why do we study dna?. the central dogma of molecular biology genes code protein perform functions...
Post on 05-Jan-2016
215 Views
Preview:
TRANSCRIPT
Why do we Why do we study study DNA?DNA?
The Central Dogma of The Central Dogma of Molecular BiologyMolecular Biology
Genes code Genes code protein protein perform perform functions in the cell that results functions in the cell that results in a phenotypein a phenotype
DNA DNA RNA RNA Protein Protein
TranscriptTranscriptionion
TranslatiTranslationon
Example of Phenotypes Example of Phenotypes Created by ProteinsCreated by Proteins
Hair colorHair color Eye colorEye color Hair textureHair texture Blood type (A, B, O)Blood type (A, B, O) Shoe sizeShoe size Eyelash lengthEyelash length
How much DNA is in our How much DNA is in our body?body?
Our DNA makes up 1% of our Our DNA makes up 1% of our body weight, so a 150 lb. person body weight, so a 150 lb. person would have 1.5 lbs. of DNA.would have 1.5 lbs. of DNA.
In one cell – 3 meters of DNA.In one cell – 3 meters of DNA. If you typed out your entire DNA If you typed out your entire DNA
sequence in Times 12pt font you sequence in Times 12pt font you would fill enough paper to reach would fill enough paper to reach the top of the Washington the top of the Washington Monument in D.C.Monument in D.C.
How the Cell Stores DNAHow the Cell Stores DNA Double helixDouble helix NucleosomesNucleosomes
DNA and DNA and histoneshistones Folds long strands of Folds long strands of
DNADNA Regulates what is Regulates what is
expressedexpressed ChromatinChromatin –– Packed Packed
DNA and histones (type of DNA and histones (type of protein)protein)
SupercoilsSupercoils Chromosomes Chromosomes –– most most
tightly packaged DNAtightly packaged DNAPackaging Movie
I supercoiled myself into this box!
Chromosome NumbersChromosome Numbers Humans: 46Humans: 46
Mouse: 40Mouse: 40
Dog: 78Dog: 78
Corn: 20Corn: 20
Ant: 2Ant: 2
The Structure of DNAThe Structure of DNANucleotidesNucleotides
DNA: DNA: DeoxyriboNucleic AcidDeoxyriboNucleic Acid Found in the nucleusFound in the nucleus Three subunits for each Three subunits for each
building block:building block: DeoxyriboseDeoxyribose (5 carbon sugar) (5 carbon sugar) PhosphatePhosphate Nitrogen Base (can be 1 of 4)Nitrogen Base (can be 1 of 4)
GuanineGuanine CytosineCytosine AdenineAdenine ThymineThymine
Base Pair MatchingBase Pair Matching
The two The two strands are strands are held together held together by by hydrogen hydrogen bondsbonds..
G and C – G and C – form form 3 hydrogen bonds3 hydrogen bonds
A and T – A and T – form form 2 hydrogen bonds2 hydrogen bonds
DNAtris
The Double HelixThe Double Helix James WatsonJames Watson, ,
FrancisFrancis CrickCrick, and , and Maurice WilkinsMaurice Wilkins were awarded the were awarded the Nobel prize.Nobel prize.
Rosalie FranklinRosalie Franklin died before she died before she could be awarded could be awarded with the Nobel prize.with the Nobel prize.
ChargraffChargraff identified identified that G and C pair, that G and C pair, and T and A pair.and T and A pair.
DNA Game
DNA ReplicationDNA Replication Double helix must unzipDouble helix must unzip
H-bonds breakH-bonds break Each original strand becomes Each original strand becomes
a a template strandtemplate strand (white) (white) Bases fill in to form Bases fill in to form
Complementary strandsComplementary strands (black)(black)
DNA polymeraseDNA polymerase –– building building enzyme enzyme –– adds new bases adds new bases
Occurs in the nucleusOccurs in the nucleus
DNA DNA ReplicatioReplicatio
nn
DNA Workshop
Enzyme(Helicase)
Unzips
New Strands
T
A
A
G
C
A
T
T
C
G
A-T
T-A
T-A
C-G
G-C
A-
T-
T-
C-
G-
-T
-A
-A
-G
-C
Enzyme(DNA Polymerase)
fills in new nucleotide bases
A-
T-
T-
C-
G-
-T
-A
-A
-G
-C
RNA StructureRNA Structure RNA: RNA: RiboNucleicRiboNucleic Acid Acid Found in the nucleus Found in the nucleus
(nucleolus)(nucleolus) Can leave the nucleusCan leave the nucleus Single stranded!Single stranded! Building blocks made of:Building blocks made of:
Ribose (5 carbon sugar)Ribose (5 carbon sugar) PhosphatePhosphate Nitrogen Base (1 of 4)Nitrogen Base (1 of 4)
GuanineGuanine CytosineCytosine AdenineAdenine Uracil (Instead of Thymine)Uracil (Instead of Thymine)
Three Kinds of RNAThree Kinds of RNA Messenger RNA (mRNA)Messenger RNA (mRNA)
conveys genetic conveys genetic information to the rest of information to the rest of the cellthe cell
Ribosomal RNA (rRNA)Ribosomal RNA (rRNA)
structural, part of structural, part of ribosomeribosome
Transfer RNA (tRNA)Transfer RNA (tRNA)
carries amino acids to carries amino acids to site of protein synthesissite of protein synthesis
TranscriptionTranscription Occurs in the Occurs in the
nucleusnucleus RNA polymerase RNA polymerase
adds adds complementary complementary nucleotidesnucleotides
Forms from one of Forms from one of the DNA strands the DNA strands ((template strandtemplate strand))
RNA is a blue print RNA is a blue print for proteinsfor proteins
Animation
TranscripTranscriptiontion
DNA Workshop
EnzymeUnzips
RNA Strand
U
A
A
G
C
A-T
T-A
T-A
C-G
G-C
A-
T-
T-
C-
G-
-T
-A
-A
-G
-C
Enzyme(RNA Polymerase)
fills in new nucleotide bases
Template Strand
ATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGTGCTACGTATTAG
Not all of this DNA sequence will make a protein, some of it is nonsense and
some of it gives information about when the protein should be made.
The Genetic CodeThe Genetic Code
DNA is a code to DNA is a code to make proteinsmake proteins
Proteins:Proteins: Made by Made by Amino Amino
AcidsAcids There are 20 types There are 20 types
of amino acidsof amino acids Each amino acid Each amino acid
has it’s own has it’s own special character.special character.
Translation:Translation:mRNA to ProteinmRNA to Protein
Think of each base as Think of each base as a letter (G, C, A, U)a letter (G, C, A, U)
Three bases = Three bases = ““a a wordword””
Each Each ““wordword”” codes for codes for an amino acid - an amino acid - codoncodon
Start codonStart codon - AUG - AUG Stop codonsStop codons Many codons together Many codons together
make a make a genegene
Firefly
Movie
Where does each step take place?
LocationLocation: ribosomes: ribosomes mRNA has mRNA has codonscodons (3 bases) (3 bases) tRNA carries an amino acid to the forming tRNA carries an amino acid to the forming
polypeptide (3 bases on tRNA - polypeptide (3 bases on tRNA - anti-codonanti-codon)) The anti-codons complement the codons in the The anti-codons complement the codons in the
mRNAmRNA Begins at Begins at start codonsstart codons Ends at Ends at stop codonsstop codons
TranslatioTranslationn
Ribosome
mRNA
LysinetRNA
Forming Polypeptide Chain
Codon
TranslationTranslation
TAC GGC TATCCA
What Causes Mutations? What Causes Mutations? Carcinogens Radiation Viruses Heredity
What Do Mutations Cause? What Do Mutations Cause? Cancer Slight frequent changes = polymorphisms Genetic Diseases
Cystic fibrosis (effects mucus production) Hemophilia (blood won’t clot) Sickle cell anemia
MutationsMutations Point mutations (Substitutions)
Original: The fat cat ate the wee rat.
Point Mutation: The fat hat ate the wee rat.
Frameshift mutations (Insertion, Deletion)
Original: The fat cat ate the wee rat.
Frame Shift: The fat caa tet hew eer at.
SubstitutionSubstitution InsertionInsertionDeletionDeletion
Gene RegulationGene Regulation Not all genes are expressed in every cellNot all genes are expressed in every cell Not all genes are expressed at the same Not all genes are expressed at the same
time.time. An An operonoperon is a group of genes that is a group of genes that
operate togetheroperate together A skin cell expresses different genes than A skin cell expresses different genes than
a nerve cella nerve cell
Regulatory sites Promoter
Start transcription
DNA strand
Stop transcription
Chapter ObjectivesChapter Objectives Know the scientists involved with the discovery of the Know the scientists involved with the discovery of the
structure and function of DNAstructure and function of DNA Know the structure and function of DNA.Know the structure and function of DNA. Know how DNA is packaged in the cell.Know how DNA is packaged in the cell. Know how DNA is replicated.Know how DNA is replicated. Know the structure and function of RNA.Know the structure and function of RNA. Know how RNA is made.Know how RNA is made. Know the three types of RNA.Know the three types of RNA. Know how RNA makes proteins.Know how RNA makes proteins. Be able to go from a sequence of DNA to RNA to protein.Be able to go from a sequence of DNA to RNA to protein. Give examples of types of proteins and what they do.Give examples of types of proteins and what they do. Differentiate between replication, transcription and Differentiate between replication, transcription and
translation.translation. List, demonstrate, and identify types of mutations.List, demonstrate, and identify types of mutations. Be able to discuss the potential outcomes of mutations.Be able to discuss the potential outcomes of mutations.
top related