as you come in make two lists under the 2 headings: -features i got from my mum and dad -features i...

Download As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad

Post on 18-Jan-2018

215 views

Category:

Documents

0 download

Embed Size (px)

DESCRIPTION

What is a gene? What is a locus? Write on a post it note. Stick it on to the chromosome I think a gene is a type of mythical creature with 3 heads.

TRANSCRIPT

As you come in Make two lists under the 2 headings: -Features I got from my mum and dad -Features I did not get from my mum and dad Learning objectives Recall the differences between environmental and inherited effects What is a gene? How does a gene code for a polypeptide Success criteria Complete bracelet models to describe translation. Take away knowledge of key terms. What is a gene? What is a locus? Write on a post it note. Stick it on to the chromosome I think a gene is a type of mythical creature with 3 heads. Bracelet sequencing Decide whether you are a chimp or a human: CTATTTGTGGTTCTGAGTTCTTA AAACCCAGTGCTTCGAAGG Making DNA Order the original dna sequence using colour code. Make a complimentary strand of DNA (remember DNA is a double helix) Learning objectives Be able to describe the genetic code Explain and compare the structure of RNA(t and m) and DNA Explain the preocess of transcription and splicing. The triplet code Given that there are four bases in DNA, and these code for 20 amino acids, what is the basis for the genetic code? If three bases = one amino acid, possible aminoacids = 64 (444) The existence of a three-base (triplet) code was confirmed by experiments by Francis Crick and his colleagues in The triplet code is degenerate, which means that each amino acid is coded for by more than one triplet. What is mRNA? When a polypeptide is required, the triplet code of its gene is converted into a molecule of messenger RNA (mRNA). This process is called transcription and is the first stage of protein synthesis. Like DNA, mRNA is a nucleic acid, but it differs in that: it is single stranded, not double stranded it contains ribose instead of deoxyribose it contains uracil instead of thymine. mRNA strand during transcription Differences between DNA and RNA Transcription and codons During transcription, the mRNA is built up by complementary base pairing, using the DNA as a template. The DNAs base triplets are converted into mRNA codons. What are the codons in the mRNA transcribed from this sequence of DNA base triplets? DNA mRNA T A CG C AG A TT A C A U GC G UC G UC U AA U G The genetic code is non-overlapping: each base is only part of one triplet/codon, and each triplet/codon codes just one amino acid. OVERLAPPING AACGTAAGCACGTTCGCACCCCAAACACAC EACH CODON CODES FOR ONE AMINO ACID. However these may be the same amino acid. What is tRNA? nucleotides amino acid attachment site anticodon In the cytoplasm, amino acids become attached to transfer RNA (tRNA) molecules. Each tRNA is specific for one amino acid. Each tRNA molecule has a sequence of three bases called an anticodon. These are complementary to codons on the mRNA molecule. 3 end 5 end hydrogen bond What is the anticodon for the codon A U G U A C What is translation? Once a molecule of mRNA has been transcribed, it moves out of the nucleus via a nuclear pore. In the cytoplasm, the mRNA combines with a ribosome the cellular structure on which the polypeptide chain will be built in a process called translation. How are the correct amino acids transported to the ribosome, and how are they linked together in the correct order? mRNA strand ribosome Next step in the polypeptide process Unwind your double helix You are going to write the mRNA sequence to your original DNA strand on your strip of card. AGCUGUCUAGUABC Next is the tRNA Write on your tRNA molecules the anticodons which are complimentary to the codons on your mRNA sequence. Next, write down the Amino Acids which are attatched to the specific amino acids. AMINO ACID LINKED TO tRNA ANTICODONS Valine - CAU/ CAC Aspargine UUG Serine AGA Glutamate - CUC Phenylalanine AAA/AAG Leucine - AAU Arganine - GAA Proline - GGU What happens during translation? tRNA molecules attach to the ribosome, and their anticodons pair up with the appropriate codons on the mRNA. The amino acids transported by the tRNA link together, and the tRNA molecules then return to the cytoplasm. The ribosome moves along the mRNA, and amino acids continue to join together until all the codons have been translated and the polypeptide is complete. Draw a chromosome Extension how do genes code for polypeptides? Answer this question using the following key words: Gene complimentary transcribe Ribosome tRNA Amino acids peptide bonds DNA translate mRNA Learning objectives What is a gene? How does a gene code for a polypeptide Success criteria Complete bracelet models to describe translation. Take away knowledge of key terms.

Recommended

View more >