“whats new in campylobacter infection”

“Whats new in Campylobacter infection”

Andrew Fox

Health Protection /Agency NorthWest

Laboratory reporting of selected GI pathogens Laboratory reporting of selected GI pathogens in England & Wales - 1977 to 2002.in England & Wales - 1977 to 2002.

0

10

20

30

40

50

60

1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001

Year

Lab

rep

orts

(10

00's

)

Campylobacters

Salmonellas

Rotavirus

Shigellas

Cryptosporidium

Norovirus

Campylobacter StatisticsCampylobacter Statistics

50,000+ confirmed cases in England and Wales (CDR)50,000+ confirmed cases in England and Wales (CDR)Estimated 400,000+ infections annually (IID study)Estimated 400,000+ infections annually (IID study)0.1% cases develop GBS (US estimate)0.1% cases develop GBS (US estimate)0-5% cases develop reactive arthritis (Scandinavia)0-5% cases develop reactive arthritis (Scandinavia)0.3-5.9% case develop bacteraemia (UK)0.3-5.9% case develop bacteraemia (UK)10% cases hospitalised, 5 days10% cases hospitalised, 5 daysMeningitis, Cholecystitis, Pancreatitis, Hepatitis,Meningitis, Cholecystitis, Pancreatitis, Hepatitis,Peritonitis, Myocarditis, Abcess ……Peritonitis, Myocarditis, Abcess ……

BUT…BUT…

Common source outbreaks are rarely identified and the source of the majority of cases reported in the UK is unknown. In one case control study, epidemiology of infection for over 60% of cases remained unknown.

There’s a lot of it about…There’s a lot of it about…

Transmission pathways forTransmission pathways for Campylobacter Campylobacter INFECTIONINFECTION

Campylobacter worldCampylobacter world

Selective cultureEnrichment culture

SerotypingSerotype specific phage typingPlasmid profiling

PFGE

Antibiograms

S.enteritidis PT4

S.typhimuriumDT104

S.virchow

S.ealing

S.goldcoast

S.typhi

The world of Salmonella EntericaThe world of Salmonella Enterica

Selective culture

Enrichment culture (foods)

Typing methodsCampylobacter spp.

Campylobacter world

PhenotypingPhenotyping

• SerotypingSerotyping– Penner serotyping (HS)Penner serotyping (HS)

• 65 serotypes65 serotypes– Lior serotypingLior serotyping (HL) (HL)

• >100 serotypes>100 serotypes– Colindale (modified HS)Colindale (modified HS)

• PhagetypingPhagetyping– Preston/Krakhria-Lior/Grajewski/ColindalePreston/Krakhria-Lior/Grajewski/Colindale

• BiotypingBiotyping– PrestonPreston

Problems with phenotypingProblems with phenotyping

• Isolates which fail to reactIsolates which fail to react

• Need to constantly expand reagent panelNeed to constantly expand reagent panel

• Limited availability of reagentsLimited availability of reagents

• Lack of standardisation Lack of standardisation

• Variable expressionVariable expression

Molecular sub-typing for Molecular sub-typing for C.jejuniC.jejuni

• Restriction endonuclease analysisRestriction endonuclease analysis• RFLPsRFLPs• RibotypingRibotyping• PFGEPFGE• fla fla typingtyping• PCR RFLPPCR RFLP• RAPDRAPD• ERICsERICs

But problems remain, Ambiguities need combinationsStandardisationRoll out

CrossroadsCrossroads

control and prevention

population genetics

Ambiguous typing

epidemiology

sporadic infection

Campylobacter infection

Campylobacter isolate Campylobacter isolate characterisationcharacterisation

• Is central to disease surveillance and Is central to disease surveillance and epidemiology, requiring methods that epidemiology, requiring methods that are are – accurateaccurate

– comprehensivecomprehensive

– reproduciblereproducible

Multilocus sequence typing Multilocus sequence typing (MLST)(MLST)

Chromosomal DNAAmplify 450-bp

fragments of seven house-keeping genes

Compare sequences of each gene fragment with the known alleles at the locus

Assign alleles at the seven loci to give the allelic profile

Compare the allelic profile with those of isolates within a central database via the internet and assign a sequence type (ST)

Sequence the seven gene fragments on both strands

C. jejuni sequence typesNameName aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA

ST-21ST-21 2 2 1 1 1 1 3 3 2 2 1 1 5 5ST-45ST-45 4 4 7 7 10 10 4 4 1 1 7 7 1 1ST-206ST-206 2 2 21 21 5 5 37 37 2 2 1 1 5 5ST-61ST-61 1 1 4 4 2 2 2 2 6 6 3 3 17 17ST-48ST-48 2 2 4 4 1 1 2 2 7 7 1 1 5 5ST-257ST-257 9 9 2 2 4 4 62 62 4 4 5 5 6 6ST-353ST-353 7 7 17 17 5 5 2 2 10 10 3 3 6 6ST-42ST-42 1 1 2 2 3 3 4 4 5 5 9 9 3 3ST-403ST-403 10 10 27 27 16 16 19 19 10 10 5 5 7 7ST-52ST-52 9 9 25 25 2 2 10 10 22 22 3 3 6 6ST-177ST-177 17 17 2 2 8 8 5 5 8 8 2 2 4 4ST-354ST-354 8 8 10 10 2 2 2 2 11 11 1212 6 6ST-22ST-22 1 1 3 3 6 6 4 4 3 3 3 3 3 3ST-433ST-433 2 2 59 59 4 4 38 38 17 17 1212 35 35ST-362ST-362 1 1 2 2 49 49 4 4 11 11 6666 8 8ST-179ST-179 1 1 6 6 7 7 2 2 40 40 3232 3 3ST-49ST-49 3 3 1 1 5 5 17 17 11 11 1111 6 6

Genetic diversity within Penner Genetic diversity within Penner serotypesserotypes

Penner serotype Number of STs1 322 334 125 86 8

Population diversity of C. jejuni

Diversity Index

Serotype and phagetype 0.989

Serotype, phage and biotype 0.997

Combined genotype 0.930

MLST 0.99

Do we need yet another typing scheme for Campylobacter?

• A nucleotide sequence based approach capitalises on technology which is largely automated and increasingly applied to the characterisation of pathogens

Advantages of MLST

• The technique is portable, reproducible and relatively quick, easy and cheap to perform

• Unlike antigen and antibiotic resistance genes, housekeeping genes are selectively neutral

• Freedom from reliance on serological typing reagents which are becoming more difficult to produce (recent changes in Animal Procedures Act)

Frequency of clonal complexes in Frequency of clonal complexes in different sample sources (n=160)different sample sources (n=160)

SourceSource ST-21ST-21 ST-45ST-45 ST-61ST-61

Ruminant 35 (41%) 11 (13%) 17 (20%)

Avian 3 (11%) 10 (35%) _ _

Wild mammal 5 (21%) 9 (37%) 2 (9%)

Environment 1 (5%) 10 (48%) 1 (5%)

Comparison of the frequency of ST-Comparison of the frequency of ST-complexes from animal and environmental complexes from animal and environmental

sources with human infectionssources with human infections

0

5101520

25303540

4550

Fre

qu

ency

(%

)

ST-21 ST-45 ST-61

RuminantAvianWild mammalEnvironmentHuman infection

Preston 2000 isolates

Number of Clonal Complexes

17

Number of Sequence Types

58

Number of HS serotypes

28

Preston 2000 isolates ST clusters versus

HS serotype ST No isolates HS serotype

ST-104 5 HS 5(1); HS 16(1); HS 50(2);HS NT(1)

ST-45 4 HS 12(3);HS NT(1)

ST-262 2 HS NT

ST-19 2 HS NT

Clonal Complexes for C.jejuni isolated from GI infections in Preston area NW

England

0

5

10

15

20

25

ST-21ST-45ST-205ST-47ST-61ST-19ST-53ST-311ST-17

Comparison of clonal complexes for UK human infections: 1991-2000

0%

20%

40%

60%

80%

100%

1991 2000

UAST-61ST-48ST-45ST-257ST-21ST-206

Glastonbury outbreak

OutbreakOutbreak aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA ST ST FlaSVRFlaSVRKettering 93Kettering 93 2 21 5 37 2 1 8 206 11 Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11 Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 1 7 3 4 8 9 5 42 9Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 1 7 3 4 8 9 5 42 9Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11Kettering 93Kettering 93 2 21 5 37 2 1 8 206 11Kettering 93Kettering 93 2 21 3 37 2 1 5 206 11

FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11FranceFrance 3 1 5 17 11 11 6 49 11

Glastonbury 93Glastonbury 93 1 4 2 2 6 3 17 61 14Glastonbury 93Glastonbury 93 1 4 2 2 6 3 17 61 14

Investigation of outbreak isolates with MLSTInvestigation of outbreak isolates with MLST

HS1PT76

HS2PT52

HS4PT121

HS4 PT55

HS11PT90

HS19PT90

ST 21 Complex

ST-61

ST 17

ST 22

Multilocus sequence typing of C.jejuni

Detection and report of Camp spp.by EIA or PCR

DNA Purification and typing

Further report to GP, EHO, CCDC, RE

24 - 48 hours

24 - 48 hours

24 hours

3 - 5 days

Cluster analysis and investigation

Campylobacter detection and typing from

faeces or foods - future prospects

C. jejuni sequence typesNameName aspAaspA glnAglnA gltAgltA glyAglyA pgmpgm tkttkt uncAuncA

ST-21ST-21 2 2 1 1 1 1 3 3 2 2 1 1 5 5ST-45ST-45 4 4 7 7 10 10 4 4 1 1 7 7 1 1ST-206ST-206 2 2 21 21 5 5 37 37 2 2 1 1 5 5ST-61ST-61 1 1 4 4 2 2 2 2 6 6 3 3 17 17ST-48ST-48 2 2 4 4 1 1 2 2 7 7 1 1 5 5ST-257ST-257 9 9 2 2 4 4 62 62 4 4 5 5 6 6ST-353ST-353 7 7 17 17 5 5 2 2 10 10 3 3 6 6ST-42ST-42 1 1 2 2 3 3 4 4 5 5 9 9 3 3ST-403ST-403 10 10 27 27 16 16 19 19 10 10 5 5 7 7ST-52ST-52 9 9 25 25 2 2 10 10 22 22 3 3 6 6ST-177ST-177 17 17 2 2 8 8 5 5 8 8 2 2 4 4ST-354ST-354 8 8 10 10 2 2 2 2 11 11 1212 6 6ST-22ST-22 1 1 3 3 6 6 4 4 3 3 3 3 3 3ST-433ST-433 2 2 59 59 4 4 38 38 17 17 1212 35 35ST-362ST-362 1 1 2 2 49 49 4 4 11 11 6666 8 8ST-179ST-179 1 1 6 6 7 7 2 2 40 40 3232 3 3ST-49ST-49 3 3 1 1 5 5 17 17 11 11 1111 6 6

AACTGGGTCCAGGCAACATCATTATCCGG

AACTGGGTCGAGGCAACATCATTATCCGG

Single Nucleotide Polymorphisms

Place and Time and Type

7 cases in 20 days

21 cases all year in NW and S Lancs HA

C.jejuni HS11 PT1

The Iceland Experiment

1.Public awareness campaign2.Frozen chicken

USDA Intervention studies Norman Stern

• Novel biological agents to reduce or eliminate Campylobacter from chicken intestinal flora– Competitive exclusion

• Bacteriocins– 15 trials

– Administer bacteriocin 5 days before slaughter

– 5-fold or total reduction in Campylobacter from chicken at slaughter

Acknowledgements

Preston PHLEric BoltonRoisin UreDavid Wareing (Dynal Biotech)

WCIED, OxfordFrances CollesKate DingleMartin MaidenRachel Urwin

University of StaffordshireMishele BarrigasPete Gowland

DEFRA Epidemiology Unit,University of LiverpoolNigel FrenchRichard KempHoward Leatherbarrow