the eukaryotic chromosome (chapter 16) monday, november 8, 2011 wednesday, november 10, 2011...

Post on 11-Jan-2016

224 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

The eukaryotic chromosome(Chapter 16)

Monday, November 8, 2011Wednesday, November 10, 2011

Genomics260.605.01J. Pevsner

pevsner@jhmi.edu

Many of the images in this powerpoint presentationare from Bioinformatics and Functional Genomicsby J Pevsner, © 2009 by Wiley-Blackwell.

These images and materials may not be usedwithout permission.

Visit http://www.bioinfbook.org

Copyright notice

Today: The eukaryotic chromosome (Chapter 16)

Wednesday Nov. 10: The eukaryotic chromosome (continued)

Friday November 12: The fungi (Chapter 17)

The following week: lab; Sarah Wheelan; David Sullivan

Schedule

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomesC value paradox and genome sizesOrganization of genomes into chromosomesGenome browsersThe ENCODE project

Repetitive DNA content of eukaryotic genomesGene content of eukaryotic chromosomesRegulatory regions of eukaryotic chromosomesComparison of eukaryotic DNAVariation in chromosomal DNATechniques to measure chromosomal change

Introduction to the eukaryotes

Eukaryotes are single-celled or multicellular organismsthat are distinguished from bacteria and archaea by the presence of a membrane-bound nucleus, an extensive system of intracellular organelles, and a cytoskeleton.

Later we will explore the eukaryotes using a phylogenetic tree by Baldauf et al. (Science, 2000). This tree was made by concatenating four protein sequences: elongation factor 1a, actin, a-tubulin, and b-tubulin.

Page 640

Eukaryotes(after Baldauf et al., 2000)

Page 730

Note that we will learn how to make phylogenetic trees in lab as soon as MEGA software is installed in the computer labs.

You should visit:http://www.megasoftware.net/Download it for Windows, MacOS or Linux

General features of the eukaryotes

Some of the general features of eukaryotes that distinguishthem from bacteria and archaea are:

• eukaryotes include many multicellular organisms, in addition to unicellular organisms

• eukaryotes have [1] a membrane-bound nucleus

[2] intracellular organelles[3] a cytoskeleton

• Most eukaryotes undergo sexual reproduction

Page 641

General features of the eukaryotes (cont.)

Some of the general features of eukaryotes that distinguishthem from bacteria and archaea are:

• The genome size of eukaryotes spans a wider range than that of most bacteria and archaea

• Eukaryotic genomes have a lower density of genes

• Bacteria are haploid; eukaryotes have varying ploidy

• Eukaryotic genomes tend to be organized into linear chromosomes with a centromere and telomeres.

Page 641

Questions about eukaryotic chromosomes

What are the sizes of eukaryotic genomes, and how are they organized into chromosomes?

What are the types of repetitive DNA elements? What are their properties and amounts?

What are the types of genes? How can they be identified?

What is the mutation rate across the genome; what are the selective forces affecting genome evolution?

What is the spectrum of variation between species (comparative genomics) and within species?

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

C value paradox and genome sizes

Organization of genomes into chromosomes

Genome browsers

The ENCODE project

C value paradox: why eukaryotic genome sizes vary

The haploid genome size of eukaryotes, called the C value,varies enormously.

Encephalitozoon cuniculi ~3 MbA variety of fungi 10-40 MbTakifugu rubripes (pufferfish) 365 Mb(same number of genes as other fish or as the human genome, but 1/8th the size)

Pinus resinosa (Canadian red pine) 68 GbProtopterus aethiopicus (Marbled lungfish) 140 GbAmoeba dubia (amoeba) 690 Gb

Page 643

C value paradox: why eukaryotic genome sizes vary

The range in C values does not correlate well with thecomplexity of the organism. This phenomenon is calledthe C value paradox.

The solution to this “paradox” is that genomes are filledwith large tracts of noncoding, often repetitive DNA sequences.

Page 643

Eukaryotic genomes are organized into chromosomes

Genomic DNA is organized in chromosomes. The diploid number of chromosomes is constant in each species(e.g. 46 in human). Chromosomes are distinguished by a centromere and telomeres.

The chromosomes are routinely visualized by karyotyping(imaging the chromosomes during metaphase, when each chromosome is a pair of sister chromatids).

Page 644

Fig. 16.1Page 645

Plate II. First P.G. mitosis in polar view. Tradescantia virginiana, Commelinaceae, n = 9 (from aberrrant plant with 22 chromosomes). 2 BE - CV smears. x 1200. Printed on multigrade paper. Darlington.

Mitosis in Paris quadrifolia, Liliaceae, showing all stages from prophase to telophase. n = 10 (Darlington).

Root tip squashes showing anaphase separation. Fritillaria pudica, 3x = 39, spiral structure of chromatids revealed by pressure after cold treatment. Darlington.

Cleavage mitosis in the teleostean fish, Coregonus clupeoides, in the middle of anaphase. Spindle structure revealed by slow fixation. Darlington.

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

C value paradox and genome sizes

Organization of genomes into chromosomes

Genome browsers

The ENCODE project

The eukaryotic chromosome: the centromere

The centromere is a primary constriction where the chromosome attaches to the spindle fibers; here the boundary between sister chromatids is not clear. It may be in the middle (metacentric) or the end (acrocentric).

If a chromosome has two centromeres spaced apart (dicentric) then at anaphase there is a 50% chance that a single chromatid would be pulled to opposite poles of the mitotic spindle. This would result in a bridge formation and chromosome breakage.

Page 644

View a centromere on chromosome 11

Go to UCSC, human, hg18 assembly, chr11:51,000,001-55,000,000Set tracks in Mapping and Sequencing (all dense):

FISH clones GAPBAC End PairsFosmid End Pairs

Gene TracksRefSeq genes

Variation and RepeatsSegmental DupsRepMask 3.2.7

(1) Try zooming out 3-fold: are there more gaps?(2) Switch to the hg19 assembly: do the answers differ?(3) How many gaps are on chromosome 11? What sizes?

How many gaps are on chromosome 11? What are their sizes?

[1] Go to Table Browser, human Assembly = hg19Group = Mapping and Sequencing TracksTrack = GapRegion = chr11 (click lookup)Output = table in browserOutput = BED, send to Galaxy

[2] Galaxy result: there are 15 regionsLeft sidebar Text Manipulation Compute c3-c2

(round the result)Left sidebar Filter and Sort Sort on column c4

Execute

[3] Note the Galaxy output (implicitly) includes the telomeres (10 kb, 50 kb) and the centromere (3 Mb).

The eukaryotic chromosome: the acrocentrics

The short arm of the acrocentric autosomes has a secondary constriction usually containing a nucleolar organizer. This contains the genes for 18S and 28S ribosomal RNA.

Page 644

The eukaryotic chromosome: the telomere

The telomere is a region of highly repetitive DNA at either end of a linear chromosome. Telomeres include nucleoprotein complexes that function in the protection, replication, and stabilization of chromosome ends. Telomeres of many eukaryotes have tandemly repeated DNA sequences (discussed below).

Page 644

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

C value paradox and genome sizes

Organization of genomes into chromosomes

Genome browsers

The ENCODE project

Two main genome browsers

There are two principal genome browsers for eukaryotes:

(1) Ensembl (www.ensembl.org) offers browsers for dozens of genomes

(2) UCSC (http://genome.ucsc.edu) offers genome and table browsers for dozens of organisms. We will focus on this browser.

Page 645

Example #1 of a human genome web browser:human chromosome 21 at NCBI

nucleolar organizing center

centromere

nucleolar organizing center

centromere

Example #2 of a human genome web browser:human chromosome 21at www.ensembl.org

centromere

Example #3 of a human genome web browser:human chromosome 21 at UCSC

Example #4 of a human genome web browser:the beta globin gene cluster on human chromosome 11 at UCSC

[1] Enter hbb (for beta globin) into the gene box, and this takes you to chr11:5,246,696-5,248,301 (for the hg19 assembly), a 1,606 base pair region.

[2] Enter chr11:5,200,001-5,750,000 (a 550,000 bp region). Set the UCSC Genes and the RefSeq genes to “pack.” Note that the UCSC Genes track includes ENORMOUS models for HBE1 and HBG2.Why?

[3] We will instead focus on the RefSeq region. Enter: chr11:5,245,001-5,295,000 (50 kb region)

Beta globin cluster on chr11:5,245,001-5,295,000 (50 kb region, hg19 build, default tracks shown)

HBB, HBD, HBG1, HBG2, HBE1

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

C value paradox and genome sizes

Organization of genomes into chromosomes

Genome browsers

The ENCODE project

Page 647

The ENCODE project

►The ENCyclopedia Of DNA Elements (ENCODE) project was launched in 2003

► Pilot phase (completed): devise and test high-throughput approaches to identify functional elements. 44 DNA targets: 1 percent of the human genome, ~30 million base pairs (Mb).

► Second phase (simultaneous): technology development.

► Third phase: production. Expand the ENCODE project to analyze the remaining 99 percent of the human genome.

Key reference: Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature (2007) 447:799-816. PMID: 17571346

Page 647

The ENCODE project

Goal of ENCODE: build a list of all sequence-based functional elements in human DNA. This includes:

► protein-coding genes

► non-protein-coding genes

► regulatory elements involved in the control of gene transcription

► DNA sequences that mediate chromosomal structure and dynamics.

Page 647

http://genome.cse.ucsc.edu/ENCODE/encode.hg17.html

ENCODE data at the UCSC Genome Browser

ENCODE data at the UCSC Genome Browser: beta globin(switch from hg19 to hg18 assembly to access tracks!)

ENCODE tracks available at the UCSC Genome Browser(hg18 assembly)

ENCODE data at the UCSC Genome Browser: beta globin(switch from hg19 to hg18 assembly to access tracks!)

The ENCODE EGASP competition shows that leading gene prediction software generates gene models that differ greatly in sensitivity and sensitivity. This often results in quite distinct predictions of gene structure. Jigsaw is one of the best.

ENCODE variation tracks available at UCSC(hg18 assembly; try chr11:5,200,001-5,250,000)

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Noncoding and repetitive sequences

1. Interspersed repeats

2. Processed pseudogenes

3. Simple sequence repeats

4. Segmental duplications

5. Blocks of tandem repeats

Britten & Kohne’s analysis of repetitive DNA

In the 1960s, Britten and Kohne defined the repetitivenature of genomic DNA in a variety of organisms.They isolated genomic DNA, sheared it, dissociatedthe DNA strands, and measured the rates of DNAreassociation.

For dozens of eukaryotes—but not bacteria or viruses—large amount of DNA reassociates extremely rapidly.This represents repetitive DNA.

Page 650

Fig. 16.5Page 651

Britten and Kohne (1968) identified repetitive DNA classes

Software to detect repetitive DNA

It is essential to identify repetitive DNA in eukaryoticgenomes. RepBase Update is a database of knownrepeats and low-complexity regions.

RepeatMasker is a program that searches DNA queriesagainst RepBase. There are many RepeatMasker sitesavailable on-line.

We will use 50,000 base pairs from human chromosome11 as an example. This region includes the beta globin gene cluster.

Page 653

http://www.repeatmasker.org/current 11/11

Repeatmasker software screens DNA for repeats

RepeatMaskerresults for 50 kb of DNA in the human HBB locus

RepeatMaskermasksrepetitive DNA(FASTA format)

Five main classes of repetitive DNA

Page 652

1. Interspersed repeats (transposon-derived repeats)constitute ~45% of the human genome. They involveRNA intermediates (retroelements) or DNA intermediates(DNA transposons).

• Long-terminal repeat transposons (RNA-mediated)• Long interspersed elements (LINEs);

these encode a reverse transcriptase• Short interspersed elements (SINEs)(RNA-mediated);

these include Alu repeats• DNA transposons (3% of human genome)

UCSC displays interspersed repeats identified by RepeatMasker

(hg18 assembly; chr11:5,200,001-5,250,000)

Turn on the RepeatMasker track from the “Variation and Repeats” section; or the RepMask 3.2.7 track

Five main classes of repetitive DNA

Table 16.6Page 653

1. Interspersed repeats (transposon-derived repeats)

Examples include retrotransposed genes that lack introns,such as:

ADAM20 NM_003814 14q (original gene on 8p)Cetn1 NM_004066 18p (original gene on Xq)Glud2 NM_012084 Xq (original gene on 10q)Pdha2 NM_005390 4q (original gene on Xp)

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Noncoding and repetitive sequences

1. Interspersed repeats

2. Processed pseudogenes

3. Simple sequence repeats

4. Segmental duplications

5. Blocks of tandem repeats

Five main classes of repetitive DNA

Page 653

2. Processed pseudogenes

These genes have a stop codon or frameshift mutationand do not encode a functional protein. They commonly arise from retrotransposition, or following gene duplication and subsequent gene loss.

For a superb on-line resource, visit Mark Gerstein’s website, http://www.pseudogene.org. Gerstein and colleagues (2006) suggest that there are ~19,000 pseudogenes in the human genome, slightly fewer than the number of functional protein-coding genes. (11,000 non-processed, 8,000 processed [lack introns].)

Pseudogenes in the UCSC genome browser

Yale pseudogenes

VEGA pseudogenes

Pseudogenes in the UCSC genome browser

Note one retrogene prediction (duplicated HBG1 gene)

Pseudogenes in the HOX cluster ENCODE region

HOX genes

From the Entrez Gene entry for human HOXA1:

In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation.

Vertebrate Genome Annotation (VEGA) database

From the VEGA home page (http://vega.sanger.ac.uk):

"The Vertebrate Genome Annotation (VEGA) database build 30 is designed to be a central repository for manual annotation of different vertebrate finished genome sequence. In collaboration with the genome sequencing centres Vega attempts to present consistent high-quality curation of the published chromosome sequences."

"Finished genomic sequence is analysed on a clone by clone basis using a combination of similarity searches against DNA and protein databases as well as a series of ab initio gene predictions (GENSCAN, Fgenes)."

"In addition, comparative analysis using vertebrate datasets such as the Riken mouse cDNAs and Genoscope Tetraodon nigroviridis Ecores (Evolutionary Conserved Regions) are used for novel gene discovery."

Vertebrate Genome Annotation (VEGA) database

VEGA definition of pseudogenes (http://vega.sanger.ac.uk):

Yale pseudogene database

http://www.pseudogene.org

The human genome has as many pseudogenes as genes

Pseudogenes: example

Mouse GULO, required for vitamin C biosynthesis, has become a pseudogene in the primate lineage (yGULO). Here is an output for GULO on the human genome:

Pseudogenes: example

GULO pseudogene in Entrez nucleotide (NG_001136):

Pseudogenes: example

Mouse GULO in Entrez protein:

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Noncoding and repetitive sequences

1. Interspersed repeats

2. Processed pseudogenes

3. Simple sequence repeats

4. Segmental duplications

5. Blocks of tandem repeats

Five main classes of repetitive DNA

Page 657

3. Simple sequence repeats

Microsatellites: from one to a dozen base pairsExamples: (A)n, (CA)n, (CGG)n

These may be formed by replication slippage.Minisatellites: a dozen to 500 base pairs

Simple sequence repeats of a particular length andcomposition occur preferentially in different species.In humans, an expansion of triplet repeats such as CAGis associated with over a dozen disorders (includingHuntington’s disease).

Example of simple sequence repeats (e.g. ACn) from the globin locus

Page 657

>hg18_rmskRM327_(TAAAA)n range=chr11:5206265-5206312 5'pad=0 3'pad=0 strand=+ repeatMasking=lower aaaataaaataaaataaaataaaataaaacaataaaatgaaataaaat

>hg18_rmskRM327_(CA)n range=chr11:5207526-5207560 5'pad=0 3'pad=0 strand=+ repeatMasking=lower acacacacacacacacacacacacacacacacaca

Repetitive DNA in the UCSC genome browser

Sequences of at least 15 perfect di-nucleotide and tri-nucleotide repeats identified by TRF. These tend to be highly polymorphic in the population.

Beta globin locus: tandem repeats, microsatellites, and RepeatMasker

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Noncoding and repetitive sequences

1. Interspersed repeats

2. Processed pseudogenes

3. Simple sequence repeats

4. Segmental duplications

5. Blocks of tandem repeats

Five main classes of repetitive DNA

Page 658

4. Segmental duplications

These are blocks of about 1 kilobase to 300 kb that arecopied intra- or interchromosomally. Evan Eichler andcolleagues estimate that about 5% of the human genomeconsists of segmental duplications. Duplicated regionsoften share very high (99%) sequence identity.

Beta globin locus: segmental duplications of the HBG1 and HBG2 genes

Fig. 16.12Page 659

Successive tandem gene duplications(after Lacazette et al., 2000)

observed today

Successive tandem gene duplications(after Lacazette et al., 2000)

Fig. 16.12Page 659

Successive tandem gene duplications(after Lacazette et al., 2000)

Fig. 16.12Page 659

Successive tandem gene duplications(after Lacazette et al., 2000)

Fig. 16.12Page 659

Beta globin locus: segmental duplicationsinvolving HBG1 and HBG2 genes

Page 660

Beta globin locus: segmental duplications(pairwise alignment of duplicated regions at UCSC)

Region of beta globin locus: segmental duplications(one region is duplicated at dozens of loci)

Region of beta globin locus: segmental duplications(one region is duplicated at dozens of loci)

By definition, non-RepeatMasked

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Noncoding and repetitive sequences

1. Interspersed repeats

2. Processed pseudogenes

3. Simple sequence repeats

4. Segmental duplications

5. Blocks of tandem repeats

Five main classes of repetitive DNA

Page 660

5. Blocks of tandem repeats

These include telomeric repeats (e.g. TTAGGG inhumans) and centromeric repeats (e.g. a 171 base pairrepeat of a satellite DNA in humans).

Such repetitive DNA can span millions of base pairs, and it is often species-specific.

Fig. 16.14Page 661

Example of telomeric repeats (obtained by blastn searching TTAGGG4)

Five main classes of repetitive DNA

Page 660

5. Blocks of tandem repeats

In two exceptional cases, chromosomes lack satellite DNA:

• Saccharomyces cerevisiae (very small centromeres)• Neocentromeres (an ectopic centromere; 60 have been described in human, often associated with disease)

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Gene content of eukaryotic chromosomes

Regulatory regions of eukaryotic chromosomes

Comparison of eukaryotic DNA

Variation in chromosomal DNA

Techniques to measure chromosomal change

Finding genes in eukaryotic DNA

Two of the biggest challenges in understanding anyeukaryotic genome are

• defining what a gene is, and • identifying genes within genomic DNA

Page 662

Finding genes in eukaryotic DNA

Types of genes include

• protein-coding genes• pseudogenes• functional RNA genes

--tRNA transfer RNA--rRNA ribosomal RNA--snoRNA small nucleolar RNA--snRNA small nuclear RNA--miRNA microRNA

Page 662

Finding genes in eukaryotic DNA

RNA genes have diverse and important functions.However, they can be difficult to identify in genomic DNA,because they can be very small, and lack open reading frames that are characteristic of protein-coding genes.

tRNAscan-SE identifies 99 to 100% of tRNA molecules,with a rate of 1 false positive per 15 gigabases.Visit http://lowelab.ucsc.edu/tRNAscan-SE/

Page 662

Finding genes in eukaryotic DNA

Protein-coding genes are relatively easy to find in prokaryotes, because the gene density is high (aboutone gene per kilobase). In eukaryotes, gene density is lower, and exons are interrupted by introns.

There are several kinds of exons:-- noncoding-- initial coding exons-- internal exons-- terminal exons-- some single-exon genes are intronless

Page 663

Fig. 16.16Page 664

Eukaryotic gene prediction algorithms distinguish several kinds of exons

Finding genes in eukaryotic DNA

Algorithms that find protein-coding genes areextrinsic or intrinsic (refer to Chapter 13).

Page 664

Homology-based searches (“extrinsic”) Rely on previously identified genes

Algorithm-based searches (“intrinsic”)Investigate nucleotide composition, open-reading frames, and other intrinsic properties of genomic DNA

DNA

RNA

Mature RNA

protein

intron

Page 664

DNA

RNA

RNA

protein

Extrinsic, homology-based searching: compare genomic DNA to expressed genes (ESTs)

intron

Page 664

DNA

RNA

Intrinsic, algorithm-based searching: Identify open reading frames (ORFs). Compare DNA in exons (unique codon usage) to DNA in introns (unique splices sites)and to noncoding DNA.

Page 664

chimpanzeeDNA

Comparative genomics: Compare gene models between species. (For annotation of the chimpanzee genome reported in 2005, BLAT and BLASTZ searches were used to align the two genomes.)

human DNA

Finding genes in eukaryotic DNA

While ESTs are very helpful in finding genes, beware ofseveral caveats.

-- The quality of EST sequence is sometimes low-- Highly expressed genes are disproportionately represented in many cDNA libraries-- ESTs provide no information on genomic location

Page 665

Finding genes in eukaryotic DNA

Both intrinsic and extrinsic algorithms vary in their ratesof false-positive and false-negative gene identification. Programs such as GENSCAN and Grail account for features such as the nucleotide composition of codingregions, and the presence of signals such as promoter elements. Try using the on-line genome annotation pipelineoffered by Oak Ridge National Laboratory. Google ORNL pipeline, or visithttp://compbio.ornl.gov/tools/pipeline/

Page 665

Oak Ridge National Laboratory (ORNL)offers an on-line annotation pipeline

Finding genes in eukaryotic DNA

We used 100,000 base pairs of human DNA. The pipelinecorrectly identified several exons of RBP4, but failed togenerate a complete gene model.

As another example, initial annotation of the rice genomeyielded over 75,000 gene predictions, only 53,000 of whichwere complete (having initial and terminal exons). Also,it is very difficult to accurately identify exon-intron boundaries.

Estimates of gene content improve dramatically whenfinished (rather than draft) sequence is analyzed.

EGASP: the human ENCODE Genome Annotation Assessment Project

EGASP goals:

[1] Assess of the accuracy of computational methods to predict protein coding genes. 18 groups competed to make gene predictions, blind; these were evaluated relative to reference annotations generated by the GENCODE project.

[2] Assess of the completeness of the current human genome annotations as represented in the ENCODE regions.

Page 666

UCSC: tracks for Gencode and for various gene prediction algorithms(focus on 50 kb encompassing five globin genes)

JIGSAW

Gencode

Page 667

EGASP: the human ENCODE Genome Annotation Assessment Project

“RESULTS: The best methods had at least one gene transcript correctly predicted for close to 70% of the annotated genes. Nevertheless, the multiple transcript accuracy, taking into account alternative splicing, reached only approximately 40% to 50% accuracy. At the coding nucleotide level, the best programs reached an accuracy of 90% in both sensitivity and specificity. Programs relying on mRNA and protein sequences were the most accurate in reproducing the manually curated annotations. Experimental validation shows that only a very small percentage (3.2%) of the selected 221 computationally predicted exons outside of the existing annotation could be verified.”

Guigo R et al., Genome Biology (2006) 7 Suppl 1: S2.1-31

Page 667

Protein-coding genes in eukaryotic DNA:a new paradox

The C value paradox is answered by the presence of noncoding DNA.

Why are the number of protein-coding genes about the samefor worms, flies, plants, and humans?

This has been called the N-value paradox (number of genes)or the G value paradox (number of genes).

Page 668

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Gene content of eukaryotic chromosomes

Regulatory regions of eukaryotic chromosomes

Comparison of eukaryotic DNA

Variation in chromosomal DNA

Techniques to measure chromosomal change

Transcription factor databases

In addition to identifying repetitive elements and genes,it is also of interest to predict the presence of genomicDNA features such as promoter elements and GC content.

See Table 16.10 (p. 670) for a list of websites that predicttranscription factor binding sites and related sequences.

Page 669

http://www.sanger.ac.uk/Users/td2/eponine

Eponine predicts transcription start sites in promoter regions. The algorithm uses a set of DNA weight matrices recognizing sequence motifs that are associated with a position distribution relative to the transcription start site. The model is as follows:

The specificity is good (~70%), and the positional accuracy is excellent. The program identifies ~50% of TSSs—although it does not always know the direction of transcription.

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Gene content of eukaryotic chromosomes

Regulatory regions of eukaryotic chromosomes

Comparison of eukaryotic DNA

Variation in chromosomal DNA

Techniques to measure chromosomal change

Comparison of eukaryotic DNA: PipMaker and VISTA

In studying genomes, it is important to align large segments of DNA.

PipMaker and VISTA are two tools for sequence alignmentand visualization. They show conserved segments, including the order and orientation of conserved elements. They also display large-scale genomic changes (inversions, rearrangements, duplications).

Try VISTA (http://www-gsd.lbl.gov/vista) or PipMaker(http://bio.cse.psu.edu/pipmaker) with genomic DNAfrom Hs10 and Mm19 (containing RBP4).

Page 673

VISTA offers comparative analysis of genomes

Fig. ~16.22Page 674

VISTA output for an alignment of human beta globin region with seven vertebrates

conservednoncoding

codingexon

VISTA analysis of HBB gene locus

UTR

VISTA allows comparison of conserved transcription factor binding sites

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Gene content of eukaryotic chromosomes

Regulatory regions of eukaryotic chromosomes

Comparison of eukaryotic DNA

Variation in chromosomal DNA

Techniques to measure chromosomal change

The spectrum of variation

Category of variation Size typeSingle base pair changes 1 bp SNPs,

point mutationsSmall insertions/deletions 1 – 50 bpShort tandem repeats 1 – 500 bp microsatellitesFine-scale structural var. 50 bp – 5 kb del, dup, inv

tandem repeatsRetroelement insertions 0.3 – 10 kb SINEs, LINEs

LTRs, ERVsIntermediate-scale struct. 5 kb – 50 kb del, dup, inv,

tandem repeatsLarge-scale structural var. 50 kb – 5 Mb del, dup, inv, large

tandem repeatsChromosomal variation >>5Mb aneuploidy

Adapted from Sharp AJ et al. (2006) Annu Rev Genomics Hum Genet 7:407-42

Eukaryotic chromosomes can be dynamic

Chromosomes can be highly dynamic, in several ways.

• Whole genome duplication (autopolyploidy) can occur, as in yeast (Chapter 15) and some plants.• The genomes of two distinct species can merge, as in the mule (male donkey, 2n = 62 and female horse, 2n = 64)• An individual can acquire an extra copy of a chromosome (e.g. Down syndrome, TS13, TS18)• Chromosomes can fuse; e.g. human chromosome 2 derives from a fusion of two ancestral primate chromosomes• Chromosomal regions can be inverted (hemophilia A)• Portions of chromosomes can be deleted (e.g. D11q syndrome)• Segmental and other duplications occur• Chromatin diminution can occur (Ascaris)

Page 675

Conservative nature of chromosome evolution

Among placental mammals, the number of diploid chromosomes is:

84 in black rhinoceros46 in Homo sapiens17 in two rodent species

The process of chromosome evolution tends to remain conservative. Heterozygous carriers of most types of chromosomal rearrangements are semisterile. Thus many chromosomal changes cannot be fixed.

Ohno (1970) p. 41

Inversions in chromosome evolution

Chromosomal inversions occur when a fragment of a chromosome breaks at two places, inverts, and is reinserted. This is a useful mechanism for producing a sterility barrier during speciation. An example is in deer mice; another example is in Anopheles gambiae.

Ohno (1970) p. 42

The eukaryotic chromosome: Robertsonian fusioncreates one metacentric by fusion of two acrocentrics

Translocations occur when chromosomal material is exchanged between two non-homologous chromosomes. Roberstonian fusion, which often accompanies speciation, is the creation of one metacentric chromosome by the centric fusion of two acrocentrics.

Robertsonian fusions are often tolerated and may sometimes be considered selectively neutral. An example is the house mouse (Mus musculus, 2n = 40) and a small group of tobacco mice in Switzerland (Mus poschiavinus, 2n = 26). Mus poschiavinus is homozygous for seven Robertsonian fusions.

Page 675; Ohno (1970) p. 43

The eukaryotic chromosome: Robertsonian fusioncreates one metacentric by fusion of two acrocentrics

Ohno (1970) Plate II

ordinary male house mouse (Mus musculus, 2n = 40)

male tobacco mouse (Mus poschiavinus, 2n = 26)

Male first meiotic metaphase from an interspecific F1-hbrid. Note seven trivalents (each from one poschiavinus metacentric and two musculus acrocentrics)

Diploidization of the tetraploid

Ohno (1970) pp 98- 101

A species can become tetraploid. All loci are duplicated, and what was formerly the diploid chromosome complement is now the haploid set of the genome.

Polyploid evolution occurs commonly in plants. For example, in the cereal plant SorghumS. versicolor (diploid) 2n = 2 x 5; 10 chromosomesS. sudanense (tetraploid) 4n = 4 x 5; 20 chromosomesS. halepense (octoplooid) 8n = 8 x 5; 40 chromosomes

In plants, the male sex organ (stamen) and female organ (pistil or carpel) is present in the same flower; they are hermaphroditic.

Diploidization of the tetraploid

Ohno (1970) pp 98- 101

Polyploid evolution occurs rarely in vertebrates and other metazoans. For diploid organisms with XY/XX sex determination, in tetraploidy the male must maintain 4AXXYY and the female 4AXXXX. But during meiosis of the 4AXXYY male, the four sex elements may pair off as the XX bivalent and the YY bivalent such that every gamete is 2AXY. All offspring of the tetraploid male and tetraploid female would be 4AXXXY. If this were male, there would be no females. The 4AXXYY male cannot produce the necessary two classes of gametes, 2AXX and 2AYY.

Mammals, birds, and reptiles are thus not polyploid.

Tetraploidy: Odontophyrynus americanus is a newly arisen bisexual autotetraploid vertebrate

Ohno (1970) pp 98- 101

Polyploid evolution can occur in fish and amphibians, because of differences in sex determination (X and Y in males, Z and W in females).

Autopolyploidy: in a diploid organism, two daughter cells at the end of mitotic telophase may fuse into one cell, forming a tetraploid cell. Two diploid gametes may produce a tetraploid zygote.

Allopolyploidy: interspecies polyploidy.

Tetraploidy: Odontophyrynus americanus is a newly arisen bisexual autotetraploid vertebrate

Ohno (1970) pp 98- 101

South American frogs species of the family Ceratophyrydidae may be autopolyploids. The diploid chromosome number has a wide range:

O. cultripes 22 chromosomes 11 bivalents in meiosis

O. americanus 44 chromosomes 11 quadrivalents in meiosis

other species of this family110 chromosomes

Ohno (1970) plate III; p. 100

Karyotype of the tetraploid frog Odontophrynus americanus (4n = 44)

44 chromosomes: 11 sets offour homologs

sperm head

two bivalents

ten quadrivalents

Diploidization of the tetraploid

Ohno (1970) p. 102

As an autotetraploid arises, it has four homologous chromosomes for each linkage group. These must change to a disomic state to allow functional diversification of the loci. If the four homologues form a quadrivalent, there cannot be functional diversification. Two distinct, separate bivalents must form, for example via a pericentric inversion.

In fish of the suborder Salmonoidea, trout, salmon, whitefish and graylings are probably autotetraploid species.

Ohno (1970) plate IV; p. 102

Karyotypes of a species in the process of diploidization:rainbow trout Salmo irideus

Liver cell61 chromosomes

43 metacentrics18 acrocentrics

104 chrom. arms

Spleen cell59 chromosomes

45 metacentrics14 acrocentrics

104 chrom. arms

4 quadrivalents 1 quadrivalent

Trisomy and polysomy

Ohno (1970) p. 107

Nondisjunction results in two chromatids of one chromosome moving to the same division pole. In diploid species, one daughter cell receives three homologous chromosomes (trisomy). If this occurs in germ cells, the progeny may be trisomic.

In the Jimson weed (Datura stramonium) trisomy for each of the 12 chromosomes was observed by Blakeslee (1930). A mating between trisomic individuals may produce tetrasomic progeny having two homologous chromosomes (thus duplicating an entire chromosome).

Trisomy and polysomy

Ohno (1970) p. 107

For vertebrates, this mechanism is too severe. Generally, only trisomy of chromosomes 13, 18, or 21 are compatible with postnatal survival in humans.

In rainbow trout that have become tetraploid, trisomy (i.e. from four to five copies) and monosomy (i.e. from four to three copies) may be tolerated.

Outline: eukaryotic chromosomes

General features of eukaryotic chromosomes

Repetitive DNA content of eukaryotic genomes

Gene content of eukaryotic chromosomes

Regulatory regions of eukaryotic chromosomes

Comparison of eukaryotic DNA

Variation in chromosomal DNA

Techniques to measure chromosomal change

top related