static-content.springer.com10.1007... · web viewthe growing medium composed of 4.4 g/l ms+vitamins...
Post on 07-Apr-2018
218 Views
Preview:
TRANSCRIPT
Supplementary online information
Detailed Materials and Methods, extension to Manuscript Part 2
2.1. Cell growth
Cells (Zea mays Black Mexican Sweet (BMS)) were grown in suspension in 25 mL aseptic
solution in 250 mL beakers, shaken at 100 rpm in dark, and subcultured every two weeks. The
growing medium composed of 4.4 g/L MS+vitamins (sigma M-6899, Murashige and Skoog
Basal Salts), 3% sucrose, 40 µL/L 2,4-D, 0.2 g/L asparagine, at pH 5.7. The medium for cells
grown with silicon (+Si cells) was supplemented with 2 mM Na2SiO3 (Sigma 33844-3) and pH
titrated with 1 M HCl solution (approximately 950 µL in 800 mL solution). The cells grown
without additional silicon (-Si cells) were supplemented with 1 M NaCl added to the same
concentration of HCl.
2.5. Transmission Electron Microscopy (TEM)
Cells cultured for 14 days were pelleted, and a drop of pellet was placed in an aluminum disc
with a 100 m-deep cavity and covered with a flat disc. The sample was then high-pressure
frozen in a HPM 010 high-pressure freezing machine according to the manufacturer's
specifications (Bal-Tec, Liechtenstein). Cells were subsequently freeze-substituted in an AFS2
freeze substitution device (Leica Microsystems, Vienna, Austria) in anhydrous acetone
containing 2% glutaraldehyde and 0.1% tannic acid for 3 days at -90°C and then warmed up to
-30°C over 24 hours and washed 3 times in anhydrous acetone at room temperature. Samples
were then incubated for 1 hour with 1% osmium tetroxide in anhydrous acetone, washed 3
times in anhydrous acetone and infiltrated in a series of increasing concentration of Epon resin
(Agar Scientific, UK). After polymerization at 60°C, 70 nm sections were mounted on a
Quantifoil (Germany) R 3.5/1 grid. Imaging and elemental mapping were performed in a
Tecnai F20 transmission electron microscope (FEI, Eindhoven, The Netherlands) operating at
200 kV and equipped with a Gatan Imaging Filter (GIF, Gatan) as well as with an UltraScan
1000, 2K x 2K CCD camera. Silicon maps were obtained at the L2,3 ionization edge using the
3 windows method.
2.6. Expression level of the silicon transporters, quantified by real-time PCR
Cells cultured for 14 days were washed twice in DDW and frozen at -80°C. RNA was isolated
from 250 mg cells using ZR plant, RNA miniprep kit (Zymo research, USA). Next, cDNA was
prepared using RevertAid H Minus Reverse Transcriptas kit (Fermentas: Thermo Fisher
Scientific Inc), according to the manufacturer's instructions. Specific primers were synthesized
(Sigma Aldrich, Rehovot Israel) to amplify the cDNA of the maize silicon transporters (Table
1S). Maize Ubiquitin (gi248338) [1] was used as a reference for normalizing the cDNA
amounts. The expression level of the transporters was measured in the presence of Platinum
1
SYBR GREEN qPCR reaction mix, (Invitrogen technologies, USA), in an ABI PRISM 7300
(Applied Biosystemsinc, USA), according to the manufacturer's specifications. The reaction,
in a final vol. of 20 l was heated to 95°C for 10 min., followed by 40 cycles of 95°C for 15
sec and 60°C for 1 min. Analysis was done on three technical replicates (meaning cell samples
grown in the same vessel), and three biological replicates (meaning cells grown in different
growth cycles). Data analysis was carried out by 7300 system SDS software study
application's software.
Table 1S: Primer sequences used to amplify targets on the transcribed sequences of silicon
transporters and ubiquitin genes.
Reverse primerForward primerGeneCGAGAGAAGAGCGACACATAGACGGACCTACACCTACATCCGCTTCLsi1 [1]AGAAGCACTGTTGGCACGTTCTCGCTGCTCGTCTTCTTCTLsi2AAACCAGCAAAGCCAGACACATTGGCTGAGAGAGTGAGTGAGAGALsi6 [1]CAGGTCCATTAAACCAACGAAGACAACATCCAGAAGGAGAGCACUbiquitin [1]
Reference
1. Moshelion M, Hachez C, Ye Q, et al. (2009) Membrane water permeability and aquaporin expression increase during growth of maize suspension cultured cells. Plant Cell Environ 32:1334–1345. doi: 10.1111/j.1365-3040.2009.02001.x
2
Supplementary Figures
Figure 1S: The development of cell culture under silicon supplementation. The medium
pH (A) and osmolarity (B) and the cells' fresh weight (C) were measured during 15 days of
cells growth. Each point is an average of three biological replicates (meaning cells grown in
different vessels). Bars represent standard deviation. Every biological replicate is an average
of three technical measurements (meaning cell samples grown in the same vessel). No
differences were found between the +Si (black) and -Si (gray) cells.
3
Figure 2S: Micrographs of the cell cultures. Samples supplemented with silicon and starved
for silicon were indistinguishable. A) Cluster of cells under a light microscope. B) The same
cells in calcofluor-white staining, staining the cell wall -glucan chains. C) Light micrograph
of a section through cell cluster. D) The same cross section stained with calcofluor-white. E)
Cross section embedded in Epon resin, stained for starch (arrows) by iodine. F) Transmission
electron micrograph of section of the cells, showing vesicles in the cytoplasm. Arrows mark
the amyloplast bodies.
4
Figure 3S: Expression levels of the silicon transporters. The Y-axis represents the relative
level of expression of the transporters, calibrated to ubiquitin. In the -Si cells we detected a
statistically significant increase in the expression of ZmLsi1 (x1.8) and ZmLsi2 (x2.2), but not
of ZmLsi6. Averages of three biological replicates are reported. Bars represent standard errors.
Letters within each panel represent significantly different groups (based on t-tests).
5
ZmLSi6ZmLSi2ZmLSi1
Relative expres
Figure 4S: Relative rates of the weight loss of commercial cornstarch treated with Si or
salt solution, reflecting pyrolysis as a function of increasing temperature. Starch was
immersed overnight in 2 mM sodium silicate, where the pH was corrected by HCl, or water
supplemented with NaCl in a concentration similar to that of the HCl. The samples were
rinsed three times in deionized water, and dried at 65°C for two days. The maximal rates of
pyrolysis of the salt-treated sample (306°C) is lower than the Si-treated sample (310°C).
6
Figure 5S: Raman spectroscopy of cell walls before amylase treatment. The spectra are
identical between the samples supplemented with silicon and those starved for silicon.
Comparing to commercial cornstarch shows that most of the scattering peaks are of the starch.
The marked peaks represent aromatic rings (1607, 1630 cm -1), and amide I protein bond, (1660
cm-1), missing from the starch spectrum. The protein peak is reduced after starch degradation
(compare to Fig. 5).
7
top related