicha actividad no estaba

restringida a la variante B24 ni a la población de Torrox, ya que encontramos actividad

también en el B1 y B2 y en diferentes poblaciones, pero no en la B5 presente sólo en

Fuengirola. Esto sugiere que la actividad de la B-NOR debe ser una condición ancestral,

puesto que es compartida por varias variantes. Además, el hecho de que la variante

189

Discusión general

considerada ancestral B1 exprese la NOR la reafirma en su condición de variante

original de B.

En este análisis encontramos, además, que existe un umbral del 10% de

diplotenes con B-NOR activa para que puedan detectarse molecularmente transcritos del

ADNr del B. Esta detección es independiente del tamaño del nucleolo del B que suele

ser aproximadamente la mitad del área del cromosoma X. Sin embargo, la proporción

de machos con la NOR del B activa era muy variable entre poblaciones (0-28’57%) y

mucho menor que la anteriormente descrita para Torrox en 2008 (48%), lo que sugiere

que la mayoría de los Bs tienen la NOR silenciada y sólo muestran actividad

esporádicamente. De hecho, en la población de Nerja, localizada a tan sólo 8 km de

Torrox, no hemos detectado actividad de la NOR de su B2, un hecho que evidencia que

la misma variante puede estar activa en unas poblaciones (incluso mostrando diferentes

grados de expresión) e inactiva en otras. Como comentamos anteriormente para el caso

de Torrox, estas diferencias se deben principalmente a fenómenos de metilación del

ADN y/o acetilación de histonas. Otra circunstancia que explicaría los diferentes

estados de actividad de la NOR del B de sería el nivel de ocupación del ADNr del B por

transposones con diana en esa secuencia como son el R1, R2 o Pokey (Eickbush 2002;

Penton y col. 2002), que pueden llegar a inhibir o potenciar la transcripción del ADNr.

Así, el cromosoma B24 tiene mayor cantidad de R2 en su ADNr que su antecesor, el B2

(Montiel y col. en preparación), y son los bloques de ADNr más largos y libres de R2

los que preferencialmente se expresan (Eickbush y col. 2008; Zhou y Eickbush, 2009).

La mayor expresión detectada en B24 respecto a B2 podría ser debido a un mayor

agrupamiento de R2 en B24, y esto deja más copias de ADNr libres de R2, que son más

proclives a expresarse. Alternativamente, no se puede descartar que R2 tenga algo que

ver con la mayor expresión de este cromosoma B (Montiel y col. en preparación). Las

diferencias en expresión entre variantes de B también podrían deberse a cambios

estructurales, como ocurrió con la fusión de B2 con el autosoma de mayor tamaño que

condujo a la activación de la NOR del B (Cabrero y col. 1987). Finalmente, la mayor

expresión de B24 también podría estar asociada a la disminución del número de copias

con respecto a su antecesor B2, ya que, como sugirieron Ide y col. (2010), en levaduras

las cepas con menos repeticiones de ADNr son los que muestran una mayor tasa de

transcripción del mismo.

Al igual que ocurría en el primer experimento de expresión, hay casos donde

vemos actividad de la NOR del B pero no detectamos transcritos o viceversa, y podría

deberse a que, como explicamos anteriormente, los experimentos citogenéticos y

moleculares no fueron realizados en las mismas partes corporales. Esta observación

requería que analizáramos la expresión del ADNr del B en diferentes partes del cuerpo,

para lo cual tuvimos primero que averiguar si el B estaba presente en las diferentes

partes del cuerpo. Lo que se sabía hasta ahora era que el B era mitóticamente estable en

partes del cuerpo del mismo individuo donde se podían visualizar cromosomas como el

testículo, la ovariola y el ciego gástrico (Camacho y col. 1980; Henriques-Gil y col.

1986), pero nada se sabía sobre qué ocurría en el resto de partes del cuerpo sin división

celular activa. Tras detectar los marcadores específicos del B (SCAR e ITS2_B) en ocho

190

partes del cuerpo con tejidos somáticos (antena, cabeza, ganglio cerebral, pata saltadora,

músculo alar, ciego gástrico, túbulos de Malphigi y la glándula accesoria en machos), en

la ovariola en hembras y en el testículo de machos portadores de B pudimos concluir

que los Bs están presentes en todas las partes del cuerpo, al menos en los aquí

analizados. Así mismo, no detectamos amplificación en partes corporales de individuos

sin B. Esto sugiere que los cromosomas B en E. plorans no son eliminados de ningún

tejido somático, comportándose de manera regular durante las mitosis que conducen al

desarrollo de los individuos.

Una vez que comprobamos que el cromosoma B estaba presente en las células

de todas las partes del cuerpo analizadas en los individuos, pudimos estudiar

molecularmente la expresión del ADNr del cromosoma B24 en las diferentes partes del

cuerpo de varios machos en los que habíamos detectado citogenéticamente la B-NOR

activa en las gónadas. La amplificación de qITS2_B (una versión más corta de la

secuencia específica del B, ITS2_B) mediante qRT-PCR en cabeza, pata saltadora,

músculo alar, testículo, glándula accesoria y ciego gástrico fue positiva en todos los

casos, poniendo de manifiesto que la transcripción del ADNr del B no está restringida a

la gónada. Además, dicha expresión era diferencial, siendo mayor en testículo, glándula

accesoria y músculo alar, y podría deberse a cambios estructurales o a cambios

epigenéticos. En el primer caso, la amplificación diferencial del ADNr conllevaría un

aumento del número de copias y la expresión podría depender de su abundancia

(Subrahmanyam y col. 1994; Ide y col. 2010), pero este hecho no ocurre en E. plorans

(ver discusión más adelante). Sin embargo, los cambios epigenéticos sí podrían ser los

responsables de las diferencias de expresión encontradas ya que en E. plorans se han

detectado marcas epigenéticas en los B asociadas a la actividad de su ADNr (Cabrero y

col. 1987; López-León y col. 1991), como hemos comentado anteriormente. Y está

establecido que la metilación del ADN y la acetilación de histonas están implicadas en

la expresión de genes específicos de tejidos y de ciertos factores de transcripción

específicos de célula/tejido (Shen y Maniatis, 1980; Cho y col. 2001; Imamura y col.

2001; Hattori y col. 2004b, 2007; Nishino y col. 2004) de forma que cada tejido tiene su

propio patrón de metilación asociado a su función (Ohgane y col. 1998; Shiota y col.

2002; Strichman-Almashanu y col. 2002), y las modificaciones de histonas influyen en

la interacción entre factores de transcripción y cromatina (Ruthenburg y col. 2007). .

La expresión diferencial del ADNr del B sugiere que existen diferencias en los

requerimientos energéticos entre partes del cuerpo de E. plorans, al menos en el

momento en que fueron congelados y que, frente a una fuerte demanda de síntesis

proteica, los transcritos aportados por el B pueden ser utilizados. El significado

biológico de estos transcritos, una vez que sabemos que son funcionales (ver discusión

más adelante) dependerá de la proporción que representen en el total de transcritos de la

célula, sin olvidar que en testículos, al menos, el área nucleolar total celular está

regulada (Teruel y col. 2007, 2009), lo que sugiere que la demanda total de ARNr de la

célula también lo está. Esta proporción no debe ser muy alta, porque lo analizado hasta

ahora concluye que no más del 50% de los machos portan una B-NOR activa y, dentro

191

Discusión general

de ellos, la proporción de células con B-NOR activas no supera el 29% en ninguna de

las 11 poblaciones analizadas (Teruel y col. 2007, 2009).

Esta expresión diferencial del ADNr del B en E. plorans también puede ser

discutida en términos de un sistema de hospedador-parásito. Como los transcritos del B

son funcionales, podría parecer que su parasitismo ejercido sobre el individuo está

disminuyendo, pero nada más lejos de la realidad si tenemos en cuenta que su ADNr se

transcribe más activamente en partes del cuerpo relacionadas con la reproducción y la

supervivencia. El B, como parásito vertical obligado, tiene su eficacia biológica

asociada a la de su hospedador (Muñoz y col. 1998), por lo que si contribuye aportando

transcritos de ARNr en partes del cuerpo importantes para la reproducción y la

supervivencia estará, en última instancia, beneficiándose a sí mismo.

La heterocromatina que constituye los cromosomas B es constitutiva, al igual

que la de las regiones pericentroméricas de los cromosomas A y una proteína

típicamente asociada a la heterocromatina es la HP1 (Heterochromatin Protein 1). Tras

forzar la disminución de los niveles de transcripción del gen para la HP1α mediante

ARNi (ARN interferencia) obtuvimos una gran variedad de efectos moleculares,

fisiológicos y fenotípicos, dependientes del estado del ciclo celular en el que se

encontrara la célula cuando fue afectada por dicha disminución. Esta variedad de

efectos se debe a que la proteína HP1α está principalmente localizada en la

heterocromatina centromérica, aunque también asociada a la eucromatina (Piacentini y

col. 2009), lo que hace que sea un gen de amplia actuación en el genoma. El patrón de

condensación anormal que encontramos debido a la disminución de HP1α, en el cual se

afectaba tanto las heterocromatinas constitutiva y facultativa como la eucromatina,

demuestra el importante papel que tiene esta proteína en el ensamblaje de la cromatina

(Eissenberg y Elgin, 2000). Aún así, en los machos experimentales quedó una región

pericentromérica condensada, seguramente debido a la protección que confieren las

proteínas centroméricas. Estos efectos sobre la condensación cromatínica pueden ser

debido a que los bajos niveles de HP1α interrumpieran la condensación en la profase

meiótica I o a un fallo en el mantenimiento de dicha condensación. Otro de los efectos

que encontramos en los machos donde hemos disminuido HP1α es la aparición de

puentes cromosómicos, los cuales producen fallos en la segregación de cromosomas

homólogos dando lugar al gran número de células poliploides (macroespermátidas) que

observamos. Estos puentes pueden resultar de: 1) fusiones teloméricas debido al

descenso de los niveles de HP1α (Fanti y col. 1998), 2) desregulación de genes

relacionados con los telómeros como Bub1 (Basu y col. 1999), 3) pérdida de interacción

entre HP1α y los telómeros, ya que HP1 forma parte de telómeros y centrómeros donde

controla la elongación y el comportamiento del primero (Fanti y col. 1998; Savitsky y

col. 2002; Sharma y col. 2003). En los machos de E. plorans donde hemos disminuido

la transcripción de HP1α no observamos una pérdida de telómeros pero sí una

disminución de la transcripción del gen Bub1 (De Lucia y col. 2005), por lo que las

explicaciones 2) y 3) son las más probables para el efecto observado en nuestra especie.

Sin embargo, nuestros resultados en E. plorans no evidencian cambios en la expresión

de los genes de ARNr y Hsp70 tras disminuir HP1α, un hecho corroborado por la

192

ausencia de cambios en la expresión de las NORs (incluida la del B, inactiva) y en el

área nucleolar total. Esto se debe a que los efectos de HP1 pueden ser dependientes de

especie (Serrano y col. 2009; Lee y col. 2013), ya que en ratones existe relación directa

entre las disminuciones de HP1 y de los genes ARNr (Horáková y col. 2010), mientras

que en Drosophila la relación es inversa (Larson y col. 2012). En E.. plorans podría

estar aumentando la expresión del ARNr en los machos experimentales, pero no la

detectamos porque, quizás, está siendo contrarrestada por el envejecimiento producido

por la disminución de HP1 y otros cambios de expresión génica que también puedan

interferir. Sin embargo, sí se detectaron en los machos experimentales varios efectos a

nivel fisiológico tales como la disminución de movilidad y vitalidad, de masa muscular,

de hemolinfa, de divisiones celulares y de la superviviencia, produciendo la muerte de

los individuos. Estos cambios son atribuibles a la disminución de HP1, ya que ésta

produce letalidad en Drosophila (Liu y col. 2005) y formación anormal del músculo en

ratones (Sdek y col. 2013). Además, la heterocromatina es muy importante para

conservar la integridad del músculo y así mantener la vida, ya que la pérdida de

músculo (sarcopenia) es la principal causa de muerte en los individuos con más edad de

Drosophila y Caenorhabditits elegans (Larson y col. 2012; Herndon y col. 2002).

Continuando con el análisis de la estructura de los cromosomas B, nos

propusimos analizar ésta a mayor profundidad cuantificando el número de copias de

ADNr específico del B en un intento de desarrollar un método molecular para elucidar

el número de cromosomas B que tenía un individuo. Este análisis puso de manifiesto la

gran variación existente para el número de copias de B-ADNr entre individuos

portadores de B, no sólo entre variantes de B, como era de esperar, sino también para

una misma variante de B en los diferentes individuos de una misma población. Esto

impidió utilizar esta metodología para el fin propuesto, ya que B24 mostró tener entre

208 y 3970 copias, en diferentes individuos, mientras que B2 mostró entre 4818 y 13658

copias. Las diferencias entre las dos variantes son lógicas si tenemos en cuenta que la

primera surgió a partir de la segunda mediante mutaciones que implicaron ganancia de

ADNsat y la pérdida de ADNr (Henriques-Gil and Arana 1990; Zurita et al 1998;

Cabrero et al 1999). Además, detectamos algunas copias específicas del B en individuos

sin B y podría ser debido a que están albergadas en el/los cromosoma(s) antecesores del

B, aunque estas copias no se están transcribiendo pues no las hemos detectado en

ningún experimento de expresión de los realizados con individuos 0B. La variabilidad

que hemos detectado para el número de copias de ADNr del B, incluso dentro del

mismo tipo, podría haberse originado por entrecruzamiento desigual o amplificación

diferencial del ADNr. El primer caso sería el más probable en E.plorans, ya que se ha

observado que los Bs forman quiasmas entre ellos cuando hay dos o más en la misma

célula meiótica, preferentemente en dos posiciones, una intersticial en la que está

implicado el ADNsat y otra distal que involucra al ADNr (Henriques-Gil y col. 1984;

López-León y col. 1994, 1995). La variabilidad para el número de copias de ADNr del

B fue además corroborada por FISH al poner de manifiesto diferencias en el tamaño de

la banda de ADNr de los Bs pertenecientes incluso a la misma población.

193

Discusión general

Sin embargo, cuando comparamos el número de copias de ADNr de B24 entre

partes del cuerpo no detectamos diferencias significativas, contrariamente a las

observaciones de Fox (1970) que sugerían una replicación diferencial del ADN nuclear

entre diferentes tejidos de Schistocerca gregaria y Locusta migratoria, o a otros casos

de plantas con número variable de copias de genes ribosómicos entre tejidos del mismo

individuo (Rogers y Bendich, 1989). La variación encontrada entre individuos pero no

entre partes del cuerpo sugiere que ésta debe estar relacionada con la meiosis y no con

la mitosis, puesto que en partes del cuerpo con tejidos somáticos donde hay división

mitótica no hay variación. A pesar de no existir variación para el número de copias de

ADNr del B entre partes corporales, sí sabemos que esta secuencia se expresa

diferencialmente en partes del cuerpo relacionadas con la reproducción y la

supervivencia, como hemos comentado anteriormente. Al igual que la regulación de la

activación de las NORs es muy estricta, manteniendo constante el área nucleolar total de

la célula (Teruel y col. 2007, 2009), la expresión del ADNr del B también debe estar

bien regulada en la célula, ya que ésta sólo transcribe habitualmente una parte de los

genes para ARNr que tienen los genomas (Reeder, 1999).

Hasta ahora, muchos de los resultados de la presente Tesis Doctoral se han

obtenido a través del uso de una región diferencial del ITS2 del ADNr del B como

marcador molecular de dicho cromosoma. Por ello, tras varios experimentos previos con

Locusta migratoria y otros machos de E. plorans, realizamos dos experimentos para

caracterizar, mediante “454 amplicon sequencing”, la variabilidad existente en la región

ITS2 del ADNr, tanto en ADNg (ADN genómico) como en ADNc (ADN

complementario) de diferentes partes corporales de un macho 0B, así como de 18

machos con diferente número de B (0-3) capturados en la población de Torrox. Esta

nueva tecnología introduce errores en las secuencias que están siendo secuenciadas,

tanto durante la PCR previa como en la secuenciación per se (Gilles y col. 2011; Brodin

y col. 2013; Niklas y col. 2013), y es uno de los principales temas de controversia al

analizar este tipo de datos, ya que aún no hay un método para eliminar errores con plena

confianza. Por este motivo, nuestro experimento llevaba un control interno que nos

permitió estimar la tasa de error: a ambos lados de la secuencia ITS2 había un total de

123 nucleótidos que formaban parte del gen 5,8S y del 28S. Dado que esta secuencia

codificadora está muy conservada en los saltamontes acrídidos (Ruiz-Ruano y col. en

preparación), podemos asumir que toda la variación que encontremos en esos 123

nucleótidos será debida a errores de secuenciación. Aunque es muy probable que esta

estima sea por exceso, eso nos garantiza la eliminación de falsos positivos en la muestra

de secuencias. Las tasas de error estimadas en los experimentos realizados en L.

migratoria y E. plorans fueron del 2-3%, por lo que consideramos que toda variante de

ITS2 que superase esta frecuencia en una muestra determinada era muy probablemente

un haplotipo genuino. Esto indicó que en L. migratoria sólo había un haplotipo para la

región ITS2, mientras que en E. plorans había 6 haplotipos (Hap1-Hap6). Los 6

haplotipos de E. plorans son reales, ya que Hap1-Hap5 han sido encontrados también

por Teruel y col. (enviado) usando secuenciación Sanger, y el Hap6 ha sido detectado

también en una población española por Ruiz-Ruano y col. (en preparación). La

194

coexistencia de seis haplotipos indica que existe una gran variabilidad intragenómica en

E. plorans que contrasta con la existencia de un solo tipo de secuencia codificadora

(para los 123 nt analizados en el ADNr 5.8S y 28S) en más del 97% de las lecturas

obtenidas de ADNg. Este resultado se ajusta a los modelos de evolución concertada

(Eickbush y Eickbush, 2007; Ganley y Kobayashi, 2007), aunque denota una baja

eficiencia de los mecanismos de homogenización de las regiones no codificadoras del

ADNr en esta especie.

Uno de los resultados más interesantes de este estudio fue encontrar que uno de

los haplotipos (Hap4) está ausente en los machos sin B y es más abundante conforme

aumenta el número de cromosomas B, por lo que podemos concluir que se trata de un

haplotipo específico del cromosoma B. Este haplotipo es, además, el único de los seis

que lleva la inserción de la adenina diferencial en base a la cual se diseñaron los primers

para amplificar la secuencia ITS2_B, en la que se ha centrado la presente tesis, con lo

que una vez más se corrobora que los datos de Sanger y secuenciación masiva son

comparables. Esto indica además, que nuestros análisis anteriores con los primers

qITS2_B estaban, en realidad, analizando el haplotipo Hap4. Este haplotipo es, de los 6

encontrados, el que tiene en el gDNA una región codificante adyacente menos

conservada, acorde con el hecho de que la naturaleza heterocromática del B le permite

acumular mutaciones, y que no todas las copias de ADNr tienen que ser funcionales

para transcribirse, ya que solo el 50% de ellas están activas (Reeder y col. 1999). Hap4

sólo apareció en el cDNA de 5 de los 11 machos portadores de B, y en mucha menor

proporción que en el gDNA, por lo que se expresa a niveles muy bajos y está muy

silenciado en las poblaciones, en concordancia con nuestros resultados anteriores que

habían demostrado que, tras analizar 7 poblaciones, sólo 18 machos de los 156

analizados mostraron actividad en la NOR del B. Los 5 machos con Hap4 tenían

además un nucleolo asociado a la NOR del B, lo que vuelve a corroborar que es el

ADNr del propio B el que está activo. Al analizar las regiones codificadoras,

observamos que las lecturas obtenidas en el cDNA son más conservadas que las del

gDNA, por lo que parece que hay preferencia en expresar las unidades más

conservadas. Este tipo de selección de ciertos ADNr para ser expresados es consistente

con un modelo propuesto por Zhou y col. (2013) en el que un genoma con

retrotransposones R2 en su ADNr selecciona para la transcripción aquellas copias con

menor densidad de R2. En el caso de E. plorans, el 100% de las lecturas de cDNA que

llevaban Hap4 (específico del B) en el ITS2 estaban asociadas a ambos lados con

regiones codificadoras conservadas. Esto indica que los transcritos de ARNr producidos

a partir de las copias de ADNr del B son funcionales. Y además sugiere que la

transcripción del B está sujeta a vigilancia genómica porque sólo se expresan en el B las

copias más conservadas en la región codificadora. En experimentos anteriores donde

cuantificábamos el número de copias del ADNr del B, habíamos detectado en

individuos 0B algunas secuencias que llevaban la inserción de la adenina diferencial del

B, pero no podemos decir si se trataba del Hap4 o no, ya que en dicho experimento se

amplificaba una región menor del ITS2. Aún así, de las 62322 secuencias obtenidas

aquí para el gDNA, 9205 corresponden al Hap4 y ninguna pertenece a los individuos

195

Discusión general

0B. Por tanto, la presencia de la inserción de adenina en el ITS2 de los individuos 0B en

forma de un haplotipo diferente al Hap4, y que además esté en los Bs, es un aspecto a

estudiar a más profundidad en un futuro.

La estructura secundaria del ITS2 juega un papel importante en definir los sitios

de rotura para su escisión durante la maduración del ADNr transcrito (Musters y col.

1990; van der Sande y col. 1992). Los 6 haplotipos ITS2 encontrados en nuestro análisis

tienen una estructura secundaria y una energía libre de Gibb muy conservadas, por lo

que todos tienen la misma posibilidad de ser expresados, incluido el Hap4. Esto sugiere

que la región del ITS2 del ADNr del B es funcional. El árbol de mínima expansión

corroboró por un lado, que la homogenización del ITS2 es muy pobre en este genoma, y

reveló por otro, que Hap1 no sólo es el haplotipo más frecuente, sino también

probablemente el ancestral. Este último dato concuerda con otros estudios en el que se

ha visto que este haplotipo es el más frecuente en machos sin B de otras regiones

mediterráneas (Ruiz-Ruano y col., en preparación).

Las diferencias de expresión de los diferentes haplotipos ITS2 de E. plorans

entre diferentes partes del cuerpo (Hap1-Hap3) e individuos (Hap1-Hap6) se repiten, en

general estando el Hap1 sobreexpresado y el Hap3 subexpresado. Aún así, este patrón

no es estricto, mostrando pequeñas diferencias entre partes del cuerpo. Remarcable es el

caso de dos partes del cuerpo importantes para el movimiento del animal (músculo alar

y pata saltadora) que muestran un patrón idéntico, y el del testículo, que es la única

parte corporal en el que se expresan casi por igual los tres haplotipos. En el experimento

poblacional observamos que Hap3, Hap4 y Hap6 están subexpresados. Por el contrario,

Hap5 es el haplotipo que muestra la mayor eficiencia en la expresión, y también es el

que tiene la mayor conservación de la región codificante adyacente.

Las diferencias de expresión existentes, que a la vez son propias de cada

haplotipo, sugieren una expresión no aleatoria de la copias de ADNr, la cual sería

posible si los haplotipos no estuvieran distribuidos al azar entre los cromosomas con

ADNr. Así, la búsqueda de los 6 haplotipos detectados en E. plorans en las secuencias

de ITS2 analizadas por Teruel y col. (enviado) (procedentes de diferentes cromosomas

microdiseccionados de la misma especie) ya apunta que hay cierta estructuración: Hap1

está en al menos los cromosomas 8, 9, X y B, Hap2 está en el cromosoma 11 y el Hap4

en el B. Esta ordenación y una pobre recombinación ectópica entre el ADNr de

cromosomas no homólogos contribuirían a la variabilidad intragenómica observada.

La menor homogenización de la región ITS2 en E. plorans en comparación con

L. migratoria podría ser debida a varias causas. El genoma de E. plorans es alrededor

del doble del de L. migratoria (Ruiz-Ruano y col. 2011), y es más difícil homogenizar

mayores cantidades de ADNr. De hecho, E. plorans tiene ADNr en siete parejas

autosomas además del cromosoma B (Cabrero y col. 1999, 2003a), fruto de su reciente

dispersión intragenómica desde los cromosomas 9 y 11 (López-León y col. 2008),

mientras que L. migratoria sólo lo lleva en tres (Teruel y col. 2010). Además, E.

plorans tiene 15000 copias de ADNr en los As y 3000 en el B24 (Montiel y col., en

preparación). En L. migratoria no existen datos comparables, pero las señales de FISH

196

obtenidas para el ADNr son de menor tamaño que las de E.plorans. Sin embargo, el

hecho de que haya otras especies de saltamontes con genoma grande y una región ITS2

muy homogeneizada, tales como Stauroderus scalaris (Ruiz-Ruano y col. en

preparación) nos hizo buscar otras razones para el caso de E. plorans.

Una posibilidad es que antes de la expansión genómica del ADNr, éste estaba

homogenizado al menos en cada cromosoma homólogo donde estaba localizado (9 y

11). En este momento podía haber dos haplotipos, uno por cromosoma. Posteriormente,

y quizás coincidiendo con el origen del cromosoma B, se produjo una mezcla de

poblaciones que incrementó el número de haplotipos. Algunos datos apuntan a una (o

más) dispersiones recientes de esta especie por la región mediterránea. Por ejemplo,

como hemos visto anteriormente, B1 es la variante ancestral compartida por diferentes

poblaciones de toda la región mediterránea occidental. Además, el marcador SCAR,

específico de los Bs muestra una secuencia de 1510 pb muy conservada en poblaciones

tan distantes como España y Armenia, lo que sugiere el origen reciente de los Bs

(Muñoz-Pajares y col. 2011) y su dispersión rápida a casi todas las poblaciones de la

subespecie E. p. plorans. Esta mezcla, y la posible baja eficacia de la homogenización

no homóloga en esta especie explicaría por qué no están homogeneizadas las secuencias

de ITS2 en la población española analizada.

En conclusión, lo que comenzó siendo una única diferencia en toda la secuencia

del ADNr del B respecto a los demás cromosomas, es decir, una simple adenina

diferencial en el ITS2 del B, se ha convertido en el inicio de un apasionante camino que

nos ha revelado i) que los Bs realmente siguen su propio camino evolutivo al no

compartir el Hap4 con los cromosomas A, ii) que, aunque está muy silenciados, no

están del todo inactivos, y iii) que los pocos transcritos que producen son funcionales y

su cantidad difiere entre las diferentes partes del cuerpo de E. plorans.

Referencias

Abdelaziz M, Teruel M, Chobanov D, Camacho JP, Cabrero J (2007) Physical mapping

of rDNA and satDNA in A and B chromosomes of the grasshopper

Eyprepocnemis plorans from a Greek population. Cytogenet Genome Res

119:143-6

Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B

chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North

Africa. I. B variants and frequency. Heredity 83:428-434

Basu J, Bousbaa H, Logarinho E et al (1999) Mutations in the essential splindle

checkpoint gene Bub1 cause chromosome missegregation and fail to block

apoptosis in Drosophila. J Cell Biol 146(1):13-28

Brodin J, Mild M, Hedskog C, Sherwood E, Leitner T, Andersson B, Albert J (2013)

PCR-Induced transitions are the major source of error in cleaned Ultra-Deep

Pyrosequencing Data. PLoS ONE 8(7): e70388

doi:10.1371/journal.pone.0070388

197

Discusión general

Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the

grasshopper Eyprepocnemis plorans on nucleolar organiser regions activity.

Activation of a latent NOR on a B chromosome fused to an autosome. Genome

29:116-121

Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM

(1997) Geographical distribution of B chromosomes in the grasshopper

Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective

historical events. Chromosome Res 5:194-198

Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B

chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity

83:435-439

Cabrero J, Perfectti F, Gómez R, Camacho JPM, López-León MD (2003a) Population

variation in the A chromosome distribution of satellite DNA and ribosomal

DNA in the grasshopper Eyprepocnemis plorans. Chromosome Res 11: 375-

381

Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007) Histone H3 lysine

9 acetylation pattern suggests that X and B chromosomes are silenced during

entire male meiosis in a grasshopper. Cytogenet Genome Res 119:135–142

Camacho JPM, Carballo AR and Cabrero J (1980) The B chromosome system of the

grasshopper Eyprepocnemis plorans sub. Plorans (Charpentier). Chromosoma

80:163-166

Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al (2007)

Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell

19:1738-1749

Chen ZJ, Pikaard CS (1997) Transcriptional analysis of nucleolar dominance in

polyploidy plants: biased expression/silencing of progenitor rRNA genes is

developmentally regulated in Brassica. Proc Nat Acad Sci USA 94:3442–3447

Cho J, Kimura H, Minami T, Ohgane J, Hattori N, Tanaka S, Shiota K (2001) DNA

methylation regulates placental lactogen I gene expression. Endocrinology

142:3389–3396

De Lucia F, Ni JQ, Vaillant C, Sun FL (2005) HP1 modulates the transcription of cell-

cycle regulators in Drosophila melanogaster. Nucleic Acids Res 33(9):2852-

2858

Eickbush TH (2002) R2 and related site-specific non-long terminal repeat

retrotransposons. In: Craig NL, Craigie R, Gellert M, Lambowitz AM (eds)

Mobile DNA II. ASM Press, Washington, DC, pp 813–835

Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the

ribosomal RNA genes. Genetics 175(2):477-485

Eickbush DG, Ye J, Zhang X, Burke WD, Eickbush TH (2008) Epigenetic regulation of

retrotransposons within the nucleolus of Drosophila. Mol Cell Biol 28:6452–

6461

Eissenberg JC and Elgin SC (2000) The HP1 protein family: getting a grip on

chromatin. Curr Opin Genet Dev 10:204-210

Fanti L, Giovinazzo G, Berloco M, Pimpinelli S (1998) The heterochromatin protein 1

prevents telomere fusions in Drosophila. Mol Cell 2(5):527-538

Fox DP (1970) A non-doubling DNA series in somatic tissues of the

locusts Schistocerca gregaria (Forskål) and Locusta migratoria (Linn.).

Chromosoma 29:446-61

198

Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal

DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun

sequence data. Genome Research 17:184-191

Gilles A, Meglécz E, Pech N, Ferreira S, Malausa T, Martin JF (2011) Accuracy and

quality assessment of 454 GS-FLX Titanium pyrosequencing. Bmc Genomics

12:245

Han F, Lamb JC, Yu W, Gao Z, Birchler JA (2007) Centromere function and

nondisjunction are independent components of the maize B chromosome

accumulation mechanism. Plant Cell 19:524–533

Hattori N, Nishino K, Ko Y, Hattori N, Ohgane J, Tanaka S, Shiota K (2004b)

Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and

trophoblast stem cells. J Biol Chem 279:17063–17069

Hattori N, Imao Y, Nishino K, Hattori N, Ohgane J, Yagi S, Tanaka S, Shiota K (2007)

Epigenetic regulation of Nanog gene in embryonic stem and trophoblast stem

cells. Genes Cells 12:387–396

Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polymorphism in

the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293

Henriques-Gil N, Jones GH, Cano MI, Arana P, Santos JL (1986) Female meiosis

during oocyte maturation in Eyprepocnemis plorans (Orthoptera: Acrididae). Can

J Genet Cytol 28:84-87

Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the

grasshopper Eyprepocnemis plorans. Evolution 44:747-753

Herndon LA, Schmeissner PJ, Dudaronek JM et al (2002) Stochastic and genetic factors

influence tissue-specific decline in ageing C. elegans. Nature 419(6909):808-814

Horáková AH, Bártová E, Galiová G, Uhlírová R, Matula P, Kozubek S (2010)

SUV39h-independent association of HP1 beta with fibrillarin-positive nucleolar

regions. Chromosoma 119(3):227-241. doi:10.1007/s00412-009-0252-2

Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA gene

copies maintains genome integrity. Science 327:693-696

Imamura T, Ohgane J, Ito S, Ogawa T, Hattori N, Tanaka S, Shiota K (2001) CpG

island of rat sphingosine kinase-1 gene: Tissue-dependent DNA methylation

status and multiple alternative first exons. Genomics 76:117–125

Larson K, S J Yan, Tsurumi A et al (2012) Heterochromatin formation promotes

longevity and repress ribosomal RNA synthesis. PLoS Genetics 8(1): e1002473.

doi:10.1371/journal.pgen.1002473

Lee DH, Li Y, Shin DH et al (2013) DNA microarray profiling of genes differentially

regulated by three heterochromatin protein 1 (HP1) homologs in Drosophila.

Biochem Biophys Res Commun 434(4):820-828

Liu LP, Ni JQ, Shi YD, Oakeley EJ, Sun FL (2005) Sex-specific role of Drosophila

melanogaster HP1 in regulating chromatin structure and gene transcription.

Nature Genetics 37:1361-1366

López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region in a B

chromosome inactivated by DNA methylation. Chromosoma 100:134-138

López–León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)

Generating high variability of B chromosomes in the grasshopper Eyprepocnemis

plorans. Heredity 71:352-362

López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,

Camacho JPM (1994). Possible origin of a B chromosome deduced from its

DNA composition using double FISH technique. Chromosome Res 2:87-92

199

Discusión general

López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during

development in the B chromosome NOR of the grasshopper Eyprepocnemis

plorans. Heredity 74:296-302

López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov

NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and

B chromosomes between eastern and western populations of the grasshopper

Eyprepocnemis plorans plorans. Cytogenet genome Res 121:260-265

Muñoz E, Perfectti F, Martín-Alganza A, and Camacho JPM (1998) Parallel effect of a

B chromosome and a mite decreasing female fitness in the grasshopper

Eyprepocnemis plorans. Proc R Soc Lond Ser B. 265:1903-1909

Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,

Perfectti F (2011) A single, recent origin of the accessory B chromosome of the

grasshopper Eyprepocnemis plorans. Genetics 187:853-863

Musters W, Boon K, Van der Sande CA, Van Heerikhuizen H, Planta RJ (1990)

Functional analysis of transcribed spacers of yeast ribosomal DNA. The EMBO

journal 9:3989

Niklas N, Pröll J, Danzer M, Stabentheiner S, Hofer K, Gabriel C (2013) Routine

performance and errors of 454 HLA exon sequencing in diagnostics. BMC

Bioinformatics 14:176

Nishino K, Hattori N, Tanaka S, Shiota K (2004) DNA methylation-mediated control of

Sry gene expression in mouse gonadal development. J Bio Chem 279: 22306–

22313

Ohgane J, Aikawa J, Ogura A, Hattori N, Ogawa T, Shiota K (1998) Analysis of CpG

islands of trophoblast giant cells by restriction landmark genomic scanning. Dev

Genet 22:132–140

Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA

genes. Annu Rev Genet 55:801-830

Penton EH, Sullender BW, Crease TJ (2002) Pokey, a new DNA transposon in Daphnia

(Cladocera: Crustacea). J Mol Evol 55(6):664–673

Piacentini L, Fanti L, Negri R et al (2009) Heterochromatic protein 1 (HP1a) positively

regulates euchromatic gene expression through RNA transcript association and

interaction with hnRNPs in Drosophila. PLoS Genetics 5(10):e1000670.

doi:10.1371/journal.pgen.1000670

Pikaard CS (2000a) Nucleolar dominance: uniparental gene silencing on a

multimegabase scale in genetic hybrids. Plant Mol Biol 43:163-177

Pikaard CS (2000b) The epigenetics of nucleolar dominance. Trends in Genetics

16:495-500

Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and

vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327

Rogers SO and Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy

number and in the intergenic spacer. Plant Molcelular Biology 9:509-520

Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,

Camacho JPM, (2011) DNA amount of X and B chromosomes in the

grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet genome

Res 134:120-126

Ruthenburg AJ, Li H, Patel DJ, Allis CD (2007) Multivalent engagement of chromatin

modifications by linked binding modules. Nature Reviews Mol Cell Bio 8:983–

994

200

Savitsky M, Kravchuk O, Melnikova L, Georgiev P (2002) Heterochromatin Protein 1

is involved in control telomere elongation in Drosophila melanogaster. Mol and

Cel Biol 22:3204-3218

Sdek P, Oyama K, Angelis E, Chan SS, Schenke-Layland K, MacLellan WR (2013)

Epigenetic regulation of myogenic gene expression by heterocromatic protein 1

alpha. PLoS ONE 8(3): e58319. doi:10.1371/journal.pone.0058319

Serrano A, Rodríguez-Corsino M, Losada A (2009) Heterochromatin Protein 1 (HP1)

do not drive pericentromeric cohesin enrichment in human cells. PLoS One 4(4):

e5118. doi:10.1371/journal.pone.0005118

Sharma GG, Hwang KK, Pandita et al (2003) Human heterochromatin protein 1

isoforms HP1Hs alpha and HP1Hs beta interfere with hTERT-telomere

interactions and correlate with changes in cell growth and response to ionizing

radiation. Mol and Cel Biol 23(22):8363-8376

Shen C, Maniatis T (1980) Tissue-specific DNA methylation in a cluster of rabbit beta-

like globin genes. Proc Natl Aca. Sci 77: 6634–6638

Shiota K, Kogo Y, Ohgane J, Imamura T, Urano A, Nishino K, Tanaka S, Hattori N

(2002) Epigenetic marks by DNA methylation specific to stem, germ and somatic

cells in mice. Genes Cells 7:961–969

Strichman-Almashanu LZ, Lee RS, Onyango PO, Perlman E, Flam F, Frieman MB,

Feinberg AP (2002) A genome-wide screen for normally methylated human CpG

islands that can identify novel imprinted genes. Genome Res. 12:543–554

Subrahmanyam NC, Bryngelsson T, Hagberg P, Hagberg A (1994) Differential

amplification of rDNA repeats in barley translocation and duplication lines: role

of a specific segment. Hereditas 121:157–170

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during

meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis

plorans. Chromosome Res 15:755-765

Teruel M (2009) Origen, expresión y efectos fenotípicos de un parásito genómico. PhD.

Universidad de Granada

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR

expression in a B chromosome of the grasshopper Eyprepocnemis plorans.

Chromosoma 118:291-301

Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry

revealed by histone genes in the migratory locust. Chromosoma 119: 217–225

Van der Sande CA, Kwa M, van Nues RW, van Heerikhuizen H, Raué HA, Planta RJ

(1992) Functional analysis of internal transcribed spacer 2 of Saccharomyces

cerevisiae ribosomal DNA. Journal of molecular biology 223:899-910

Zhou J, Eickbush TH (2009) The pattern of R2 retrotransposon activity in natural

population of Drosophila simulans reflects the dynamic nature of rDNA locus.

PLoS Genet 5:e1000386

Zhou J, Eickbush MT, Eickbush TH (2013) A Population Genetic Model for the

Maintenance of R2 Retrotransposons in rRNA Gene Loci. PLoS Genet 9(1):

e1003179. doi:10.1371/journal.pgen.1003179

Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism

regeneration for a neutralized selfish B chromosome. Evolution 52:274-277

201

Discusión general

202

Capítulo 10. Conclusiones

203

204

Conclusiones

1. Los cromosomas B de Eyprepocnemis plorans son funcionales, al menos en el ADNr

que contienen.

2. El cromosoma B1 es el antecesor de todos los cromosomas B de esta especie

encontrados en la región mediterránea occidental.

3. Los cromosomas B de E. plorans estaban presentes en todas las partes corporales

analizadas, lo que sugiere que son mitóticamente estables. No hemos podido, sin

embargo, averiguar si todas estas partes tienen el mismo número de Bs, ya que la

herramienta molecular que intentamos diseñar estaba basada en el número de copias de

ADNr en los Bs y éste resultó ser muy variable entre Bs de la misma población.

4. Cuando el ADNr del cromosoma B está activo en un individuo, lo está en todas las

partes corporales analizadas, pero su grado de expresión en testículo, glándula accesoria

y músculo alar es el triple que en cabeza, pata y ciego gástrico.

5. La proteína HP1 es necesaria para mantener el patrón de condensación cromosómica

normal de todos los tipos de cromatina en E. plorans, y su función es vital en esta

especie. La disminución de los niveles de expresión de HP1, forzada por el ARNi,

estaba asociada a la disminución de la expresión del gen Bub1, el descenso del número

de células en división, la pérdida de masa muscular y limitación del movimiento, la

disminución de la cantidad de hemolinfa y en última instancia, la muerte.

6. El uso de la región codificadora 5.8-28S como control interno de la tasa de error de

los experimentos de “454 amplicon sequencing” es, en el caso del ITS2, una

herramienta muy útil para eliminar falsos positivos.

7. El ADNr de E. plorans está muy homogenizado en las regiones codificadoras 5.8S y

28S, pero no tanto en la región ITS2, donde hemos detectado 6 haplotipos en una misma

población. Todos los haplotipos mostraban características conservadas en su estructura

secundaria, y unos parámetros de energía libre de Gibbs compatibles con su capacidad

de expresión. De hecho, todos fueron encontrados en el ADNc.

8. El haplotipo Hap4 resultó ser exclusivo de los cromosomas B, ya que el número de

lecturas encontradas en ADNg aumentaba con el número de Bs, y no se encontró en los

individuos sin B.

9. Los 6 haplotipos mostraron diferencias en el grado de expresión, siendo Hap5 el más

eficiente en su expresión y el Hap4 (el del B) el menos eficiente, ya que se expresaba

muy poco incluso en individuos que mostraban que sus Bs eran capaces de organizar un

nucleolo. Igualmente, Hap3 y Hap6 eran haplotipos poco eficientes en su expresión,

mientras que Hap1 y Hap2 se encontraban entre los más eficientes.

10. El Hap4 es el único cuyas regiones codificadoras estaban conservadas en el 100%

de las lecturas en ADNc, a pesar de que, en ADNg, es el haplotipo menos conservado.

Esto sugiere que la expresión del ADNr del B está sujeta a una fuerte vigilancia por

205

parte del genoma, es decir, normalmente está muy reprimido, pero cuando se expresa

sólo lo hacen sus unidades de ADNr que están más conservadas en la región

codificadora.

11. En general, las lecturas de ADNc mostraron menor diversidad nucleotídica para la

región ITS2, y estaban más conservadas en las regiones codificadoras 5.8S y 28S, que

las del ADNg, por lo que podemos concluir que las unidades de ADNr no se expresan al

azar.

12. La total conservación de las regiones codificadoras en las lecturas de ADNc

observadas para el Hap4 sugiere que el ARNr transcrito a partir del cromosoma B es

totalmente funcional, como lo prueba además que en los 5 machos donde obtuvimos

lecturas para este haplotipo en ADNc los Bs fueron observados formando nucleolo, que

es el fenotipo de estos genes.

206

Capítulo 11. Perspectivas

207

208

Perspectivas

Los estudios realizados en la presente Tesis Doctoral han permitido profundizar en el

conocimiento de la estructura y la expresión del ADNr del cromosoma B de

Eyprepocnemis plorans. Los resultados expuestos nos han dado mucha información

sobre ello, pero a la vez han abierto otros frentes para futuras investigaciones.

Hemos visto que tres de las cuatro variantes de cromosomas B presentes en las

poblaciones españolas tienen el ADNr activo y que, además, se considera que las

variantes de B del oeste mediterráneo son de un tipo diferente a las de la zona este. Una

manera de continuar esclareciendo la conexión que hay entre ambos tipos de variantes y

el momento de origen del B sería estudiar la expresión de los Bs de poblaciones no

españolas.

La activación de la NOR del B y la transcripción del ARNr procedente de dicho

cromosoma parece estar asociado a cambios epigenéticos relacionados con la metilación

del ADN y acetilación de histonas. Sería interesante profundizar en este estudio de

marcas epigenéticas del B, incluso detectando el grado de variación si las hubiera, para

así estar más cerca de elucidar a qué se debe que unos B estén activos y otros no, o

incluso por qué una misma variable esté activa o no en diferentes poblaciones.

La detección de la expresión diferencial del ADNr del B en tejidos relacionados

con la reproducción y la supervivencia abre el camino de estudio de la contribución

molecular de esos transcritos a la eficacia biológica. Sería interesante estudiar la

transcendencia que estos transcritos tienen, ya que son funcionales y pueden estar

produciendo algún efecto (beneficioso o no), sobre E. plorans.

Tras disminuir los niveles de expresión de HP1, vimos que no había ningún

efecto sobre los genes ribosómicos de E. plorans o, al menos, no fueron detectables.

Podría ser que realmente esta proteína no regule la expresión del ARNr en esta especie,

ya que hemos visto que los efectos pueden ser dependientes de especie. Por tanto, un

análisis a realizar sería buscar proteínas que estén afectando a la expresión del ADNr en

E. plorans, para así tratar de encontrar qué proteínas están produciendo el

silenciamiento/la activación del ADNr del cromosoma B.

Por otro lado, sería interesante analizar si el hecho de que los cromosomas B

tengan alta variabilidad para el número de copias de ADNr es heredable, es decir, si

padres con Bs portadores de muchas copias de ADNr tienen descendientes con Bs

portadores de un número similar de copias, o bien se producen cambios en el número de

copias de ADNr del B en el transcurso de una sola generación.

La elevada variabilidad encontrada para las secuencias ITS2 entre diferentes

partes corporales e individuos de E.plorans sugiere estudiarla en mayor profundidad al

nivel intragenómico. Hemos discutido la posible localización no aleatoria de los

diferentes haplotipos en diferentes cromosomas, pero habría que corroborarlo haciendo

el mismo experimento sobre el ADN obtenido de los cromosomas microdiseccionados,

por separado. Esto nos permitiría también intentar averiguar el origen cromosómico del

209

B, siguiendo el rastro del haplotipo específico del B. Además, sería interesante realizar

un experimento como el realizado en la población de Torrox, mediante secuenciación

454, pero ampliando el número de poblaciones para averiguar la distribución de los

diferentes haplotipos a lo largo de la distribución geográfica de esta especie. Esto

proporcionaría información muy valiosa sobre la estructura genómica interpoblacional

del ITS2 y, en última instancia, podría conducir a elucidar la población donde

probablemente se originó el B.

Finalmente, la metodología utilizada en el experimento de pirosecuenciación

454, utilizando ADNg y ADNc de los mismos individuos, puede abrir una vía para

nuevos análisis, en esta y otras especies, que pueden ser muy valiosos para estudios de

la expresión del ADNr al nivel genómico. Esto será muy provechoso, con toda

seguridad, cuando los métodos de secuenciación masiva proporciones mayores tamaños

de lectura con menores errores de secuenciación.

210