the biotechnology of cannabis sativa (full text) april ...€¦ · the biotechnology of cannabis...
Post on 29-Jun-2020
6 Views
Preview:
TRANSCRIPT
The Biotechnology of Cannabis sativa (Full Text)
Sam R. Zwenger
April, 2009
stem
callus
[7
transgenic Cannabis rooting
This book is dedicated to the future of humankind. Please distribute it at no
charge.
"I smoke pot, and I like it."
-Anonymous
Table of Contents:
Introduction
1. The Botany of Cannabis sativa
2. Plant Biotechnology
3. Tissue Culture
4. Agrobacterium tumefaciens
5. The GFP Leaf
6. Woody Cannabis
7. Terpene Production
8. The THC Pathway
9. Smoking Roses and Other Proposals
10. Cannabis DNA Sequencing
11. Molecular Tools
12. Marijuana Laws, Regulations, and Education
Appendix A: Representative list of interesting genes to be used for
Cannabis transformation.
Appendix B: Vendors of biotechnology equipment and reagents.
Glossary
Introduction
Marijuana, whose scientific name is Cannabis sativa, is perhaps the most
famous plant
ever discovered by humans. Since its discovery it has been used by millions
of people for
both inducing pleasure and alleviating pain. Cannabis has a rich history,
complex biology
and a fascinating physiology.
Molecular biology and plant biotechnology are only beginning to uncover the
secrets of
this plant. Scientists now have the opportunity to grow Cannabis plants in
vitro (in a test
tube or Petri dish), thereby being able to genetically modify these plants in
dozens of
ways. Fluorescent Cannabis, THC-producing roses, Cannabis that climbs like a
vine, and
phenomenal increases in branch number and flower size are only a few of the
ways in
which this plant can be enhanced through biotechnology.
Many would benefit from Cannabis biotechnology. For example, producing
genetically
transformed, THC-containing weed species might be an effective way to bypass
legal
issues and still allow sufferers of chronic illnesses to self-medicate. In
other words, with
biotechnology the legalities concerning Cannabis cultivation diminish. Within
the next
few years, through biotechnology, a surrogate plant will soon be created that
synthesizes
THC. This might lead some policy makers to increase their vigilance against
the THC
molecule itself. Conversely, they may finally put their war on this
beneficial plant to rest.
The purpose of this book gives insight into the possibilities that
biotechnology can
provide to the Cannabis community and the world. It begins with a botanical
introduction
and continues with an explanation of biotechnology and techniques, examples
and
purpose for genetically modifying Cannabis, THC biosynthesis and cellular
interaction,
and information on some necessary molecular biology techniques.
The tools of biotechnology, such as DNA sequencing and gene cloning, are
speeding up
the reality that this highly controversial plant will continue to make an
impact on human
societies for generations to come. This book covers advances and techniques
on how to
grow plant tissue in vitro, genetically modify this tissue, and re-grow it in
order to
produce a transgenic Cannabis plant. Anyone who wants to know what the future
holds
for Cannabis sativa and marijuana should read this book.
1. The Botany of Cannabis sativa
Before explaining the features of plant biotechnology, it is important to
have an
understanding about what parts of the plant may be genetically modified.
Therefore, by
introducing some concepts in plant anatomy and physiology, this chapter
serves as a
platform for how a biotechnology experiment may modify the Cannabis plant.
Within the great diversity of life there exists the plant kingdom. This
kingdom covers a
vast array of different species, some used by humans and others not yet
discovered or
their potentials unrealized. The plant kingdom is unlike the animal and fungi
kingdoms.
Plants make their own carbon compounds, such as sugars and starches, through
their
ability to perform photosynthesis. They do this via intricate biochemical
machinery that
has developed through more than 2 billion years of evolutionary forces.
The evolution of Cannabis represents a fascinating phenomenon. Early in the
evolution
of life on earth, some floating cells in the ocean swallowed tinnier cells.
This lead to the
theory of endosymbiosis, which states that these prehistoric larger cells
were unable to
digest the smaller cells they had engulfed (Reyes-Prieto et al., 2007). This
process
explains why plants have both chloroplasts (for photosynthesis) and
mitochondria (for
respiration). Both of these organelles are easily observed with any compound
microscope
and represent living proof of the past event of endosymbiosis.
Grasses'! DM YA
Evolution
Photos vnthetic bacteria 3.5BYA Land plants 3S0MYA
I I
Cannabis -34MYA
J ,
origins of Earth 4.5b YA AriRiosperms 130MYA Humans -2MYA
This timeline shows that Cannabis is thought to have first arisen about 34
million
years ago based on work by McPartland and Nicholson (2003).
Thus, evolutionary change through time has pushed plants, like other
organisms, to
become very efficient in their environmental interactions. Plants stand out
from other
organisms not only because they do photosynthesis, but also because they have
a cell
wall with depositions of cellulose, an incredibly large carbohydrate that
functions like
rebar in concrete slabs. This is one reason that plants were able to make the
transition
from water to land; they had better cellular structures (i.e., a rigid cell
wall) to hold
themselves upright. The development of lignin, the compound that gives wood
its
characteristic strength, came later in evolution and gave plants an added
benefit for living
on land.
However the fundamental distinguishing characteristic, which sets plants
apart from all
other organisms, is their alternating life cycles between a diploid
sporophyte and a
haploid gametophyte. Diploid means that an organism has two copies of each
chromosome and haploid means it has only one copy of each chromosome. These
alternate between the organism and its reproductive cells. Hence, plants have
an
alternation of generations. The large pine that might be observed in a city
park or a
neighbor's front yard is the diploid spore-bearing generation. The pollen you
see in the
spring is the haploid gametophyte.
With this considered, the Cannabis plant is a sporophyte that releases
gametes, which
includes the pollen. When pollen is released its main objective is to
fertilize the ovule,
which upon fusing together, yields a diploid embryo. Wondering how plants to
new areas
then, it follows that the marijuana embryo develops into a mature storage
capsule (a seed)
that can be transported by birds, or in some cases, the postal service. This
is, of course,
with the gracious assistance of seed companies.
The plant kingdom is nicely divided into many subdivisions, but perhaps the
most
important one to many plant taxonomists is the family level. Plant families
include the
sunflower family (Asteraceae), the bean family (Leguminosae), and the grass
family
(Poaceae). There are more than 300 plant families but the one we will concern
ourselves
with, at least in this book, is the hops and cannabis family (Cannabaceae).
Domain
Eukaryota
Eukaryota
Kingdom
Planta
Animalia
Phylum
Angiosprems
Chordata
Class
Dicotyledones
Mammalia
Order
Cannabales
Primates
Family
Canabaceae
Hominidae
Genus
Cannabis
Homo
species
C. sativa
H. sapiens
Comparison of how marijuana and humans are placed according to current
biological classification.
The Cannabaceae family is composed of two genera. Humulus, the plant used for
making
beer taste "hoppy", has two species within its genus. The genus Cannabis has
only one
species C. sativa. However, this has been greatly debated. Some researchers
argue that a
second species originating in India (C. indica) is a valid species. Others
content that C
indica is a subspecies and should be treated as a variety rather than an
independent
species. Years ago, the wild type variety of hemp was referred to as C
ruderalis. The
origins of Cannabis have been examined using genetic tools (Mukherjee et al.,
2008).
Because much of the debate continues on how many species of Cannabis exist,
we will
leave it to rest for the time being.
One reason Humulus and Cannabis are placed in the same family is that hops
and
marijuana both grow in similar sexual morphs. They are dioecious plants,
which means
they have separate male and female flowers. Dioecy occurs in -5% of flowering
plants
(Thomson, 2006).
Nearly three-fourths of flowering plants have perfect flowers, due to having
both male
(stamens) and female (pistil) parts within the same flower. Strangely,
Cannabis and a few
other plants are outside of this normalcy; their male and female flowers grow
on
completely separate individuals (i.e., they have imperfect flowers). Because
there is a
male plant and a female plant, out-breeding (exchanging genetic material
between non-
related individuals) is maximized, and may be seen as an evolutionary
advantage because
it allows for more genetic diversity.
The female plant is what marijuana smokers are most interested in, unless
they are
sexually propagating a new variety. The male plant is interesting too, from
an
economical, environmental, and agricultural perspective. Indeed, many books
have been
published on hemp (Robinson, 1996; Herer, 2000; Conrad, 1997). However, only
a
limited number of governments have realized the strength of hemp fibers and
have
subsequently allowed industrial production. China is by far the largest
producer of hemp
in the world today (Wang and Shi, 1999)
Hemp is not considered to have large amounts of resin, the material that
contains the
psychoactive compounds most breeders desire. Resin, a sticky and chemically
complex
substance, is often secreted through glandular trichomes on Cannabis leaves
and flower
surfaces. There are two basic types of trichomes, glandular and non-
glandular. Non-
glandular trichomes, in most species, are small, hair-like projections of a
modified
epidermal cell that have evolved to restrict water loss from the leafs
stomatal pores,
which function similarly to the pores in human skin (i.e., they regulate
internal
temperature). Although stomata often serve to transpire water vapor from the
organism
and thus, facilitate a cooling effect, the plant eventually loses this water
to the
atmosphere. The process of transpiration also helps distribute soil ions,
water, and
nutrients through the plant. When plants lose water they eventually need
additional water
at a later time for growth and cellular processes. Therefore to reduce this
loss, non-
glandular trichomes help retain at least some of the plant's water before it
leaves the
stomata. Often plants that are adapted to arid or dry habitats are covered
with non-
glandular trichomes.
Most important to Cannabis cultivators are glandular trichomes. These too are
modified
epidermal cells but function in secreting resin. There are many functions of
the resin.
Some have asserted that it aids in capturing pollen, however there is
presently no research
that supports this belief. It seems more logical, and in fact has been
correctly asserted,
that resin plays some role in attracting pollinators for the flower
(Armbruster, 1984).
For example, if the female Cannabis is kept free from pollination, glandular
trichomes
will secrete more resin. The subsequent resin production attracts pollinators
through this
method. The sticky resin secreted by the glandular trichomes continues
production as
long as pollen is prohibited from landing on the stigma. Subsequently, this
is the reason
that many Cannabis growers seek to prohibit male plants from interfering with
pollinating their female plants. That is, keeping males plants out of
Cannabis gardens
increases resin production in female plants.
When pollen is used it is often in the form of a controlled crossing
experiment. Crossing
different plant species is difficult because the pollen grain has exterior
surface proteins
that must match up with a genetically compatible female stigma of the same
species,
similar to key fitting into a lock (it simply occurs on a molecular level).
The stigma,
which is the top part of the pistil that the pollen lands on, also has
recognition proteins on
its surface. Sometimes this method is faulty and different plant species by
mistake
successfully interbreed, although this is a rare event.
A typical flower (lily) with bracts labeled. The ovary (not shown) is at the
base
and along with the stigma and style comprises the flower's pistil.
Many genes control resin production. However many genes also control the
genetic path
for plant development. Flowers are no exception to this and many genes have
been
8
identified that play a role in the flowering process. The most popular model
for flower
development is known as the ABC model (Soltis et al, 2007). This is based on
the fact
that there are four whorls in a typical flower. The first whorl is the
sepals. The petals
make up the second whorl and as one travels towards the center of the flower
the next
two whorls are the stamens (male parts) and pistil (female part),
respectively. The flowers
of Cannabis are interesting in themselves in that they lack petals but have
retained their
sepals. Collectively, the sepals are termed the calyx and it is the calyx
that surrounds the
fruit. Within the plant kingdom, various types of fruits exist, the
description of which, is
beyond the scope of this botanical overview. Suffice it to say Cannabis
produces a fruit
called an achene, where the seed and pericarp (outer fruit wall) are attached
at the
funiculus (small stalk).
stamen
i
r
1
SS
pedicel
This shows the basic parts of a typical flower. The pedicel functions as the
stalk of the flower. Different plants have evolved different sizes and
numbers
of each part. For example, a Cannabis flower lacks petals and usually has
male
(stamens) and female (pistil) parts on separate plants.
In many cases, transcription factors are needed to give the signal for
turning a DNA
sequence into a functioning protein. The ABC model describes transcription
factors,
which are proteins that act like an on/off switch for the genes that allow
development of
flower parts. The exact function of the A, B, and C transcription factors has
been
determined through creating mutated plants that have lost various functions
of each of
these genes. By carefully tracking the mutational defects and the associated
observable
trait, the function of each gene has been deciphered. Transcription factors
for floral
development are normally initiated by alternating periods of light and dark,
called the
photoperiod.
Transcription factor
A
B
C
Parts encouraged to grow
Sepals and petals
Petals and stamens
Stamens and carpels
Gene regulators involved in the ABC model of flowering. Each transcription
factor is a small protein that activates other genes, stimulating different
flower parts to develop.
Photoperiod has been shown to play a crucial role in plant flower
development. Indeed,
this is a primary reason Cannabis continues vegetative growth in a light
cycle of 14-16
hours. During the vegetative stage most indoor Cannabis growers keep their
plants on a
long light cycle, in some cases the lights are never turned off. When the
light is decreased
to 12 hours or less key signaling events occur within the plant that trigger
the ABC
transcription factors that allow up-regulation, or turning on, of flowering
genes.
With the diversity of plants on earth (-280 million species) it is a well-
grounded
assumption that each plant species has evolved to respond in a slightly
different way to
varying photoperiods. This partly explains the diversity in strains that have
the ability to
flower early or late. Still, the ABC model of flowering applies to nearly all
plants.
There also exists within Cannabis and other plants a protein called
cytochrome (Bou-
Torrent et al., 2008). Cytochromes are protein molecules that harbor a
chromophore, a
color-absorbing molecule. Depending on the wavelength of light striking the
plant
surface, the phytochromes are converted between different states or forms.
When the
phytochromes receive red light (660nm) they become the Pf r type, which is
active and
allow flowering to proceed. If far-red light (730nm) is detected the
phytochrome becomes
the P r type. The P r type is a biologically inactive form and so flowering
cannot proceed.
An indoor gardener can use this principle to initiate flowering even in a
light cycle of 14
or more hours. During the dark period of a plant's life, they can be given a
brief pulse of
red light. This changes the P r type into the Pf r form and allows flowering
to begin.
Interestingly, these same phytochrome proteins play a crucial role in seed
germination.
10
For instance, the Pf r form of phytochrome allows germination to proceed.
Therefore, if
one is having difficulty germinating recently purchased Cannabis seeds, they
should try
exposing them to a short period of red light before planting them.
Transcription factors and cytochromes are still just part of a larger system
within the
plant cell. Plant hormones are another important part of Cannabis development
and
biochemistry and play a crucial role in its genetic modification. There are
five prominent
classes of plant hormones, which include auxins, cytokinins, gibberellins,
ethylene, and
abscisic acid. An imbalance in any of these can cause strange morphologies
within a
plant (Robert-Seilianiantz et al., 2007). The hormones all act as chemical
regulators of
gene expression and thus, guide development and the morphology (observable
shape) of
Cannabis. After all, the word hormone means "to set motion to".
Indole-3 -acetic acid (IAA) and 2,4-dichlorophenoxyacetic acid (2,4-D) are
perhaps the
most widely known auxins. The amino acid tryptophan is enzymatically modified
to
produce indole-3 -acetic acid. Auxins are commonly found in developing leaves
and
seeds. They function to control apical dominance, which is cell division at a
terminal bud
or stem. They also play an important role in stimulating flowering and fruit
development,
stimulate adventitious roots (growing from the stem) in asexual cuttings
(clones), and can
induce ethylene synthesis.
Cytokinins also have many identified structures, perhaps the most common one
in plants
is zeatin. Cytokinins are synthesized in the roots and are moved through the
xylem to the
shoots to regulate mitosis. Artificial application can induce lateral buds to
branch.
Cytokinins will be discussed later due to their important role in culturing
Cannabis in
vitro. Cytokinins can also cause a delay in leaf senescence.
Gibberellins were used early on in plant experiments. They elicit perhaps one
of the most
dramatic effects on a plant. If two plants are grown in separate pots, side
by side and
gibberellins are applied to one plant, that plant will grow several
magnitudes taller than
the other. Gibberellic acid is one of the most important and common
gibberellins in
plants. Gibberellins are produced from mevalonate, a precursor in synthesis
of terpenes (a
class of plant metabolites). They are found in immature Cannabis leaves and
seeds. In
most species gibberellins help in elongating shoots and regulate some seed
enzymes,
which are proteins that speed up a reaction.
Ethylene (C2H4) is a gas, which functions as a plant hormone. The amino acid
methionine
is the precursor, which leads to formation of ethylene. Because ethylene is a
small
molecule, it can easily move from cell to cell via diffusion. This hormone
gave rise to the
old adage that one bad apple can spoil the whole bunch. Ethylene is most well
known for
hastening fruit ripening. When tomatoes are picked and shipped, they are
green. Just prior
to arrival at the grocery store the tomatoes are sprayed with this gas,
ripening and
reddening the tomato fruits.
Like gibberellins, abscisic acid is also synthesized from mevalonate. It is
an important
regulator of stomates and plays a role in seed dormancy. By applying abscisic
acid to
11
seeds, they can be kept dormant for shipping, so as not to allow them to
mistakenly
sprout.
It should be noted to the reader that only a basic introduction to plant
hormones is
provided here. For example, there are additional classes of plant hormones,
but limited
knowledge exists on their synthesis and function. These include jasmonates,
systemin,
salicylic acid, and the brassinolides. For the purposes of this book, the
focus will be on
auxins and cytokinins, since they are used in plant biotechnology.
In Cannabis tissue culture, auxins and cytokinins are used to control root
and shoot
formation of a young tissue growing in vitro. From a scientific view it is
interesting to
know how Cannabis plants are growing and being maintained within their cells.
Hormones regulate nearly every response and function within the marijuana
plant. Most
importantly, because many synthetic hormones are available for anyone to
purchase,
experiments with Cannabis and any of these plant hormones can easily be
performed by
anyone with a basic understanding of plant biology.
When flowers appear on the plant, more energy is delivered into the flower
cells rather
than the vegetative cells. Plants in nature start to lose their flowers and
begin seed
production each season when their genetic makeup interacts with environmental
cues.
These cues are signaling events that prepare the flower for seed production,
seed
maturation, and eventually plant death (annuals) or dormancy (perennials).
The plant roots are important in taking up minerals, ions, and water. There
exist small
root hairs on the roots to increase surface area. Therefore, when
transferring Cannabis
plants from one container to another, one should be very cautious to keep the
soil-root
interface in tact. Disturbance of this interface diminishes the capability
for the plant to
take up its needed supplies for metabolism.
Polymer
lipids
proteins
carbohydrates
nucleic acids
Monomer(s)
fatty acids, glycerol
amino acids
monosaccharide
nucleotide bases, sugar,
phosphate
Example
cell membrane
THCA synthase
glucose
DNA, RNA
Macromolecules of life divided into their monomer subunits and
representative examples.
Metabolism includes both breaking down materials (catabolism) and building
materials
(anabolism). These processes are needed to construct new cells and cellular
structures
such as organelles (e.g., mitochondria and chloroplasts). Cellular structures
are either
12
made up of lipids, proteins, carbohydrates, or nucleic acids. Each of these
four large
molecules necessary for life is found in every living organism and vary in
their
arrangement and concentration. Each is also a polymer (multiple units)
composed of
smaller monomers (single units).
Light gives plants the ability to make their own food through the process of
photosynthesis. The chromophore (absorbing pigment) in plant chloroplasts
that captures
light is chlorophyll. This molecule absorbs strongly at the red and blue ends
of the visible
light spectrum. This spectrum represents part of a larger electromagnetic
spectrum. Since
energy travels in waves, this spectrum is divided according to its
wavelength. Visible
light ranges from -400-700 nanometers (nm), where one nanometer is a
billionth of a
meter. That's pretty damn tiny! Plants have a difficult time using
wavelengths in the
middle of the visible spectrum (~500nm), which is reflected and seen by most
humans as
the color green.
Perhaps the most important and familiar structure in the Cannabis plant is
the nucleus.
This is the organelle that houses the DNA. Cannabis has twenty chromosomes
and is
diploid. This means that it has two copies of each chromosome. By comparison,
humans
have 23 chromosomes and are diploid. Genes along the DNA strand code for the
proteins
that direct cellular development, flower development, etc. This is discussed
in more detail
later, since it deserves its own chapter.
All of these botanical features and how they relate to Cannabis have not been
described
in vain. They serve as a platform for the remainder of this book and
facilitate a robust
background to host extending ideas on the genetic modification of Cannabis.
13
2. Plant Biotechnology
In many ways plant biotechnology first began when humans initiated
cultivating and
genetically crossing varieties of plant species to intentionally produce
desired results. For
example, imagine a human ten thousand years ago collecting the pollen from a
wheat
plant that was slightly taller then the other wheat plants then dusting this
onto the female
flowers of other wheat plants. Over many years of collecting and dusting
pollen from the
tall offspring and putting this pollen onto more wheat plants, most of the
wheat plants
would be tall.
Nearly every crop food eaten today, including tomatoes, rice, potatoes, corn,
barley,
apples, etc., all began as very strange looking varieties of undomesticated
plants
thousands of years ago. Only when people recognized that there were patterns
of
inheritance did they begin spreading select genes to other plants. Although
the primitive
state (short height and small fruit size) of food crops offered our ancestors
some gain in
nutrition, the capability to produce more food (taller height and large fruit
size) has been
constantly pushed to the limits. Recent gains in realizing the genetic
components of crop
species has led to a broader understanding of how foods have been improved
over time
(Vaughan et al., 2007).
In fact most scientists today have optimistic views on food production. With
biotechnology there are few limits as to what sort of food can be grown. This
means the
boundaries of plant genetic manipulation are still expanding. Biotechnology
today is what
applying pollen onto flowers was for humans thousands of years ago. It has
allowed our
species to gain larger yields of food on smaller areas of land.
The same basic ideas and patterns of inheritance of crop production have been
applied to
marijuana plants. It logically follows that biotechnology should also be
applied to
Cannabis crops. There are many benefits that biotechnology can offer Cannabis
growers,
whether they are indoor or outdoor growers. The details of how this can be
accomplished
are fairly basic but require a fundamental understanding of plant
biotechnology to at least
have an intelligent conversation or carry out a reliable experiment. As
stated by Albert
Einstein, imagination can be more powerful than knowledge. However
imagination is
cultivated more easily through concepts of knowledge, making both imagination
and
knowledge necessary for maximum progress.
One of the most fundamental components of plant biotechnology is the ability
to
introduce foreign genes. Most high school students have seen the image of a
glowing
tobacco (Nicotiana tobaccum) plant. This marked an important event in plant
biotechnology in that it stimulated public interest and created a deeper
curiosity for plant
transgenics. Prior to fluorescing tobacco, people in the United States were
introduced to
the Flavr Savr tomato, one of the first genetically modified foods introduced
to
consumers (Marks, 2007). Boasted as having a longer shelf life in grocery
stores, the
Flavr Savr tomato had little taste and left little to savor. This transgenic
tomato remained
a poor seller on the market and so was pulled from shelves and discontinued.
14
Among the agricultural industry, perhaps the most popularized gene that has
been
introduced to plants is the gene that produces an insect toxin (Romeis et
al., 2006). The
toxin, called Bt, is only toxic to certain insects and has no negative
effects on humans.
Insects and humans have different proteins lining their digestive tracts. It
was one of
these proteins to which the Bt toxin could bind to in insects. Humans lack
this protein in
their digestive tract, and thus the toxin cannot bind and disrupt metabolism
the way it
does in insects. This was the main reason it was allowed into corn plants.
Researchers
subsequently found that insects avoided eating transgenic crop plants with
the Bt gene, so
the plants were able to be grown without pesticide or stress from insect
infestations. This
provided a huge savings to farmers who were commonly spraying their fields
with
expensive pesticides. It also reduced the amount of chemicals going into the
croplands.
In another example, quite different than the Bt gene, researchers have put
genes into
plants that made them resistant to pesticides, which also grabbed the
attention of the
agriculture industry. To give a specific example, the herbicide called
glyphosate
(Roundup) kills plants but does not harm animals. Roundup kills plants by
inhibiting a
metabolic pathway that only plants have (the pathway to make aromatic amino
acids). So
when scientists put the Roundup resistance gene into crop plants, they gave
it resistance
to the herbicide. When farmers sprayed with the Roundup pesticide, they did
not kill their
crop plants. Instead, all other plants that did not have the Roundup
resistance gene died,
including petulant weeds and unwanted invasive plants. The result was a happy
crop
plant with no weedy competitors. This biotechnology advancement was so
successful that
soybean and corn with Roundup resistance gene are now the most abundant
transgenic
food crops grown in the US.
The US has been quick to embrace transgenic crops. Other countries have not
been so
quick. At least part of this is due to the work of environmental groups such
as Green
Peace, who is strongly opposed to GM (genetically modified) crops. Groups
such as
Green Peace argue that some of these genes that are put into the plants can
behave in
unpredictable ways. For example, suppose a person were to plant transgenic
corn that had
the Roundup gene. Since all corn releases pollen during its flowering stage,
that pollen
carries the gene for Roundup resistance. If the pollen with this gene were to
then become
incorporated into a weedy or invasive plant species, there may be some
concern. Imagine
a farmer that uses Roundup corn and then when they go to spray to kill the
weeds, they
find that the weeds will not die; they have acquired the resistance to the
pesticide. It has
been argued that the accidental incorporation of the resistance gene may
produce such
"super weeds".
Groups such as Green Peace often give both of these scenarios; transgenic Bt
crops
killing beneficial insects or herbicide resistance genes being incorporated
into other
plants to make "superweeds". The process of genes migrating from genetically
modified
plants into other non-genetically modified plants is known as gene pollution.
Certainly
genetic pollution of the environment should be a concern. The emergence of
transgenic
weeds that are resistant to an herbicide is not desirable by either the
farmers or the
corporations selling the herbicides. In fact, preventing weedy plants from
acquiring the
pesticide resistance genes is a major goal of agricultural biotechnology
industries. This is
15
because they have a vested interest in assuring that their pesticide
continues to retain its
effectiveness.
Arguably, genetically modified crops need more research in order to
understand their
complete role and influence on the natural environment. However, many
countries have
moved ahead, confident that genetically modified crops are the best way to
obtain food
and other raw materials such as cotton. Based on current statistics the
United States is by
far the largest producer of transgenic crops (James, 2005). Argentina,
Brazil, Paraguay,
and Canada are the next largest producers. Cotton is the most common
transgenic non-
food crop while soybean is the largest transgenic food crop (Stewart, 2008).
The great majority of plant genetic research and information on plant
biotechnology in
the last few decades was aided with a small mustard plant called Arabidopsis
thaliana.
Many researchers like Arabidopsis because it offers a short life cycle of
about six weeks
from seed to maturity, is easy to grow, is small and therefore easy to work
with, and has a
small genome (-157 Mbp) (Johnston et al., 2005). An organism's genome is the
complete
set of genes, which all reside on the chromosomes, that it posses.
Arabidopsis has served
as a model organism quite well, so well in fact, plant researchers around the
world use it
for genetic, developmental, and evolutionary studies.
The model plant Arabidopsis thaliana. This small mustard plant is used
extensively in genetic studies for understanding traits of the plant kingdom.
There has been a wealth of information from this little mustard plant.
Fortunately, much
that has been learned from Arabidopsis can be applied to Cannabis. There are
many
genes that have been identified in Arabidopsis that are now waiting to be
found in
16
Cannabis (see Appendix A). Once these genes are found in Cannabis (called
homologous
genes), they can be manipulated and induced to have a higher expression rate
or knocked
out of the plant altogether. The result will be a plant of almost any form,
with any trait
desirable. These genes are more exciting than the genes that stop insect
damage or
provide herbicide resistance. In fact, the most difficult part of genetically
modifying
Cannabis is going to be deciding on which gene to manipulate! The process of
creating a
transgenic plant can often be tedious and time consuming. Fortunately, there
only needs
to be one person to make transgenic Cannabis plants and then the seeds can be
shared
with others. Regardless, it is important to understand the process of making
a transgenic
Cannabis plant.
17
3. Plant Tissue Culture
Tissue culture is a method where living tissue is sustained apart from an
entire organism.
It allows for growing organs (i.e. roots) or cell masses in vitro, which
literally means, "in
glass". This requires the tissues be placed on a special growth media that
contains all the
necessary ions and sugars to sustain its growth and energy needs. This is
called plant
tissue culture. Fortunately for plant biotechnologists, plant tissues grown
on this type of
media are also very susceptible to taking up foreign DNA. This is how
transgenic plants
are often created.
Plant tissue culture has emerged as a way to genetically modify crop plants;
hence many
techniques are available for specific species (Smith, 2008). There are three
well-
understood methods for delivering a foreign gene into a plant. These are the
floral dip,
the gene gun, and the bacteria, Agrobacterium tumefaciens. Each has
advantages and
disadvantages and varies in use among institutions and researchers.
The floral dip is the easiest way to insert a foreign gene. When Arabidopsis
is flowering,
it can be dipped upside down into a liquid broth culture of Agrobacterium.
Agrobacterium is a special type of bacteria that is able to transfer its DNA
to the plant
(discussed more later). This means that some of the Arabidopsis flowers will
be infected
with the Agrobacterium DNA. The floral dip is most commonly performed only
with
Arabidopsis. Limited information exists on its efficacy on other plants.
Considering the
size that Cannabis can become, this method may not be desirable. However,
empirical
research is needed before this claim can be justified.
The second mode of introducing genes into plants is through the use of a gene
gun. This
is a device that shoots microscopic metallic beads that are covered in a
gene. The metal
beads are shot at a high enough velocity into a living plant so that some of
the beads
penetrate the plant cell nucleus and the genes on the beads are incorporated
into the plant
genome. The device costs a fortune (~15,000USD) and is therefore not used by
the
majority of labs.
Perhaps the most pragmatic and cost-effective method of introducing a gene
circles
around plant tissue culture. This method of plant transformation has proven
to be quite
useful for many different species of plants. Although it takes many months
from the start
tissue culture to the final product of a genetically modified plant, the
method is very
affordable and most labs can accommodate the technical requirements. This
method is
also the oldest of the three gene delivery methods, having its beginnings in
the early
1900's in Germany from work by Heldebrant (Thorpe, 2007).
Successful transfer of a foreign gene using plant tissue culture depends on a
bacterium
known as Agrobacterium. The way Agrobacterium works is described in the next
chapter
so will not be discussed in detail here. For now, it is important to know
some plant
physiology pertaining to plant tissue culture.
18
Plants have a meristematic region where cell division is actively occurring.
The meristem
is similar to the stem cells of humans in that they can divide many times.
This tissue also
has what is called totipotency, which is the ability to divide and develop
into any plant
cell type. Tissue culture takes advantage of meristems by allowing the
researcher to grow
a piece of stem on sterile growth media, which supports the meristematic
tissue's
nutritional and energy needs.
Plant meristems play an important role in not only biotechnology but also
plant
biology. These areas within plant tissues are commonly found on the tips or
stems
and roots. Perhaps the most familiar type of meristem is aptly called the
apical
meristem. Apical simply refers to the location of the tissue; it is found on
the plant's
apex (or ends). Dividing cells within the root apical meristem are what allow
the
plant root to grow farther down into the soil. Similarly, the shoot apical
meristem
allows for vertical growth, or tallness, of the plant. When Cannabis
elongates its
roots and shoots the apical meristems act as guiding forces.
Another meristematic region is known as the lateral meristem. While they are
similar in harboring actively dividing cells, lateral meristems differ from
apical
meristems by providing lateral growth. The cell division is occurring just
under the
plant's epidermal tissues along stems and branches, hence it increases the
thickness
of these parts. For instance, lateral meristems in Cannabis give the plant
sturdiness
and ability to hold large flowers later in its life cycle. Cannabis growers
who have
selected for incredibly large buds often desire thick lateral meristems in
order to
keep their plants from falling over.
Meristems are hormonally controlled by auxin. Therefore, changing the plants
auxin
levels involved in signaling affects its meristematic regions. The auxin acts
locally on
the apical meristem by inducing cell division but when it travels to other
bud
regions, the auxin inhibits them from growing. In the realm of plant
physiology this
mechanism is called apical dominance, and is the main reason that plants
often grow
taller than wide. If a person was to remove the dominant apical meristem (the
tip of
the longest part of the main branch), lateral buds would be allowed to
develop and
the plant would take on a bushy appearance.
The lateral meristem is perhaps the most important meristem used in to plant
biotechnology. Again, this is because the lateral meristem that contains the
totipotent
actively dividing cells. It is these cells that are allowed to grow on plant
tissue culture
Petri plates.
19
Two types of culture methods for growing plant tissue in vitro, a traditional
Petri dish on the left and a Magenta culture box on the right. The Magenta
box
is like a tall Petri dish that maintains sterile conditions and allows
vertical
expansion of a transformed plant.
Just prior to initiating tissue culture, a plant is diced along its stem and
the pieces, called
explants, are placed onto tissue media. Conditions must remain sterile so
that the stem
pieces are not contaminated with microscopic dust particles that often
contain fungal
spores and bacteria. If improper technique is used and sterility is not
achieved, fungal or
bacterial contamination will be obvious in several days to a few weeks.
Because sterility of tissue culture is of the upmost importance, the details
of the technique
need to be described. First, it is highly recommended that the plant stem be
young (4-5
weeks). The Cannabis seedling should also be grown indoors as the outdoor air
is filled
with spores and bacteria that will easily cling to the surface of the cut
plant. If this
happens contamination will be noticeable a few days after the plant has been
diced and
placed onto culture media.
Collection of the stem should be carried out with a few simple tools. A small
tweezers is
used to clasp the plant at the base. Similarly, one might prefer to gently
pinch the top of
the plant to keep it steady. A scissors is used to snip the young plant at
the base. Any
leaves that have developed are trimmed off. Careful attention is given so
that at no time
will the stem come into contact with the soil or any surface. The final
product should be a
20
slender, and preferably straight Cannabis stem. This is placed in a sterile
tube and
capped. After capping the tube the stem is ready to be lightly washed with a
mild
detergent and 70% alcohol solution. These solutions can be directly added to
the tube.
Washing is just as crucial as cutting and trimming the stem. If the wash
steps are too
long, the plant cells will die. If the washes are too short, any microbial
contaminants will
remain and fungus or bacteria will overrun the growth media. Therefore, a
delicate
balance must be achieved to successfully wash the stem without killing the
plant cells.
Generally, an initial wash with 70% alcohol (e.g., 3mL water and 7mL 100%
alcohol for
a total of lOmL) is used with a drop of tween20, a mild detergent. The
detergent is not
always necessary, but it does aid in working the alcohol into the grooves on
the outside of
the stem. The tube is capped and shaken vigorously and allowed to sit at room
temperature for 5 minutes. The tube is washed with sterile water and a second
wash is
implemented in the same fashion as the first wash but without the detergent.
A final wash
with a 1% bleach solution (lmL bleach and 99mL water, using only lOmL of
this) is
preferred in some tissue culture methods, however when dealing with stems
obtained
from indoor-grown plants this may be superfluous.
Sterile water is used for a series of no more than ten rinses to guarantee
that the alcohol
and bleach have been completely washed from the stem. The closed tube is
placed in a
sterile laminar flow hood. If you do not have access to a flow hood, you can
make a
sterile hood-like environment. I have seen these in a few of my friends'
houses who do
experiments at home. However, biotechnology at home is its own endeavor and
will not
be discussed in this book. Tissue culture media should be prepared ahead of
time so the
stem can be carefully removed from the sterile tube, diced and placed onto
the media.
21
A laminar flow hood is used for working in sterile conditions. Sterile air is
moved down from the top and out of the hood on the sides to avoid
contamination by unwanted fungal and bacterial spores.
Preparing the growth media for Cannabis is not as difficult as one may think.
Many
companies sell a powder form of mixed micro and macronutrients, which is
mixed with
water and sterilized.
There are two types of media commonly used in plant tissue culture. The first
is called
callus media. This is because after placing Cannabis meristematic tissue on
it, the
appearance takes on tissue formed over a wound. Because callus media is the
first media
used in a plant tissue culture experiment and it forces the plant tissue to
form a callus, the
media is aptly named callus initiation media.
The second type of media in plant tissue culture is used at a later stage in
the process.
This growth media is called MS media. In the 1970's two researchers whose
last names
were Murashige and Skoog developed this nutrient media (Murashige and Skoog,
1962).
Skoog was an undergraduate working in Dr. Murashige' s lab when he discovered
this
media. It is now called MS media in their honor. Both of these media types
will be
explained in greater detail. For now, concern will be given to proper
preparation of the
media.
22
This table shows the ingredients in MS media, which is needed for growing the
plant tissue from a non-differentiating callus into a callus with roots.
Name of Chemical
Molecular Formula/Description
ammonium nitrate
NH4NO3
calcium chloride
CaCl 2
magnesium sulfate
MgS0 4
manganese sulfate
MgS0 4
Potassium phosphate
KH 2 P0 4
ferrous sulfate
FeS0 4
zinc sulfate
ZnS0 4
potassium nitrate
KNO3
potassium iodide
KI
cupric sulfate
CuS0 4
boric acid'
H3BO3
cobalt chloride
C0CI2
sodium molybdate
Na 2 Mo0 4
niacin
a coenzyme
pyridoxine (vitamin B6)
a coenzyme
ethylenediamine tetra-acetic acid
acts as a metal chelator
inositol
a sugar
thiamine
a coenzyme
glycine
an amino acid
indole acetic acid (IAA)
root hormone
kinetin
shoot hormone
sucrose
a common sugar
agar
solidifies media
23
Callus initiation media and MS media can be ordered from most any web
resource that
deals with biological supplies. As in all other growth media, the contents
are shipped in a
dry state, so they must be weighed and mixed with the appropriate amount of
deionized
water. Deionized water is important to use because chlorine and other ions in
tap water
may interfere with the growth of the explants. After measuring the proper
amount of
deionized water, the contents of the media mixture (water and dry media
powder) are
stirred and autoclaved.
The autoclave is an oven-like chamber that reaches high pressure and
temperatures. The
highest temperature most autoclaves reach is 121°C/250°F. Such high
temperatures are
needed because boiling sometimes does not kills bacterial endospores, a type
of survival
state used by some bacteria. Prior to autoclaving, agar is also added to the
media mixture.
Agar acts as a solidifying agent when the media cools. This too is a powder
and is
weighed, usually adding 15 grams per Liter of water. Upon adding and mixing
all
ingredients, the opening of the flask or glass container must be covered with
aluminum
foil.
24
The autoclave is a large oven-like chamber, which is used to sterilize lab
equipment.
After the mixture of water, plant nutrients and agar is autoclaved it is
allowed to cool
inside a laminar flow hood. The laminar flow hood creates a negative pressure
that aids in
25
keeping the work area sterile. Above the working area, sterile air is blown
down. The
flow of air is aided by perforations in the back of the hood and lower front
part of the
hood opening that pull on the flowing air.
It is important to remember that the laminar flow hood is the only safe place
for carrying
out any work that must be kept free from contamination. Petri dishes are
often purchased
in bulk, so that media can be made on demand and MS media plates can be used
when
needed. These Petri dishes are disposable, however reusable glass Petri
dishes are
available.
Some of the basic materials needed to begin Cannabis transformation; 1)
Erlenmeyer flask, 2) graduated cylinder, 3) MS and callus media, 4) agar, 5)
parafilm, 6) Petri dishes, 7) scale, 8) tweezers and small scissors, 9)
antibiotic.
Pouring plates is the method of removing the Petri dishes from a clear
plastic sleeve,
making stacks of 4-5 plates (i.e., Petri dishes), and carefully opening them
one at a time
(starting from the bottom of the stack) while pouring molten media into each
plate. It is
one of the first techniques a new lab student learns. Only about 10-20mL of
media is
needed for each plate, which is just more than enough to cover the bottom
surface of the
plate. Callus media is used in the first part of the experiment, however
these techniques
apply to MS media (used later in tissue culture) as well.
26
The media used to culture calluses of Cannabis has yet to be published in any
scientific journal. However, a recipe that has worked well for many plants is
carrot
callus initiation media. Similar media can also be used for shoot initiation,
which is
called carrot shoot development media. Both of these can be ordered online
from
Carolina Biological Supply (see appendix B). This company provides premixed
packets of dry media, which can be poured, along with dry agar, into a Liter
of water.
After autoclaving the hot liquid media is poured into the Petri dishes, as
just
described.
The plates are then carefully lifted one at a time from the stack and laid
out inside the
laminar flow hood in a grid-like fashion. As they are placed onto the surface
of the flow
hood, the lids are slightly tipped to the side to allow the media to cool
faster and excess
moisture to escape. During placement and movement of the plates containing
molten
media it is important to not splash media onto the inside lid of the plate.
If this happens, it
increases the chance for contamination when working with the plates at a
later time.
When the plates have cooled the lids are tipped correctly back into place and
they are
restacked into one column. The sleeve is placed back on top of them and they
are covered
and the entire contents can be inverted and are kept refrigerated at
4°C/39°F. The entire
process of making media and pouring plates takes approximately 2 hours,
although the
time is greatly reduced with practice.
Which brings us back to the sterile tube with the Cannabis stem. The tissue
culture plates
with the media should be made the day before the stem clipping and washing
steps. Prior
to preparing the stem, the sterile plates should be removed from the
refrigerator and
placed inside the flow hood. Inside the laminar flow hood there should also
be a small
sterile scissors and tweezers. These should both be autoclaved, usually
wrapped in
aluminum foil, to guarantee their sterility, and then opened only in the flow
hood. In fact,
these items can be autoclaved along with the media.
There should also be an alcohol dish and a flame. Before use, the ends of the
scissors and
tweezers are dipped in the alcohol after which the alcohol is burned off.
Keeping them
from touching any part of the hood, the stem is removed with the tweezers and
held
steadily over an uncovered Petri dish containing tissue media. Small sections
(l-2mm) of
the plant are clipped with the scissors and allowed to fall onto the callus
media. Often,
latex gloves are used as a precaution to allowing skin cells or bacteria to
fall onto the
plate.
When 5-15 pieces of stem have fallen onto the plate, the sterile tweezers can
be used to
manipulate and move the pieces of Cannabis stem. They should be placed
equidistant
from one another and gently pushed down to ensure complete contact with the
media.
The lid can then be placed back onto the Petri dish. Parafilm, a stretchy
plastic film, is
wrapped along the edge of the plate and its lid. This helps in retaining
moisture and
keeping the contents sterile.
27
The tissue cultures are put away from any disturbance and are kept at room
temperature
(22°C/72°F). They do not need light. After a few weeks the bits of Cannabis
stem will
slowly start to change into an amorphous aggregate of totipotent cells. This
is called a
tissue callus and contains the genetic components of Cannabis, but has the
distinct
quality of being able to develop into any plant organ (totipotency).
Plants, due to their meristematic regions, are unlike animals, which have
stem cells, in
that they can be asexually propagated. Using conventional techniques in the
laboratory, a
cat's ear could not be grown into a new cat because there is an absence of
meristematic
cells. Additionally, complications would arise due to the nutrient and energy
demands of
the cat ear. Plant tissue culture is unique in that it allows rapid
production of clones of a
desired species with minimal demands required for the growth media.
When the calluses have grown into masses that lack resemblance to the
original bits of
stem, they can be inoculated with a few drops of the infectious plant
bacterium,
Agrobacterium tumefaciencs .
28
4. Agrobacterium tumefaciens
Much progress has been gained in research through the fundamental
understanding that
microbes (bacteria and fungi) are ubiquitous. Bacterial and fungal species
are in the air,
water, soil, on all types of surfaces, and can thrive in the human body. Each
species has
evolved the molecular machinery to sustain their energy and nutrient needs.
For these
reasons they have often been looked at to provide potentially beneficial
industrial
applications (Pontes et al., 2007).
In order to reproduce, bacteria divide in a process called binary fission.
This creates two
identical offspring, sometimes in as little time as twenty minutes. Fungal
spores often
take much longer than this to reproduce. Regardless, the power of microbes
should be
respected. Although they are often only a few micrometers in length, they
have the power
to overtake a body with a weakened immune system. They have the ability to
feed on raw
sewage with glee and a small percentage even smile in the face of
antibiotics. It should
not be a surprise, then, that bacteria have found a way to colonize and
infect plant tissue.
If the outer epidermal tissue is pierced and the delicate tissue of the plant
is exposed to
the outside air, bacterial infection might result. This is often seen on the
crown of the
plant, which is the base where the trunk meets the soil. The crown is a
likely point of
entry because it is dividing and growing to support the weight of the tree,
therefore the
outer layers of tissue are prone to splitting. Among the billions of bacteria
that have been
discovered and described is a species known as Agrobacterium tumefaciencs .
This bacterium has evolved the molecular machinery to infect plants in a very
interesting
way. It lives in the rhizosphere, which is the area directly around plant
roots, and enters
and infects the plant when an opportunity arises. Interesting research has
shown that the
relationship between Agrobacterium and some plants involves complex signaling
events
(Yaun et al., 2008). The result of this cross talk is what most gardeners
call crown root
gall but a plant biotechnologist thinks of as an expected and welcomed tool
of
biotechnology.
29
The base of a tree trunk with arrows pointing to sites of infection by
Agrobacterium shows the characteristic knobs (tumors).
Like other bacteria, Agrobacterium has a genome that contains nearly all its
genes needed
for routine metabolism and growth. What makes this bacterium unique is that
it has an
extra chromosomal piece of DNA about 200 thousand bases (kb) in size. This
extra
chromosomal piece is technically referred to as a plasmid, and can come in
various
lengths depending on the bacterial species. It is also important to note that
plasmids are
often circular in shape. Interestingly, a part of the plasmid within
Agrobacterium can be
transferred to the genome of a plant, thereby passing bacterial genes to a
"higher"
organism.
30
Plasmid
ari Region
Gene of your choice
Kan (kanamycin resistance gene)
20D h 00l> base pairs
TDNA f-23kb)
Diagram of an Agrobacterium plasmid (not to scale).
The ori region, shown on the plasmid above, stands for the origin of
replication. This is
the sequence on the DNA that has a specific base sequence that allows for an
enzyme to
bind and begin copying the plasmid. Remember, the plasmid DNA must be copied
before
a cell divides. Therefore, the enzyme that polymerizes a new plasmid must be
able to find
this ori region. The enzyme is (not surprisingly) called DNA polymerase
because it is
polymerizes DNA.
Most importantly to Cannabis biotechnology, plasmids can also take up new
pieces of
DNA. Consider any gene and call it your gene of choice (or if you can't think
of one, see
Appendix A). This foreign gene can be first transferred to the plasmid, the
plasmid
transferred to Agrobacterium, then the Agrobacterium transferred to a plant
cell. This is
partly due to that when at the right size and stage, Cannabis callus cultures
can be
intentionally infected with Agrobacterium containing the plasmid that
contains your gene
of choice. Whew, now that's a mouth full! Now that your imagination is
blossoming with
potential genes to insert, it is important to know some details on these
mechanisms. The
31
remainder of this book deals with inserting genes into plasmids, infection of
calluses with
Agrobacterium, gene delivery (transformation), and maturing the callus
cultures into an
adult transgenic plant.
There are many different strains of Agrobacterium that are available for
purchase to
infect plant calluses. Different strains have various positive and negative
aspects, such as
the ability to only infect a certain species or type of plant. Many of these
strains can be
ordered directly from Internet companies (see Appendix B). Some strains are
designed
with part of the transferred DNA (T-DNA), which is the DNA segment that gets
transferred to the plant. For example, the T-DNA might contain the gene that
encodes for
a protein with the ability to fluoresce visible light. However, many other
genes can also
be chosen for transferring to the Cannabis plant genome. Additionally, many
other genes
are necessarily transferred to the calluses. For instance, notice that the
Agrobacterium
plasmid has a small gene coding for an enzyme that breaks down the antibiotic
kanamycin. This will become very important later in the transformation
process.
The transferred DNA (T-DNA) also contains sequences of nucleotides that code
for
enzymes that make two important components that the bacterium will need to
survive in
the plant cell (McCullen and Binns, 2006). The first set of genes is for
enzymes to make
plant growth hormones, which confuse the plant into dividing and growing its
own tissue.
This ultimately results in a crown gall, a knobby protrusion that provides a
nice home for
the Agrobacterium. This is fascinating because what is happening is that the
Agrobacterium hijacks control of the plant cell and dictates to the plant
cells on how to
grow.
The second set of enzymes on the T-DNA is for enzymes that synthesize opines,
rare
amino acids that Agrobacterium needs in order to grow. Opines are so unusual
that plants
do not have enzymes that recognize them and therefore, cannot use them. Only
the
bacteria can use them, which provides an advantage. The total size of the T-
DNA
transferred to the plant is about 23kb.
In addition, the Agrobacterium has regions on the plasmid besides the T-DNA
region.
There is a virulence region that is ~40kb and codes for proteins that help
guide the T-
DNA into the nucleus of the plant cell. There is also what is called an
origin of
replication, or ori region, which simply allows for plasmid replication.
Although there are
many more regions of the Agrobacterium plasmid, we will concern ourselves
with the T-
DNA segment, since that is of the upmost concern for transforming Cannabis.
After infecting the Cannabis callus with Agrobacterium, the tissue is allowed
to remain
in its Petri dish for two days. This is called co-cultivation and gives the
Agrobacterium
ample time to infect the plant cells. It is during this time that the T-DNA
is inserted into
the plant genome.
When the two days of co-cultivation have passed, the callus tissue is
transferred to new
callus growth media. Again, working in the flow hood and sterile conditions
are
necessary to keep microbes from landing on the growth media. The new growth
media
32
contains two antibiotics. One is to kill the Agrobacterium. This is important
because
letting the Agrobacterium continue its growth on the callus will eventual
result in plant
cell death. Since the T-DNA has had time to be incorporated into the Cannabis
genome,
the death of Agrobacterium is of no concern. A common antibiotic used is
timentin,
which kills the Agrobacterium, but has no effect on plant cells.
The antibiotics in the media are not only present to kill Agrobacterium, but
also to select
for transgenic plants. Part of the T-DNA passed to the plant genome confers
resistance to
kanamycin and if a plant cell has taken up the T-DNA it will grow on media
that has had
antibiotic added. Antibiotics are added to warm media after removing the
media from the
autoclave. The temperature of the molten growth media should not be more than
55°C/13 1°F so as not to destroy the molecular structure of the antibiotic.
Plant cells do not tolerate kanamycin and therefore it kills them. Only
transformed plant
cells containing the kanamycin resistance gene can survive on the kanamycin
antibiotic
media. It is the kanamycin that kills any non-transformed callus cells and
allows for only
those calluses that have been genetically modified to survive. This helps in
selecting for
only plant calluses that have been genetically modified for subsequent
manipulation.
The calluses at this point in the transformation process are very brittle and
resemble
small, rough-shaped pieces of soap. When squeezing them with a tweezers they
will
easily break into multiple pieces. Sometimes this is desired; many pieces of
callus will
lead to many plants. However, many plants may not be necessary, so it is up
to the plant
biotechnologist to decide how to distribute the calluses onto the new media.
33
Calluses growing on Petri dish with callus media with kanamycin and timentin
added. In this photo, UV light was shinned to induce fluorescence in order to
confirm that the GFP gene was successfully transferred.
To make sure all the Agrobacterium have died and only transformed plant cells
remain,
the calluses are transferred every 7-14 days to a new Petri dish with callus
media and the
two antibiotics (kanamycin and timentin).
After 4-5 weeks of this process the calluses can be transferred for a final
time. They are
moved once again using sterile technique. This time each callus is placed on
media that
has plant hormones imbedded in it in addition to the antibiotics. The
hormones will tell
the calluses that it is time to differentiate into specific cells (leaves,
roots, shoots, etc.).
Instead of a Petri dish a taller container with MS media (with hormones) can
be used.
This taller container, called a Magenta box, allows for more area that the
roots and shoots
will need to grow.
34
Petri dish with fungal contamination. The arrow is pointing to the advancing
edge of the fungal colony, which has already surrounded larger calluses to
the
lower left area of the dish.
To help the calluses develop shoots and roots, a cytokinin (e.g., zeatin) is
present to
induce shoot formation while an auxin (e.g., indole acetic acid) is present
to induce root
development. These can be used in different ratios, depending on what is
desired. For
example, a high auxin to cytokinin ratio favors shoot formation.
Choosing the correct auxin: cytokinin ratio is for the biotechnologists to
decide and
depends on the species one is using in the experiment. In some tissue culture
powders,
hormones are added, allaying any concentration or ratio concerns that the
plant
biotechnologist may have. Manipulating plant hormones within the tissue media
is the
underlying reason that a callus changes from being totipotent to initiating
organogenesis,
or shoot and root formation. The Cannabis tissue cultures are placed under a
suitable
grow light in order to allow the transformed calluses to begin manufacturing
chloroplasts
used in photosynthesis.
In as little time as a month small points and protrusions will be seen on the
Cannabis
calluses. These are the young shoots and roots beginning to emerge. The
calluses are
allowed to continue growing on the MS media until their shoots and roots are
at a healthy
size. They will still be very delicate at this point. Just prior to removing
the young
genetically modified plants from the Petri dish or Magenta box, they need to
be exposed
to the external air. To do this, the lid of the container is opened and air
is allowed to
35
circulate through passive diffusion. This process, which lasts about two
days, also helps
in hardening the plants in preparation for much lower humidity levels outside
of the Petri
dish or Magenta box.
Photograph of calluses growing on root initiation media with arrows pointing
to developing roots. Some chlorophyll (green) pigmentation is also present.
The small root hairs, which increase surface area for optimal water uptake,
are also visible. The inset photo is an enlargement of the rooting callus.
It is important to consider that once the developing plants are moved to soil
their organs
will have to sustain a young plant. Care should also be taken to minimize
exposure of the
young plants to pests or harsh environmental conditions such as temperature
fluxuations.
Therefore, before transferring the developing plants consider where they will
be grown.
An indoor growth chamber with adequate light is necessary in nearly all
situations of
plant transformation. This provides a steady, equilibrated environment with
an adequate
light source. Most plant growth chambers allow for temperature, light and
sometimes
even CO2 control.
36
A Cannabis callus that has been genetically modified with the GFP gene is
shown
growing in a Magenta box. When its roots, shoot and leaves have further
developed,
it can be placed in soil and moved to a growth chamber.
If moving the transformed Cannabis to a greenhouse or an outdoor area, they
need time
to slowly adjust. Small increases of time in exposure to less favorable
conditions are
made gradually over several weeks. This is extra work and lends itself to
possible plant
death, wasting many months of hard work. Therefore using a growth chamber
provides
the best chance for keeping the transgenic Cannabis alive.
37
A refrigerator-sized growth chamber used for growing transformed plants
with delicate new roots and shoots.
38
A smaller growth chamber, which performs equally well compared to that of
the larger refrigerator-sized chamber, can also be used for optimizing tissue
culture conditions.
39
Obtain Cannabis stem and callus media
/work is flow hood)
Sterilize stem
70% Ethanol, -lOmin
Dice and place on Petri dish
[-3 months
Infect withAffrotacterium
days, ca -cultivation
on selective (antibiotic) media
ielect for transformed callu ses
Transfer calluses to shoot/root initiation media
-3 months
Transfer to soil
Grow to flowering sta^e
Further breeding
ilizt
¥
ace
*■■
lAgr
ve [ "
hoot
i-
sfci
V
Flow chart of Cannabis tissue culture method progressing from the original
stem of the Cannabis plant to further breeding. Each step shown here is often
slightly modified according to the type of plant species one is working with.
40
5. The GFP Leaf
The simplest Cannabis transformation involves using Agrobacterium that has
the green
fluorescent protein (GFP) gene in its T-DNA region. The GFP gene codes for a
protein
that fluoresces ~500nm (green) wavelengths of light when exposed to blue
light. In
respect to its size and relation to other protein molecules it is a
relatively modest protein,
composed of only 238 amino acids. Agrobacterium that contains this gene (and
an array
of other genes) can be readily purchased (see Appendix B).
Similar to the cytochrome discussed earlier, GFP contains a chromophore. The
chromophore has electrons that are excited by the blue light. Upon exposure
to blue light
the electrons in the chromophore are elevated to a higher energy state. As
they lose
excitation they release energy in the form of visible light, which is the
cause of the
fluorescence. This brings us back to the concept of electromagnetic
radiation, discussed
in the opening chapter. Visible light is a small part of a spectrum of
different frequencies
of energy. High-energy waves have a higher frequency and a smaller
wavelength. Low
energy waves of the spectrum have less energy and a lower frequency.
Gamma rays and X-rays are on the high-energy end of the spectrum while radio
waves
are on the opposite end and have less energy. Visible light is somewhere in
the middle of
these two extremes. At just a higher frequency than visible light is
ultraviolet light, which
damages cells due to its high-energy nature. The colors on the visible part
of the spectrum
can be divided into specific frequencies and have distinct wavelengths.
Violet, next to
ultraviolet, is a higher frequency than red, while green is in between these
two. An easy
way to remember the order of light and its frequencies is with the pneumonic,
ROY G
BIV (red, orange, yellow, green, blue, indigo, and violet).
From knowing the colors and their associated wavelengths, understanding
fluorescence is
straightforward. When something fluoresces it emits a lower energy color than
the
incident, or incoming, wavelength that first strikes it. For example, shining
a blue light on
something with fluorescent properties results in a lower energy wavelength of
light being
emitted, such as green. The fluorescence itself arises due to an electron
being
momentarily excited to a higher energy state and then falling back to a lower
energy
state. The transition of energy states results in a particle of light (a
photon) being
released. Humans see this as fluorescence.
The green fluorescent protein gene was first isolated from a jellyfish in the
1990's. It has
since found many uses in plant biotechnology (Sheen et al., 1995; Davis and
Vierstra,
1998). Its main use is to act as a reporter gene. This means that when
performing a plant
transformation experiment, the GFP gene can be attached to the T-DNA region
of the
plasmid. This then allows for visual confirmation of a successful plant
transformation
experiment. Green fluorescent protein has become so important in many
experiments that
the discoverers of GFP were awarded the Nobel Prize in Chemistry in 2008
(Cantrill,
2008).
41
Since its discovery the GFP gene has been inserted into many other organisms,
including
animals. This has included making glowing fish (Danio sp.), and mice. Many
pet stores
now sell GFP fish to put into home aquariums. Perhaps the strangest creation
of all has
been the GFP pig.
Induced mutations of the GFP gene make a protein that emits slightly
different
wavelengths of light. Available in the biotech market today, there exists a
GFP reporter
gene that will result in a protein that fluoresces nearly every color of the
rainbow.
Transforming these genes into Cannabis would result in a plant with colorful
buds when
under a black light.
The pragmatical reasons for doing a Cannabis-GFP transformation are difficult
to argue.
However, science is not just about pragmatism, it's also about discovery,
exploration, and
excitement. When tobacco was first transformed with a firefly gene (that
encoded for the
protein luciferase), everyone including the public sector as well as school
kids were all
suddenly interested in how plant biotechnology might affect their lives. The
same reasons
might be argued for creating a glowing Cannabis plant.
However, in some cases such as the creation of GFP mice was not simply for
show. It
has, in fact, led to an important new method of studying brain function.
Using different
variants of the GFP gene that emitted different wavelengths (colors) of light
has allowed
scientists to study individual cells and differentiate between single
neurons. Since brains
are often quasi-organized, but often with indiscernible entanglements,
variation in neuron
color helps to distinguish individual neurons. Perhaps making a GFP Cannabis
plant with
the same variety of fluorescence could lead to better viewing of the xylem
and phloem.
The GPF experiments offer insight into how biotechnology provides advances in
knowledge and discovery. However, cutting a gene out of one organism and
putting it
into another organism requires skill, proper knowledge and the proper lab
equipment.
First, the experiment must be decided. The sequence of the gene of interest
must at least
partially be known, which allows isolation and amplification of the gene.
Second, a
potential organism to be transformed must be decided. Usually this is
selected from a
choice of model organisms whose genome composition, ability to be
transformed, and
growth conditions have been well established. Finally, one must then decide
on the
vector, or the way that the gene will be transferred. We have previously
discussed the
Agrobacterium plasmid as the vector for Cannabis transformation.
Inserting the gene into the chosen organism can only be done after the gene
has been
ligated, or enzymatically linked, to a vector. Perhaps the most well
established vector for
transforming plant calluses is the plasmid of Agrobacterium. Therefore, in
order to
deliver the gene from Agrobacterium into plant calluses, the plasmid must be
ligated to
the gene. Many molecular biology kits to carry this reaction out are
commercially
available from a wide range of companies.
After ligation, the plasmid containing the gene can then be inserted into the
Agrobacterium in one of two ways. The plasmid with the ligated gene can be
mixed with
42
Agrobacterium cells and placed in a small tube called a cuvette. An electric
shock is
given that forces the Agrobacterium to take up the plasmid. This process is
known as
electroporation.
An electroporator, which is used to make Agrobacterium take up the plasmid.
The upper left corner shows the cuvette. After placing Agrobacterium and the
plasmid into the cuvette, the cuvette is inserted into the pod and a small
pulse
of electricity is given.
Selection for transformed Agrobacterium can then be carried out on antibiotic
containing
Petri dishes that only allow Agrobacterium that has a plasmid to grow. This
is because
the plasmid will have an antibiotic resistance gene, as previously discussed.
The second way to make Agrobacterium take up the ligated plasmid is called
heat shock.
In this method, the Agrobacterium and plasmid are mixed in a small tube. This
mixture is
transferred from ice to a warm water bath, then back to ice. The cells are
then spread onto
the Petri dish, much like after doing an electroporation reaction.
After growing the Agrobacterium on a Petri dish, some of the cells can be
picked off with
a sterile wire and dipped into a broth (liquid) culture, which is a growth
media similar to
the Petri dish but without the solidifying agar. This broth is allowed to
grow for two days,
or until the Agrobacterium reach a desired cellular density.
43
A few drops of the broth culture cells can be dropped onto plant tissue
callus. By their
nature, they will infect the plant callus tissue and insert the genes from
the plasmid (the
T-DNA). This is the basis of genetically transforming the plant cells. If so
chosen, the
Agrobacterium that was grown in broth can be grown in bulk and small aliquots
frozen
for future use. Now that you have been provided the basics on how to make a
transgenic
Cannabis plant, it seems necessary to divulge into some of the candidate
genes.
44
6. Woody Cannabis
Nearly all plant cells have a rigid, outer protective layer called a cell
wall that provides
support and protection for the cellular contents. The cell wall is not a
static entity. It has
enzymes imbedded that perform a wide array of biochemical functions. The main
component of plant cell walls is cellulose, a large polysaccharide made up of
glucose
monomers.
Almost anyone who has taken a basic biology class knows that a cell is the
smallest unit
of life. On a microscopic scale, cells are small factories where thousands of
biochemical
process are occurring each second. All plant cells also have a plasma
membrane, made up
of lipid-derived molecules. Seeing how the plasma membrane helps keep a cell
together
can be understood when looking at oil and vinegar salad dressing. Notice that
in this
dressing there are two distinct layers, an oily (water insoluble) phase and a
liquid (lipid
insoluble) phase. You have to shake the bottle of dressing to try and bring
the two layers
together. But after time, the layers separate again. A cell membrane is
similar to the bottle
of oil and vinegar salad dressing in that it keeps the liquid phase, which
contains all of the
cell's machinery, together by making the oily outer layer called the plasma
membrane.
The plasma membrane then is like an oil shell, providing a fairly constant
internal
environment. Imbedded in this oily shell are proteins with various functions.
In a plant cell, in addition to the plasma membrane, part of keeping the
internal parts
from bursting out from the oily shell layer (nucleus, mitochondria,
chloroplast, etc.) is
provided by the most exterior layer called the cell wall. Integrity of the
cell is maintained
by keeping the cell in tact by the rigid external layer of cellulose, a major
component of
the cell wall. The cell wall also keeps the inner plasma membrane and its
contents
protected from external environmental onslaught such as salinity changes or
pressure
changes. It also protects the cell from popping due to internal pressure from
water
accumulation. In fact, the cell wall was a crucial evolutionary step in the
transition of
plants from their aquatic ancestors to colonize land.
There are two components to the cell wall, a primary and a secondary cell
wall. The
primary wall is established first, early in the cell's life. As time
progresses the cell
matures and the secondary wall is established. This wall is laid down inside
of the
primary wall. The secondary cell wall is the portion that often contains
higher amounts of
lignin and is at least partly responsible for what is known as wood. Laying
down lignin in
the cell wall is called lignification. Both the primary and secondary wall
contain cellulose
but differ in concentration of lignin and the types of proteins. Between each
plant cell and
on the outside of the cell wall there is a layer of a substance called
pectin, which is a
carbohydrate that essentially glues adjacent cells together. Pectin is also
the substance
that is used in thickening jellies and jams.
All of this is important because an interesting discovery occurred with
researchers who
wanted to understand how lignin, the main component of wood, is produced in
large trees
(Kirst et al., 2003). They examined the gene sequences of Arabidopsis, which
usually
doesn't produce wood.
45
Using the tools of bioinformatics, which uses computers to understand
sequences in
databases, they first found and identified several genes that played a role
in secondary
xylem, or wood production. The researchers then started comparing the
sequences of the
tree genes with Arabidopsis genes. To their surprise, they found remarkable
similarities.
Although their morphological appearances were strikingly different, both
shared the
genes needed for wood production. For some unknown reason, the lignin genes
have
been turned off 'in Arabidopsis.
Since Arabidopsis, the small herbaceous mustard plant, had the genes for wood
production in its genome, other researchers have postulated that if these
genes were to be
expressed, wood formation might occur. Indeed, research in this avenue has
already
begun with some success (Mitsuda et al., 2007). Although Arabidopsis is
usually thought
of as a herbaceous (non-woody) plant, this has been changed through the tools
of
biotechnology.
Searching for the gene for wood production in Cannabis could prove to be
difficult
considering that there is limited genomic information available. However, it
would
indeed be possible to use the Arabidopsis study as a stepping-stone to reach
the goal of
producing a woody Cannabis plant. The DNA sequence of a gene for one species
is often
similar to the same gene in a different species. This is called gene
homology, or as
sometimes referred to-two genes are homologous if they share similar
sequences and are
found in different species. The gene for wood production is most likely
hidden
somewhere in the Cannabis genome, much like it was hidden in the Arabidopsis
genome.
The gene simply needs to be detected and properly expressed.
The construction of the plant cell wall and lignification depends on the
activity of
enzymes responsible for synthesis of cellulose, lignin and other polymers.
Most people
are familiar with plants, whether they are found in gardens, in homes, front
yards, dinner
tables, or in a pipe, people are often directly interacting with plants.
Interacting indirectly
with plants is inevitable, since breathing the oxygen they release is
fundamental to most
life on earth. However, the great majority of people are less familiar with
the plant cell.
Since Cannabis already has the machinery to produce primary and secondary
cell walls,
the only necessary genetic changes would be to up-regulate lignin production
in the
secondary wall. The challenge is to find and isolate the gene in Cannabis,
which is
entirely possible through bioinformatics and understanding gene homology.
Transforming Cannabis with a gene for increased lignin production would be a
practical
application of biotechnology. Having a woody plant would allow an outdoor
gardener to
have a perennial Cannabis plant. Buying and planting new seeds to sew each
year could
be eliminated. Cuttings to propagate a favorite strain would also be easier
to obtain and
share among friends.
With the correct genes for both wood production and size, an extreme case of
an entire
forest of Cannabis trees is possible. This would have ecological
ramifications beyond
46
releasing a genetically modified crop organism into the wild. For instance,
imagine a
forest fire where the smoke has enough THC to get every man woman and child
in an
adjacent city stoned. Firefighters rushing to the scene may find themselves
unable to
focus on extinguishing the fire. Although an extreme scenario, this helps
articulate the
fact that regulations of genetically modified organisms are indeed important.
Since hemp is already used as a sustainable crop in some countries, they may
want to
consider growing hemp varieties with higher lignin production. These
genetically
modified varieties could be useful for more durable goods than that made from
traditional
hemp strains. The current hemp varieties are in fact better than trees for
making paper
due in part because they have a lower lignin density. The lower lignin
concentration
makes hemp an attractive plant because the higher lignin in trees requires
more harsh
chemicals used in processing. In fact, it is because of the lignin that hemp
is often
preferred over trees. Hemp also has a higher cellulose density than trees,
making it great
for increasing product yields.
For these reasons one may argue against making a woody Cannabis plant.
However, if
the countries where hemp is currently cultivated could be grown to increase
lignin
production the country would surely benefit. A country with much of its land
mass given
over to desert or dry area is often able to grow hemp. If these same areas
could produce
lignin within their countries, they could rely less on the import of forest
products. This in
turn would slow the destruction of forests in other countries. An advantage
of higher
lignin content is also given to the plant. Many organisms cannot tolerate
eating lignin and
therefore a transgenic hemp plant with higher lignin content may provide
herbivore
resistance.
But other benefits abound for humans. A high lignin-producing hemp plant
could provide
raw materials for building more durable goods than presently available from
contemporary hemp varieties. The current list of products made from hemp
ranges in the
hundreds. Increasing lignin content could expand this list. Based on the
current rate of
forest destruction, it may be absolutely necessary to make a transgenic hemp
plant that
makes large amounts of lignin.
47
7. Plant Secondary Metabolites and Terpene Production
Knowing the biochemistry that presently occurs in plants is vital to
understanding plant
biotechnology. There are hundreds of biochemical pathways that lead to a
plant product.
Knowing all of these pathways is unnecessary and can be time consuming (and
impossible) to learn. Therefore, one should primarily concern themselves with
the
pathways that lead to important Cannabis compounds (e.g.,
tetrahydrocannibinol). To
begin this exploration the terpene pathway is introduced. However, it is also
important to
know other plant secondary metabolites.
Previously we discussed plant primary metabolites. These consist of proteins
(amino
acids), carbohydrates (sugars), fats and lipids, and DNA and RNA (nucleic
acids).
Primary metabolites are crucial to plant survival. Without these four basic
metabolites, a
plant could not carry out the daily requirements and processes of life.
Secondary metabolites differ from primary metabolites in that they are not
always
necessary for plant survival. However, they are often advantageous or provide
some
benefit to the plant. There are three major groups of plant secondary
metabolites;
phenolics, alkaloids and terpenes. Phenolics are distinct in that they have a
carbon ring
structure with a hydroxyl group (-OH derivative) attached. Lignin, a huge
polymer of
phenolic rings, is the most common phenolic compound among plants. Other
important
phenolic compounds include tannins, vanilla, nutmeg, capsaicin (the spicy hot
molecule
in peppers), and anthocyanins (plant pigments).
Alkaloids represent another class of secondary metabolites. Alkaloids are
bitter tasting
nitrogenous compounds. A popular alkaloid in the 1980's was cocaine. Other
well-known
alkaloids in include atropine, caffeine, psilocybin, strychnine, quinine, and
morphine.
Terpene synthases are the enzymes that synthesize terpenes, the third and
final class of
secondary metabolites. Terpene enzymatic pathways have been described in
detail
(Pichersky et al., 2006). Terpenes provide a wide array of functions in
plants. For
example, the tail portion of the chlorophyll molecule is composed of the
terpene called
phytol, which is a diterpene. Citrus smells are possible because of limonene,
a
monoterpene. In total there are about 60,000 known phenolics, alkaloids, and
terpenes.
Terpenes make up the largest proportion of plant secondary metabolites.
The most important terpene, at least in this book, is geranyl diphoshpate,
which is needed
for tetrahydrocannibinol (THC) biosynthesis. The basic enzymatic pathways
leading to
molecules of terpenes incorporate carbon molecules based on multiples of
fives.
Therefore, a nomenclature system has emerged that follows this pattern.
48
Terpene name
Formula
Molecular weight
Isoprene units
Example
Hemiterpene
C5H16
76.2
0.5
2-methylbutane
(isoprene)
Monoterpene
C10H16
136.2
1.0
pinene
Sesquiterpene
C15H24
204.4
1.5
farnesol
Diterpene
C20H32
272.5
2.0
phytol
Sesterterpene
C25H40
340.6
2.5
leucosceptrine
Triterpene
C30H48
408.7
3.0
squalene, THC
Tetraterpene
C40H64
544.9
4.0
carotenoids
Polyterpene
OoofloO
100,000-1,000,000
1,500-15,000
natural rubber
Similarly, a nomenclature system exists for enzymes, the proteins that act as
a catalyst to
speed reaction rates. One only needs to add the suffix '-ase' onto a
protein's function to
give it a name. For example, a transferase is an enzyme that transfers one
molecule to
another and a decarboxylase is an enzyme that removes a carbon. Most of the
steps
leading from one molecule to another involve an enzyme. These enzymes are
desirable to
understand because over expression of anyone of these protein's genes could
lead to
higher THC production in Cannabis.
The five carbon units for building terpenes consist of the phoshporylated
(has a
phosphate added) starting materials isopentenyl diphosphate (IPP) and
dimethylallyl
diphosphate (DMAPP). These can be joined in either "tail to tail" or "head to
tail"
reactions. In the case of the atmosphere and its terpene constituents, the
low molecular
weight terpenes have been shown to play are larger role, and hence have been
more
widely studied in global climate.
Additionally, it has been observed that plants can produce terpenes
(anabolism) and then
consume them by breaking them down (catabolism). Often, large terpene
compounds can
be metabolically broken down and released in smaller (reduced molecular
weight) forms.
The reactions of terpene biosynthesis are an important part of Cannabis
biochemistry.
49
Shown above is a single isoprene molecule (C5H16) is the primary constituent
of
all terpenes.
There are two pathways, which lead to production of terpenes. The mevalonate
(MVA)
pathway for terpene production in higher plants occurs in the cell cytoplasm
and leads to
sesquiterpenes and triterpenes. The second pathway is called the 1-deoxy-D-
xylulose
(DXP or non-MVA) pathway and occurs in the plastid. This pathway can lead to
monoterpenes and diterpenes.
PLANT CELL
CYTOPLASM
MVA Path
i
Sesquiterpenes
Geranyl diphosphate
V
Plant cell showing each terpene pathway. Geranyl diphosphate is used in THC
synthesis.
50
To begin the MVA pathway, thiolase catalyzes the synthesis of acetylacetyl-
CoA by
fusing two acetyl-CoA molecules. HMG-CoA synthase synthesizes acetylacetyl-
CoA
with a third acetyl-CoA to produce 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA).
A
final reaction catalyzed by HMG-CoA reductase uses 2 NADPH to reduce HMG-CoA
to
the six-carbon molecule mevalonate (MVA).
The high-energy molecule, adenosine triphosphate (ATP) is required for the
next three
reactions, which ultimately lead to isopentenyl diphosphate. These reactions
involve
MVA kinase, MVAP kinase, and MVAPP decarboxylase, and proceed with MVA,
mevalonic acid 5-phosphate (MVAP), mevalonic acid 5-diphosphate (MVAPP), and
isopentenyl diphosphate (IPP), respectively.
The plastidial pathway is initiated with the joining a pyruvate molecule to a
glyceraldehyde 3-phosphate molecule facilitated by the enzyme DOXP synthase.
This
forms l-deoxy-D-xylulose-5-phosphate (DOXP). This is reduced by the enzyme
DOXP
reductoisom erase (DOXP-R) to form 2-C-methyl-D-erythritol 4-phosphate (MEP).
A
cytidine triphosphate then incorporated to form 4-(cytidine-5-diphoshpo)-2-C-
methyl-D-
erythritol (CDP-ME) via the enzyme CDP-ME synthase.
An ATP is used to add a phosphate to form 4-diphosphocytidyl-2C-methyl-D-
erythritol
2-phosphate (CDP-ME-2P). The enzyme that catalyzes this reaction is CDP-ME
kinase.
This product is then cyclized to form 2-C-methyl-D-erythritol 2,4-
cyclodiphosphate
(CDP-ME diphosphate) via CDP-ME diphosphate synthase. After removing a water
molecule, (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate (HMBPP) is formed via
HMBPP synthase. The final step removes an additional water molecule while
simultaneously reducing (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate to yield
isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).
51
Plant Cell
Cytoplasm
MVAPath
3 Acetyl-CiaA
HMG-CoA Synthase
ML- CoA
HMG-CoA Reductase
mevaJojiate
M VA Kinase
mevalonate phosphate
MVAP Kinase
mevaknate diphosphate
. MVAPF Decarboxylase
EPP < I > DMAFP <<
MG
l<
?vaJ'
I'
late
1
3te<
T
Polyisoprene Synthase
sesquiterpenes
Non-MVA Facta
GA-3-P + pyruvate
, DOXP Synthase
DOXP
' DOXP Reductoisomerase
MEP
CDP-ME Synthase
DP-ME
CDP-ME Kinase
P-ME-2P
CDP-ME Diphosphate Synthase
CDP-ME diphosphate
HMBFP Synthase
HMBPP
I'
do:
Ml
I
~DP
IP*
I'
bill]
I PI'
T
DMA]'?
jiio rioter penes
(gcranyl diphosphate)
Outline of the cytosolic terpene pathway and the plastidial terpene pathway.
Note the cross talk between each pathway. Geranyl diphosphate is perhaps the
most relevant molecule to THC biosynthesis.
Since they are phosphorylated, the IPP and DAMPP can be used in the so-called
"head to
head" or "tail to tail" combinations to build terpenes. DAMPP can also be
produced from
IPP by the enzyme isopentenyl-diphosphate isomerase (IPP isomerase).
Dimetheylallyl
transferase uses either IPP or DMAPP to form geranyl diphosphate or farnesyl
dihposphate via polyisoprene synthase. Geranyl diphosphate and farnesyl
diphosphate are
monoterpenes and sesquiterpenes, respectively. It is geranyl diphosphate,
which lends
52
itself to THC synthesis. Finally, it is important to note that there can be
exchange of
products between the cytosolic and plastidial pathways.
Many biochemical reactions taking place within plant cells are not carried
out in such
sequential steps. Although biochemical pathways occur when precursor
molecules initiate
the pathway, things can only proceed as fast as products are made. This is
because
enzymes are often suspended within an intracellular matrix (the cytoplasm) or
attached to
a cellular membrane, so that reactants must somehow join with the correct
enzyme.
A complex interaction between enzymes and their substrate concentration is
played out
where an enzyme may only be produced on demand. It follows from this that
increasing
the concentration of the substrates can cause an increase the concentration
of the
products. All of this has led to something called a rate-limiting step. This
says that the
rate of any reaction depends on the previous reaction. When thinking about
THC
production, it relies on previous steps within the THC biosynthetic process.
The HMG-
CoA reductase enzyme is often considered a rate-limiting step.
The enzymatic reactions taking place within the plant cell all occur very
rapidly and
depend heavily on the temperature and concentration of reactants and enzymes.
The
terpene pathway is one of many plant biosynthetic pathways. Therefore it is
not too
surprising that the terpene pathway also overlaps with other plant pathways,
including
plant hormone synthesis. For example, gibberellins and auxins are both formed
starting
with a molecule of mevalonate derived from the MVA pathway.
Since THC is the most active component of marijuana smoke, the importance of
its
molecular synthesis cannot be overstated. Like the terpene pathway, the THC
pathway
consists of different enzymatic steps and has intermediate molecules, for
example it is
synthesized via a terpene. Each of these enzymes plays a crucial role in the
overall
formation of plant secondary metabolites.
Becoming familiar with both the terpene pathway and the THC pathway allows
one to
understand not only key enzymes, but also the genes that encode those
enzymes. This is
crucial to relating the ways in which Cannabis can be genetically
transformed. For
example, in order to increase the concentration of the psychoactive component
of
Cannabis, an increase in IPP or DMAPP is needed. These molecules are produced
in the
terpene pathway. The gene coding for the protein that synthesizes IPP or
DMAPP needs
to be over expressed in Cannabis. Choosing any gene that codes for any enzyme
within
the terpene pathway might produce a similar increase, but needs to be
experimentally
verified. The important component to remember from these complex pathways of
THC
synthesis is that transferring any of these genes is possible with today's
biotechnology
tools. Before detail on these tools and techniques are provided, a review of
the THC
pathway is necessary.
53
8. The THC Pathway
The terpene pathway is important to understand both because it serves as a
model for the
other biosynthesis reactions, such as the THC pathway, and because the
terpene geranyl
diphosphate is needed in THC biosynthesis. Similar reactions, albeit at
different rates and
locations, occur within plant cells that result in production of THC. The
chemical
structure of THC was first determined in the 1930's (Pertwee, 2006). Knowing
the
complete pathway to its production is considered an important piece of
Cannabis
biotechnology.
THCA
THC
Shown here is the molecular structure of THCA and THC with arrows pointing
to the variation in the side group. THCA is the component in Cannabis plants
and it is not until it is burned that THC is formed.
Interestingly, it is not until THCA is burned that it becomes chemically
modified into a
more psychoactive form, which is THC (Hazekamp et al., 2005). The burning
causes a
decarboxylation reaction, or a loss of a carbon group that is on the THCA
molecule,
thereby converting it to the more psychoactive THC molecule.
However, the THCA component of Cannabis is the precursor of THC, so its
formation
and accumulation within the plant influences the amount of THC when the plant
is
smoked. Again, part of the THCA molecule is derived from the terpene geranyl
54
diphosphate. Synthesis of THCA begins when a molecule of geranyl diphosphate
(a
monoterpene) is joined to a phenolic ring (a circular molecule with six-
carbons). This is
why THC is sometimes referred to as a terpenophenolic. Because it has a few
extra
molecular attachments, the phenolic ring is called olivetolic acid and it is
through the
enzyme geranylpyrophosphate:olivetolate geranyltransferase that forms
cannabigerolic
acid, or CBGA. The final product after CBGA formation is THCA by way of
tetrahydrocannabinolic acid (TCHA) synthase. Subsequently, high levels TCHA
are
found in Cannabis trichome cavity (Sirikantaramas et al., 2005).
Cannabis Cell
r
CYTOPLASM
olivetolic add
+
geranyl diphosphate ^
\
THCA
A look inside the Cannabis cell, showing geranyl diphosphate and olivetolic
acid combining to yield THCA.
The pathway leading to olivetolic acid is most likely synthesized from three
molecules of
hexanoyl-CoA. However, work remains to be done to in order to understand the
synthesis
of THCA in its fullest extent. Details on each enzymatic reaction, their
substrates and
their products have been recently provided (Taura et al., 2007).
With all this biochemistry comes the curiosity of why Cannabis has evolved to
produce
THC -like molecules. It has been hypothesized that the molecules can act as a
sunscreen
for the plant (Lydon et al., 1987). In fact, research has shown that THC can
absorb UV
light, thus the plants are protected from harmful radiation. Additionally,
THC precursors
have believed to have antimicrobial activities, therefore these cannabinoids
may also play
a role in plant defense.
Since the part of the biochemical pathway of THC has been elucidated, picking
some of
the genes from the pathway for transgenic manipulation is possible. For
example, if
55
THCA synthase is attached to the CAMV35S promoter it will be highly over
expressed.
This would produce transgenic lines of Cannabis that are loaded with THCA.
Putting these genes into other plants may serve useful to people in countries
where
Cannabis cultivation is illegal. One species of plant that might be desirable
to genetically
modify with THC genes is the weed species, Amaranthus retroflexus. This plant
is in the
family Amaranthaceae, also known as the pigweed family. The common name for
this
plant is redroot pigweed and is consumed as a food in some parts of the world
(Kong et
al., 2009).
One reason for its candidacy for genetic modification stems from the fact
that it is a
weed; it grows along railroad tracks, in ditches, and even between cracks in
the middle of
parking lots. Therefore, very little labor would be required from the
cultivator to maintain
healthy pigweed plants.
A second reason for its candidacy is that the flowers of pigweed are large
and bulky. This
would provide the obvious advantage of producing large quantities of finished
product.
Additionally, it needs little water, grows rapidly, produces lots of seed,
and tolerates poor
soil and harsh growing conditions. In many respects it behaves like Cannabis,
but is
legal. Growing a few plants of pigweed would not send the police to your
house. For
instance, growing pigweed next to your tomato plants in your garden would not
seem that
strange. Neighbors would not give the situation a second thought.
56
Amaranthus retroflexus, a candidate for genetic modification with the THCA
synthase gene. The top left corner shows an up-close view of the large flower
clusters of this plant.
57
The prospect of growing a legal THC-containing plant might also seem alluring
to
medical marijuana users. Within the US, medical marijuana is currently legal
in only a
handful of states. While other countries have legalized or promoted the use
of medical
Cannabis, the US Food and Drug Administration (FDA) has historically declared
marijuana to have only limited medical potential. This is contrary to
continuing scientific
findings and the fact remains many patients currently use medicinal marijuana
with or
without a doctor's recommendation.
The inflorescence (flower) of pigweed can be much larger and bulkier than
marijuana,
which would allow for production of large amounts of medication for medical
marijuana
patients. The biotechnology for producing transformed, THC-containing plants
might be
an effective way to bypass legal issues and still allow sufferers of chronic
illnesses to
self-medicate. Since Amaranthus is known to harbor terpenoid biosynthetic
pathways,
inserting the THCA synthase gene should result in THC production.
Transforming a plant with one gene is relatively straightforward. Inserting
multiple
genes, called gene stacking, has proven to be more difficult. In the past
researchers had to
do laborious transformations starting with one gene, then grow the plant into
an adult,
and breed it for multiple generations. Only then could they use this stem
tissue for
creating calluses and insert a second gene. Success was far and few between.
Fortunately,
many new vector systems, mainly in the form of plasmids, have shown to be
more
versatile in their capacity to deliver multiple genes simultaneously (Dafny-
Yelin and
Tzfira, 2007). The emergence of artificial plant chromosomes has allowed
putting several
genes together and inserting them into a vector. With time, the complete THC
pathway
will undoubtedly be inserted into other plant species.
58
9. Smoking Roses and Other Proposals
There are limitless ways in which Cannabis and biotechnology will influence
one
another. Having a basic knowledge of science and biology is imperative, but
having an
imagination might prove equally as important. However, thinking of concepts
and
applying logical ideas to them begins with a solid science education. This
allows one to
gather reasonable arguments as to possibilities of Cannabis transformation
that may arise
in the near future.
Work has already begun with yeast cells (Taura et al., 2007). These small
fungi were
genetically modified to express the THCA synthase gene. Workers from the same
lab
were also responsible for transforming tobacco, albeit under special
conditions
(Sirikantaramas et al., 2004). For example, the THCA synthase enzyme had to
be
provided with the THCA precursor molecule (cannabigerolic acid). The tobacco
cells
were also grown in vitro. Nevertheless, the gene for THCA synthesis has been
shown to
have the ability to successfully transfer and expressed in organisms other
than Cannabis.
Some of the fastest advances in improving Cannabis and other plants have been
through
application of chemicals or hormones. For example, inducing chromosomal
duplications
in plants has been occurring since the discovery of colchicine. This chemical
interferes
with the proteins that pull chromosomes apart during cell division. Applying
colchicine
has been shown to cause complete genome duplications. Sometimes this leads to
doubling of all gene products and not just the genes. It follows, then, that
a Cannabis
plant treated with colchicine might result in production of twice as much THC
than an
untreated plant.
Although colchicine is commercially available, performing more drastic
genetic
experiments are not so easily available. These require special aseptic
conditions and
access to the necessary technology. Once these obstacles are overcome,
transforming
Cannabis with any gene is simply a game of experimentation.
It is indeed possible to control genes and cause them to be upregulated in
order to
increase their gene product. To do this, the known gene has to be attached,
or ligated, to a
special region that communicates this to the Cannabis cell. This region is
called a
promoter region, since it promotes the expression of that gene. The promoter
region sits
just ahead of the gene along the chromosome.
Some promoter regions have been found to have such strong expression
activity, that they
are routinely used in plant biotechnology. One such promoter is called the
CaMV 35S
promoter (Venter, 2007). This promoter was first found in a virus, then
carefully
removed, and finally ligated to a plant gene. When researchers did this they
found that
whatever gene was attached resulted in a constant expression of that gene.
The CaMV
35S promoter has since proven to be a useful promoter to make transgenic
plants that
express large amounts of a foreign gene.
Since there is overlap of the THC and terpene biosynthetic pathways, adding
an
59
additional two or three terpene genes to Cannabis will likely result in that
terpene
product. For example, many fruit scents and flavors are terpenes. Most anyone
is familiar
with the citrus smell of an orange, grapefruit or lemon. This smell is the
result of a
terpene known as limonene.
The biosynthesis of limonene is so well understood that there are multiple
transgenic
plants that have been made expressing limonene. Putting the limonene gene
into
Cannabis would give the buds a citrus-like smell. While some may find this
aesthetically
appealing, others might simply enjoy something different. From a practical
standpoint,
the paranoia of indoor growers might decrease upon learning that the smell
their
neighbors are complaining about is lemons rather than from marijuana
cultivation.
Since the precursor molecules needed early in the pathway of THC are known,
increasing
these initial pathway substrates might result in more THC production. IPP and
DMAPP
are the starting materials for terpenes. Upregulating the genes (isopentenyl
diphosphate
synthase and dimethylallyl diphosphate synthase) would provide this
possibility. These
gene sequences are known in other plants, therefore a model for isolation and
amplification of the Cannabis IPP and DMAPP synthase genes is available.
Another interesting experiment focuses around Cannabis flowers. Many roses
are
currently sold as so called, double roses. This is because they have two
whorls of petals,
not just one, as in typical roses. This was brought about not by genetic
modification, but
through discovery of a mutant double flowered rose. The mutant was
subsequently bred
with other roses to distribute the mutation through the offspring. Selection
for double
roses and crossing between double roses produced only double roses, so much
in fact,
that there are complete genetic lines of double flowered roses.
One of the most prominent desires from Cannabis growers is to increase yield.
Many
cultivators would rather grow one plant that yields 2 kilos than to grow five
or six plants
that produced this same amount. Luckily for Cannabis growers, a single gene
controls
flower size, at least in some plant species. Upregulating this gene then,
would be of huge
importance to the Cannabis community.
A different approach to making larger flowers in Cannabis would be to express
the gene
for petals. The transcription factors of the ABC flowering model could be
exploited to
facilitate this goal. Although Cannabis lacks petals, manipulation of the ABC
transcription factors could overcome this barrier.
Conversely, ignoring the petals and focusing on the sepals could produce a
similar
outcome. Luckily enough, the A transcription factor controls both sepal and
petal
production. Therefore, up-regulating the A transcription factor would likely
result in buds
with enlarged petals and sepals. Ultimately, different experiments would be
required to
find the best combination of which genes to up-regulate. In addition to
larger buds,
producing many more buds seems just as important.
60
Perhaps the goal should not be to make larger flowers or have more of them.
Considering
how plants make their food might equally result in an increase in growth of
its buds or at
least the time needed. For example, if the genes for photosynthesis are
upregulated,
conferring hyper-photosynthetic ability, may shorten the time needed to grow
Cannabis
in the vegetative stage. Cannabis producers could have the vegetative state
of Cannabis
finish in two months instead of four months.
The possibility also exists that one can manipulate the genetic expression of
trichomes.
The gene for trichome production has been found and described in detail. With
trial and
error, a Cannabis plant with twice as many trichomes might result in twice as
much THC.
Alternatively, the entire Cannabis plant can be discarded. Inserting THC-
synthesizing
genes into any plant that can be cultured in vitro is a possibility. Roses
with THC-
producing flowers may soon be available to everyday gardeners. The benefits
would be
obvious. Since roses are perennials, their flowers can be harvested every
year, sometimes
more than one time a year. Roses also have the unique characteristic of being
able to
bloom multiple times in a season, which would provide a continuous supply of
TCH-
containing flowers.
Before Cannabis consumers celebrate these transgenic advances with too much
excitement, there remains a caveat. If marijuana seed companies choose, they
might use a
method similar to that which the agricultural biotech seed companies have
chosen. For
example, in some transgenic food crops a suicide gene is inserted into the
seed so the
person harvesting the crop will be unable to use seed from that crop for
planting the
following year. The suicide gene essentially renders the seed infertile. This
was the
method that the large agricultural giant Monsanto used in their "terminator"
technology.
If a seed company has invested many months or years developing a plant, they
may deem
it necessary to protect its secrets and stay in business. For now at least,
marijuana seed
companies appear to be following a different philosophy than that of today's
corporate
agricultural giants.
61
10. Cannabis DNA Sequencing
All life uses deoxyribonucleic acid (DNA) to transmit information to its
offspring. In
eukaryotes (e.g., Cannabis and humans) DNA is contained in a nucleus, while
prokaryotes (e.g., Agrobacterium and other bacteria) lack a nucleus.
Bacterial DNA floats
within a localized region, often called the nuclear region. The DNA
represents the
organism's genetic material. The scale of view transforms along a finer
gradient from
chromosomes (or plasmids) to DNA to gene and finally to nucleotide bases.
Understanding how the order of nucleotide bases (adenine, thymine, guanine
and
cytosine) contributes to an organism is fundamental to understanding an
organism.
DNA sequencing began with scientists counting one base at a time. The bases
were
translated as patterns or marks on paper and identifying a base was done
manually. The
process was long and difficult, partly because it required the use of small
amounts of
radioactive materials.
The development of automated sequencing resulted in a rapid increase in the
number of
base pairs that could be read. Additionally, the accuracy and reliability
increased.
However, the DNA had to be moved through large slabs of a gel. The process
was less
labor intensive than counting manually and by hand as they did in the
beginning of
sequencing projects but still consisted of hours of careful work.
Recently there has been rapid progress in DNA sequencing technologies. This
has
claimed the name, next generation sequencing and represents most of the tools
currently
used in sequencing labs. However, the technology continues to evolve,
becoming
cheaper, faster, less labor intensive and more reliable. Researchers are now
trying to get
the enzyme that polymerizes (extends or makes more of) DNA to do sequencing
for
them. In this way, sequencing a DNA strand can be accomplished in real time
through the
work of an enzyme. Because enzymes are so fast in their reactions, using DNA
polymerase would throttle sequencing speeds to an unprecedented rate.
Currently, there is a mad race to learn the sequence of as many organisms as
possible.
Although this started with sequencing a bacterial virus, the trend quickly
spread to
include the human and model organisms (e.g., Arabidopsis, mouse, and yeast).
Knowing
an organism's genetic sequence provides a blueprint for manipulating and
experimenting
in order to discover biological secrets.
Since there is so much DNA sequencing data being discovered, there has
evolved large
databases to in which to deposit this digital data. The European Molecular
Biology
Laboratory (EMBL) is centralized in Heidelberg, Germany but also has other
extensions
across Europe. The portion of EMBL involved in DNA sequencing is often
referred to as
EMBL Nucleotide Sequence Database or, more succinctly, EMBL-Bank. It is
important
to understand that there is a physical laboratory and then there is also a
digital storage
component. This is the same situation for another large laboratory in Japan
called the
DNA Database of Japan (DDBJ).
62
The final database is called GenBank (in Bethesda, Maryland), which is part
of the
National Center for Biotechnology Information (NCBI). EMBL-Bank, DDBJ and
GenBank are the three large constituents that comprise an international
consortium of
bioinformatics data (essentially digital data). Each database is linked to
one another and
they exchange information daily. For instance, although the scientists who
sequenced
THCA synthase were from Japan and deposited their gene sequence data in DDBJ,
people in Europe and North America also have access to this sequence. In
fact, anyone
with an Internet connection has free access to any sequence data deposited in
any of these
three databases.
1 atgaattget cageatttte ettttggttt gtttgcaaaa taatattttt etttetetea
61 tteaatatee aaattteatt agetaatect caag a&aact t-CGttaaatg cttctcggaa
121 tatattccta acaatccagc aaateeaaaa tteatataca eteaacacga ccaattgtat
181 atgtctgtec tgaattcgac aatacaaaat ettagatt-ea c-ctctgatac aaceecaaaa
241 ecactcgtta ttgtcaetee ttcaaatgte tcecatatee aggccagtat tctctgetec
301 aagaaagttg gtttgeagat tcgaaetega agcggtggee atgatgctga gggtttgtec
361 taeatatctc aagtcceatt tgctatagta gacttgagaa acatgcatac ggtcaaagta
421 gatattcata gecaaaetgc gtgggttgaa gccggageta cccttggaga agtttattat
481 tggatcaatg agatgaatga gaattttagt tttcctggtg ggtattgccc tactgttggc
541 gtaggtggac actttagtgg aggaggctat ggageattga tgcgaaatta tggccttgcg
601 get gat a at a teattgatge acacttagtc aatgttgatg gaaaagttet agatcgaaaa
661 tccatgggag aagatctatt ttgggctata egtggtggag gaggagaaaa ctttggaatc
721 attgeagcat ggaaaatcaa acttgttgtt gtcccateaa agccLactat atteagtgtt
781 aaaaagaaca tggagataca tgggcttgtc aagttattta acaaatggca aaatattget
B41 tacaagtatg acaaagattt aatgctcacg actcacttca gaaetaggaa tattaeagat
901 aatcatggga agaataagac tacagtacat ggttaettct cttccatttt tcttggtgga
961 gtggatagfcc tagttgactt gatgaacaag agetttcefcg agfctgggtat taaaaaaact
1021 gattgeaaag aattgagctg gatfcgataca accatcttct acagtggtgt tgtaaattac
1081 aacactgeta attttaaaaa ggaaattttg cttgatagat cagctgggaa gaagaegget
1141 ttctcaatta agttagacta tgttaagaaa ctaatacctg aaactgcaat ggtcaaaatt
1201 ttggaaaaat tatatgaaga agaggtagga gttgggatgt atgtgttgta cccttacggt
1261 ggtataatgg aigagatltc agaatcagca alLccaH.cc ctcafccgagc tggaataatg
1321 tabgaacttt ggtacactgc lacctgggag aagcaagaag ataacgaaaa gcatataaac
1381 tgggttcgaa gtgtttataa tfctcacaacg ccttatgtgt cccaaaatcc aagattggcg
1441 tatctcaatt atagggacct tgafctfcagga aaaactaabc ctgagagtcc taataattac
1501 acacaagcac gtatttgggg tgeaaagtat tttggtaaaa attttaacag gttagttaag
15&1 gtgaaaacca aagctgatcc caataatfctt tttagaaacg aacaaagtat cccacctctt
1621 ccaccgcatc atcat
The DNA sequence of THCA synthase, the protein responsible for THCA
synthesis. The sequence of nucleotides is translated into an amino acid
sequence, which constitutes the THCA enzyme.
63
5 Nucleotide
( Go ) ( Clear)
ATCT
TCTV
Limits | Preview/Index | History | Clipboard | Details |
Format: GenBank FASTA Graphics More Formats T
GenBank: AB212639.1
Cannabis sativa gene for tetrahydrocannabinolic acid synthase, partial cds,
strain:066
Features Sequence
LOCUS
DEFINITION
ACCESSION
VERS I OH
KEYWORDS
SOURCE
ORGANISM
REFERENCE
AUTHORS
TITLE
JOURNAL
PUBMED
REFERENCE
AUTHORS
TITLE
JOURNAL
AB2 12839 1635 bp DNA linear PLN 01-AUG-2006
Cannabis sativa gene for tetrahydrocannabinolic acid synthase,
partial cds, strains066.
AB2 12839
AB212839.1 Gl!81158001
Cannabis sativa (hemp)
Cannabis sativa
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spcrmatophyta; Magnoliophytaj eudicotyledons; core eudicotyledons;
rosids; eurosids I; Rosales; Cannabaceae; Cannabis.
1
Kojoma,M., Seki,B., Yoshida,S. and Muranaka,T.
DNA polymorphisms in the tetrahydrocannabinolic acid (TBCA)
synthase gene in "drug-type" and "fiber-type" Cannabis sativa L
Forensic Sci. Int. 159 (2-3), 132-140 (2006)
16143478
2 (bases 1 to 1635)
Ko joma,M.
Direct Submission
Submitted ( 05-MAY-2005 ) Hareshige Kojoma, The University of Tokyo;
457 kano, minami-izu 415-0304, Japan
( E-mail : ko j oma@ uf .a. u-tokyo.ac. jp, Tel ! 81-558-62-002 1)
Screenshot of the NCBI web site. Searches can be performed many different
ways including key words, nucleic acid sequences, or proteins sequences.
There are thousands of different proteins, all encoded by different sequences
of
nucleotides (e.g., adenine, guanine, cytosine, and thymine). Imagine finding
a DNA
sequence that coded for an enzyme that gobbled up hazardous waste, rapidly
removed
carbon from the atmosphere and could combat global climate change,
synthesized a life-
saving drug, or that could break down garbage in city dumps or pollutants in
streams.
These examples highlight just a few of the reasons why knowing as many
sequences as
possible is beneficial. Knowing the sequence of an organism allows
researchers and
bioinformaticists to tease out these important protein biomachines. There are
many
methods of DNA sequencing, with so-called next generation sequence methods
gaining
popularity because of its affordability and increase in data output.
Before a complete Cannabis genome sequence is provided to the public, a more
affordable and abbreviated sequence may arrive first. This technique is
called a cDNA
library, much like a library where people borrow books. When a plant makes a
protein it
64
must obey the central dogma of biology and the central dogma is fundamental
to any
biology student. The central dogma is logical in its flow and can be easily
understood
upon closer inspection.
The central dogma of biology states that a gene is the sequence of nucleotide
bases that
resides on a chromosome within the nucleus. A gene has the ability to be
turned on or off.
When a gene is turned on, it produces a transcript called messenger RNA, or
mRNA.
This mRNA is moved from the nucleus to the cell cytoplasm where it is
translated by
ribosomes. Ribosomes clasp the mRNA, which then allow binding of amino acid-
carrying molecules called transfer RNA, or tRNA. This is an extremely
macroscopic
view, as the actual events are based on subatomic interactions that happen in
a fraction of
a second.
The amino acids that arrive on the tRNA are attached in an order that
compliments the
sequence of the mRNA strand. Each amino acid brought to the mRNA has a unique
side
chain that interacts with its environment. The interaction with all of these
different side
chains (one for each of the 20 amino acids) elicits different properties that
make it unique
to the function of the protein to which they are incorporated. Since every
DNA sequence
is slightly different, organisms can produce a huge variety of amino acid
sequences that
fold into many different enzymes.
Regardless, the entire central dogma starts with a gene, which is then
changed into
mRNA, and ends with a gene product (a protein). One important tool used in
sequencing
today is the cDNA library. This is the representation of all or most of the
expressed genes
in a tissue at any given time. To make a cDNA library the mRNA is first
isolated from a
tissue or organ. Using enzymes within a small reaction tube, this mRNA strand
is reverse
transcribed back into DNA. The molecule remaining is complimentary DNA, or
cDNA.
Thus, a collection of cDNA sequences is called a cDNA library. These can be
sequenced
and compared to known sequences in the large public databases such as
GenBank.
65
Constructing a cDNA Library
Isolate Cannabis mRNA
jverse trans
1^
I
ce s_
I'
Outsource sequencing
1-2 weeks
Obtain sequences
Analysis
Use data to create transgenic lines
*
An overly simplified depiction of how to sequence expressed genes from
Cannabis. cDNA library construction is routinely done for many organisms and
often found in databases as expressed sequence tags (ESTs).
Obviously, there will be many different genes being produced in any cell at
any time. For
instance, flowers will have different cDNA sequences then sequences from a
root cell.
Different biotechnology companies provide complete cDNA construction kits,
and all
cost relatively modest amounts. However, one can also choose to send isolated
Cannabis
RNA to a company that will construct and sequence a cDNA library for an extra
charge.
However, some Cannabis cDNA sequences do exist. As mentioned, the public
database
GenBank is a repository full of digital information and can be freely
searched. Currently,
the majority of sequences available in this database are from a hemp plant,
what most
Cannabis cultivators would not find very interesting. However, it can be used
to study
other aspects of Cannabis. There are also a handful of Cannabis sequences
from other
researchers as well. Since this information is publically available, anyone
with an Internet
connection has access. With such huge amounts of genetic data and so few
researchers
mining the information, potential discoveries are waiting to be found this
very moment.
66
11. Molecular Tools
There are a plethora of molecular tools being used in molecular biology
today. Covering
them all would be far beyond the scope of this book. However a few important
and
common methods are covered. Reading this chapter will certainly help in
understanding
greater detail on how transgenic plants are made.
Perhaps the tool that any individual wanting to learn plant biotechnology
must become
familiar with is the polymerase chain reaction (PCR) This process was
developed in the
1970's and has been a crucial advancement to the development in all areas of
molecular
biology and biotechnology. Starting with a DNA sample, any sequence from that
sample
can be amplified in sufficient quantities to perform further experiments. The
entire
process takes only a few hours.
It is important to make many copies of a DNA segment (a gene) because the
gene of
interest must be amplified in large numbers before any other experiment can
proceed.
Since there are many different genes along a DNA strand, the first step is
identifying at
least a portion of the gene sequence that one is interested in isolating.
For example, isolating the THCA synthase gene requires starting with a sample
of DNA
that contains the specific DNA sequence that codes for the THCA synthase
protein. This
particular sequence on the DNA would be found in virtually any Cannabis
plant. The
total genomic DNA (DNA isolated from the nucleus) is placed in a small test
tube. In
addition, single stranded DNA fragments are added called primers that are 20
bases long.
The primers are added in very high concentrations because they get used up
each time the
gene is amplified. Because the primers have the exact opposite sequence of
the gene of
interest they bind and are able to anneal (or bind to) to the DNA molecule.
Ideally, the
primers flank the sides of the gene.
Primer 1- tacttaacgagtcgtaaaag
Primer 2- cacttttggtttcgactaggc
In the test tube there is also an enzyme called DNA polymerase. This was
discussed
previously when discussing how plasmids replicate at the oh region. As is the
case with
both making more plasmid or more of a gene, DNA polymerase can only bind to
double
stranded DNA. Therefore, when the primers bind to their complementary sites
along the
DNA sample, DNA polymerase is then allowed to attach and begin to polymerize
a new
fragment of DNA. Momentarily, however, in order to allow the DNA polymerase
to
make more of the gene of interest, such as the THCA synthase gene, the double
helix of
DNA must first become a single helix to allow primers to bind.
The details of this mechanism rely on manipulation of temperatures. To
separate out the
DNA double helix in the sample, the sample tube is heated to 94°C/201°F. The
high
67
temperature melts the two genomic DNA strands apart from one another. A
sudden drop
in temperature to ~55°C/131°F allows the smaller primers to find and anneal
to the single
stranded genomic DNA. Once the primers are in place, the temperature rises to
72°C/162°F and the DNA polymerase is activated and polymerizes a new strand
of DNA,
in our example, the sequence for THCA synthase. Since the primer is at a much
higher
concentration than genomic DNA, repeating the series of temperature cycles
allows DNA
polymerase to amplify a specific fragment of genomic DNA.
Often the PCR is carried out in a small machine that is automated to change
temperatures
very quickly. The changes in temperature that allow for separating the double
helix
strands, allowing primers to bind and activating DNA polymerase, can continue
for many
cycles. The more cycles of this pattern of temperatures will allow for more
gene product
to be amplified. Even if a homologous sequence is known, primers can be made
based on
that sequence and a researcher can at least try to amplify a desired gene.
This amplified gene product, or PCR product, can then be slightly modified
and
successfully transferred and ligated into a suitable vector such as a
plasmid. This is
because the PCR product is a perfect double stranded piece of DNA with a
single base
overhang on each end. This makes the ends "sticky", which means they are able
to fit
attach to another, complimentary end of DNA. For this reason, some plasmids
are
designed to have a single base overhang that compliments the PCR product.
Putting the
plasmid into a small tube with the PCR product provides the chance for these
two pieces
of DNA to stick together. The enzyme DNA ligase seals the bond between the
overhangs
that have hopefully found one another.
The ligated plasmid can then be successfully put into Agrobacterium . This
can be done
via electroporation or heat shock. Once Agrobacterium takes up the plasmid,
successful
genetic transformation of plant calluses can occur.
Often, when the PCR method is finished, the DNA polymerase, ions, and bits of
small
nucleotides (like excess primers) must be removed before the PCR product can
be used.
This requires using a small block of gel that rests within a box. The PCR
reaction is put
into a small hole, or well, of the gel. The box is able to harbor a current
of electricity so
the DNA molecules separate. Since DNA contains lots of negatively charged
phosphates,
it migrates toward the positively charged end of the box. This procedure is
aptly called
gel electrophoresis.
68
A gel electrophoresis apparatus used for separating DNA bands of various
sizes. DNA moves towards the positive (red) end and away from the negative
(black) end.
The image taken from a gel electrophoresis is often shown on popular TV
programs.
Usually this follows a crime scene investigation. There are apparent bands,
which mean
nothing to the actors, and the viewers are supposed to infer some meaning.
Television
grossly exaggerates reality and fails to explain anything with any clarity.
In the real
world, understanding what the bands mean and how they became apparent is in
fact
necessary.
Importantly, the rate that the PCR product moves through the gel depends on
its length. A
longer piece of DNA will not be able to travel very fast through the gel, and
so remains
closer to the end of the box where it was inserted into the gel well. Smaller
fragments of
DNA travel faster through the gel and so a band farther down from the well
implies the
fragment is smaller in length. The size of each band infers something about
the size of the
DNA molecule, which represents the actual band. To make the bands become
visible a
special dye is added to the gel and a light is applied, similar to eliciting
the green
fluorescence from GFP. The difference is that the bands glow and a picture
can be taken
and later analyzed.
If desirable, the band of DNA can be cut from the gel using a sharp blade.
The small
piece of gel is placed in a tube and a series of clean up reactions is
performed to remove
69
the gel but leave the DNA behind. This DNA can be used in further
biotechnological
applications or assays.
The US Drug Enforcement Agency (DEA) employs scientists who use specific
primers
that bind to particular regions of Cannabis DNA. They often use many
different
sequences of primers, which yields many different banding patterns. Since the
Cannabis
has genetic varieties across the nation and globe, not all primers will bind
to the same
regions of Cannabis DNA and, thus, patterns of bands will naturally be
observed. This is
what is referred to as the genetic fingerprint. The genetic fingerprint can
be helpful in
tracking where marijuana supplies are flowing from and, with enough samples,
even
specific routes of transport can be elucidated.
Determining if a gene has been successfully transferred and is being
expressed in a
Cannabis plant requires extraction of the RNA. The gene in the plant should
be present
and if expressed, it will be in the form of mRNA. If the expression of the
gene is
detected, then one can rightfully confirm successful transformation. As most
molecular
biologists know, working with RNA can often be tricky due to ubiquitous
degradating
enzymes. However, techniques can be employed to ensure proper experimental
control.
In any case, if one is careful enough, a procedure called a northern blot can
be carried out
for confirming that a transformation experiment was successful. Once the
Cannabis
mRNA is extracted it can be separated on a gel and then transferred to a
nylon
membrane. Similarly, it can be directly spotted onto a nylon membrane. A
single stranded
DNA probe that has the capability of fluorescence or radiating a mark onto a
special film
is applied to the nylon membrane. If the single stranded DNA probe finds an
opposite
sequence of mRNA on the nylon membrane, it will successfully bind. The nylon
membrane is washed in special reagents. When placed under light a signal of
fluorescence will be detected if the mRNA was originally present.
Methods and machines also exist to quantify the amount of mRNA at any given
time. In a
process called quantitative real time PCR (QRT-PCR), an RNA sample is
amplified,
similar to regular PCR. However, the PCR machine used is connected to a
detector that
can monitor the accumulation of the PCR product. This results in the ability
to work in
reverse and determine the original quantity or RNA that was present. Again,
if the RNA
is not present, the primers will not be able to bind and amplify anything, so
nothing will
be detected by the QRT-PCR machine.
Another method similar to the northern blot is called a southern blot. It
uses similar
principles but is used with DNA instead of RNA. Western blots are also used
in
molecular biology. These use neither RNA nor DNA and instead are used in
studying and
detecting proteins.
Many techniques also exist to take a gene back out of a plasmid. This might
be desirable
if a person was to put their plasmid into a bacterial cell, then grow the
bacterial cell in
bulk. After spinning the bacteria and removing the media, a basic plasmid
extraction can
be performed. This leaves the researcher with a pellet of plasmid DNA that
contains a
70
gene of interest. The sites flanking the insert is known, so unique enzymes
that will snip
the insert out of the plasmid can be used. The resulting reaction can be
separated on a gel
as described earlier. The bands can be cut and cleaned for future use.
Some techniques rely on previously determined sequence data. If a cDNA
library is made
from Cannabis, then short sequences of ~50bp from these sequences can be
attached to a
glass slide in a matrix-like array, properly called a microarray. A person
can then isolate
mRNA from any Cannabis plant and place that mRNA sample onto the microarray.
Often, the plant sample obtained has recently been under salt stress, drought
stress, or any
biotic or abiotic influence. The mRNA is then added onto the microarray. The
glass slide
containing the ~50bp fragments may contain hybridized mRNA sequences and this
can
be confirmed by using a microarray scanner. Fluorescence is observed where
there are
hybridization points. This method can provide an entire genomic expression
profile for a
plant. From this, metabolic pathways, developmental regulation, and
environmental
response genes can be studied for expression patterns and levels.
One of the newest fields of molecular biology is using RNA molecules to bind
to and
inhibit mRNA sequences from making their way to the ribosome. For this reason
the
technique has been dubbed RNA interference (RNAi). Research has since shown
that the
joining of a 20-25 base pair long RNA molecule to a complimentary mRNA
strand,
initiates a degradation pathway, destroying the mRNA. In other words, the
mRNA leaves
the transcribed gene unable to make its way to the ribosome to be translated.
Because the
mRNA molecule is the blueprint for manufacturing a protein, the cell can't
function
properly and dies.
There are potentially detrimental effects RNAi could have on Cannabis
growers. For
example, RNAi could be used as an herbicide (targeting Cannabis). This might
consist of
applying plant vectors or naturally occurring plant viruses that have an RNAi
sequence.
The vector would then need to insert the RNAi into the plant cell.
Genetically modified
plant viruses could one day carry out this process.
RNAicide, a term coined from RNAi and herbicide, might someday replace
conventional
herbicides. In the case of eradication of Cannabis fields, RNAicide would
need to be
directed at a sequence-specific (and species-specific) mRNA target, thereby
initiating the
gene-silencing pathway. This view represents an extreme case of plant
biotechnology,
and is not yet being tested.
However, rather than targeting marijuana with a pesticide, just the opposite
is possible.
The gene for pesticide resistance can be inserted into marijuana. This has
been done for
multiple crop species including soybean and corn. The gene for pesticide
resistance also
has been inserted into cotton. In fact, of all the transgenic crops produced
in the world,
pesticide resistance is the most common trait that has been exploited. At
first glance it
may seem odd that humans have inserted a gene for pesticide resistance into
the major
crop species. Further inspection reveals the logic behind this situation.
71
Throughout history pesticides have been used to fight unwanted weed and
insect species
from encroaching on cultivated food. Pesticides include both insecticides
that target
insects and herbicides that target herbaceous plants (weeds). Chemical
companies
profited from pesticides by making billions of dollars, farmers could better
control their
land, governments obtained larger profits and less land was needed to obtain
greater
yield. It was not until Monsanto, perhaps now the worlds largest
agribusiness, inserted a
gene for herbicide resistance into crops that ultimately led to such
unforeseeable profits.
The most common gene used in pesticide resistant crops is resistance to
glyphosate.
Glyphosate is more commonly known as Roundup. What glyphosate does is it
inhibits a
plant's ability to manufacture amino acids that have an aromatic ring (a six
carbon circle)
attached. By inhibiting this metabolic pathway, which is called the shikimic
acid
pathway, a plant cannot manufacture functional proteins and dies.
Subsequently, the
enzyme is called 3-enolpyruvylshikimate-5-phosphate synthase, or EPSPS for
short.
Transgenic crops with glyphosate resistance have a variant form of EPSPS and
so are not
affected by glyphosate. The glyphosate herbicide is non-specific that is it
can inhibit any
green plant from making aromatic amino acids.
If a crop species such as corn is not inhibited by glyphosate a farmer is
able to apply this
herbicide across an entire field. Since the entire crop of corn has this gene
for glyphosate
resistance only the weeds surrounding the field will be killed. This leaves
more sun,
water and soil for the crop species and allows for easier production of the
crop.
This process has large implications for marijuana growers. First, if
cultivators are
growing their crop on many acres, glyphosate-resistant Cannabis could be
sprayed with
glyphosate and reduce competition from surrounding plants. This would
ultimately yield
larger quantities and therefore may require smaller space to produce more
Cannabis.
Secondly, the US government carries out glyphosate spraying on Cannabis
crops. If
producers were growing genetically modified Cannabis, application of
glyphosate would
have no effect on the plants. In fact, the US government would be doing a
favor to
growers by limiting the surrounding vegetation. One may wonder when the
successful
drug lords will begin investing in Cannabis biotechnology.
In summary, the mechanism for glyphosate resistance has been described in
greater
detail. The molecular function of the gene for resistance, EPSPS, has also
been described
in detail. Since this gene can be inserted into plants, glyphosate resistance
is potentially
less than a year from being reality. Other herbicides sprayed on Cannabis
crops also have
known resistance genes. Therefore, it is up to the researchers working on the
betterment
of Cannabis to transform these genes, in addition to glyphosate resistance,
in order to
preserve the vast fields of Cannabis product.
72
12. Marijuana Laws, Regulations, and Education
Before beginning any Cannabis research it is important to know the laws and
regulations.
Research laws vary among countries. Some states within the US have some of
the most
stringent laws on simple possession of marijuana while other states are more
progressive.
For example, California legalized medical marijuana in the mid 1990's.
Recently there
has been legislation initiated within California and Massachusetts to
legalize marijuana to
increase state revenues, possibly providing more than a billion dollar in
revenue.
The ease people can grow marijuana is obvious. After all, it evolved as a
weed and shows
its resilience by taking up residence in waste sites and along roadsides.
Among the plant
kingdom, its large equatorial range is difficult to surpass. It seems hopeful
that research is
becoming more progressive and research on Cannabis is becoming less
restricted.
Japan has produced some of the most recent research on elucidating the THC
pathway
and potentials for THC in biotechnology (Sirikantaramas et al., 2007).
However, science
is an international phenomenon and listing all who have contributed to
Cannabis research
is far beyond the scope of this book.
In other countries, especially in the United States, governments limit or
prohibit
Cannabis research. At least in the United States, this may be due to the fact
that the
politicians are making a portion of their salaries from alcohol sales tax.
Many people
think that marijuana, if legalized for recreational purposes, might be
incredibly difficult
to regulate by a government.
Limitations have also been placed on medical marijuana clubs and
repositories, which
were routinely raided by federal officials under the Bush Administration.
Since President
Barack Obama has taken office, his administration, specifically the Attorney
General Eric
Holder, has publically announced they will not interfere with state medical
marijuana
laws (i.e., no more federal raids). The Obama Administration has seemed so
progressive
on marijuana laws that the slogan, "Yes we cannabis" has emerged. (His
popularized
campaign slogan was "Yes we can".)
Much of the debate around marijuana seems to have emerged partly from the
U.S. anti-
marijuana campaign. This misinformation has greatly distorted the science
behind
marijuana. However, informative and objective literature has been circulating
among
scientific circles on the potentials of Cannabis and its influence on the
brain.
What is currently known about the physiological influences is that
marijuana's
psychoactivity can be attributed to cannabinoids, small molecules with a
distinct
molecular conformation that bind to distinct mammalian cell receptors. The
highest
concentrations of these cannabinoids are found in Cannabis flowers. Humans
too, make
cannabinoid-like compounds internally, called endocannabinoids. We have
subsequently
evolved cell receptors (proteins on our cells' plasma membranes) for these
internally
produced (endogenous) molecules to bind and cause a cascade of biochemical
reactions.
This reaction ultimately provides the euphoric feeling, or high, after
smoking. However,
73
the binding of THC to our cells' receptors is actually due to cross-
reactivity. In other
words, it's due to sheer chance that THC binds to cell receptors that
originally evolved to
allow endogenous molecules to bind.
While the cannabinoid-like compounds in our bodies (called endocannabinoids)
elicit the
same euphoric response as THC, they have a noticeably different molecular
structure.
Still, they have enough similarity in their overall molecular structures that
THC cross-
reacts and can bind the receptors to elicit a euphoric effect. The details of
the physiology
and underlying mechanisms of reactivity have recently been outlined in
explicit detail
(Berghuis, 2007).
Previous studies, which have warned of the negative effects of smoking
marijuana, were
exaggerated with faulty claims (Ponto, 2006). On the contrary, it has been
demonstrated
that mice given cannabinoids stimulates neuronal activity within certain
regions of their
brains. Indeed, endocannabinoids have been shown to play a large role in
facilitating
neuronal growth and development (Harkany et al., 2008). I have often wondered
if high-
ranking officials suppress marijuana because of its potential to produce new
ideas and
make people feel more spiritually empowered. If people were indeed able to
think for
themselves, they would not be so heavily dependent on a government's
direction on how
to live their lives through societal servitude.
Scientifically studying how Cannabis interacts with our nervous system could
be helpful
in many ways to the public. The diminishing use of alcohol would serve a
larger benefit
to all of society. This logic has repeatedly been presented from many
different groups
trying to both prohibit alcohol and to legalize marijuana. The fact remains
that drunk
drivers, child and spousal abuse, binge drinking, violence and harsh crimes,
cancers and
liver failure, and public stupidity almost always involve alcohol
consumption. In addition
to the nearly infinite list of dangers that alcohol offers, it is a
biological toxin and is used
routinely to kill microbes on surfaces, in wounds, etc. With so many negative
effects
stemming from alcohol, one should logically expect to see politicians
embracing safer
alternatives to alcohol, such as marijuana.
Public education has largely remained a grass-roots effort to discuss the
benefits and
science of marijuana, although Oxford University Press has recently published
the second
edition of, The Science of Marijuana. Popular culture (e.g., High Times) has
also aided
the effort to spread the facts on marijuana. Taken together, these means of
education
seem to be effective enough to have allowed marijuana to persist in our
culture. With the
rise of the biotechnology of Cannabis sativa, more people will undoubtedly
become
involved in working to understand and discuss potential benefits.
My own use of marijuana has helped stimulate an interest in the sciences and
ask more
questions about life. When I was in high school my interest level in learning
was below
zero. I barely graduated my senior year. Whether I was bored or not, I can't
remember. It
was a time of confusion and fear, not knowing much about myself and listening
to what
older people were telling me to do. There was little room for independent
thought.
74
When I was finished with high school, I joined the US Army. This wasn't odd,
considering many kids from my town used that as an option for immediate
escape into
the world. The military provided comfort in that I was with people my own
age, with
similar educational and socioeconomical background, and making friends came
fairly
easily. But then I ended up with a life-changing experience while I was
serving, one so
radical that many would not believe my story and so I dare not discuss it
within the
framework of this book.
I left the military and went back to my hometown. There, I learned about the
local
university, where kids were able to take classes of their choice and
interest. I enrolled and
within a few weeks I knew that college would be one of the most stimulating
things I
may ever encounter. But then, not long after I started my freshman year, I
met someone
who smoked marijuana. He was a regular user, probably more than regular
actually. I
smoked with him a few times and then I bought a small bag from him.
It was very unfamiliar to me. It was dry, smashed, and smelly. I took it home
to the
apartment where I lived alone. I didn't touch it for a few days. I read a
little more about
what it was and learned that it was a flower from a plant. Eventually, after
I was finished
reading for my modern world civilization class, I loaded a small pipe I had
bought, went
to my living room and I took some hits. My house suddenly became very quiet.
The small
sounds of the creaky floor and the wind against the windows were very crisp,
I was very
alert. At the same time my mind seemed to be speeding through hundreds of
ideas each
second.
First I was thinking about Akbar from the ancient Middle East, then Diderot
and his
encyclopedia, and then suddenly it was my houseplants and how they were
responding to
the dim light of my living room. My mind was simultaneously brought to an
ease that I
had never felt before. These two extremes, rapid flow of thoughts and
calmness of my
mind, switched back and forth repeatedly for quite some time. Everything in
my life
seemed to suddenly make sense and my purpose became obvious. I wanted to
learn as
much as I could while in college and make the most out of my life.
I also fell in love that night with a plant called Cannabis sativa. I had
found meaning to
my life, and the smoke from my pipe had given me clarity and purpose for
college. I
wanted to study my history more, while thinking of the role marijuana played
in shaping
it. I wanted to study my human anatomy and physiology book and think about
how
marijuana travels through and is metabolized by the human body. I wanted to
study my
plant taxonomy book and figure out where Cannabis fit into the diverse
kingdom. I
wanted to learn everything I could about everything there was.
Since my undergraduate years have passed, I have smoked less and less
marijuana.
However, I have not forgotten its effect on my life. I am grateful for this
plant and in
many ways I feel I am indebted to it. It has allowed me to grasp abstract
ideas in a more
concrete way and provided me opportunities that I otherwise would have never
had. It
has given me motivation and drive to learn. I know that this is not the
experience
everyone has after smoking marijuana. Some people who are introduced to it
smoke and
75
are not motivated to do anything. For me, the best times of my undergraduate
years were
reading quietly for long hours alone in my apartment then smoking and
thinking about
what I had just read. For others, they are caught in a vicious and
unproductive cycle of
television and video games; they use marijuana to zone out, to avoid the rest
of the world.
I can't say this is wrong, but I do wonder why Cannabis has opposite effects
on each
person. We need to give more scientific study this plant, both for its
biochemistry and its
potential in biotechnology.
Biotechnology may not be limited to Cannabis. For instance, those with the
ability to
invest large amounts of money into creating their own labs and hiring
competent plant
biotechnologists, may be able to create any plant with any drug they want.
Production of
a cocaine-producing plant that is tolerant of conditions in North America
would bring
billions in drug sales. It may also wipe out communities and increase
instability among
otherwise stable regions. This is not to say Cannabis biotechnology should
not be
pursued. Its use however should remain up to the individual.
One drawback of marijuana use may be when an individual shares their pipe or
other
device with friends they may also be sharing oral diseases. A recent opinion
article
argued that there might be an increase in the rate of oral cancers among
marijuana
smokers. This may not be due to marijuana smoke; rather it is possibly due to
passing
virus particles and germs from an infected individual to an uninfected
individual
(Zwenger, 2009). For instance, oral human papilloma virus (UPV), commonly
associated
with warts in all areas of the body but now being increasingly found in the
mouths of
younger people, might be one reason for the increase in oral cancers. UPV has
previously
been linked with vaginal and oral cancers.
Therefore, marijuana smokers should be cautious about sharing with anyone,
since
detection of UPV is uncommonly reliable by sight alone. This should not
discourage one
from smoking with friends. Rather it should serve as beneficial advice. It
should serve as
a warning to anyone who cares about his or her future health and safety to
retain their
own smoking device for themselves.
Knowledge such as this should not be looked upon as depressing. Indeed,
knowledge is a
good thing to posses, whether it is about how the universe operates, the
meaning of life,
or Cannabis (which often is the meaning of life for some people).
Understanding more
about Cannabis, which is one of the most intriguing plants that humankind has
ever
discovered, could allow humans to prosper far beyond their present state.
Changing the
genetic structure could prove even more beneficial by discussing its science,
chemistry,
and importance to human mental health.
The future is bright for Cannabis biotechnology. There could be no better
time to create
transgenic plants harboring select genes. This book has touched on some of
the unique
Cannabis plants that are waiting to be created. I leave it to the student of
plant
biotechnology to decide when to bring these ideas to reality. Improving
Cannabis
through biotechnology will most likely occur within the next decade. The only
question
that remains is, who will be the first to smoke if!
76
References:
Armbruster, W. S. "The role of resin in angiosperm pollination: ecological
and chemical
considerations.," Amer J Bot (71) 1986, pp. 1149-1160.
Berghuis, P., Rajnicek, A. M., Morozov, Y. M., Ross, R. A., Mulder, J.,
Urban, G. M.,
Monory, K., Marsicano, G., Matteoli, M., Canty, A., Irving, A. J., Katona,
I., Yanagawa,
Y., Rakic, P., Lutz, B., Mackie, K. and Harkany, T. "Hardwiring the brain:
endocannabinoids shape neuronal connectivity.," Science (316:5828), 2007, pp.
1212—
1216.
Bou-Torrent, J., Roig-Villanova, I. and Martinez-Garcia, J. F. "Light
signaling: back to
space.," Trends Plant Sci (13:3), 2008, pp. 108-114.
Cantrill, S. Nobel Prize 2008: Green fluorescent protein.," Nature Chem
doi:10.1038/nchem.75, 2008.
Conrad, C. Hemp for health: The medicinal and nutritional uses of Cannabis
sativa."
1997, Healing Arts Press.
Dafny-Yelin, M. and Tzfira, T. "Delivery of multiple transgenes to plant
cells.," Plant
Physiol (145:4), 2007, pp. 1 1 18-1 128.
Harkany, T., Keimpema, E., Barabas, K. and Mulder, J. "Endocannabinoid
functions
controlling neuronal specification during brain development.," Mol Cell
Endocrinol
(286: 1-2 Suppl 1), 2008, pp. S84-S90.
Hazekamp, A., Ruhaak, R., Zuurman, L., van Gerven, J. and Verpoorte, R.
"Evaluation
of a vaporizing device (Volcano) for the pulmonary administration of
tetrahydrocannabinol.," J Pharm Sci (95:6), 2006, pp. 1308-1317.
Herer, J. "The Emperor Wears No Clothes: The Authoritative Historical Record
of
Cannabis and the Conspiracy Against Marijuana.," 2000, Quick American
Archives.
James, C. "Global Status of Commercialized Biotech/GM Crops: 2005.," 2005,
ISAAA,
Ithica, NY.
Johnston, J. S., Pepper, A. E., Hall, A. E., Chen, Z. J., Hodnett, G.,
Drabek, J., Lopez, R.
and Price, H. J. "Evolution of genome size in Brassicaceae.," Ann Bot (Lond)
(95: 1),
2005, pp. 229-235.
Kirst, M., Johnson, A. F., Baucom, C, Ulrich, E., Hubbard, K., Staggs, R.,
Paule, C,
Retzel, E., Whetten, R. and Sederoff, R. "Apparent homology of expressed
genes from
wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis
thaliana.," Proc
Natl Acad Sci USA (100:12), 2003, pp. 7383-7388.
77
Lydon, J., Teramura, A. H. and Coffman, C. B. "UV-B radiation effects on
photosynthesis, growth and cannabinoid production of two Cannabis sativa
chemotypes.," Photochem Photobiol (46:2), 1987, pp. 201-206.
Marks, L. A., Kalaitzandonakes, N., Wilkins, L., Zakharova. "Mass media
framing of
biotechnology news.," Public Under st Sci (16:2), 2007, pp. 183--203.
McCullen, C. A. and Binns, A. N. 'Agrobacterium tumefaciens and plant cell
interactions
and activities required for interkingdom macromolecular transfer.," Annu Rev
Cell Dev
Biol (22), 2006, pp. 101-127.
Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K.
and Ohme-
Takagi, M. "NAC transcription factors, NST1 and NST3, are key regulators of
the
formation of secondary walls in woody tissues of Arabidopsis.," Plant Cell
(19: 1), 2007,
pp. 270-280.
Mukherjee, A., Roy, S., De Bera, S., Jiang, H., Li, X., Li, C, Bera, S.
"Results of
molecular analysis of an archaeological hemp (Cannabis sativa L.) DNA sample
from
North West China.," Genet Resour Crop Evol (55:4), 2008, pp. 481-485.
Murashige T. and Skoog, F. "A revised medium for rapid growth and bioassays
with
tobacco tissue cultures.," Physiol Plant (15:3), 1962, pp. 473-497.
Pertwee, R. G. "Cannabinoid pharmacology: the first 66 years.," Br J
Pharmacol (147
Suppl 1), 2006, pp. S163-S171.
Pichersky, E., Noel, J. P. andDudareva, N. "Biosynthesis of plant volatiles:
nature's
diversity and ingenuity.," Science (311:5762), 2006, pp. 808-811.
Pontes, D. S., Lima-Bittencourt, C. I., Chartone-Souza, E. and Nascimento, A.
M. A.
"Molecular approaches: advantages and artifacts in assessing bacterial
diversity.," JInd
Microbiol Biotechnol (34:7), 2007, pp. 463-473.
Ponto, L. L. B. "Challenges of marijuana research.," Brain (129:Pt 5), 2006,
pp. 1081-
1083.
Reyes-Prieto, A., Weber, A. P. M. and Bhattacharya, D. "The origin and
establishment of
the plastid in algae and plants.," Annu Rev Genet (41), 2007, pp. 147—168.
Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J. D. G.
"Pathological hormone
imbalances.," Curr Opin \ Plant Biol (10:4), 2007, pp. 372-379.
Robinson, R. "The great book of hemp: The complete guide to the
environmental,
commercial, and medicinal uses of the world's most extraordinary plant.,"
1996, Park
Street Press, Rochester, VT.
78
Romeis, J., Meissle, M. and Bigler, F. "Transgenic crops expressing Bacillus
thuringiensis toxins and biological control.," Nat Biotechnol (24: 1), 2006,
pp. 63—71.
Sheen, J., Hwang, S., Niwa, Y., Kobayashi, H. and Galbraith, D. W. "Green-
fluorescent
protein as a new vital marker in plant cells.," Plant J (8:5), 1995, pp. 777—
784.
Sirikantaramas, S., Morimoto, S., Shoyama, Y., Ishikawa, Y., Wada, Y.,
Shoyama, Y.
and Taura, F. "The gene controlling marijuana psychoactivity: molecular
cloning and
heterologous expression of Delta 1-tetrahydrocannabinolic acid synthase from
Cannabis
sativa L.," J Biol Chem (279:38), 2004, pp. 39767-39774.
Sirikantaramas, S., Taura, F., Morimoto, S. and Shoyama, Y. "Recent advances
in
Cannabis sativa research: biosynthetic studies and its potential in
biotechnology.," Curr
Pharm Biotechnol (8:4), 2007, pp. 237-243.
Sirikantaramas, S., Taura, F., Tanaka, Y., Ishikawa, Y., Morimoto, S. and
Shoyama, Y.
"Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana
psychoactivity,
is secreted into the storage cavity of the glandular trichomes.," Plant Cell
Physiol (46:9),
2005, pp. 1578-1582.
Smith, R. "Plant tissue culture: Techniques and experiments.," 2008, Academic
Press.
Soltis, D. E., Ma, H., Frohlich, M. W., Soltis, P. S., Albert, V. A.,
Oppenheimer, D. G.,
Altman, N. S., dePamphilis, C. and Leebens-Mack, J. "The floral genome: an
evolutionary history of gene duplication and shifting patterns of gene
expression.,"
Trends Plant Sci (12:8), 2007, pp. 358-367.
Stewart, S. "Plant biotechnology and genetics: Principles, techniques and
applications.,"
2008, Wiley-Interscience.
Taura, F., Dono, E., Sirikantaramas, S., Yoshimura, K., Shoyama, Y. and
Morimoto, S.
"Production of Delta(l)-tetrahydrocannabinolic acid by the biosynthetic
enzyme secreted
from transgenic Pichia pastoris.," Biochem Biophys Res Commun (361:3), 2007,
pp. 675—
680.
Taura, F., Sirikantaramas, S., Shoyama, Y., Shoyama, Y. and Morimoto, S.
"Phytocannabinoids in Cannabis sativa: recent studies on biosynthetic
enzymes.," Chem
Biodivers (4:8), 2007, pp. 1649-1663.
Thomson, J. "Tactics for male reproductive success in plants: contrasting
insights of sex allocation theory and pollen presentation theory.," Integr
Comp Biol
(46:4), 2006, pp. 390-397.
Thorpe, T. A. "History of plant tissue culture.," Mol Biotechnol (37:2),
2007, pp. 169-
180.
79
Vaughan, D. A., Balazs, E. and Heslop-Harrison, J. S. "From crop
domestication to
super-domestication," Ann Bot (Lond) (100:5), 2007, pp. 893--901.
Venter, M. "Synthetic promoters: genetic control through cis engineering.,"
Trends Plant
Sci (12:3), 2007, pp. 118-124.
Wang, Q. and Guanming S. "Industrial Hemp: China's experience and global
implications.," Rev Ag Eco, (21:2), 1999, pp. 344-57.
Yuan, Z.-C, Haudecoeur, E., Faure, D., Kerr, K. F. and Nester, E. W.
"Comparative
transcriptome analysis of Agrobacterium tumefaciens in response to plant
signal salicylic
acid, indole-3 -acetic acid and gamma-amino butyric acid reveals signalling
cross-talk and
Agrobacterium-plant co-evolution.," Cell Microbiol (10:11), 2008, pp. 2339-
2354.
Zwenger, S. "Bogarting that joint might prevent oral F£PV among Cannabis
users.," Curr
Oncol. (16), 2009. In Press.
80
Appendix A
Presented here is a representative list of genes with the potential to be
used for
transforming (or up-regulating) into Cannabis plants. Gene symbols are given
along with
the complete name, which also may describe the function. Although these were
originally
described in the model plant Arabidopsis thaliana, they most likely have
analogous
sequences in Cannabis sativa. It should be noted that this is not an
exhaustive list and
many other genes could be transformed into Cannabis. For example, the gene
for the
ability to make tendrils, which are simply modified leaves, is not listed.
Gene Symbol
Complete Gene Name
ABC
Aberrant chloroplasts
ABS
Abnormal, aborted seeds
ACW
Altered cell wall
ADO
Adagio
AESP
Separase
AFO
Abnormal floral organs
ALAC
Alarm clock
ALE
Abnormal leaf shape
AN
Angustifolia
AS
Asymmetric leaves
BAL
Ball
BAM
Big apical meristem
BDY
Buddy
BIF
Bifid stigma
BLB
Blueberry
BNS
Bonsai
BPE
Bigpetal
BSH
Bushy plants
BST
Bristled
BUD
Bulkhead
BUS
Bushy
CA
Caespitosa
CAF
Carpel factory
CBB
Cabbage
CEL
Callus expression of RBCL
CHP
Chlorophyll mutant
CLV
Extra carpels
CLY
Early flowering
COD
Cone head
CTS
Comatose
CUT
Altered epicuticular wax
CYL
Cyclops
DFL
Dwarf in light
81
DIS Distorted trichomes
DLS Delayed leaf senescence
DM Dangerous mix
DPR Drought and pathogen resistant
DRA Dracula
DRO Drought tolerant
DSR Dark green leaves, stunted roots
DVL Devil
DWG Dwarf gigantica
DYA Dyad
EAF Early flowering
ECL Early curly leaf
EEP Early extra petals
ELF Early flowering
ELG Elongated
ELL Extra long lifespan
ER Erecta
ERH Ectopic root hair
ERT Early trichomes
ESI Elongated, stout internodes
ESK Eskimo
EXC Extra cells
EXI Exigua
FAC Embryonic factor
FAF Fantastic four
FAX Fewer axillary branches
FDH Fiddlehead
FE Late flowering
FEY Forever young
FIT Flower in flower
FIL Filamentous flower
FKD Forked
FLH Flowering H
FLK Flaky pollen
FTR Fat root
GCT Grand central
GGL Gargoyle
GI Gigantea, late flower
GLM Gollum
GLO Glabrous, chlorotic
GMB Gumby
GRA Grandifolia
GRE Glyphosate responsive
GRM Gremlin
GTR Glassy trichome
HAP Hapless
82
HBT Hobbit
HCA High cambial activity
HIC High carbon dioxide
HIO High oil (altered seed content)
HOR High expression of abiotic responsive gene
HRT Heartless
HST Hasty
HYV High vigour
IAD Increased apical dominance
ICA Icarus
ICU Incurvata
IKU Haiku
IMP Impotent
IRN Yellow-green
ITN Increased tolerance to NaCl
IVR Invasive root
JAG Jagged
JAW Serrated leaves
JSN Jason
KAK Kaktus
KEG Keep on going
KEU Keule
KIP Kinky pollen
KJK Kojak
KYP Kryptonite
KNB Knobhead
LAD Late anther dehiscence
LEM Leaf morphogenesis disrupted
LHW Lonesome highway
LIT Lions tail
MAA Magatama
MAD Male gametophytic defective
MAL Marbled leaves
MFO Multifolia many leaves
MIC Mickey
MOD Mosaic death
MSH Many shoots
NOC No cotyledons
NOT Loves-me-not
NPG No pollen germination
NSM Insomniac
NZZ Nozzle
OLT Old timer
OMO Odd man out: male meiosis defective
ORB Orbiculata
PAC Pale cress
83
PAN
Extra perianth organs
PBH
paintbrush
PBO
Peek-a-boo
PBR
Polar bare
PCK
Peacock
PCL
Phytoclock
PEP
Pepper
PHD
Pothead
PI
Pistillata
PIC
Pinocchio
PKL
Pickle
PLT
Plethora
PLU
Pluto
PNT
Peanut
POL
Poltergeist
PRA
Prairie
PRK
Peter Parker
PRS
Pressed flower
QBL
Quibble
QRT
Quartet
QUA
Quasimodo
RAT
Resistant to Agrobacterium transformation
RBE
Rabbit ears
RBY
Ruby
RCK
Rock-n-rollers
RCU
Recurvata
RD
Rotundata
RED
Red light elongated
RFI
Rastafari
RGM
Rapid germination
RLP
Revertant for leafy petiole
RNT
Runt
RON
Rotunda
ROU
Rouge
RTY
Rooty
RUG
Rugosa
SAB
Sabre
SAG
Sagittatus
SAW
Sawtooth
SCA
Scabra
SCF
Scarface
SCN
Supercentipede
SDD
Stomatal density, distribution
SEA
S errata
SHD
Shepherd
SHI
Short internodes
84
SHN
Shine
SHV
Shaven
SLK
Seuss-like
SLO
Slowcoach
SLOMO
Slowmotion
SMB
Sombrero
SML
Stamen loss
SNO
Snoball
SNV
Supernova
SPCH
Speechless
SPK
Spock
SPR
Spiral
SPS
Supershoot
SPT
Spatula
SRB
Shoot and root branching
SSE
Shrunken seed
STA
Satchel
SUP
Superman
SWE
Sweetie
TARA
Tarantula
TASTY
Tasty
TAX
Trichome anthocyanin expansion
TBR
Trichome birefringence
TCU
Transcurvata
TDL
Trichome density locus
TFA
Things fall apart
TIL
Tilted
TIN
Tinman
TIO
Two-in-one
TLZ
Tlazolteotl
TMM
Too many mouths
TNY
Tiny
TOAD
Toadstool
TOP
Tower of Pisa
TPL
Topless
TRL
Troll
TRN
Tornado
TRY
Triptychon
TWD
Twisted dwarft
UCN
Unicorn
ucu
Ultracurvata
UFO
Unusual floral organs
ULA
Hula
ULT
Ultrapetala
UMA
Umami
URM
Unarmed
85
URO
Upright rosette
UTC
Up the creek
Uzi
Unzipped
VAR
Variegated
VCH
Vertically challenged
VEP
Vein patterning
VHE
Van Helsing
VHI
Vascular highway
VIR
Virescent
WAG
Wag
WAR
Wax restorer
WCO
White cotyledons
WDY
Woody
WER
Werewolf
WHG
Warthog
WIG
Wiggum
WLC
Wavy leaves, cotyledons curled back
WOL
Wooden leg
WOW
Wonderwoman
WVS
Wavy sepal
WYR
Wryd
XS
Extra-small sisters
XTG
Extinguisher
YAB
Yabby
YAK
Yakka
YDA
Yoda
YEL
Yellow
YI
Yellow inflorescence
YOR
Yosemite resistance
YSV
You're so vein
YUC
Yucca
ZEU
Zeus
ZIG
Zig zag stem
ZLL
Zwille
ZPL
Zeppelin
ZPY
Zippy
ZWG
Zwergerl
ZWI
Zwichel
86
Appendix B
Provided here is a small representation of the many biotechnology companies
that are
currently selling useful products for plant biotechnology research. Each
company varies
by product and location, while some companies specialize in only certain
products.
Needless to say, there are many other companies in addition to the ones
listed here.
-Bio-Rad, http://www.bio-rad.com
This company sells electroporation equipment, although these devices are
often very
expensive. They also sell a huge variety of molecular research tools and
reagents for labs
ranging from labs with high-tech needs to high school labs.
-Carolina Biological Supply Company, http://www.carolina.com
This is primarily a company that specializes in classroom kits and products.
However,
they also sell callus initiation media, containers and dishes for plant
tissue culture, and
pre-made sterile media.
-Eppendorf, http ://www. eppendorf . com
This is perhaps one of the world's largest suppliers of biotechnology
equipment and sells
plastic-ware and pipettors to distribute cells and small amounts of liquid.
-Lucigen Corporation, http://www.lucigen.com
This international company sells different kits to splice and cut genes into
different
vectors and have established themselves as a reliable source for
biotechnology research.
Additionally, they offer cDNA library construction.
-pGreen, http://www.pgreen.ac.uk
pGreen is part of the biotechnology resources for Arable Crop Transformation
(BRACT),
located in the UK. This is one of the best resources for purchasing strains
of
Agrobacterium. Agrobacterium cells that have been transformed with GFP can be
purchased here as well.
-Hoffmann-La Roche, http://www.roche.com
Although best known for its biomedical supplies, this Swiss company is a
giant in the
biotechnology industry and sells enzymes and cells, which may be pertinent to
some
experiments in plant biotechnology.
-Sentryair Purification Systems, http://www.sentryair.com
This company specializes in providing sterile working conditions, that is
crucial in plant
biotechnology experiments. They offer a huge selection of laminar flow hood
models and
sizes.
Sigma-Aldrich, http://www.sigmaaldrich.com
A huge chemical supply company with locations in multiple countries that
sells
chemicals of all kinds. Some of its newest products focus on RNAi research.
87
-Streamline Laboratory Prodcuts, http://www.streamlinelab.com
This company offers laminar flow hoods, PCR hoods, ductless hoods, and tissue
culture
hoods. They supply many different models with a variety of price ranges.
88
Glossary
2,4-dichlorophenoxyacetic acid (2,4-D)- an auxin hormone that causes cell
division and
root formation
abscisic acid- a cytokinin used to promote cell division and shoot formation
achene- a type of fruit that has
agar- polysaccharide used to solidify media
Agrobacteirum- bacteria used to infect plants and transfer foreign DNA
alternation of generations- the life cycle of plants that alternates between
a haploid
gametophyte and a diploid sporophyte
annual- a plant that lives for only one year
antibiotic- chemical that can inhibit cells from growing
apical dominance- the case where a terminal bud suppresses the growth of
lateral buds
archaea- one of the three domains of life that is composed of extremophiles
asexual propagation- process where cuttings of a plant can be re-grown into
complete
organisms
Asteraceae- the sunflower or composite plant family
auxin- plant hormone involved in root formation and used in tissue culture
bacteria- one of the three domains of life that contains most bacteria; a
single celled
prokaryote
biotechnology- the process where cells are manipulated for desirable genetic
outcomes
bud- a general term for a flower
callus- an undifferentiated mass of plant cells
callus media- growth substrate used for growing bits of plant stem into
calluses
calyx- term used for that includes all of the sepals
Cannabaceae- the Cannabis and hops plant family
89
Cannabis sativa- the scientific name for marijuana plant
carbohydrate- an organic molecule such as cellulose or glucose that can be
used for
energy
carpel- the female reproductive part of the flower
cDNA library- a collection of sequences that represent actively transcribed
genes
cell- the smallest unit of life; many cells constitute a tissue
cell wall- the outer layer of the cell that serves to protect and maintain
the contents of the
cell
cellulose- large polysaccharide that is the main constituent of plant cell
walls
central dogma of biology- fundamental process of biology where a gene is
transcribed
into mRNA, which is then translated into a protein
chromosome- the piece of DNA that harbors genes, it is composed of many
nucleic acids
co-cultivation- process in plant tissue culture that allows time for the
Agrobacterium to
infect the callus
complimentary DNA (cDNA)- reverse transcribed mRNA that represents an
expressed
gene
corolla- term for all the flower petals combined
cytochromes- plant proteins responsible for detecting various wavelengths of
light
cytokinins- plant hormones that can induce cell division and shoot formation
cytoplasm- the intracellular matrix in which organelles, proteins and
molecules are
suspended in
deoxyribonucleic acid (DNA)- a polymer that is the genetic material of all
life
dimethylallyl pyrophosphate/diphosphate (DMAPP)- molecule used in the
synthesis of
terpenes
diploid- having two copies of each chromosome
electroporation- process where Agrobacterium is induced to take up foreign
DNA using
an electric shock
90
endosymbiosis- an even that occurred early in the evolution of life and led
to eukaryotic
organisms
enzyme- a protein that acts as a catalyst to speed up a reaction
epidermis- the outermost layer of plant tissue
ethylene- a small gaseous molecule that is also a plant hormone that speeds
fruit ripening
eukaryote- an organisms that has double-membrane structures and a nucleus
explant- term used for the bits of plant stem that are placed onto the
culture media
family- a classification groups that many plant taxonomists are familiar with
flower- the reproductive structure of angiosperms
funiculus- the small stalk that connects the seed to the pericarp
gene- sequence on DNA that can code for a protein
gene gun- device used to transfer foreign DNA into cells using high velocity
microbeads
gene stacking- transferring many foreign genes simultaneously
genome- the complete set of genes an organism posses
gibberellins- plant hormones that can increase height of a plant
glucose- a carbohydrate monomer that is used for energy or in biosynthesis to
create
larger polymers
green fluorescent protein (GFP)- a barrel-shaped protein
haploid- having a single copy of a gene
heat shock- process of briefly heating a bacterium to make it take up foreign
DNA
hemp- a low THC-containing Cannabis plant known for its tough fibers
homology- having similar sequence or structure in two different species
indole-3 -acetic acid (IAA)- an auxin plant hormone that stimulates root
production and
cell division
isopentenyl pyrophosphate/diphsphate (IPP)- a carbon building block used in
terpene
91
biosynthesis
isoprene- a five carbon molecule, which is often the product of terpene
degradation
kanamycin- antibiotic used to select for transgenic calluses
kilobase (kb)- a thousand bases
kingdom- one of the highest ranks of classification, which includes plants,
fungi, animals
and protists
laminar flow hood- an enclosed chamber that uses a negative air pressure to
maintain
sterile working conditions
Leguminosae- plant family of beans
lignification- the process of laying down lignin in the cell wall
lignin- a polysaccharide that gives strength and rigidity to the plant cell
lipid- one of the four macromolecules of life that are the main constituents
of cell
membranes
meristematic region- location of actively dividing cells
messenger RNA (mRNA)- the molecule synthesized from the DNA template used to
make a protein
mevalonate- the end product of the mevalonate terpene pathway that occurs in
the
cytoplasm
microbe- a microscopic organism, usually refers to either bacteria or fungus
molecule- a compound made up of multiple elements, e.g. a water molecule
morphology- the overall appearance or shape
morph- abbreviation for morphology
Musharige-Skoog (MS) media- the most commonly used plant tissue culture media
for
developing calluses into plants
nanometer (nm)- a billionth of a meter
northern blot- technique used to confirm expression of a gene
92
nucleotide base- component of nucleic acids that can be either adenine,
guanine, cytosine,
thymine, or uracil
nucleus- the area of a eukaryotic cell where chromosomal material is stored
organogenesis- the process by which totipotent cells develop into shoots and
roots
perennial- a plant that lives more than one year
pericarp- the outer layer of the fruit
petal- floral whorl in plants often colored to act as an attractant
Petri dish- plastic or glass plate used to culture or keep cells
phenolic ring- a circularized six carbon molecule
photoperiod- the length of daylight that is one method plants use to detect
seasonality
photosynthesis- the process of converting radiant energy into chemical energy
plasmid- an extra chromosomal piece of DNA, often circular in shape
plastid- a plant organelle in the cytoplasm that can make or store food
polymerase chain reaction (PCR)- a series of heating and cooling that results
in
amplification of a gene product
polysaccharide- a polymer of sugar subunits
prokaryote- a single celled organism that lacks a nucleus; a bacteria
promoter- region of a gene that helps dictate the rate at which mRNA is made
protein- a polymer of amino acids that is often an enzyme
reporter gene- a gene used in biotechnology to confirm transformation
resin- a complex mixture of plant secondary metabolites in a liquid matrix
reverse transcription- process where an mRNA molecule is made back into DNA
root hairs- often microscopic protrusions of the roots that increase surface
area
secondary xylem- wood
sepal- a subunit of the calyx; the floral bract at the base of most flowers
93
southern blot- molecular biology tool that allows detection of a gene
species- the classifying unit in biology that falls under genus
spore- a microscopic asexual unit capable of generating an entire organism
stamen- the male reproductive part of a flower
terpene- a large class of plant secondary metabolites
tetrahydrocannabinol (THC)- the main psychoactive component of Cannabis
THCA synthase- the enzyme responsible for converting cannabigerolic acid to
THCA
tissue- similar cells working together
tissue culture- technique where plants can be grown in vitro
totipotency- having the capability to turn into any type of cell
transcription- conversion of DNA to mRNA
transcription factor- small protein that helps regulate transcription
transfer DNA (T-DNA)- part of the DNA that is transferred from Agrobacterium
to a
plant cell
transfer RNA (tRNA)- small RNA molecule that carries the amino acid to the
site of
protein synthesis
transgenic- term used for an organism that has been genetically modified
transpiration- process where water moves from roots and through the xylem and
out of
the stomata
trichomes- modified epidermal cells that can help in water retention
tween20- a mild detergent used to wash freshly cut stems
up-regulation- process where a gene is expressed at a higher rate
western blot- method used in molecular biology to study proteins
xylem- part of the vasculature of plant that conducts water
94
GGTCTCGAAACJLTTGGAAG<yUirrTTCAACATTG<^TACTGGGCCAGTCTAAAACTTK^TAAAAAaCCGTTAA«
. i. l"l 'J . -"1 AGATCAAG GGCAACATCTGCAATTGTTAAAGG GAGC AG GC IV _' . G
iAGCAGGGTCTrGCCCATTAXTGTAAAGGATT'l rAAATACCCCGI rCAC _Y.l
I hope you enjoyed this scientific-based book on the exciting field of plant
biotechnology
with a special focus on its relationship with Cannabis sativa, commonly known
as
marijuana. This world-renowned herb has captured the interest of nearly every
culture on
every continent for hundreds, and in some instances, thousands of years.
Although, now
in the twenty first century, crop plants are being genetically modified to
better suit the
needs of society, marijuana has not received the same level of attention.
This book describes the merging of two important subjects, marijuana and
plant
biotechnology. Marijuana's role in the biotechnology age is outlined and
described in this
book with the equal hopes of encouraging research to improve this plant and
to inspire
young people to pursue a lifetime of learning.
About the Author:
Sam is a graduate student studying plant biotechnology at the University of
Northern
Colorado. Although his research focuses on plant terpenoids, he has secondary
interests
that include astronomy, music, and the role of science in society.
95
top related