the human genome project - studiestoday.com...the human genome project began in 1990 • the mission...
Post on 27-May-2020
7 Views
Preview:
TRANSCRIPT
The Human Genome Project
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Human Genome Project Began in
1990
• The Mission of the HGP: The quest to
understand the human genome and the role it
plays in both health and disease.
“The true payoff from the HGP will be the ability to
better diagnose, treat, and prevent disease.” --- Francis Collins, Director of the HGP and the National Human
Genome Research Institute (NHGRI)
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The genome is our Genetic Blueprint
• Nearly every human cell contains 23 pairs of chromosomes
– 1 - 22 and XY or XX
• XY = Male
• XX = Female
• Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Genome is
Who We Are on the inside!
• Chromosomes consist of DNA
– molecular strings of A, C, G, & T
– base pairs, A-T, C-G
• Genes
– DNA sequences that encode proteins
– less than 3% of human genome
Information coded
in DNA
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
Until the early 1970’s, DNA was the most difficult
cellular molecule for biochemists to analyze.
DNA is now the easiest molecule to analyze –
we can now isolate a specific region of the
genome, produce a virtually unlimited
number of copies of it, and determine its
nucleotide sequence overnight.
Molecular Biology Of The Cell. Alberts et al. 491-495
The Human Genome Project
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Beginning of the Project
• Most the first 10 years of the project were
spent improving the technology to sequence
and analyze DNA.
• Scientists all around the world worked to make
detailed maps of our chromosomes and
sequence model organisms, like worm, fruit fly,
and mouse.
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
At the height of the Human Genome Project,
sequencing factories were generating DNA
sequences at a rate of 1000 nucleotides per
second 24/7.
Technical breakthroughs that allowed the
Human Genome Project to be completed
have had an enormous impact on all of
biology…..
Molecular Biology Of The Cell. Alberts et al. 491-495
The Human Genome Project
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Challenges were Overwhelming
• First there was the AssemblyThe DNA sequence is so long that no technology can read it all at once, so it was broken into pieces.
There were millions of clones(small sequence fragments).
The assembly process included finding where the pieces overlapped in order to put the draft together.
3,200,000 piece puzzle
anyone?
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
Goals:■ identify all the approximate 30,000 genes in human DNA,
■ determine the sequences of the 3 billion chemical base pairs that make up human
DNA,
■ store this information in databases,
■ improve tools for data analysis,
■ transfer related technologies to the private sector, and
■ address the ethical, legal, and social issues (ELSI) that may arise from the project.
Milestones:■ 1990: Project initiated as joint effort of U.S. Department of Energy and the National
Institutes of Health
■ June 2000: Completion of a working draft of the entire human genome (covers >90%
of the genome to a depth of 3-4x redundant sequence)
■ February 2001: Analyses of the working draft are published
■ April 2003: HGP sequencing is completed and Project is declared finished two years
ahead of schedule
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
http://doegenomes.org
http://www.sanger.ac.uk/HGP/overview.shtml
The Human Genome Project
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
UCSC put the human genome
sequence on the web July 7, 2000
UCSC put the
human genome
sequence on CD in
October 2000, with
varying results
Cyber geeks
Searched
for hidden
Messages,
and
“GATTACA”
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Completion of the Human
Genome Sequence• June 2000 White House
announcement that the majority of the human genome (80%) had been sequenced (working draft).
• Working draft made available on the web July 2000 at genome.ucsc.edu.
• Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature.
• Completion of 99.99% of the genome as finished sequence on July 2003.
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?
By the Numbers
• The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G).
• The average gene consists of 3000 bases, but sizes vary greatly, with the largest
known human gene being dystrophin at 2.5 million bases. Smallest is tRNA gene at
76bp!
• The total number of genes is estimated at around 30,000--much lower than
previous estimates of 80,000 to 140,000.
• Almost all (99.9%) nucleotide bases are exactly the same in all people.
• The functions are unknown for over 50% of discovered genes.
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
How It's Arranged
• The human genome's gene-dense "urban centers" are predominantly composed of
the DNA building blocks G and C.
• In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T.
GC- and AT-rich regions usually can be seen through a microscope as light and dark
bands on chromosomes.
• Genes appear to be concentrated in random areas along the genome, with vast
expanses of noncoding DNA between.
• Stretches of up to 30,000 C and G bases repeating over and over often occur
adjacent to gene-rich areas, forming a barrier between the genes and the "junk
DNA." These CpG islands are believed to help regulate gene activity.
• Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest
(231).
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The human genome
How It's Arranged
• The human genome's gene-dense "urban
centers" are predominantly composed of
the DNA building blocks G and C.
• In contrast, the gene-poor "deserts" are
rich in the DNA building blocks A and T.
GC- and AT-rich regions usually can be
seen through a microscope as light and
dark bands on chromosomes.
• Genes appear to be concentrated in
random areas along the genome, with vast
expanses of noncoding DNA between.
• Stretches of up to 30,000 C and G bases
repeating over and over often occur
adjacent to gene-rich areas, forming a
barrier between the genes and the "junk
DNA." These CpG islands are believed to
help regulate gene activity.
• Chromosome 1 has the most genes
(2968), and the Y chromosome has the
fewest (231).U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
The Wheat from the Chaff
• Less than 2% of the genome codes for proteins.
• Repeated sequences that do not code for proteins ("junk DNA") make up at least
50% of the human genome.
• Repetitive sequences are thought to have no direct functions, but they shed light
on chromosome structure and dynamics. Over time, these repeats reshape the
genome by rearranging it, creating entirely new genes, and modifying and
reshuffling existing genes.
• The human genome has a much greater portion (50%) of repeat sequences than
the mustard weed (11%), the worm (7%), and the fly (3%).
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
How the Human Compares with Other Organisms• Unlike the human's seemingly random distribution of gene-rich areas, many other
organisms' genomes are more uniform, with genes evenly spaced throughout.
• Humans have on average three times as many kinds of proteins as the fly or worm
because of mRNA transcript "alternative splicing" and chemical modifications to the
proteins. This process can yield different protein products from the same gene.
• Humans share most of the same protein families with worms, flies, and plants; but the
number of gene family members has expanded in humans, especially in proteins
involved in development and immunity.
• Although humans appear to have stopped accumulating repeated DNA over 50 million
years ago, there seems to be no such decline in rodents. This may account for some of
the fundamental differences between hominids and rodents, although gene estimates
are similar in these species. Scientists have proposed many theories to explain
evolutionary contrasts between humans and other organisms, including those of life
span, litter sizes, inbreeding, and genetic drift.
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human
genome sequence tell us?
Variations and Mutations• Scientists have identified about 3 million locations where single-base DNA differences
(SNPs) occur in humans. This information promises to revolutionize the processes of
finding chromosomal locations for disease-associated sequences and tracing human
history.
• The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females.
Researchers point to several reasons for the higher mutation rate in the male germline,
including the greater number of cell divisions required for sperm formation than for eggs.
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003http://doegenomes.org
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?
Led to the discovery of whole new classes of
proteins and genes, while revealing that many
proteins have been much more highly
conserved in evolution than had been
suspected.
Provided new tools for determining the functions
of proteins and of individual domains within
proteins, revealing a host of unexpected
relationships between them.
Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What does the draft human genome
sequence tell us?
By making large amounts of protein
available, it has yielded an efficient way to
mass produce protein hormones and
vaccines
Dissection of regulatory genes has provided
an important tool for unraveling the complex
regulatory networks by which eukaryotic
gene expression is controlled.
Molecular Biology Of The Cell. Alberts et al. 491-495
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Project is not Done…
• Next there is the Annotation:
The sequence is like a topographical map, the
annotation would include cities, towns,
schools, libraries and coffee shops!
So, where are the genes?
How do genes work?
And, how do scientists use
this information for scientific
understanding and to
benefit us?
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
What do genes do anyway?
• We only have ~19,000 genes, so that means that
each gene has to do a lot.
• Genes make proteins that make up nearly all we are
(muscles, hair, eyes).
• Almost everything that happens in our bodies
happens because of proteins (walking, digestion,
fighting disease).
Eye Color and Hair Color
are determined by genes
OROR
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
Of Mice and Men:
It’s all in the genes
Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible?
One human gene can make many different proteins while a mouse gene can only make a few!
Did you say
cheese?
Mmm,
Cheese!
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
Genes are important
• By selecting different pieces of a gene, your
body can make many kinds of proteins. (This
process is called alternative splicing.)
• If a gene is “expressed” that means it is turned
on and it will make proteins.
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The UCSC Genome Browser
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The browser takes you from early
maps of the genome . . .
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
. . . to a multi-resolution view . . .
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
. . . at the gene cluster level . . .Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
. . . the single gene level . . .Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
. . . the single exon level . . .Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
. . . and at the single base level
caggcggactcagtggatctggccagctgtgacttgacaag
caggcggactcagtggatctagccagctgtgacttgacaag
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
The Continuing Project
• Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function.
• Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don’t really understand how they work.
• Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.
Downloaded from www.studiestoday.com
Downloaded from www.studiestoday.com
top related