role of vesicle-associated membrane protein 2 in glucagon ...€¦ · role of vesicle-associated...
Post on 30-Apr-2020
3 Views
Preview:
TRANSCRIPT
Role of Vesicle-Associated Membrane Protein 2 in Glucagon-
like Peptide-1 Secretion
by
Samantha K. Li
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Physiology
University of Toronto
© Copyright by Samantha K. Li (2013)
ii
Abstract of Thesis
Role of Vesicle-Associated Membrane Protein 2 in Glucagon-like
Peptide-1 Secretion
Samantha K. Li
Master of Science
Graduate Department of Physiology
University of Toronto
2013
Glucagon-like peptide-1 (GLP-1) is an incretin hormone produced by the enteroendocrine
L-cell that potently stimulates insulin secretion. Although signaling pathways promoting GLP-1
secretion are well characterized, the mechanism by which GLP-1 containing granules fuse to the
L-cell membrane remain elusive. RT-PCR and protein analysis indicate that vesicle-associated
membrane protein 2 (VAMP2) is expressed and localized to secretory granules in the murine
GLUTag L-cell model. VAMP2, but not VAMP1, interacted with the core SNARE complex
protein, Syntaxin 1a, in GLUTag cells. Tetanus toxin (TetX) cleavage of VAMP2 in GLUTag cells
prevented glucose-dependent insulinotropic peptide (GIP)- and oleic acid (OA)-stimulated GLP-1
secretion, as well as K+-stimulated exocytosis from GLUTag cells. Although components of
membrane rafts were detected in GLUTag cells, their role in GLP-1 secretion remains to be
determined. Together, these findings indicate an essential role for VAMP2 in GLP-1 exocytosis
from the GLUTag cell.
iii
Acknowledgments
When one door closes, another opens – I don’t think I could have picked a better door to
walk through. First and foremost, I would like to thank my supervisor Dr. Patricia Brubaker for
her support and guidance throughout my Master’s project. In the past two years, Pat has taught me
to be a better student, scientist, and person. To that extent, I am forever grateful. I would also like
to thank my Supervisory committee (Drs. Feng and Gaisano) for their invaluable input and advice.
This project could not be done without the help and supplies provided by several people. I
would first like to thank Dr. Gaisano, for being a collaborator and providing vital feedback
throughout my project. With respect to materials, the Gaisano lab has also provided several of the
antibodies and plasmid vector constructs used. I would particularly like to thank YouHou and
HuanLi for their expertise in SNARE-related western blots, as well as help in finding the reagents.
To Dr. Dan Zhu, thank you for teaching me about TIRF microscopy – you have been a wonderful
mentor and collaborator. To Battista, thank you for spending numerous hours spent on the confocal
microscope; although the experiments did not work, I can confidently say I have the knowledge
on how to use ANY microscope. I would also like to thank Dr. Trimble for the VAMP2-GFP
construct, and Drs. Wheeler, Steiner, and Miyazaki for the MIN6 cells.
The Brubaker lab is definitely the most warm and supportive lab that one could be a part
of—thank you for making the past two years such an enjoyable experience. I would especially like
to extend gratitude towards the girls (Jasleen, Charlotte, and Kaori) for always having my back,
and for always being there for a coffee run, a laugh, or a hug. To each of you I am indebted.
To Mom and Dad – thank you for the allowing me to terrorize the house while writing my
thesis. I would not be where I am today without the unconditional love and support of my family.
To my loving partner Larry – words cannot express how important you are to me. Thank you for
iv
gluing me back together every time I fall apart. To my dog Gigi – thank you for being the worst
study partner ever. To my friends – thank you for being there. I am a horrible and forever
unavailable friend and don’t deserve half the level of support. I would especially like to thank
Herman for fixing my grammar and Derek for his knowledge in new scientific techniques.
It has been a long but memorable two years: frustrations with successes, sleepless nights
with dreary days, and challenges with lessons learned. It was a period in which I have grown
immeasurably, both as a person and a scientist. I am thankful for the incredible experience that
being a part of the Brubaker lab has endowed, and am looking forward to the journey ahead. Now
onward.
v
Table of Contents
Abstract of Thesis ........................................................................................................................... ii
Acknowledgments .......................................................................................................................... iii
Table of Contents ............................................................................................................................ v
List of Figures .............................................................................................................................. viii
List of Tables .................................................................................................................................. x
List of Abbreviations ..................................................................................................................... xi
Introduction ................................................................................................................................ 1
Rationale ............................................................................................................................. 1
GLP-1 .................................................................................................................................. 2
1.2.1 Incretin Effect ......................................................................................................... 2
1.2.2 Discovery of GLP-1 ................................................................................................ 3
1.2.3 GLP-1 Synthesis ..................................................................................................... 5
1.2.4 GLP-1 Secretion ...................................................................................................... 6
1.2.5 GLP-1 Bioactivity ................................................................................................... 9
1.2.6 GLP-1 Degradation ............................................................................................... 11
1.2.7 Models of the Enteroendocrine L-cells ................................................................. 11
Primary L-cell Models ............................................................................................... 12
Immortalized L-cell Models ...................................................................................... 12
1.2.8 Discovery of SNAREs & the SNARE Hypothesis ............................................... 15
vi
1.2.9 Neurotoxins ........................................................................................................... 20
1.2.10 SNAREs in Endocrine Cells ................................................................................. 21
1.2.11 SNAREs in Membrane Rafts ................................................................................ 23
Hypothesis and Specific Aims ................................................................................................. 24
Materials and Methods ............................................................................................................. 25
Cell Models ....................................................................................................................... 25
3.1.1 GLUTag ................................................................................................................ 25
3.1.2 MIN6 ..................................................................................................................... 25
RNA Analyses .................................................................................................................. 26
Neurotoxins ....................................................................................................................... 27
3.3.1 Bacteria Culture and Vector Isolation ................................................................... 27
3.3.2 Transfection of GLUTag cells .............................................................................. 30
Activation of Tetanus Toxin ............................................................................................. 30
Protein Analyses ............................................................................................................... 31
3.5.1 Protein Isolation .................................................................................................... 31
3.5.2 Co-Immunoprecipitation ....................................................................................... 31
3.5.3 Western Blot ......................................................................................................... 32
Microscopy ....................................................................................................................... 34
3.6.1 Construct Detection .............................................................................................. 34
3.6.2 TIRF ...................................................................................................................... 34
GLP-1 Secretion Assay ..................................................................................................... 35
vii
Cholesterol Depletion ....................................................................................................... 36
Statistical Analyses ........................................................................................................... 37
Results ...................................................................................................................................... 37
SNARE complex proteins are expressed in GLUTag cells .............................................. 37
VAMP2 is localized to granules, and interacts with Syntaxin 1a from the SNARE
acceptor complex in GLUTag cells .................................................................................. 37
Neurotoxins cleave SNARE proteins in GLUTag cells .................................................... 42
Inactivation of VAMP decreased stimulated secretion of GLP-1 and granular
exocytosis from GLUTag cells ......................................................................................... 47
Membrane rafts ................................................................................................................. 50
Markers of Cholesterol handling in GLUTag cells ........................................................... 56
MβCD treatment depleted cholesterol from MIN6 cells, but not GLUTag cells. ............ 56
Discussion ................................................................................................................................ 58
Reference List .......................................................................................................................... 69
viii
List of Figures
1.1 Post-translational processing of the proglucagon prohormone .......................................... 4
1.2 Regulation of GLP-1 secretion in the L-cell ...................................................................... 7
1.3 Cleavage of VAMP isoforms by TetX ............................................................................. 17
1.4 The SNARE hypothesis ................................................................................................... 19
4.1 GLUTag cells express mRNA transcripts for SNARE complex and accessory proteins
............................................................................................................................................. 38
4.2 GLUTag cells express SNARE complex proteins ........................................................... 40
4.3 VAMP2 colocalizes to a granule marker in GLUTag cells ............................................. 41
4.4 VAMP2, but not VAMP1, interacts with core SNARE protein, Syntaxin 1a, in GLUTag
cells ..................................................................................................................................... 43
4.5 Neurotoxin transcripts are expressed in pcDNA3 vectors; pcDNA3 vectors can be
transfected into GLUTag cells ............................................................................................ 44
4.6 Neurotoxins cleave SNARE proteins at low efficiency in GLUTag cells ....................... 45
4.7 Activated TetX cleaves both VAMP2 and VAMP1 in GLUTag cells ............................ 46
4.8 VAMP2-GFP distribution is altered in the presence of TetX .......................................... 48
4.9 GLP-1 secretion is decreased in TetX-transfected GLUTag cells ................................... 49
4.10 Fusion events in pCMV-NPY-pHluorin and pcDNA3-transfected GLUTag cells ........ 51
4.11 Fusion events in pCMV-NPY-pHluorin and pcDNA3-TetX-transfected GLUTag cells
............................................................................................................................................. 52
4.12 Exocytotic events are decreased in TetX-Transfected GLUTag cells ............................ 53
4.13 GLUTag cells express mRNA transcripts for membrane raft markers as well as
cholesterol metabolism pathway proteins ........................................................................... 54
ix
4.14 MβCD treatment does not affect cell viability or GLP-1 secretion from GLUTag cells
............................................................................................................................................. 55
4.15 MβCD treatment did not deplete cholesterol in GLUTag cells ...................................... 57
x
List of Tables
1. List of RT-PCR primers and annealing temperatures…………………………………….…28
2. List of antibodies and conditions for western blots…………………………………………33
xi
List of Abbreviations
Abbreviations
ABCA1 ATP-binding cassette transporter 1
ABG5 ATP-binding cassette transporter gene 5
ABG8 ATP-binding cassette transporter gene 8
AC Adenylyl cyclase
ANOVA Analysis of variance
BoNT Botulinum neurotoxin
BSA Bovine serum albumin
cAMP Cyclic adenosine monophosphate
CCK Cholecystokinin
CDA Canadian Diabetes Association
DAPI 4'-6-Diamidino-2-Phenylindole
DIRKO Double incretin receptor knock-out mice
DMEM Dulbecco's modified eagle medium
DNA Deoxyribonucleic acid
DPPIV Dipeptidylpeptidase IV
EGFP Enhanced green fluorescent protein
Erk Extracellular signal-regulated kinase
FACS Fluorescence activated cell sorting
FAF-BSA Fatty acid-free bovine serum albumin
FATP4 Fatty acid transporter protein 4
FBS Fetal bovine serum
FFA2R Fatty acid receptor 2
FMIC Fetal mouse intestinal cells
FRIC Fetal rat intestinal cells
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GDP Guanosine diphosphate
GIP Glucose-dependent insulinotrophic peptide
GLP-1 Glucagon-like peptide-1
GLP-2 Glucagon-like peptide-2
GLUTag Proglucagon SV40 large T-antigen
GPCR G-protein coupled receptor
GPR G-protein coupled receptor
GRPP Glicentin-related polypeptide
GTP Guanosine triphosphate
HBSS Hank's balanced sodium solution
HMG-CoA reductase 3-Hydroxy-3-Methyl-Glutaryl-Coenzyme A reductase
IP Intervening peptide
LB Luria Bertani
LCFA Long chain fatty acid
xii
LDLr Low density lipoprotein receptor
mAChR1 Muscarinic acetylcholine receptor 1
MEK Mitogen-activated protein kinase kinase
MPGF Major proglucagon fragment
mRNA Messenger ribonucleic acid
MβCD Methyl-β-cyclodextrin
NPC1L1 Niemann-Pick C1-like 1
NPY Neuropeptide Y
OD540 Optical density at 540 nm
OEA Oleoethanolamide
PAM Peptidylglycine-α-amidating monooxygenase
PBS Phosphate-buffered saline
PC Prohormone convertase
PKA Protein kinase A
PKC Protein kinase C
PLC Phospholipase C
PVDF Polyvinylidene Fluoride
R Receptor
RIA Radioimmunoassay
RNA Ribonucleic acid
RT-PCR Reverse transcription polymerase chain reaction
SCFA Short chain fatty acid
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SGLT Sodium glucose transporter
SI Small intestine
SNAP Soluble NSF attachment protein
SNAP-25 Snaptosomal protein of 25 kDa
SNARE Soluble NSF attachment protein receptor
T2D Type 2 diabetes
TBS Tris-buffered saline
TBST Tris-buffered saline with 0.1% Tween 20
TetX Tetanus toxin
TFA Trifluoroacetic acid
TIRFM Total internal reflection fluorescence microscopy
VAMP Vesicle associated membrane protein
WHO World Health Organization
xiii
Symbols & Units
Α Alpha
Β Beta
bp Base Pair oC Degree Celsius
G Gram
H Hour
kDa Kilodalton
L Litre
M Milli
M Molar
Μ Micro
Min Minute
N Nano
Sec Second
Ζ Zeta
1
Introduction
Rationale
Diabetes has become one of the top 10 leading causes of death in high-income countries
(World Health Organization (WHO (1))). In 2013, the WHO reported that 347 million people in
the world have type 2 diabetes (T2D) (WHO (2)). Treatment of hyperglycemia includes increasing
insulin levels (endogenously or exogenously) and/or insulin action. Alternatively, GLP-1 is
released following nutrient ingestion, and potently stimulates insulin secretion when blood glucose
levels are elevated. GLP-1 related therapies are targeted towards inhibition of GLP-1 degradation
or direct activation of the GLP-1 receptor. These therapies are known to decrease blood glucose
levels, HbA1c, as well as body weight in some cases (1-7).
Adults with diabetes are at a higher risk to develop other deadly diseases such as
myocardial ischemia and hypertension (WHO (2)). Approximately 80% of diabetic patients die
due to cardiovascular-related complications (WHO (2)). These patients are often on several
different medications that could potentially cause adverse events. Fortunately, GLP-1 therapeutics
also have beneficial cardiovascular effects, decreasing blood pressure and atherogenesis (8).
An alternative approach to increase the biological actions of GLP-1 is to increase secretion
of GLP-1. GLP-1 is secreted in response to several factors, the signaling pathways for which have
been well characterized in the past three decades. However, the mechanism that mediate secretory
granule fusion to the L-cell membrane remain elusive. A better understanding of these mechanisms
may lead to the development of novel GLP-1 related treatments for T2D.
2
GLP-1
1.2.1 Incretin Effect
It is well known that increased blood glucose levels stimulate insulin secretion from the
pancreatic β-cell. However, the manner by which blood glucose levels are increased can greatly
affect the amount of insulin released. By increasing blood glucose levels orally, it was observed
that insulin secretion increased by 50-70% as compared to an isoglycemic intravenous load (9;10).
Scientists postulated that direct contact between nutrients and the gastrointestinal tract leads to the
release of a humoral factor by the intestinal mucosa essential in the potentiation of insulin secretion
(9;11). This phenomenon was deemed the incretin effect, and was later found to be modulated by
two insulin secreting (incretin) hormones: GIP and GLP-1.
In 1968, it was observed that infusion of crude cholecystokinin (CCK) preparations into
denervated canine stomach inhibited the secretion of gastric acid and pepsin, both of which play
important roles in the digestion of nutrients (12). Purification of these CCK preparations led to the
discovery of ‘gastric inhibitory peptide’ (aka GIP), a 43 amino acid peptide secreted by K-cells of
the duodenum (13-15). However, only infusion of supraphysiological concentrations of GIP were
able to inhibit gastric acid secretion in in humans (16). Instead, increased insulin secretion was
observed following GIP infusion in humans, but only under conditions in which blood glucose
levels were raised (17-19). Thus, GIP was renamed glucose-dependent insulinotropic peptide, in
order to preserve the original acronym. GIP secretion by the K-cells is stimulated in response to
direct contact with nutrients, such as glucose or fats (20). Biological effects of GIP also include:
increased lipogenesis, bone resorption, and hippocampal neurogenesis (21-25).
3
GIP immunoneutralization studies suggested the existence of a second incretin hormone,
as removal of GIP did not abrogate the incretin effect, but merely blunted it by approximately 30%
(26;27). Resection studies also hinted that the second incretin hormone was produced by the distal
gut, as removal of the ileum significantly decreased the amount of insulin secreted after an oral
load (28). This mysterious second incretin hormone was later found to be GLP-1. Double incretin
receptor knock out (DIRKO) mice are deficient in both GIP and GLP-1 receptors (29). Oral
glucose and intraperitoneal tolerance tests revealed that the incretin effect was completely
abrogated in DIRKO mice, confirming the roles of the two incretin hormones, GIP and GLP-1, in
the incretin effect (29).
1.2.2 Discovery of GLP-1
Following the creation of radioimmunoassays (RIA), glucagon-like immunoreactivity was
observed in the intestines of dogs, rats, and humans (30;31), suggestive that glucagon was not
exclusively expressed by the pancreatic alpha cells. However, glucagon immunoreactivity in the
intestines was only observed when antibodies targeting the mid-region of glucagon were used
(32;33). Immunostaining for mid-sequence glucagon confirmed expression of glucagon-
immunoreactive peptides in the pancreas, intestine, and brain (31;34-36). The intestine expressed
several glucagon-immunoreactive peptides, called enteroglucagon, which were higher in
molecular weight as compared to pancreatic glucagon (37). It was later discovered that both
pancreatic and intestinal glucagon-immunoreactive peptides were post-translational products of
proglucagon (Fig 1.1). First cloned from two separate mRNA transcripts from the anglerfish, both
proglucagon mRNA transcripts were found to encode for glicentin-related polypeptide (GRPP),
glucagon, and GLP-1 (38;39). In contrast, mammals only express one proglucagon mRNA
4
—NH2
IP2 GLP-1
—C GLP-2
N— GRPP GLP-1 IP2 —C GLP-2
N— Glucagon GRPP IP1
Glicentin
Glucagon IP1
Oxyntomodulin
N— GRPP Glucagon IP1 IP2 —C GLP-2 GLP-1
Major Proglucagon Fragment
PC2 Cleavage Sites PC1/3 Cleavage Sites Amidation by PAM
Legend
Figure 1.1 Post-translational processing of the proglucagon prohormone. Differential
post-translational processing of the proglucagon prohormone is dependent on the isoform of
prohormone convertase (PC). In the pancreas, PC2 cleaves proglucagon into GRPP, glucagon,
IP1, and MPGF. In the intestine and brain, PC1/3 cleaves proglucagon into glicentin or GRPP
and oxyntomodulin, as well as GLP-1, IP2, and GLP-2.
In Pancreas:
In Intestine & Brain:
Glucagon
N— GRPP IP1 IP2 —C GLP-2 GLP-1
Proglucagon Prohormone
5
transcript (40). Mammalian proglucagon mRNA transcripts encode for GRPP, glucagon, GLP-1,
and GLP-2 (41).
Since GLP-1 was found to be structurally similar to glucagon, effects of GLP-1 on the β-
cell were examined (42;43). At first, GLP-11-37 was thought to be biologically active, but was
found to have no effects on insulin secretion or plasma glucose levels (42;44). It was later
discovered that GLP-17-37 and GLP-17-36NH2 were the biologically active forms of GLP-1. GLP-17-
37 and GLP-17-36NH2 were able to potently stimulate insulin secretion and lower plasma glucose
levels (42;45). Although the other proglucagon derived peptides did not have effects on insulin
secretion, they were found to have effects on other organs. GLP-2 is an intestinal growth factor
that stimulates proliferation, blood flow, and increase barrier function (46;47). Glicentin stimulates
intestinal proliferation, and inhibits secretion of gastric acid and intestinal movement (47-49).
Oxyntomodulin also inhibits gastric acid secretion, intestinal motility, and food intake (48;50;51).
1.2.3 GLP-1 Synthesis
GLP-17-37 and GLP-17-36NH2 are 30-31 amino acid peptides produced by the open-type
enteroendocrine L-cell dispersed within the ileum and colon (25;52). GLP-1 is derived by post-
translational processing of the prohormone proglucagon (53). The proglucagon gene is located on
the long arm of chromosome 2 in humans and consists of 5 introns and 6 exons (25;54). The entire
proglucagon coding sequence resides in exons 2-5 (25;54). Proglucagon mRNA transcripts are
expressed in the pancreatic alpha-cells, intestinal L-cells, and some hypothalamic neurons
(34;55;56). Differential post-translational processing of proglucagon is dependent on the isoform
of prohormone convertase (PC) expressed (56). PC2, expressed in the pancreatic alpha cells,
cleaves proglucagon into GRPP, glucagon, and the major proglucagon fragment (MPGF) (57-59).
6
PC1/3, which is found in intestinal L-cells and hypothalamic neurons, cleaves proglucagon into
glicentin or GRPP plus oxyntomodulin, GLP-1, intervening Peptide 2 (IP2), and GLP-2 (53;57;59-
61). PC1/3 first cleaves GLP-1 into a 37 amino acid peptide; however, in order to confer biological
activity, PC1/3 must also cleave off the first 6 amino acids of GLP-11-37 (57;62). Peptidylglycine-
α-amidating monooxygenase (PAM) amidates the last glycine residue of GLP-17-37 (63). The
majority of GLP-1 is in the form of GLP-17-36NH2, and is biologicaly indistinguishable from GLP-
17-37 (63;64). Amidation is believed to increase GLP-1 half-life (63;64). The post translational
processing of proglucagon is depicted in Figure 1.1.
1.2.4 GLP-1 Secretion
GLP-1 is secreted in a biphasic fashion. In humans, early phase secretion occurs at
approximately 30 minutes after nutrient ingestion, whereas late phase secretion is seen 60-120
minutes after food intake (65). The major GLP-1 secretagogue signalling pathways are depicted
in Figure 1.2. Interestingly, both the biphasic pattern and time frame of both phases of secretion
are similar to secretion of insulin from the pancreatic β-cell (65).
Since nutrients do not come into direct contact with L-cells of the distal gut within 30
minutes of nutrient ingestion, scientists postulated that the first phase of GLP-1 secretion must be
regulated by an indirect signalling pathway. Rodent studies have shown that vagal innervation is
essential in mediating first-phase GLP-1 secretion (66;67). Hence, nutrients placed in the ligated
proximal duodenum of rats stimulated GLP-1 secretion from L- cells in the distal gut (66).
Placement of nutrients into the ligated duodenum or infusion of physiological concentrations of
GIP in rats subjected to a vagotomy completely abrogated GLP-1 secretion (66), confirming that
7
Oleic acid
Glucose
+
Na+
ψ SGLT1
FATP4 PKC
Gαs
GIP
MEK1/2 Insulin
Erk1/2
AC/ ↑ cAMP
PKA + Ca2+
K+
Gαq
Acetylcholine
PLC
PKC
Ca2+
Gαs
Intestinal Lumen
L-cell Blood Vessel
Neuron
Gαq
OEA
LCFA
SCFA
AC/ ↑ cAMP
PKA
Ca2+
PLC PKC
Ca2+
Figure 1.2 Regulation of GLP-1 secretion in the L-cell. GLP-1 secretion can be
stimulated by neurotransmitters (acetylcholine), hormones (insulin & GIP), nutrients
(glucose, oleic acid, long chain fatty acids (LCFA), short chain fatty acids (SCFA),
oleoethanolamide (OEA)), and by direct depolarization by a high K+ stimulus.
Actin Cytoskeleton
Ca2+
mAChR1
GPR119
GPR40-43&120
FFAR2
8
the connection between the duodenum and distal gut was through the vagus (66). It was further
suggested that nutrients come in direct contact with the K-cells of the duodenum and stimulate
GIP secretion, GIP then binds to its receptor on vagal afferent neurons and stimulates acetylcholine
secretion from vagal efferent neurons onto the distal gut (66). Acetylcholine then binds to the Gαq-
coupled muscarinic acetylcholine receptor 1 (mAChR1) on the L-cell and stimulates secretion of
GLP-1 (66;68;69).
The second phase of GLP-1 secretion is mediated by luminal nutrients (67;70-72). Since
the L-cell is an open type enteroendocrine cell, the microvilli of the L-cells can come into direct
contact with nutrients (52). Although glucose does not normally enter the distal gut, glucose has
been found to stimulate GLP-1 secretion from the L-cell (67;70;72;73). However, unlike the β-
cell, metabolism of glucose is not the primary trigger for exocytosis in the L-cell, as non-
metabolizable sugars can also stimulate GLP-1 release (74;75). Co-transport of glucose with
sodium through sodium glucose transporter 1 (SGLT1) leads to an accumulation of positive
sodium ions within the L-cell, which depolarizes the L-cell (70;76). This leads to the opening of
voltage gated Ca2+ channels, which increases intracellular Ca2+ concentrations, and stimulates
release of GLP-1 into circulation (70;76).
Fats, such as monounsaturated fatty acids (i.e.: oleic acid (OA)) can also potently stimulate
GLP-1 secretion (67;77-79). Once OA reaches the distal gut, it is transported into the L-cell by
fatty acid transport protein 4 (FATP4) (79). OA then directly activates protein kinase C ζ (PKCζ),
increasing its activity and stimulating Ca2+-independent GLP-1 secretion (77;78). In contrast, the
long chain fatty acid derivative, oleoylethanolamide (OEA), binds to its receptor GPR119, and
stimulates GLP-1 secretion through a cAMP/Protein kinase A (PKA)-dependent pathway (80).
9
Free fatty acids and other long chain fatty acids, are known to activate the G-protein coupled
receptors (GPR), GPR120 and GPR40, which stimulate GLP-1 secretion in a PKC-dependent
pathway (81;82). Short chain fatty acids, such as propionate, stimulate GLP-1 secretion in a Ca2+-
dependent manner by binding to the Gαq coupled free fatty acid receptor 2 (FFA2R) (83). However,
this finding may only apply to L-cells located in the colon, and not the distal small intestine (83).
Hormones, such as GIP and insulin, can also stimulate GLP-1 secretion from the L-cell
(67;77;83-85). On the L-cell, the GIP receptor is coupled to Gαs, activating protein kinase A PKA,
and leading to Ca2+-dependent secretion of GLP-1 (70;77). Although rare in human physiology,
insulin works in a feed-forward loop to stimulate its own secretion. Hence, insulin has been shown
to stimulate Erk1/2-dependent GLP-1 release, which would then bind to the GLP-1 receptor (GLP-
1r) on the ß-cell to stimulate insulin release (86;87). Interestingly, all of the secretagogues
mentioned above can also stimulate insulin release from the pancreatic β-cell (88).
1.2.5 GLP-1 Bioactivity
The GLP-1r is a class B G-protein coupled receptor expressed in several tissues including
the pancreas, gastrointestinal tract, heart, and central and peripheral nervous systems (25;89-91).
When secreted into the circulation, GLP-1 binds to its receptor and causes conformational changes
in the Gα proteins (92-94). This allows for the exchange of guanosine diphosphate (GDP) for
guanosine triphosphate (GTP), resulting in the activation of downstream pathways associated with
the Gα family. The Gα protein couples to the third intracellular loop of the GLP-1r (89;93;95);
depending on the tissue, the GLP-1r is known to couple to Gαs, Gαi, Gαq, and Gαo (92-96).
Once in the circulation, GLP-1 binds to its receptor on the β-cell and activates the
downstream effector protein adenylyl cyclase (AC) via Gαs (92;93;95). cAMP levels are increased,
10
which leads to the activation of PKA and exchange protein activated by cAMP. KATP channels are
then phosphorylated by PKA, closing of KATP channel, depolarizing the β-cell, which leads to
Ca2+-dependent insulin secretion as seen in the incretin effect (97;98). However, these effects can
only occur when blood glucose levels are elevated—once glucose levels are normalized, GLP-1
can no longer stimulate insulin secretion from the β-cell (99). In rodents, GLP-1 also promotes
insulin mRNA transcription, thereby increasing insulin biosynthesis (43;100;101). GLP-1 has also
been found to decrease β-cell apoptosis, stimulate proliferation of beta cells, and mediate
differentiation of β-cells (25;100;102-106).
GLP-1 is a favourable target for the treatment of T2D, as it also inhibits glucagon secretion,
slows gastric emptying, and suppresses food intake. Glucagon stimulates gluconeogenesis, which
can contribute to increased fasting blood glucose levels as seen in T2D patients. GLP-1 either
inhibits glucagon secretion directly or indirectly by stimulating secretion of somatostatin (107-
109). GLP-1 is released with peptide YY from the L-cells; these two hormones have been shown
to have additive effects on the inhibition of gastric acid secretion (110;111). Without gastric acid,
the rate of nutrient digestion and absorption is delayed; the GI tract senses the increase in
undigested nutrients and releases GLP-1, oxyntomodulin, and PYY, in response (112;113). This
signals to the brain to decrease food ingestion (111;113-115). GLP-1 can also act through the vagus
to suppress food consumption; however, the mechanisms are not fully elucidated (116).
Long-acting GLP-1 analogues, such as exenatide (synthetic analogue of exendin-4; a GLP-
1r agonist) and liraglutide (degradation resistant GLP-1 analogue), are used clinically for the
treatment of T2D (1-4). GLP-1 analogues lower blood glucose and HbA1c levels, and promote
weight loss. T2D patients often develop cardiovascular disease such as hypertension (117). GLP-
11
1 analogues have also been found to stimulate vasodilation via secretion of atrial natriuretic peptide
(118;119).
1.2.6 GLP-1 Degradation
The half-life of active GLP-1 is approximately 2 minutes, as dipeptidylpeptidase IV
(DPPIV) rapidly cleaves GLP-17-36NH2 into the inactive form (GLP-19-36NH2) (120-123). DPPIV is
widely expressed and is found circulating in the blood stream, as well as bound to cell membranes
(124). Once GLP-1 is released, it must cross the lamina propria before it reaches the circulation;
DPPIV on the membrane of endothelial cells of the capillaries rapidly degrades 75% of GLP-1
(120;122;123;125). As blood moves across the liver, another 12% of GLP-1 is degraded before it
can reach its target organs such as the beta cell (126). GLP-19-36NH2 is then cleared from circulation
by the kidneys within 4-5 minutes (120;123-125;127). Interestingly, the related incretin hormone,
GIP, is also cleaved and degraded by DPPIV(120).
Inhibition of DPPIV activity increases the half-life and thereby, activity of endogenous
GLP-1 and GIP (6;7;128). Hence, DPPIV inhibitors, are also used clinically for the treatment of
T2D (4-6). Similar to the GLP-1 analogues, DPPIV inhibitors can significantly reduce HbA1c,
fasting and post-prandial blood glucose levels (4-7).
1.2.7 Models of the Enteroendocrine L-cells
Because L-cells are influenced by a variety of factors in vivo, as mentioned above, it is
extremely difficult to elucidate secretagogue signalling pathways without ‘noise’ from other
inputs. Therefore, the development of in vitro L-cell models has been essential in GLP-1 secretion
12
studies. These models include both primary and immortalized cultures originating from mice, rats,
and humans.
Primary L-cell Models
FRICs (fetal rat intestinal cells) are a heterogenous primary L-cell model (129;130).
Briefly, whole intestines are collected from near-term neonatal Wistar rats, enzymatically
dispersed, and grown in culture for up to 7 days (130). FRIC cultures have been shown to
synthesize and process proglucagon normally, as compared to ex vivo fetal and adult intestine
(63;131). FRIC cultures have been shown to respond to known secretagogues, and remain an
excellent model for GLP-1 secretion studies (68;129;130;132). Recently, primary heterogenous
cultures of both mouse and human L-cells have also been reported and may become important
models of the enteroendocrine L-cell (133).
In attempt to create a homogenous primary L-cell model, transgenic mice that express
fluorescently labelled Venus-proglucagon in the pancreas, intestine, and brain were created (73).
Unfortunately, after FACS sorting, Venus positive cells from the intestine were not able to survive
in culture (73). However, the fluorescent labelling of L-cells allows for single primary cell
experiments such as patch clamp, Ca2+ imaging, and gene transcription studies (73;83;134).
Immortalized L-cell Models
GLUTag Cells
Since L-cells are scattered throughout the distal small intestine (52), generation of the
immortalized GLUTag cell line —a cell line consisting exclusively of L-cells —was important in
the study of GLP-1. A 2.3 kb fragment of rat proglucagon 5’-flanking region was fused upstream
13
of the simian virus-40 (SV40) large T-antigen coding sequences to create a transgenic mouse
(135). Expression of the proglucagon gene was seen in the brain, pancreas, and small and large
intestine — which mirrors the natural expression of the proglucagon gene (135;136). The SV40
large T-antigen caused formation of neuroendocrine carcinomas in the large intestine by 4-8 weeks
of age (135). A sample of the tumour from the SV-40 transgenic mouse was transplanted
subcutaneously into a nude mouse, and allowed to propagate (136). Finally, cells from the
secondary tumour were single-cell cloned and named ‘GLUTag’ cells for proglucagon SV40 large
T-Antigen. These cells have been extensively validated as models of the intestinal L-cell
(73;78;80;137-140).
The intestinal L-cell is one of fifteen types of enteroendocrine cells scattered along the
intestinal tract (141). Although each type of enteroendocrine cell was thought to only produce one
precursor hormone, recent studies have proved otherwise (141;142). The L-cell not only expresses
the proglucagon prohormone, it can also express CCK, secretin, somatostatin, and GIP (141;142).
Expression of proglucagon mRNA (as well as other peptide mRNAs) may also depend on the
location of the L-cell (83). Microarray analysis indicates that mRNA expression of L-cells found
in the upper small intestine (SI) is more similar to that of an upper SI K-cell than to that of a colonic
L-cell (142). When comparing microarray data from primary colonic L-cells to GLUTag cells,
gene expression was highly correlated (142). Since GLUTag cells are an immortalized cell line,
gene expression is likely to differ from a primary L-cell; however, GLUTag cells still remain as
the best immortalized representation of the distal L-cell.
14
STC-1
The STC-1 cell line is another murine model used in studies of the L-cell. Mice expressing two
oncogenes (SV40 large T-antigen and Polyoma Small T-antigen) under the control of the rat
insulin promoter were found to express tumours in the pancreas, upper small intestine, mesentery,
and liver (143-145). A tumour from the duodenal regions was dispersed, plated, and named the
secretin tumour cell 1 (STC-1) line. STC-1 cells express several enteroendocrine peptides such as
secretin, proglucagon-derived peptides (glicentin, GLP-1, GLP-2, glucagon), GIP, gastrin,
neurotensin, and somatostatin (144). Thus, STC-1 cells are a heterogenous plurihormonal cell line
derived from a duodenal tumour (144). Gene expression of STC-1 cells is highly correlated with
duodenal L-cells (142). However, duodenal L-cells have been shown to be more like K-cells than
colonic L-cells (142), and the STC-1 cells are therefore thought to poorly represent the majority
of L-cells.
NCI-H716
NCI-H716 cells are an immortalized human L-cell line derived from a poorly differentiated
colorectal adenocarcinomal tumour (146). Depending on tumour propagation conditions, tumour
cells can differentiate into endocrine cells (147). Although studies have shown that NCI-H716
cells may not be suitable for human proglucagon gene transcription studies (148), NCI-H716 cells
are the only human L-cell line, and are an excellent model for studying GLP-1 secretion
(69;80;87;132;139;149).
15
1.2.8 Discovery of SNAREs & the SNARE Hypothesis
Although mechanisms that stimulate GLP-1 secretion have been well established, little is
known with regards to the distal steps of exocytosis—more specifically, the mechanisms that
govern fusion of the GLP-1-containing granules to the L-cell membrane. Soluble NSF attachment
protein receptor (SNARE) proteins were first discovered in the late 1980s. Since then, SNARE
proteins have been established as universal mediators of membrane fusion—from single celled
yeast to humans (150). The discovery of SNAREs began with research on golgi transport.
Treatment of golgi stacks with N-ethylmaleimide was found to block fusion of ‘donor’ vesicles to
‘acceptor’ golgi stacks in a cell-free system (151;152). Vesicles accumulated at the golgi stacks,
but were unable to fuse; vesicular fusion was restored when NSF was replenished (151-153).
Rothman then suggested that NSF could also affect fusion of vesicles to the plasma membrane
(151;152). NSF was later found to interact with a 20S protein complex through the adaptor protein,
soluble NSF attachment protein (SNAP) (154).
The minimal (core) snare complex, consists of three different proteins: on the granule,
vesicle-associated membrane protein (VAMP) and, on the plasma membrane, syntaxin and
synaptosomal protein of 25 kDa (SNAP-25) (154-156). Each of these SNARE proteins possesses
a 60-80 amino acid region which consists of at least a seven amino acid ‘SNARE motif’ (157-
159). This 60-80 amino acid region is alpha-helical in structure, and is essential in the formation
of the SNARE complex (157;158).
The discovery of VAMP proteins began with Torpedo Californica marine rays in 1988
(160). Antiserum targeting Torpedo synaptic vesicles identified bacterial plaques expressing
Torpedo cDNA (160). VAMP1 was identified following cDNA and protein sequencing of
16
immunoreactive plaques, and was suggested to play a role in vesicular transport or membrane
fusion (160;161). The search for VAMP1 homologues in the rat brain led to the discovery of
VAMP2, also known as synaptobrevin (161;162). Rat VAMP2 is 77% homologous to rat VAMP1;
both VAMPs possess a proline-rich head, a highly conserved hydrophilic core, and a hydrophobic
membrane-spanning carboxyl-terminus tail (161). VAMP2 is higher in molecular weight, as
compared to VAMP1 (19 kDa versus 17 kDa, respectively), and is expressed in the whole brain;
VAMP1 expression was found to be localized to the spinal cord (161), although both proteins are
now known to be widely expressed. It is now also known that there exist seven isoforms of VAMP,
of which VAMP1, -2, -3, and -8 have been implicated in exocytosis (163-165). Of these, mouse
VAMP1, -2, and -3 are known to be cleaved and inactivated by tetanus toxin (TetX), as shown in
Figure 1.3 (166;167).
The plasma membrane bound syntaxin was first isolated from rat brain in 1992 (168).
Enrichment of the syntaxin protein was found at presynaptic neurons (168). Syntaxin was found
to interact with N-type Ca2+ channels as well with synaptotagmin, a SNARE accessory protein
associated with synaptic vesicles, both of which were implicated as essential components for
synaptic vesicle fusion (168). Because of these characteristics, Syntaxin was suggested to play a
role in the docking of synaptic vesicles (168). To date, 13 isoforms of Syntaxin have been
discovered (166), all of which are known to play roles in exocytosis and trafficking of proteins
(169;170).
SNAP-25, first cloned from neuron-specific mRNAs in 1989, is a highly hydrophilic
protein localized to the presynaptic terminus of neurons (171). Unlike VAMP1, VAMP2, and
syntaxin, SNAP-25 does not possess a hydrophobic membrane spanning region (171). Instead, it
17
VAMP
SNAP-25 Syntaxin
TetX Cleavage Site (Q | F)
VAMP1
VAMP2
VAMP3
VAMP8
VAMP1
VAMP2
VAMP3
VAMP8
VAMP1
VAMP2
VAMP3
VAMP8
Figure 1.3 Cleavage of VAMP isoforms by TetX Tetanus toxin cleaves VAMP isoforms
between glutamate (Q) and phenylalanine (F) residues, this QF cleavage site is found in mouse
VAMP1, -2, and -3.
18
was later discovered that SNAP-25 associates with the plasma membrane through palmitoylation
of cysteine residues (172-174). It was first suggested that SNAP-25, like syntaxin, played a role in
vesicle docking (171). However, SNAP-25 function was not elucidated until exposed to the
neurotoxin Botulinum A (BoNTA)---SNAP-25 was found to be readily cleaved by BoNTA, which
prevented release of neurotransmitters from the neuromuscular junction (175). Neurotoxin
(Botulinum and Tetanus) cleavage of SNARE proteins were essential in the elucidation of the
mechanisms governing vesicle fusion to the plasma membrane, also known as the SNARE
hypothesis. There exist 3 isoforms of SNAP-25 (SNAP- 23, SNAP-25, and SNAP-29) (166), of
which SNAP-23 and SNAP-25 mediate granule fusion to the plasma membrane (176). SNAP-29
is known to bind SNARE proteins, but its role in granule fusion remain to be elucidated (177;178).
The SNARE hypothesis is depicted in Figure 1.3. As secretory granules come into close
proximity (approximately 50 nm) to the plasma membrane, the granule is docked through
interactions between Syntaxin (in its ‘closed’ conformation), the cytosolic SNARE accessory
protein Munc18-1, and a small GTPase Rab protein on the granule (179-182). Munc13 then
converts Syntaxin to its ‘open’ conformation, which allows for the N-terminus of VAMP to
interact with the membrane-associated SNARE proteins (Syntaxin and SNAP-25) (183;184). The
SNARE complex starts to ‘zipper’ starting from the N-terminus towards the C-terminus, forming
a bundle of parallel four α-helical SNARE motifs; one each from VAMP and Syntaxin, and two
from SNAP-25 (155;185-187). ATP is required to ‘prime’ the granule for fusion to the plasma
membrane (155;185). The SNARE accessory protein Synaptotagmin, located on the granule
membrane, senses increases in Ca2+ concentration and promotes full zippering of the main SNARE
19
VAMP
Syntaxin
SNAP-25
Granule
Plasma Membrane
Munc18
Tethering & Docking
Munc13
Exocytosis Priming
+ATP
+Ca2+
+NSF &
α-SNAP
Recycling
Figure 1.4 The SNARE hypothesis. The secretory granule is docked to the plasma membrane
through interactions between Syntaxin 1a, Munc18, and an unknown granule-bound protein.
Munc13 converts Syntaxin 1a into its ‘open’ conformation, which allows for ‘zippering’
interactions between the core SNARE complex proteins. ATP primes the granule for fusion.
Once there is a signal to exocytose, such as an increase of intracellular Ca2+ levels, the SNARE
complex zippers and forces the fusion between granule and plasma membranes. Finally, NSF
and α-SNAP disassemble the SNARE complex in preparation for future fusion events.
Rab
20
complex protein (155;185), followed by fusion of the granule and plasma membranes and
release of the granule contents (155).
1.2.9 Neurotoxins
All neurotoxins are zinc metalloproteases produced by bacteria from the Clostridium
family (188;189). These neurotoxins are post-translationally processed into two domains, a
heavychain and a light chain, which are linked by a single disulfide bond (188;189). The heavy
chain has been implicated in the binding to neurons and translocation of the light chain into
the neuron (188;189). The light chain is the catalytic domain, which is now known to cleave
and inactivate specific proteins of the core SNARE complex (188). As Clostridium neurotoxins
are sterically hindered from accessing SNARE proteins when in a complex, SNARE proteins
can only be cleaved before assembly (190).
Tetanus toxin poisoning is caused by infection with Clostridium tetani, which enters
the human body through open wounds (188). Clostridium tetani germinates in anaerobic
lesions, and releases TetX into the circulation (188). TetX binds to and enters presynaptic
termini of the neuromuscular junction, and subsequently moves in a retrograde fashion to the
inhibitory neurons of the spinal cord (188). TetX cleaves VAMP proteins within the inhibitory
neurons, which prevents the release of neurotransmitters and causes the spastic phenotype of
tetanus toxin poisoning (188;191;192). With respect to VAMP2, TetX cleaves at amino acid
position 76, in the alpha helical region required to form the SNARE complex, thereby
preventing granule-membrane fusion (188).
In contrast, Clostridia botulinum enters the human body through contaminated foods
and germinates in epithelial cells of the gastrointestinal tract (188;193;194). Following its
21
release, BoNT then binds to and enters cholinergic neurons (188;195;196). Cleavage of core
SNARE complex components is dependent on the BoNT isoform. BoNTA, -C1, and -E
specifically cleave SNAP-25 at amino acid positions 197, 198, and 180, respectively
(175;188;197); BoNTC1 also cleaves Syntaxin 1a at amino acid position 253 (188;198), and
TetX, BoNTB, -D, -F, and -G specifically target VAMP (188;191;199-201). However,
regardless of the isoform of BoNT, cleavage of SNARE complex proteins in the alpha helical
region prevents exocytosis of acetylcholine, and causes the paralytic phenotype seen in BoNT
poisoning.
1.2.10 SNAREs in Endocrine Cells
VAMP2, SNAP25, and Syntaxin 1a have been found to mediate exocytosis in β-cells,
α-cells, and chromaffin cells (164;202-206). Use of neurotoxins has shown that SNARE
proteins are essential for insulin exocytosis in β-cells (205;207;208). HIT-T15 insulinoma cells
were permeabilized and treated with TetX, resulting in a 77% decrease in VAMP2, followed
by an 84% decrease in Ca2+-dependent insulin secretion (164). When HIT-T15 cells were
treated with BoNTA, SNAP-25 was cleaved at ~20% efficiency, followed by a proportional
decrease in insulin secretion (205). Similarly, cleavage of Syntaxin 1a (and SNAP-25, to a
lesser extent) by BoNTC1 also significantly decreases insulin secretion regardless of the
stimulus in the HIT-T15 cell line (209).
Subsequent studies have shown that other core SNARE complex isoforms may also
play minor roles in the regulation of exocytosis from the β-cell. For example, SNAP-23 can
regulate insulin secretion from β-cells during situations in which SNAP-23 is overexpressed,
as well as when SNAP-25 is inactivated (176). VAMP3’s role in insulin secretion cannot be
excluded, as BoNTB and TetX cleave most VAMP isoforms, and β-cells express both VAMP2
22
and VAMP3 (164). VAMP8 has also been shown to play an essential role in GLP-1 stimulated
insulin secretion (165). Finally, Syntaxin 4 is known to govern both the first and second phase
of insulin secretion, whereas Syntaxin 1a has been shown to regulate only the first phase of
insulin secretion (210;211).
Enteroendocrine L-cell secretion is often modelled after the β-cell (77;80;82;86;87).
Both L-cells and β-cells are endocrine cells that possess biphasic secretion patterns
(65;212;213). All of the GLP-1 secretagogues shown in Figure 1.2 can also stimulate insulin
secretion from the β-cell (88). During nutrient stimulated insulin secretion, the actin-
cytoskeleton must be depolymerized to allow for replenishment of the ‘readily releasable’
granule pool (214-216). A role for actin depolymerization was also demonstrated in insulin-
stimulated L-cell secretion (86). Although not yet confirmed, other secretagogues are also
expected to depolymerize the actin barrier in order to potentiate the secretion of GLP-1 from
the L-cell.
Since VAMP2, Syntaxin 1a, and SNAP-25 are essential in mediating granule fusion to
the membrane in β-cells, they may also play an essential role in GLP-1 exocytosis from the L-
cell. VAMP2, Syntaxin 1a, and SNAP-25 have been found to be expressed in GLUTag cells
(217;218). Whether these SNARE proteins are important in GLP-1 secretion remains to be
determined. Furthermore, the SNARE accessory protein, synaptotagmin 7, has been implicated
as the Ca2+ sensor for glucose-induced secretion in β-cells (219;220). Interestingly,
synaptotagmin 7 deficient mice subjected to an oral glucose tolerance test exhibit significantly
decreased secretion of GLP-1. These findings therefore suggest that both core and accessory
SNARE proteins may be essential in mediating granule fusion to the L-cell plasma membrane
(218).
23
1.2.11 SNAREs in Membrane Rafts
Finally, the plasma membrane is a dynamic environment composed of sphingolipids,
cholesterol and membrane-associated proteins, all of which are heterogeneously distributed
(221-224). Membrane rafts are more homogeneous microdomains located in the plasma
membrane that can be identified by the presence of scaffolding proteins such as Flotillin-1/2
(also known as reggie-2/1) and Caveolin-1/2. Enriched in cholesterol and sphingolipids,
membrane rafts create a favourable environment for localization of membrane-associated
proteins (222-226). Signalling proteins, ion channels, and plasma membrane-associated
SNARE proteins (i.e. Syntaxin1a and SNAP-25) have all been found to be localized to
membrane rafts (203;224;225;227). It has thus been suggested that the enrichment of proteins
in membrane rafts creates an efficient environment for downstream events such as exocytosis.
When in solution, Methyl-β-cyclodextrin (MβCD) forms a ring with a hydrophobic
cavity that specifically extracts cholesterol from the plasma membrane (222). Depletion of
cholesterol disrupts membrane rafts and disperses raft-associated proteins (41;203;225). With
respect to endocrine cells such as β-cells, α-cells and chromaffin cells, MβCD treatment has
been shown to decrease SNARE protein association with the plasma membrane and, in turn,
decreasing hormone secretion (41;203;225). However, cholesterol balance in the β-cell must
be strictly regulated, as both cholesterol overload and depletion can decrease insulin secretion
(41;225). Whether membrane rafts exist in L-cells, and the role of membrane rafts in L-cells
remain to be elucidated.
24
Hypothesis and Specific Aims
Release of GLP-1 into the circulation is integral to the incretin effect. GLP-1 secretion
is stimulated by neurotransmitters, nutrients, and hormones. Although the signaling pathways
leading to the secretion of GLP-1 have been well documented, the mechanisms by which GLP-
1 granules fuse to the L-cell membrane remain largely unknown. SNARE proteins are known
to mediate granule fusion in endocrine cells such as β- and α-, as well as chromaffin cells.
Specifically, in β-cells, VAMP2, Syntaxin 1a and SNAP25 are localized to membrane rafts
and essential in insulin exocytosis. Since L-cell secretion is often modelled after the β-cell, I
hypothesize that 1) VAMP2 and 2) membrane raft localization of Syntaxin 1a and SNAP-25
are essential components in the exocytosis of GLP-1.
To address hypothesis 1, the specific aims included:
1) Examine the expression of VAMP isoforms in GLUTag cells.
2) Examine localization of VAMP2 in GLUTag cells.
3) Examine associations between VAMP2 and Syntaxin 1a under both basal and
stimulated conditions.
4) Determine the effects of Tetanus toxin on VAMP in GLUTag cells.
5) Determine the effects of VAMP cleavage in GLUTag cell exocytosis.
To address hypothesis 2, the specific aims included:
1) Examine the existence of membrane rafts in GLUTag cells.
2) Determine the effects of cholesterol depletion in GLUTag cells.
3) Examine localization of SNARE proteins with respect to membrane raft markers.
25
Materials and Methods
Cell Models
3.1.1 GLUTag
Murine GLUTag L-cells were grown and maintained in high glucose (25 mM glucose)
Dulbecco’s Modified Eagle Medium (DMEM) (GIBCO, Burlington, ON, Canada)
supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich, Oakville, ON, Canada) in
a humidified chamber with 5% CO2, and 95% air at 37oC. Culture media was changed every
two to three days, and cells were passaged once grown to approximately 80% confluency.
GLUTag cells were washed with Hank’s Balanced Sodium Solution (HBSS), treated with
0.25% trypsin (GIBCO) for approximately 2 minutes at 37oC, resuspended, centrifuged to
pellet, and seeded to approximately 30% confluency. Depending on the experiment, GLUTag
cells were plated at approximately 30-60% confluency on poly-D-lysine hydrobromide treated
(Sigma-Aldrich) multi-well plates (BD Falcon, Mississauga, ON, Canada) or glass coverslips
(18 or 25 mm diameter) (Fisher Scientific Company, Ottawa, ON, Canada) for at least 48 hours
prior to experimentation. In brief, glass coverslips were shaken in chromic acid (Anachemia
Chemicals Inc., Rouses Point, NY, USA) overnight. The chromic acid was washed off with
running tap water for at least 3 hours; coverslips were padded dry, and autoclaved. Glass
coverslips or multi-well plates were then coated with poly-D-lysine hydrobromide for 5
minutes, and exposed to UV light sterilization for 15 minutes. Finally, coverslips or multi-well
plates were rinsed twice with HBSS before plating of cells.
3.1.2 MIN6
MIN6 cells (a kind gift from Dr. M. Wheeler, University of Toronto; Dr. J. Miyazaki,
University of Tokyo; and Dr. D.F. Steiner, University of Chicago) were grown and maintained
26
in high glucose DMEM supplemented with 10% FBS, 2 mM L-glutamine (GIBCO),
penicillin/streptomycin (100 U/ml, 100 mg/L) (GIBCO), and 71 μM 2-mercaptoethanol
(Sigma-Aldrich) in a humidified chamber with 5% CO2, 95% air at 37oC. Culture media was
changed every two to three days, and cells passaged once grown to 80% approximately
confluency. MIN6 cells were seeded as described for the GLUTag cells, but trypsinized with
0.25% trypsin-EDTA (GIBCO).
RNA Analyses
GLUTag and MIN6 cells were grown to approximately 90% confluency in 10 cm plates
(BD Falcon), and RNA was isolated and purified using the RNEasy Plus Mini kit with
Qiashredder according to manufacturer’s instructions (Qiagen Inc., Missisauga, ON, Canada).
Brain and liver tissue was isolated from a male C57Bl/6 mouse, and mammary gland tissue
from a pregnant female C57Bl/6 mouse. RNA was isolated from these tissues using RNEasy
Plus Mini kit with Qiashredder according to manufacturer’s instructions. RNA was quantified
(Ratio of absorbance readings at 260 nm and 280 nm (A260/A280)) and only RNA with an
absorbance ratio between 1.9-2.1 was used to ensure purity. RNA was stored at -80oC until
use.
The One-Step RT-PCR kit (Qiagen Inc.) was used for all RT-PCR experiments. Briefly, 1 μg
of RNA was reverse-transcribed and amplified with reported primers and annealing
temperatures as listed in Table 1. If annealing temperatures were not reported, optimal
conditions were determined using a temperature ramp. RT-PCR thermocycler conditions were
as follows: 30 minutes at 50oC for reverse transcription, 15 minutes at 95oC for initial PCR
activation, 3 step cycling (30 seconds at 94oC for denaturation, 30 seconds at temperatures
listed in Table 1 for annealing, 1 minute at 72oC for extension) for 35 cycles, and 10 minutes
27
at 72oC for the final extension reaction. All primers were verified with positive control samples
(mouse tissue or MIN6 cells) that were selected based on the literature (166;228-233). Positive
control reactions were performed with mouse brain, mammary gland, or liver mRNA template,
as appropriate (data not shown). Negative control reactions were performed by substituting
RNA template with RNase-free water (data not shown). RT-PCR products were run on a 1.5%
agarose gel (ONBIO, Richmond Hill, ON, Canada) at 100 V, detected with SYBR-Safe
(Invitrogen, Burlington, ON), and band sizes were compared to a 100 bp DNA ladder
(Fermentas, Ottawa, ON, Canada).
Neurotoxins
3.3.1 Bacteria Culture and Vector Isolation
Enhanced green fluorescent protein-neuropeptide Y (pEGFP-N1-NPY)-mCherry,
porcine cytomegalovirus (pCMV)-NPY-pHluorin, pcDNA3 plasmids for GFP (control), light
chains of Botulinum (BoNT) A, BoNTC1, BoNTE, TetX, and pcDNA3 alone (control) were
provided by Dr. H. Gaisano, University of Toronto. pcDNA3-VAMP2-GFP was a kind gift
from Dr. W. Trimble, University of Toronto (234). All plasmid vectors were ampicillin-
resistant except for pcDNA3-GFP, which was resistant to kanamycin. Agar plates,
supplemented with either ampicillin (50 μg/mL) or kanamycin (30 μg/mL) (BioShop Canada
Inc., Burlington, ON, Canada), as appropriate, were streaked with bacteria containing vector
plasmid and incubated at 37°C overnight. One colony was chosen and placed into 10 mL of
Luria Bertani (LB) broth (BioShop Canada Inc.) supplemented with the same concentration of
ampicillin or kanamycin, and shaken at 250 rpm and 37°C for 8 hours, then transferred to 1 L
of LB broth supplemented with appropriate antibody and shaken overnight at the same settings.
28
Forward Primer Reverse Primer Expected
Band Size
Annealing
Temperature References
VAMP1 CCTGCTGAAGGGACAGAAGG ACTACCACGATGATGGCACAGA 311
55 (166)
VAMP2 ATGTCGGCTACCGCTGCCACC AGTGCTGAAGTAAACGATGAT 348
VAMP3 GCTGCCACTGGCAGTAATCGAAGAC GAGAGCTTCTGGTCTCTTTC 113
VAMP4 GGGACCATCTGGACCAAGATTTGG CATCCACGCCACCACATTTGCCTT 225
VAMP5 ATGGCAGGGAAAGAACTGAAGCAAT TGGTTTACTACTGTCCCCACCACTC 306
VAMP7 ATGGCCATTCTTTTTGCTGTTGTTG TTTCTTCACACAGTTTGGCCATGT 660
VAMP8 ATGGAGGAGGCCAGTGGGAGTGC AGTGGGGATGGTACCAGTGGCAAAA 303
SNAP-23 ATGGATAATCTGTCCCCAGAGG TTAACTATCAATGAGTTTCTTT 633
SNAP-25 ATGGCCGAAGACGCAGACAT TTAACCACTTCCCAGCATCTTTG 621
Syntaxin 1 CGACGACGATGTCACTGTCACT CATGATGATCCCAGAGGCAAAG 502
Syntaxin 2 AAAGGCCGCATCCAGCGCCAGCT GATGCTGGTCTCCAGCTTCATGAT 192
Syntaxin 3 CTGAAGGCCAAGCAGCTGAC TCCACCAGCATGGCGATGTC 593
Syntaxin 4 GGAGTTGGAGAAACAGCAGG TGCCCACTGTCCAGCATCTG 363
Syntaxin 5 ATGTCCTGCCGGGATCGGACCCA GGCAAGGAAGACCACAAAGA 903
Syntaxin 6 ATGTCCATGGAGGACCC TCAGCTCGTTGGTGGTCCAGTC 151
Syntaxin 7 ATGTCTTACACTCCGGGGATTGG CGGAGGTCATCCTCTGTGATTTC 497
Syntaxin 8 CGCTGAGAAGATTCAAGAACG GGTCACTCGCCTGGCTTCAGT 556
Syntaxin 11 ACCAACTCCATCGCCAAGGCCAT CCAGCAGGTTCTCGGAGAATACA 330
Syntaxin 12 AACATCCAGCGGATCAGCCAAGCC TCTTGCTCAGTGATGGCCGCCTCT 437
Syntaxin 16 TGACGGATCTCTCGCTCCCTCTC CAGGAAGAGCGGCTACTGCGGAA 269
Syntaxin 17 CTCAGATATATGCCTTGCCTGAA GCTGGAAGTGAGCTTCTCCATCAT 407
Syntaxin 18 ACAGACACAGAGCGAGACCAGAT ATCTCTTCTGGAGACAGCTCATC 428
Synaptotagmin 1 AAAGGAGGAGCCCAAGGAAGAGGA AGCGGAGGGAGAAGCAGATGTCAC 449
55.4 (228)
Synaptotagmin 2 TAAAGCTATCCCCTCTGCCACCAT CTCGCCTTCACCTTCTCCTTCAGT 427
Synaptotagmin 3 CTGCCGGGTGGAGAGGAAAAAG CAGCCGTGGGGAGGTAGCAGA 553
Synaptotagmin 4 GGAAGACGCTGGACCCTGTTTTTG CCCCCACCGCTTCCTTCTGC 574
Synaptotagmin 5 GGTGCGGGTGCCTATGA TCTTGCGAACCTTTTTACCTC 251
Synaptotagmin 6 TCCCTACTATGTGATGGGCG GGGTTCCCTCTTTGAAGGATTT 313
Synaptotagmin 7 CTACCCGACAAGAAGCACAAA CGAAGGCGAAAGACTCATT 481
Synaptotagmin 10 TTCGCGGGTCAGGTGGAGTG GAGTTGTGGCGGGATGAAGACG 446
Synaptotagmin 11 CCCCAGCACAGGCAAGGTTCAG GCCCCAGGGTTAGTACTCGCTCAG 499
Synaptotagmin 12 GGCCACCTTCGAGTCCTGCTTCAT GGGGTCTGCTGTGCTCTTCTCATT 412
Synaptotagmin 13 CCCCCAGGCCCAGAGTGA ACAGGTGCGCAGGGTGAGT 400
Munc 13-1 GCCATGCGTGACCAGGATGAGTA CACGGAGCTGTGACAGGAGTGAT 474 55 (166)
Munc 13-2 TGGAGCTGAGGACCGAACTCAGA TTGGAGGTGCCATCCAGGACACT 177
29
Munc 13-3 AGGCCAGTGCAGTTGTGAAGGAC CAGCATCCTTGAAGGCAGGAAGT 435
Munc 13-4 TCTGCCGTGGATCTGTCTACCTG CCTGGCTCTGGTCCTTCTGAACT 196
Munc 18-1 TGAGGACGATGACCTGTGGATTG GTATCTGAGCGTGCTGGATGAGT 452
Munc 18-2 AGGCTGTCCTCCTGGATGAAGAT TCCGCAGAAGGATGTAGAGCAAC 414
Munc 18-3 CTTGAAGAAGACGACGACCTGTG CAAGGTGGCTCCAGTTACGAATC 493
Flotillin-1 CTTGTGGCCCAAATGAG ATCTCCTGCTCCTGCAC 805 52 (229)
Flotillin-2 CAGGTGAAGATCATGACG ACCACAATCTCATCGAC 929 50
Caveolin-1 CTACAAGCCCAACAACAAGGC AGGAAGCTCTTGATGCACGGT 340 52 (230)
Caveolin-2 ATGACGCCTACAGCCACCACAG GCAAACAGGATACCCGCAATG 268 52
LDLr ACCCCAAGACGTGCTCCCAGGATGA CGCAGTGCTCCTCATCTGACTTGT 384 59 (231)
NPC1L1 GCTTCTTCCGCAAGATATACACTCCC GAGGATGCAGCAATAGCCACATAAGAC 367 58 (232)
ABCA1 CCCAGAGCAAAAAGCGACTC GGTCATCATCACTTTGGTCCTTG 89 60 (233)
ABG5 AGGTCATGATGCTAGATGAGC CAAAGGGATTGGAATGTTCAG 261 60 (233)
ABG8 CCCAGAGCAAAAAGCGACTC GGTCATCATCACTTTGGTCCTTG 190 60 (233)
HMG-CoA
Reductase CCGGCAACAACAAGATCTGTG ATGTACAGGATGGCGATGCA
115 60 (233)
Table 1. List of RT-PCR Primers and Annealing Temperatures
30
Bacteria were then harvested by centrifugation (4000xg for 30 minutes at 4oC) and plasmids
were isolated using the GeneJET™ Plasmid Maxiprep Kit as per the manufacturer’s
instructions (Fermentas).
Plasmid constructs for GFP, pcDNA3, and the neurotoxins were digested with both
EcoRI and XbaI (New England Biolabs Inc., Ipswich, MA, USA). In brief, 5μg of plasmid
vector was incubated with 20 units of EcoR1 and 3 μL of EcoR1 buffer (final volume 30 μL)
for 1 hour at 37oC. This solution was inactivated at 65oC for 20 minutes, then 40 units of Xba1
in 6 μL of Xba1 buffer supplemented with 0.6 μL of bovine serum albumin (BSA) solution
(final volume of 60 μL) was added and incubated at 37oC for 1 hour. The digested plasmid (20
μL) was then run on a 1% agarose gel, and band sizes were determined by comparison to a 1
kb ladder (Fermentas).
3.3.2 Transfection of GLUTag cells
Two days prior to transfection, GLUTag cells were plated on 24 well plates coated with
poly-D-lysine hydrobromide. Cells were then incubated with 100 μL OptiMEM I (GIBCO), 3
μL Lipofectamine 2000 (Invitrogen), and 1 or 2 plasmids (total of 1 μg per transfection) at
37°C for 4 hours, after which media was changed and cells were allowed to recover for 48
hours. If larger plates were required (i.e. 12 well or 6 well plates), the amounts of
Lipofectamine 2000, OptiMEM I and plasmid were increased accordingly.
Activation of Tetanus Toxin
In preliminary studies, TetX action was not detected in GLUTag cells transfected with
pcDNA3-TetX. However, several studies have indicated that tetanus toxin must be activated
with a reducing agent, in some cell types, in order for VAMP cleavage to occur (207;235).
31
GLUTag cells transfected with the TetX construct (or control vector) were therefore treated
with 2 mM dithiothreitol (DTT) (in media) for 10 minutes at 37°C. After washing with HBSS,
fresh media was added and GLUTag cells were allowed to recover for 4 hours prior to
experimentation.
Protein Analyses
3.5.1 Protein Isolation
GLUTag cells were lysed with a Tris-HCl protease-inhibitor buffer (150 mM NaCl, 50
mM Tris-HCl (pH 7.4), 10 mM EDTA, 1 mM EGTA, 1 mM NaF, 1 mM Na3VO4, 1 mM
PMSF, 1% (v/v) IGEPAL CA-630 (Sigma-Aldrich), 1 EDTA-free protease inhibitor tablet
(Roche, Mississauga, ON, Canada)), sonicated on ice, and centrifuged at 13,000xg for 5
minutes at 4oC to clear cellular debris. Mouse brain and pancreas samples were collected in
the Tris-HCl protease-inhibitor buffer, sonicated on ice, and centrifuged at 13,000xg for 60
minutes to remove particulates. Protein concentrations were determined by Bradford Assay
(Bio-Rad, Mississauga, ON, Canada), and stored at -80oC until use.
3.5.2 Co-Immunoprecipitation
GLUTag cells were plated on 10 cm plates two days prior to experimentation, and then
treated with either control experimental media (DMEM + 0.5% FBS), or 50 mM KCl in
experimental media for 20 minutes at 37oC. Cell lysate was collected and protein concentration
determined as above. Two mg of protein, 10 μg of Syntaxin1a antibody (Synaptic Systems,
Goettingen, Germany), and lysis buffer was added for a final volume of 1 mL and was
continuously mixed overnight at 4oC. For each co-immunoprecipitation sample, 50 µL of
PureProteome Protein G Magnetic beads (Millipore, Billerica, MA, USA) was prepared
32
according to the manufacturer’s instructions. In order to isolate the antibody-antigen complex,
the lysate-antibody mixture was added to the prepared magnetic beads and continuously mixed
for 30 minutes at room temperature. Magnetic beads were washed with PBS+0.2% Tween-20,
and sample buffer (without DTT) was added and boiled for 10 minutes, which dissociated
bonds between the magnetic beads and the antibody-antigen complex. The magnetic beads
were allowed to migrate towards the magnetic stand; samples were collected and stored at -
80oC until use. For co-immunoprecipitation studies, PVDF membranes were cut in order to
blot for SNAP-25 (Synaptic Systems), Syntaxin 1a (Sigma Aldrich), VAMP2/1 (Synaptic
Systems), and Munc18-1 (Synaptic Systems) on a single membrane without the need to strip
the membranes.
3.5.3 Western Blot
Equal amounts of protein (25 μg) from each sample was loaded per well, run on an
SDS-PAGE gel (percentage dependent on experiment, see Table 2) at 85V for 30 minutes,
followed by 110V until desired separation of molecular weight markers was obtained. Proteins
were transferred to an Immun-blot Polyvinylidene Fluoride (PVDF) membrane (Bio-Rad) at
120V for 1.5 hours at 4oC, washed with Tris-Buffered Saline + 0.1% Tween 20 (TBST),
blocked with 5% skim milk in TBST to decrease non-specific binding, and incubated overnight
at 4oC with the appropriate primary antibody, as listed in Table 2. The next day, membranes
were washed with TBST and incubated with the appropriate secondary antibody, as listed in
Table 2, at room temperature for 1 hour. Prior to incubation with Amersham ECL Western
Blotting Detection Reagent (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA),
membranes were washed with TBST (0.1% TBST for rabbit secondary antibody, 0.2% TBST
33
Expected
Band Size
(kDa)
% SDS-
PAGE
Gel
Dilution Source Antibody
Origin
VAMP2 19 15 1:1200 Anson Lowe
(236)
Rabbit
VAMP1/2/3 VAMP1: 17
VAMP2: 19
VAMP3: 12
15 1:1000 Synaptic
Systems
Rabbit
SNAP-25 25 12 1:5000 Sternberger
Monoclonals
(Lutherville,
MD, USA)
Mouse
SNAP-25 25 15 1:800 Synaptic
Systems
Rabbit
Syntaxin 1a 33 12 1:1200 Sigma-Aldrich Mouse
Munc18-1 67 15 1:1000 Synaptic
Systems
Rabbit
β-Actin 42 12 1:1000 Sigma-Aldrich Rabbit
Anti-rabbit IgG,
HRP-linked Antibody
1:1000 Cell Signaling
Technologies
(Danvers,
MA, USA)
Goat
Anti-mouse IgG,
HRP-linked Antibody
1:2000 Cell Signaling
Technologies
Horse
Table 2. List of Antibodies and Conditions for Western Blots
34
for mouse secondary antibody) for 1.5 hours at room temperature. Finally, bands were
visualized and quantitated with Kodak Molecular Imaging software (Carestream Molecular
Imaging, New Haven, CT, USA).
Microscopy
3.6.1 Construct Detection
GLUTag cells were plated on 18 mm glass coverslips and transfected with appropriate
vectors (pcDNA3-VAMP2-GFP + either pcDNA3 or pcDNA3-TetX, or pcDNA3-VAMP2-
GFP + EGFP-NPY-mCherry). Two days after transfection, coverslips were fixed in 4%
paraformaldehyde for 15 minutes at 37°C, washed in phosphate-buffered saline (PBS,) and
mounted with Vectashield containing 4’,6-Diamidino-2-Phenylindole (DAPI) (Vector
Laboratories) in order to visualize the nuclei. Images were acquired with a Zeiss AxioPlan
microscope. Twenty images were taken of each cell along the z-axis at 1 μm intervals.
3.6.2 TIRF
GLUTag cells were plated on 25 mm glass coverslips and transfected with pCMV-
NPY-pHluorin and either pcDNA3 or pcDNA3-TetX for 48 hours prior to the experiment.
NPY-pHlourin, a pH-sensitive fluorescent tag, localizes to granules (165). As the granule
content starts to leave the granule, the increased pH causes NPY-pHluorin to fluoresce at a
higher intensity. Ten minutes before experiments, cell media was changed to high-glucose
DMEM supplemented with 0.5% FBS. Basal fluorescence was monitored for approximately 2
minutes, and KCl (final concentration of approximately 50 mM) was then added to depolarize
the cells; fusion events were monitored for an additional 6-8 minutes. Ammonium chloride
(final concentration of approximately 30 mM) was added in order to confirm that GLUTag
35
cells were indeed transfected with NPY-pHluorin. A Nikon TE2000U TIRF microscope and
Nikon NIS-Elements software (Nikon Instruments Inc., Melville, NY, USA) were used to
obtain TIRF images (5 Hz, 100ms exposure time), which were quantitated using ImageJ
software (NIH, Bethesda, MD, USA). An increase in fluorescence by approximately 4-fold
over basal was considered an exocytotic event. These experiments were conducted with the
expertise of Dr. Dan Zhu in the Gaisano laboratory.
GLP-1 Secretion Assay
Two days after transfection with pcDNA3 or pcDNA3-TetX, GLUTag cells were
washed with HBSS and treated with control media (DMEM + 0.5% FBS), or 0.1 µM GIP
(Bachem, Torrance, CA, USA) in control media; or with vehicle (250 µL of 0.5N NaOH in
CaCl2-free DMEM (GIBCO) supplemented with 0.5% fatty acid-free BSA (FAF-BSA) and
1.8 mM CaCl2) or 1000 µM OA (Sigma-Aldrich) in vehicle for 2hours at 37°C. For MβCD
secretion assays, GLUTag cells were pre-treated with 0.1μM MβCD (Sigma-Aldrich) in
DMEM + 0.5% FAF-BSA for 30 minutes at 37°C. This was followed by a secretion assay, as
above, in which GLUTag cells were co-treated with 0.1μM MβCD and media alone (control)
or with 0.1 μM insulin (Eli Lilly, Toronto, ON, Canada) in DMEM + 0.5% FAF-BSA for 2
hours at 37°C.
After 2 hours, media was collected, and centrifuged at 1,300xg for 10 minutes at 4oC,
and trifluoroacetic acid (TFA) was added to the supernatant (final concentration of 0.1%
TFA). Cells were collected in extraction media (1N hydrochloric acid, 5% (v/v) formic acid,
1% sodium chloride (w/v), 1% TFA (v/v)), sonicated on ice, and centrifuged at 1,300xg for 30
minutes at 4oC. Peptides contained in the media and cells were purified on C-18 Sep-Paks
(Waters Associates, Milford, MA, USA) by reversed-phase extraction, and GLP-1 was
36
measured by radioimmunoassay for GLP-1x-36NH2 (Enzo Life Sciences, Farmingdale, NY,
USA), as described previously (79;86;87). GLP-1 secretion was calculated as: GLP-1 content
in the media/total GLP-1 content (= GLP-1 content of media + cells), and all data was
expressed as a fold of control or vehicle secretion. Across all experiments (n=8), control
secretion was 4.7±0.8% of total content, and that of the vehicle was 4.6±0.8%. TetX
transfection also did not affect control (pcDNA3: 4.7±0.8% vs TetX: 16.3±6.6%; p = n.s.) or
vehicle (pcDNA3: 4.6±0.8% vs TetX: 8.2±1.9%; p = n.s.) secretion.
Cholesterol Depletion
To determine the effects of MβCD on GLUTag and MIN6 cell viability, a neutral red
viability assay was performed. In brief, GLUTag and MIN6 cells were plated on 24 well plates
48 hours before the assay, and treated with MβCD (0 or 0.1 mM for 30 minutes) or 5 mM H2O2
(positive control) in DMEM + 0.5% FAF-BSA. Cells were then rinsed with HBSS, and treated
with 0 or 0.1 μM GIP with 0 or 0.1 mM mM MβCD, as appropriate, at 37°C. One hour after
the GIP treatment, neutral red (Sigma-Aldrich), final concentration of 40 μg/mL, was added
for 1 hour at 37°C. The neutral red solution was then aspirated, and 200 μL of extraction buffer
(50% (v/v) bonded ethanol, 1% (v/v) glacial acetic acid) was added to each well. Optical
density was then determined at 560 nm.
Filipin is a fluorescent molecule that binds to membrane cholesterol, and is used to
visualize cholesterol in biological membranes. The filipin-based, Cholesterol Cell-based
Detection Assay kit (Cayman Chemicals Company, Ann Arbor, MI, USA) was used to
visualize the effects of MβCD (0.1 mM MβCD for 2.5 hours at 37oC) on cholesterol in
GLUTag and MIN6 cells, as per the manufacturer’s instructions. In some experiments, cells
were plated on glass-bottom 8-well slides (BD Falcon), and images were acquired with a Zeiss
37
AxioPlan microscope, with all images taken using the same exposure time. In other studies,
cells were plated on 96-well plates and fluorescence was measured with a Synergy Mx plate
reader at an excitation of 340 nm and emission of 385 nm.
Statistical Analyses
Differences between groups were assessed by 2-way ANOVA followed by Student’s
t-test as appropriate, using SAS (SAS Institute, Cary, NC, USA) or Microsoft Excel
(Microsoft, Redmond, WA, USA) software.
Results
SNARE complex proteins are expressed in GLUTag cells
RT-PCR survey for minimal SNARE complex isoforms demonstrated that GLUTag
cells express mRNA transcripts for all isoforms of VAMP and Syntaxin, but only one isoform
of SNAP-25 (n=3) (Fig. 4.1). GLUTag cells were also found express mRNA transcripts for
most isoforms of the SNARE accessory proteins Munc 13, Munc18, and Synaptotagmin (n=3)
(Fig 4.1A). The validity of all primers was confirmed in control studies using murine brain,
mammary gland, and liver tissues (Fig 4.1B).Western blot confirmed protein expression for
VAMP2, Syntaxin 1a, and SNAP-25 in GLUTag cells (n=3) (217;218) (Fig 4.2). GLUTag
cells also expressed protein for VAMP1; VAMP3 and VAMP8 were not detected (n=3) (Fig
4.2).
VAMP2 is localized to granules, and interacts with Syntaxin 1a
from the SNARE acceptor complex in GLUTag cells
GLUTag cells were transfected with pcDNA3-VAMP2-GFP and the secretory granule
marker EGFP-NPY-mCherry at approximately 32% efficiency (n=1321 cells, from 2 different
38
`
Syntaxin
G 1a 2 3 4 5 6 7 8 11 12 16 17 18
- 500 bp
- 100 bp
bp: 250 502 192 593 363 903 151 497 556 330 437 269 407 427 :bp
100 bp -
500 bp -
Figure 4.1A GLUTag cells express mRNA transcripts for SNARE complex and
accessory proteins. RT-PCR analysis was performed for GLUTag cells with primers for
SNARE complex proteins (VAMP, SNAP-25, and Syntaxin), SNARE accessory proteins
(Synaptotagmin, Munc 13, Munc 18), and GAPDH (G). Representative of n=3.
100 bp -
500 bp -
bp: 311 348 113 225 306 660 303 250
VAMP 1 2 3 4 5 7 8 G
-
- -
SNAP-25 G 23 25
250 533 621 :bp
- 100 bp
- 500 bp -
-
-
- - -
-
- -
500 bp -
100 bp -
Synaptotagmin
bp: 250 449 427 553 574 335 358 481 446 499 412 400
G 1 2 3 4 5 6 7 10 11 12 13
-
-
-
Munc 13 Munc 18
bp: 474 177 435 196 452 414 493 250
500 bp -
100 bp -
1 2 3 4 1 2 3 G
-
-
-
A
39
500 bp -
100 bp -
- - -
- - -
500 bp -
100 bp -
100 bp -
- - -
500 bp -
100 bp -
- - -
500 bp -
100 bp -
- - -
500 bp -
bp: 311 348 113 225 306 660 303
VAMP (M)
1 2 3 4 5 7 8 bp: 533 621 bp: 533 621
SNAP-25 (B)
23 25 23 25
SNAP-25 (M)
Syntaxin (B)
1a 2 3 4 5 6 7 8 11 12 16 17 18 bp: 502 192 593 363 903 151 497 556 330 437 269 407 427
Munc 13 Munc 18 (M)
bp: 474 177 435 196 452 414 493
1 2 3 4 1 2 3
Figure 4.1B GLUTag cells express mRNA transcripts for SNARE complex and
accessory proteins. RT-PCR analysis was performed for pregnant mouse mammary gland
(M) or brain (B) with primers for SNARE complex proteins (VAMP, SNAP-25, and
Syntaxin) and SNARE accessory proteins (Synaptotagmin, Munc 13, Munc 18).
Representative of n=1.
Synaptotagmin (B) 1 2 3 4 5 6 7 10 11 12 13
bp: 449 427 553 574 335 358 481 446 499 412 400
100 bp -
500 bp -
-
-
-
B
40
Figure 4.2 GLUTag cells express SNARE complex proteins. Western blot for
VAMP1/2/3, VAMP8, SNAP-25, and Syntaxin 1a were performed for GLUTag cells. Actin
was used a loading control; mouse brain and pancreas was used as a positive control.
Representative of n=3.
VAMP2 (19 kDa)
VAMP1 (17 kDa) VAMP3 (12 kDa)
Syntaxin 1a (33 kDa)
Actin (42 kDa)
Actin (42 kDa)
VAMP8 (13 kDa)
Actin (42 kDa)
Brain GLUTag
GLUTag
GLUTag Brain
Pancreas
SNAP-25 (25 kDa)
Actin (42 kDa)
GLUTag Brain
41
VA
MP
2-G
FP
DA
PI
NP
Y-m
Ch
err
y D
AP
I
0
5
10
15
20
25
30
35
VAMP2-GFP NPY-mCherry VAMP2-GFPand NPY-mCherry
% o
f tr
an
sfe
cte
d G
LU
Tag
Cell
s
Figure 4.3 VAMP2 colocalizes with a granule marker in GLUTag cells GLUTag cells
were transfected with pcDNA3-VAMP2-GFP and the secretory granule marker, pEGFP-N1-
NPY-mCherry with a transfection efficiency of 31.7%. Images were acquired with a Zeiss
deconvolution microscope at 1 µm intervals along the z-axis. Both VAMP2-GFP and NPY-
mCherry were expressed in 96.3% of transfected cells (n = 1321 cells, from 2 different splits).
42
splits). In GLUTag cells transfected with pcDNA3-VAMP2-GFP and EGFP-NPY-mCherry,
the GFP and mCherry signals were found to colocalize or be in close proximity (Fig 4.3).
Immunoprecipitation of Syntaxin 1a demonstrated interactions between VAMP2 and
Syntaxin 1a, as well as between SNAP-25 or SNARE accessory protein Munc18-1 and
Syntaxin 1a under both basal and stimulated conditions (Fig 4.4). This is consistent with
interactions between the SNARE complex proteins. In contrast, no interaction between
VAMP1 and Syntaxin 1a could be detected in GLUTag cells, under either basal or stimulated
conditions.
Neurotoxins cleave SNARE proteins in GLUTag cells
Following digestion of neurotoxin plasmid vectors with EcoRI and XbaI, digestion
products were found to be at the predicted band sizes, confirming that the neurotoxin was
expressed in the plasmid vector (Fig 4.5A). Transfection efficiency of the pcDNA3 vector was
determined to be 45% (n=846 cells, from 2 different splits) (Fig 4.5B). GLUTag cells were
then transfected with the appropriate neurotoxin (pcDNA3-BoNTA, -BoNTC1, or -TetX) or
pcDNA3-GFP vector. Western blot demonstrated that BoNTA cleaved SNAP-25 at <20%
efficiency (Fig 4.6A). While BoNTC1 did not cleave SNAP-25 (Fig 4.6A), it did cleave
Syntaxin 1a but only at <5% efficiency (Fig 4.6B). Finally, TetX did not cleave VAMP2 in
the absence of DTT (Fig 4.6C). However, after DTT treatment, TetX-transfected GLUTag
cells exhibited a 48% decrease in VAMP2 (n=6, p<0.05) (Fig 4.7), with a similar decrease
seen in VAMP1 immunoreactivity (n=3; Fig 4.7).
43
Figure 4.4 VAMP2, but not VAMP1, interacts with core SNARE protein, Syntaxin 1a,
in GLUTag cells GLUTag cells were exposed to media alone (unstimulated) or stimulated
50mM KCl in media for 20 minutes. A Western blot for VAMP2, SNAP-25, Syntaxin 1a, and
Munc18-1 was performed for total cell lysate and Syntaxin 1a immunoprecipitated lysate. B
Interactions between VAMP2 and Syntaxin1a and C Munc18-1 and Syntaxin 1a were
quantified by densitometric analysis (p > 0.05 and p < 0.01; n=14 and 8, respectively).
Basal KCl KCl
Co-IP: Syntaxin 1a Control Input
VAMP2 (19 kDa) VAMP1 (17 kDa)
Syntaxin 1a (33 kDa)
SNAP-25 (25 kDa)
A
B
Basal KCl KCl
Munc 18-1 (67 kDa)
0
0.5
1
1.5
2
Unstimulated 20 min 50 mMKCl
Am
ou
nt
of
VA
MP
2/S
ynta
xin
1a C
0
0.4
0.8
1.2
Unstimulated 20 Min 50 mMKCl
Am
ou
nt
of
Mu
nc1
8-
1/S
ynta
xin
1a **
44
BoNTA BoNTC1 pcDNA3 GFP TetX
250 bp -
1000 bp -
2000 bp -
5500 bp -
Expected bp: 1500 1380 5400 700 1700
Figure 4.5 Neurotoxins transcripts are expressed in pcDNA3 vectors; pcDNA3 vectors
can be transfected into GLUTag cells. A EcoR1 and XbaI digestion of BoNTA, BoNTC1,
pcDNA3, GFP, and TetX constructs in bacterial plasmids. B pcDNA3-GFP vector was
transfected into GLUTag cells, and transfection efficiency of the vector was determined to
be 45% (n=846 cells, from 2 different splits).
GF
P D
AP
I
A
B
0
10
20
30
40
50
60
GFPTransfected
Cells
NonTransfected
Cells
% o
f C
ells
45
0.0
0.5
1.0
1.5
SN
AP
-25
/Ac
tin
A
0.0
0.5
1.0
1.5
Syn
tax
in 1
a/A
cti
n
B
pcD
NA
3
Bo
NT
A
Bo
NT
C1
Te
tX
Syntaxin 1a (33 kDa)
Actin (42 kDa)
pcD
NA
3
Bo
NT
A
Bo
NT
C1
Te
tX
SNAP-25 (25 kDa)
Actin (42 kDa)
pcD
NA
3
Te
tX
Bo
NT
A
Bo
NT
C1
VAMP2 (19 kDa)
Actin (42 kDa)
0.0
0.5
1.0
1.5
pcDNA3 TetX BoNTA BoNTC1
VA
MP
2/A
cti
n
C
Figure 4.6 Neurotoxins cleave SNARE proteins at low efficiency in GLUTag cells
Neurotoxins (BoNTA, BoNTC1, TetX) were transfected into GLUTag cells. Western blots
and densitometric analysis for A SNAP-25, B Syntaxin 1a, and C VAMP2 allowed for
examination of neurotoxin efficacy in GLUTag cells. Exposure times were increased for
better visualization of cleavage products, but densitometric analysis was performed on
images acquired at lower exposure times. Representative of n=3.
46
Actin 42 kDa
0.0
0.2
0.4
0.6
0.8
1.0
1.2
VAMP2 VAMP1
Am
ou
nt
of
VA
MP
(R
ela
tiv
eto
Acti
n)
pcDNA3 TetX*
VAMP2 19 kDa
VAMP1 17 kDa
pcD
NA
3
TetX
Figure 4.7 Activated TetX cleaves both VAMP2 and VAMP1 in GLUTag cells GLUTag
cells were transfected with pcDNA3-TetX, treated with 2 mM DTT for 10 minutes, and
allowed to recover for 4 hours. Densitometric analysis of western blots probed for
VAMP1/2/3 were performed in order to evaluate the efficacy of TetX cleavage of VAMP.
* p<0.05 Representative of n=3-6.
47
VAMP2 cleavage in GLUTag cells was visualized by co-transfecting GLUTag cells with
pcDNA3-VAMP2-GFP (decpited in Figure 4.8A) and either pcDNA3 or pcDNA3-TetX.
VAMP2-GFP was distributed evenly within the cytoplasm in control co-transfected cells, as
well as pcDNA3-VAMP2-GFP and pcDNA3-TetX co-transfected cells in the absence of DTT
(Fig 4.8B-C). In contrast, pcDNA3-VAMP2-GFP and pcDNA3-TetX co-transfected cells
treated with DTT, the fluorescence appeared to be be more focal and aggregated (Fig 4.8D).
This is consistent with studies in L6 myoblasts, which showed a similar re-distribution of the
cleaved portion of VAMP-2-GFP to the golgi regions (234). In GLUTag cells co-transfected
with pcDNA3-VAMP2-GFP and pcDNA3-TetX, 98% of the cells displayed aggregation of
VAMP2-GFP (n=1307, cells from 2 splits) (Fig 4.8E), which suggests that VAMP2 was
cleaved by TetX in almost all of the transfected cells. All further experiments involving TetX
were therefore performed in the presence of DTT for both control and TetX transfected cells.
Inactivation of VAMP decreased stimulated secretion of GLP-1
and granular exocytosis from GLUTag cells
To determine the role of VAMP in GLP-1 secretion, GLUTag cells transfected with
pcDNA3-GFP or pcDNA3-TetX were treated with known GLP-1 secretagogues. When
pcDNA3-GFP (control) transfected cells were treated with 0.1 μM GIP, GLP-1 secretion
increased significantly, by 2.2-fold as compared to vehicle-treated cells (p<0.05, n=6-8) (Fig
4.9A). Similarly, 1000 μM OA treatment increased GLP-1 secretion by 2.3-fold in control
transfected cells (p<0.01; n=8) (Fig 4.9B). However, in TetX-transfected GLUTag cells,
neither GIP nor OA treatment significantly increased GLP-1 secretion. Secretory granules in
the GLUTag cells were labelled by transfection with pCMV-NPY-pHluorin. This allowed for
visualization of granules, as well as fusion events, represented by flashes of fluorescence, by
48
0
20
40
60
80
100
Cytoplasmic VAMP2-GFP Perinuclear VAMP2-GFP
% o
f T
etX
-Tra
ns
fecte
d C
ell
s
VA
MP
2-G
FP
DA
PI
pcDNA3 V
AM
P2
-GF
P D
AP
I
TetX + DTT
Figure 4.8 VAMP2-GFP distribution altered in the presence of TetX A Schematic
diagram of VAMP2-GFP construct. GLUTag cells were transfected with pcDNA3-VAMP2-
GFP with B pcDNA3 or pcDNA3-TetX in the C absence or D presence of DTT. E Active
TetX caused relocalization and aggregation of VAMP2-GFP in 98% of transfected cells.
(n=1307 cells, from 2 different splits)
A
C
E
TetX - DTT D
VA
MP
2-G
FP
DA
PI
B
C
GFP
TetX
49
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Vehicle OA
Fo
ld S
ecre
tio
n (
Rela
tiv
e t
o C
on
tro
l)
pcDNA3 TetX
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Control GIP
Fo
ld S
ecre
tio
n (
Rela
tiv
e t
o C
on
tro
l)
pcDNA3 TetX
**
*
Figure 4.9 GLP-1 secretion is decreased in TetX transfected GLUTag cells GLUTag
cells were transfected with pcDNA3 (control) or pcDNA3-TetX and treated with A 1000 μM
Oleic Acid (n=8) or B 0.1 μM GIP (n=6-8). ** p < 0.01, * p < 0.05, 2-way ANOVA followed
by unpaired student’s t-test.
B
A
50
TIRFM. Representative photos of TIRF experiments for control- and TetX-transfected cells
are shown in Figure 4.10 and 4.11, respectively. In GLUTag cells transfected with pCMV-
NPY-pHluorin and pcDNA3 (control cells), the total number of fusion events during the basal
period was 1.9 ± 0.4/100 μm2. pCMV-NPY-pHluorin and TetX co-transfected cells exhibited
a total of 0.37 ± 0.2/100 μm2 fusion events. The number of fusion events increased significantly
in control-transfected cells, by 8.6 fold, when treated with a 50 mM KCl stimulus (p<0.001,
n=6) (Fig 4.12A-B). However, when TetX-transfected cells were treated with 50 mM KCl, the
number of fusion events did not significantly increase (p>0.05, n=6) (Fig 4.12A-B). The total
number of fusion events in pcDNA3-transfected GLUTag cells was therefore significantly
higher than in TetX-transfected GLUTag cells at all time points (Fig 4.12C). Representative
videos of the TIRF experiments are attached to this document.
Membrane rafts
RT-PCR analysis indicated expression of mRNA transcripts for the membrane raft
markers, Flotillin-1 and Caveolin-2 in GLUTag cells (Fig 4.13).
Neutral red cell viability assay confirmed that neither GLUTag nor MIN6 cells were
affected by treatment with MβCD, a cholesterol sequestering compound (Fig 4.14A). In order
to test for the role of membrane rafts in GLP-1 secretion, GLUTag cells were pretreated with
MβCD, and then treated with 0.1 mM MβCD alone or with 0.1 μM insulin. Basal secretion of
GLP-1 was not affected by MβCD treatment. However, instead of decreasing GLP-1 secretion
from GLUTag cells, as seen for insulin release from MβCD-treated islets and MIN6 cells
(225), the MβCD treatment had no effect on GLP-1 release by GLUTag cells (p>0.05, n=4)
(Fig 4.14B).
51
Frame 267/3001
Frame 268/3001
Basal
Frame 265/3001
Frame 266/3001
Frame 999/3001
Frame 1000/3001
Frame 1001/3001
Frame 1002/3001
Frame 1003/3001
Frame 1004/3001
+ 30 mM NH4Cl
Stimulated
Frame 1005/3001
Stimulated
Figure 4.10 Fusion events in pCMV-NPY-pHluorin and pcDNA3-transfected GLUTag
cells Control-transfected GLUTag cells were treated with KCl to stimulate exocytosis and
NH4Cl to visualize granules. Fusion events are marked by arrows.
+ 50 mM KCl
52
Basal Stimulated Stimulated
Frame 265/2959
Frame 266/2959
Frame 266/2959
Frame 267/2959
Frame 268/2959 Frame 1003/2959
Frame 1002/2959
Frame 1001/2959
Frame 1000/2959
Frame 999/2959 Frame 1004/2959
Frame 1005/2959
Frame 1006/2959
Frame 1254/2959
+ 30 mM NH4Cl
+ 50 mM KCl
Figure 4.11 Fusion events in pCMV-NPY-pHluorin and pcDNA3-TetX transfected
GLUTag cells TetX-transfected GLUTag cells were treated with KCl to stimulate
exocytosis and then with NH4Cl to visualize granules. Fusion events are marked by arrows.
53
** **
*
*
* *
*
pcDNA3 TetX
+ 50 mM KCl
pcDNA3 TetX
P<0.05 – 0.001
For All
+ 50 mM KCl
A
B
C
Figure 4.12 Exocytotic events decreased in TetX-transfected GLUTag cells GLUTag
cells were transfected with pCMV-NPY-pHluorin and pcDNA3 or pcDNA3-TetX. 50 mM
KCl was added to depolarize GLUTag cells and stimulate secretion. A-B Total number of
fusion events per treatment period and C Cumulative number of fusion events in pcDNA3
and TetX-transfected GLUTag cells (*p < 0.05, ** p < 0.01, *** p < 0.001, n=6)
0
5
10
15
20
25
Basal Stimulated
# o
f Fu
sio
n E
ven
ts/1
00
μm
2
pcDNA3 TetX
*
*
Time (sec)
Fu
sio
n e
ve
nts
/1
00
µm
2
To
tal F
usio
n e
ve
nts
/1
00
µm
2
***
54
MIN6
Figure 4.13 GLUTag cells express mRNA transcripts for membrane raft markers as
well as cholesterol metabolism pathway proteins RT-PCR analysis for markers of
membrane rafts (Flotillin-1 and Caveolin-2) and cholesterol metabolism (Cholesterol Efflux:
ABG5, ABG8, ABCA1; Cholesterol synthesis: HMG-CoA Reductase; Cholesterol
Absorption: LDLr, NPC1L1) in GLUTag and MIN6 cells. Representative of n=3.
bp: 384 367 250 384 367 250
bp: 805 268 261 190 89 115 805 268 261 190 89 115
GLUTag MIN6
Flo
tilli
n-1
Caveolin
-2
AB
G5
AB
G8
AB
CA
1
HM
G-C
oA
Red
ucta
se
GLUTag MIN6
Flo
tilli
n-1
Caveolin
-2
AB
G5
AB
G8
AB
CA
1
HM
G-C
oA
Red
ucta
se
LD
Lr
NP
C1
L1
GA
PD
H
LD
Lr
NP
C1
L1
GA
PD
H
1000 bp -
500 bp -
100 bp -
- - -
- - - -
500 bp -
100 bp -
- - -
55
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Control H₂O₂ 0.1 mM MβCD
OD
540 n
m (
Fo
ld o
f C
on
tro
l)
GLUTag MIN6
* *
0.0
0.5
1.0
1.5
2.0
2.5
Control Insulin
GL
P-1
Secre
tio
n (
Fo
ld o
f C
on
tro
l)
Control 0.1 mM MBCD
*
Figure 4.14 MβCD treatment does not affect cell viability or GLP-1 secretion from
GLUTag cells A Neutral red cell viability assay performed to assess the effects of 2.5 hour
0.1mM MβCD treatment on GLUTag and MIN6 cell viability. H2O2 treatment (2.5 hour 30
mM) was used as a positive control. B GLUTag cells were pretreated with 0 (control) or 0.1
mM MβCD before treatment with 0.1 μM insulin (± 0.1 mM MβCD) for 2 hours. (* p < 0.05,
n=4).
A
B
56
Markers of Cholesterol handling in GLUTag cells
Cholesterol depletion has been found to improve insulin secretion in studies wherein β-cells
were overloaded with cholesterol or had impaired cholesterol handling (237). Thus, RT-PCR
was performed for transcripts of proteins involved in cholesterol synthesis, absorption, and
efflux (n=3). Both GLUTag and MIN6 cells were found to express 3-hydroxy-3-methyl-
glutaryl-coenzyme A Reductase (HMG-CoA reductase), the rate limiting enzyme in
cholesterol synthesis (Fig 4.13). mRNA expression for low density lipoprotein receptor (LDLr)
and Niemann-Pick C1-Like 1 (NPC1L1) transcripts, both important in cholesterol absorption,
was found in GLUTag cells, whereas MIN6 cells expressed only LDLr (Fig 4.13). Both cell
lines were found to express mRNA for the cholesterol efflux proteins, ATP-binding cassette
transporter genes (ABG)-5 and -8, and the ATP-binding cassette transporter 1 (ABCA1) (Fig
4.13). Although mRNA expression does not always translate into protein expression or
function, RT-PCR data suggests that cholesterol handling in GLUTag cells is normal, as
compared to MIN6 cells.
MβCD treatment depleted cholesterol from MIN6 cells, but not
GLUTag cells.
Finally, cells were examined for MβCD-induced changes in both cholesterol levels and
distribution. Visual examination of Filipin fluorescence demonstrated that 2.5 hour of MβCD
treatment did change distribution or levels of Filipin fluorescence in GLUTag cells, as
compared to control media alone (Fig 4.15A). Treatment with 1.25 μM U18666A, a cholesterol
transport inhibitor (positive control) also did not visually change cholesterol levels or
cholesterol distribution in GLUTag cells (Fig 4.15A). Quantification of cholesterol levels via
spectrometer further indicated that cholesterol levels in GLUTag cells did not change with
57
Figure 4.15 MβCD treatment could not deplete cholesterol in GLUTag cells A Filipin
fluorescence was imaged after GLUTag cells were treated for 2.5 hours with 0.1 mM
MβCD or 72 hour with 1.25 μM Cholesterol Transport Inhibitor (U18666A) (n=6). B
Changes in Filipin fluorescence were quantified in order to determine the effects of 0.1 mM
MβCD or U18666A on cholesterol levels in GLUTag and MIN6 cells (n=8).
0.1 mM MβCD Media
Cholesterol Transport Inhibitor
A
B
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
Control 0.1 mM MβCD Cholesterol TransportInhibitor
Exci
tati
on
34
0, E
mis
sio
n 3
85
nm
(Fo
ld o
f C
on
tro
l)
GLUTag MIN6
58
either MβCD or U18666A treatment (Fig 4.15B). In contrast, MIN6 cells exhibited a marked
decrease, although not statistically significant, in Filipin fluorescence with both MβCD and
U18666A treatments (Fig 4.15B). Thus, as the MβCD treatment did not seem to decrease
cholesterol levels in GLUTag cells, the membrane raft experiments were not pursued further.
Discussion
With T2D becoming more prevalent, the Canadian Diabetes Associatinon predicts that
T2D treatments will cost the Canadian government $16.9 billion annually by the year 2020
(CDA). Early treatment of T2D, through the control of hyperglycemia, can prevent costly
complications such as limb amputation (CDA). GLP-1 not only increases glucose-dependent
insulin secretion, but can also have positive effects on the cardiovascular diseases that are often
related to diabetes (8;118). In order to increase endogenous secretion of GLP-1, it is important
to understand the mechanisms that regulate fusion of the granule. In endocrine cells, granule-
membrane fusion is exclusively governed by the SNARE complex proteins.
This study demonstrates that core SNARE proteins are expressed in GLUTag cells, a
validated murine model of the enteroendocrine L-cells (73;78;80;138-140). For the first time,
I demonstrate that although GLUTag cells express both VAMP2 and VAMP1, VAMP2 is the
only isoform that interacts with Syntaxin 1a, and that appears to be essential in the exocytosis
of GLP-1. Finally, I also determined that despite the possible existence of membrane rafts in
the GLUTag cells, MβCD treatment could not deplete cholesterol levels and did not reduce
GLP-1 secretion.
59
VAMP2, the best characterized isoform of the VAMP family, has been shown to be
essential in mediating granule-vesicle fusion in several types of secretory cells, ranging from
neurons to pancreatic α- and β-cells (164;202-206). For the first time, VAMP2 has now been
shown to play an essential role in enteroendocrine L-cell secretion. In summary, pcDNA3-
TetX was transfected into GLUTag cells at 45% efficiency, decreasing VAMP2 (and VAMP1)
immunoreactivity by 55%. In the GLP-1 secretion studies, the effects of TetX-mediated
VAMP2 inactivation were only observed under GIP- and OA-stimulated conditions; basal
secretion of GLP-1 was not different between control and TetX transfected GLUTag cells. In
contrast, TetX-transfected cells displayed a 75% decrease in the number of exocytotic events
under basal conditions as compared to the control (0.4±2 vs 1.9±0.4 fusion events/100 µm2,
respectively) in single-cell TIRF experiments.
Although both the population and single cell studies examined basal secretion of GLP-
1, TetX-transfected cells only exhibited a significant decrease in basal secretion in the single
cell experiments. It must be noted that the GLP-1 secretion studies examined the combined
response of both TetX-transfected and non-transfected cells (e.g. the entire cell population).
Thus, the effects of VAMP2 inactivation on GLP-1 secretion is masked by the non-transfected
cells; the decrease in secretion in TetX-transfected GLUTag cells could be more dramatic than
observed. Both TetX and NPY-pHluorin vectors should have been transfected into GLUTag
cells at equal efficiency, based on the findings made with TetX and VAMP2-GFP co-
transfection studies. Thus, results from the single-celled experiments are likely a better
representation of VAMP2 inactivation, as the fluorescent labelleling allows for identification
of TetX-transfected cells. A recent study by Oya and colleagues demonstrated that in NPY-
Venus transfected GLUTag cells, only 75% of NPY-containing granules also contained GLP-
60
1—in fact, a better marker may be tissue plasminogen A, which was found to colocalize with
80% of the GLP-1 containing granules (238). However, as tissue plasminogen A has been
found to be released slowly and be retained in granules, NPY-pHluorin allows for better
visualization and understanding of fusion dynamics in TIRF studies (239).
In Streptolysin-O permeablized and TetX-LC treated hamster HIT-T15 β-cells, a 77 %
decrease in VAMP2 and 92% decrease in cellubrevin caused an 84% inhibition in Ca2+-
induced insulin exocytosis (164). Furthermore, TetX-LC transfection into HIT-T15 cells at 40-
50% efficiency caused a 45% decrease in Ca2+-dependent insulin secretion (206).
Densitometric analyses demonstrated that TetX decreased VAMP2 immunoreactivity by 55%
efficiency. In contrast to the BoNT/A toxins, the TetX cleavage product was not observed as
the VAMP2 cleavage product is rapidly degraded (206). In VAMP2-GFP transfected cells, the
cleavage product is attached to GFP, which stabilizes the protein and allows for visualization
of movement, and perhaps recycling, following TetX cleavage. Our GLP-1 secretion studies
show that a 55% inactivation of VAMP2 (and VAMP1) leads to a 38% decrease in GIP-
stimulated GLP-1 secretion, and a 40% decrease in OA-stimulated GLP-1 secretion. In TIRFM
experiments, control transfected cells exhibited a significant 8.6-fold increase in fusion events
after KCl stimulus. In contrast, TetX-transfected cells exhibited a 12.4-fold increase in fusion
events, however, this increase was not significant. Since there was such a low number of basal
fusion events in TetX-transfected cells, the fold increase in stimulated fusion events seems
more dramatic as compared to control. It is known that TetX cannot cleave VAMP2 when it is
assembled into a complex, however, the SNARE proteins can come out of complex, and allow
for TetX cleavage of VAMP (190); thus, the fusion events seen in the TetX-transfected TIRF
experiments may be due to inefficient TetX action.
61
Since TetX action is dependent on DTT activation (207;235), TetX is only active for
less than six hours. This time period was not sufficient for TetX to cleave all VAMP2 present
in the GLUTag cells, as fusion events were still in some of the TIRF experiments. Thus, an
increased time period of TetX action could allow for a more complete cleavage of VAMP2
proteins. However, this is not possible in the current studies, as prolonged or repeated DTT
treatment could possibly cause cause issues with cell viability. Moreover, sustained TetX
activity can also cause an accumulation of granules within the GLUTag cells, which may lead
to ER stress and dysfunction of the GLUTag cells. Thus, although the current model for
VAMP2 inactivation may not allow for complete cleavage of VAMP2 in the GLUTag cells, it
eliminates potential confounding factors, such as ER stress or cell death, that may occur with
prolonged exposure to TetX.
VAMP2 inactivation was able to inhibit GLP-1 secretion/exocytosis following
stimulation with GIP, OA, and KCl. All three secretagogues work through separate pathways
to stimulate release of GLP-1 (70;77;78;84;85). GIP stimulates GLP-1 secretion through a
PKA and Ca2+-mediated pathway (70;84). Direct depolarization with KCl also requires an
increase of intracellular Ca2+ in order to stimulate GLP-1 secretion (73). In contrast, it has been
reported that there is no increase in Ca2+ levels following OA stimulation of GLP-1 (77).
Instead, PKCζ was found to be an essential component in the OA signaling pathway (77).
Downstream signaling remains unknown, but is unlikely to require GTP, as earlier studies in
β-cells have shown that TetX does not inhibit GTP stimulated secretion (164). It has been
previously shown that PKCζ directly phosphorylates VAMP2 and promotes GLUT4
movement to the membrane of skeletal muscle (240). Similarly, PKCζ could also directly
interact with VAMP2 in OA-stimulated GLP-1 exocytosis.
62
For the first time, I demonstrate that while GLUTag cells express mRNA transcripts
for all isoforms of VAMP, only protein expression for VAMP2 and VAMP1 was observed via
western blot (VAMP3 and 8 were not detected and, as VAMP4, 5, 7 are not known to regulate
exocytosis, their protein expression was not examined). TetX cleaved both VAMP2 and
VAMP1 in GLUTag cells; both VAMP isoforms have been shown to be capable of regulating
exocytosis, and the non-specificity of TetX results in the inactivation of both isoforms in our
studies. Therefore, the decrease in exocytosis may be due to the inactivation of both VAMP2
and VAMP1.
It would be logical to assume that whichever isoform of VAMP is expressed at higher
levels would be responsible for GLP-1 exocytosis. Visually, in the western blots it seems that
VAMP2 is expressed at greater levels than VAMP1. However, as it has not been confirmed
that the VAMP1/2/3 antibody has equal affinity for both VAMP1 and VAMP2, a standard
curve for both proteins would be required to determine the relative amounts of VAMP1 and
VAMP2 expressed. Furthermore, VAMP1 involvement in GLP-1 exocytosis was ruled out by
the Syntaxin 1a co-immunoprecipitation studies, wherein VAMP2, but not VAMP1
immunoreactivity was detected. Western blot confirmed that Syntaxin 1a also interacts with
SNAP-25 to form the classic VAMP2/Syntaxin 1a/SNAP-25 core SNARE complex.
Notwithstanding, to completely eliminate a role for VAMP1 in GLP-1 exocytosis, two
experiments would have to be performed: 1) SNAP-25 co-immunoprecipitation studies, as
outlined below; and 2) VAMP2 siRNA-mediated knockdown.
SNAP-25 is the only isoform from its family expressed in the GLUTag cells. Thus,
SNAP-25 must exclusively mediate exocytosis. Co-immunoprecipitation studies should show
that VAMP2 is the only isoform that can form a complex with SNAP-25 and Syntaxin 1a; thus,
63
it would be concluded that VAMP1 must not have a role in GLP-1 exocytosis. siRNA
experiments would be the final confirmation that VAMP2 is the isoform of VAMP regulating
GLP-1 exocytosis. However, siRNA experiments would have to be performed for both
VAMP1 and VAMP2. With VAMP2 inactivated, VAMP1 could be used in replacement,
leading to an exocytotic phenotype that indicates VAMP2 is not as important as currently
expected. This phenomenon has been seen in β-cells, in which SNAP-23 is used in conditions
where SNAP-25 has been inactivated (176). Thus, VAMP1 siRNA knockdown must also be
performed in order to determine VAMP1’s innate role in GLP-1 exocytosis. Nonetheless, since
VAMP2 is the only isoform that interacts with Syntaxin 1a in GLUTag cells, there is a high
possibility that VAMP2 is the only VAMP isoform involved in GLP-1 exocytosis.
GLUTag cells also secrete glutamate and VAMP1 may play a role in the exocytosis of
these synaptic vesicles (241). In β-cells, VAMP2 and VAMP3 are localized to both GABA-
containing synaptic vesicles and insulin-containing secretory granules (164). Fractionation and
density gradient centrifugation experiments, followed by western blot, could determine which
isoform of VAMP is localized to synaptic vesicles, secretory granules, or both types of
exocytotic organelles.
As mentioned earlier, VAMP2 co-immunoprecipitated with Syntaxin 1a under both
basal and stimulated conditions. Some studies have shown that the interactions between
VAMP2 and other core SNARE complex proteins are increased under stimulated conditions
(165), whereas others have shown that although the SNARE complex proteins are essential in
exocytosis, no increased interactions can be detected by co-immunoprecipitation (163). I
demonstrated that, in GLUTag cells, there exists no significant increase in VAMP2-Syntaxin
64
1a interactions under stimulated conditions. However, this does not necessarily mean that
VAMP2 is not involved with GLP-1 exocytosis.
The core SNARE complex is thought to be in trans-conformation when granules are
docked but not fused (157;242). However, following the fusion event, the SNARE complex is
in cis-conformation as all proteins are located on one continuous membrane (157;242).
Munc18-1, a SNARE accessory protein, plays an essential role in the docking of granules and
only interacts with the core SNARE complex in trans-configuration (157;242). Therefore,
analyzing interactions between Syntaxin 1a and Munc18-1 can be used to determine changes
from trans- to cis-SNARE complex configurations (243). Results indicated a decrease in
interaction between Munc18-1 and Syntaxin 1a following KCl treatment. By extension, this
suggests that KCl treatment caused an increase in cis-configured SNARE proteins as well as
fusion events, consistent with the increased number of exocytotic events seen by TIRF. The
lack of increase in VAMP2-Syntaxin 1a interactions following KCl treatment could therefore
suggest that KCl treatment promotes fusion of previously docked granules to the plasma
membrane but not recruitment of newcomer granules within the time frame of this study. Of
note, KCl treatment changes the concentration gradient for K+ ions and favours movement of
ions into the L cell or prevents movement of K+ ions out of the L-cell. This causes an
accumulation of positive K+ ions in the L-cell which directly depolarizes the L-cell and
promotes exocytosis. However, as the timelines in both the co-immunoprecipitation and TIRF
studies are greater than 10 minutes, several rounds of depolarization are expected to occur as
the K+ ion channels are likely to close and cause another round of depolarization until the
concentration gradient is depleted.
65
Alternatively, NSF and α-SNAP could have efficiently disassembled the SNARE
complex, thereby rapidly decreasing interactions between VAMP2 and Syntaxin 1a following
KCl treatment. Studies in cardiomyocytes have shown that treatment with N-Ethylmaleimide
inhibits disassembly of the core SNARE complex (163), co-immunoprecipitation following
this treatment demonstrated a significant increase of VAMP2 interactions with Syntaxin 1a,
without this treatment cardiomyocytes did not display altered interactions between the SNARE
complex proteins, similar to what was seen in GLUTag cells (163). Thus, repeating the co-
immunoprecipitation experiments with an N-Ethylmaleimide pretreatment may demonstrate
that an increased interaction between VAMP2 and Syntaxin 1a following secretagogue
treatment.
The existence of membrane rafts within GLUTag cells remains questionable. While I
demonstrated that the GLUTag cells express mRNA transcripts for membrane raft markers
Flotillin-1, Caveolin-2 (as well as Flotillin-2 and Caveolin-1, data not shown), protein
expression was not confirmed. As demonstrated earlier, GLUTag cells were found to express
mRNA transcripts for VAMP3 and VAMP8; however, these mRNA transcripts were not
translated into protein expression. This could also be the situation for expression of membrane
raft markers; thus, fractionation and density gradient centrifugation experiments must be
performed for membrane raft protein markers in order to confirm the existence of membrane
rafts in GLUTag cells. Such experiments have already been conducted for in PC12, β-, and α-
cells to demonstrate the localization of plasma membrane-associated SNARE proteins (SNAP-
25 and Syntaxin 1a) in membrane rafts (203;244;245).
MβCD treatment (0.1 mM for 2.5 hours) maximally inhibits insulin secretion from
MIN6 cells as well as perfused islets (225). However, the opposite effect was seen in GLUTag
66
cells, wherein the same MβCD treatment did not reduce insulin-stimulated GLP-1 secretion.
When cells are overloaded with cholesterol, such as LDLr-/- islets or cholesterol-loaded β-
cells, secretion is inhibited (237;246). In these situations, MβCD treatment was found to
increase secretion, due to normalization of cholesterol levels (237;246). Abnormalities in
cholesterol metabolism within the GLUTag cells could therefore have caused increased
cholesterol levels within the cell. Thus, RT-PCR analysis was performed in order to compare
mRNA expression of GLUTag and MIN6 cells with regards to proteins involved with
cholesterol absorption (LDLr, NPC1L1), synthesis (HMG-CoA reductase), and efflux (ABG5,
ABG8, ABCA1). GLUTag cells were found to express mRNA transcripts for all of the proteins
listed above, with the exception of ABG8, similar to MIN6 cells, which were also found not to
express NPC1L1. Thus, cholesterol metabolism was suggested to be normal in GLUTag cells,
as compared to MIN6 cells.
Although the MβCD treatment did not affect GLUTag or MIN6 cell viability or
GLUTag cell secretion, it also did not alter cholesterol levels in GLUTag cells. In contrast,
MβCD significantly decreased cholesterol levels in MIN6 cells, as previously reported (225).
Alternatively, inhibition of endogenous cholesterol synthesis has been also been used in MIN6
cells to deplete cholesterol (247). However, as cholesterol is such an important component in
cellular function, the same study demonstrated that inhibition of cholesterol synthesis greatly
affects the integrity of the cellular membrane (247). Therefore, in order to determine the role
of membrane rafts in GLUTag cells, more selective membrane raft disruption techniques must
be developed first.
The only model used in these studies were the murine GLUTag cells. Although
GLUTag cells are an excellent secretion model of the enteroendocrine L-cell (73;78;80;138-
67
140), the use of primary cell cultures or in vivo models would confirm and possibly lead to a
better understanding of the role of VAMP2, and other SNARE proteins, in GLP-1 exocytosis
from the enteroendocrine L-cell. VAMP2-null mice are neonatal lethal (248), thus in vivo
experiments cannot be performed unless mice with L-cell specific VAMP2 knockout can be
created. Alternatively, fetal mouse intestinal cell cultures can be created from VAMP2
knockout mice, and used as a primary cell model of the enteroendocrine L-cell. Furthermore,
our lab has previously used an adenovirus-mediated approach to successfully knockdown
PKCζ in the rat colon (78). Similar experiments could be performed in order to evaluate
VAMP2’s role in the L-cell in vivo. Although FMIC and in vivo experiments may be better
physiological models of the enteroendocrine L-cell, GLUTag cells have allowed for specific
and essential experiments to be performed in the conduct of this thesis. Studies in GLUTag
cells have shown that VAMP2 plays an essential role in GLP-1 exocytosis, and are an excellent
starting point for further studies of SNARE proteins in enteroendocrine L-cells.
In the future, the role of other core SNARE complex isoforms and SNARE accessory
proteins will be examined. Syntaxin 4 has been shown to regulate both the first and second
phase of insulin secretion from the ß-cell (211). In contrast, Dr. Gaisano’s laboratory has
recently demonstrated that Syntaxin 2 plays an inhibitory role in insulin secretion (249). It will
be interesting to see whether the roles of these two Syntaxin isoforms have similar roles in L-
cell. While only core SNARE complex proteins are required for granule-membrane fusion,
SNARE accessory proteins are essential in the mediation of efficient exocytosis.
Synaptotagmin 7 has already been shown to function as the Ca2+ sensor in the L-cell (218),
and is essential in the exocytosis of GLP-1. Examination of the roles of other accessory proteins
will allow for a better understanding of GLP-1 exocytosis.
68
Defective insulin secretion in T2D patients can be linked to dysfunction of SNARE
protein function. Elevated glucose levels cause decreased expression of VAMP2 and VAMP3,
but not SNAP-25 and Syntaxin 1a, in β-cells in vivo and in vitro (250). This decrease in VAMP
proteins affects the number of SNARE complexes formed, which causes a reduction in
glucose-stimulated insulin secretion. GLP-1 secretion is also affected in some T2D patients
(251); as with the β-cell, reduced GLP-1 secretion can be caused by a loss of VAMP proteins.
In conclusion, the findings of this study show that VAMP2 plays an essential role in
GLP-1 exocytosis from the GLUTag cells, whereas the role of membrane rafts in GLP-1
secretion remains to be determined. Given the current rising trends in T2D, the need for novel
and effective therapies for this disease will only increase. Therapies that target GLP-1 not only
stimulate insulin secretion, but can also target other symptoms related to T2D such as
hypertension, and obesity. With a better understanding of the underlying mechanisms of GLP-
1 exocytosis could provide new avenues for pharmacological agents that act to secrete
endogenous GLP-1.
69
Reference List
1. Wilding JP, Hardy K 2011 Glucagon-like peptide-1 analogues for type 2 diabetes.
BMJ 342:d410
2. Madsbad S 2009 Exenatide and liraglutide: different approaches to develop GLP-1
receptor agonists (incretin mimetics)--preclinical and clinical results. Best Pract Res
Clin Endocrinol Metab 23:463-477
3. Buse JB, Henry RR, Han J, Kim DD, Fineman MS, Baron AD 2004 Effects of
exenatide (exendin-4) on glycemic control over 30 weeks in sulfonylurea-treated
patients with type 2 diabetes. Diabetes Care 27:2628-2635
4. Gallwitz B 2005 Glucagon-like peptide-1-based therapies for the treatment of type 2
diabetes mellitus. Treat Endocrinol 4:361-370
5. Herman GA, Bergman A, Stevens C, Kotey P, Yi B, Zhao P, Dietrich B, Golor
G, Schrodter A, Keymeulen B, Lasseter KC, Kipnes MS, Snyder K, Hilliard D,
Tanen M, Cilissen C, De Smet M, De Lepeleire I, Van DK, Wang AQ, Zeng W,
Davies MJ, Tanaka W, Holst JJ, Deacon CF, Gottesdiener KM, Wagner JA 2006
Effect of single oral doses of sitagliptin, a dipeptidyl peptidase-4 inhibitor, on incretin
and plasma glucose levels after an oral glucose tolerance test in patients with type 2
diabetes. J Clin Endocrinol Metab 91:4612-4619
6. Gallwitz B 2008 Saxagliptin, a dipeptidyl peptidase IV inhibitor for the treatment of
type 2 diabetes. IDrugs 11:906-917
7. Augeri DJ, Robl JA, Betebenner DA, Magnin DR, Khanna A, Robertson JG,
Wang A, Simpkins LM, Taunk P, Huang Q, Han SP, Abboa-Offei B, Cap M,
Xin L, Tao L, Tozzo E, Welzel GE, Egan DM, Marcinkeviciene J, Chang SY,
Biller SA, Kirby MS, Parker RA, Hamann LG 2005 Discovery and preclinical
profile of Saxagliptin (BMS-477118): a highly potent, long-acting, orally active
dipeptidyl peptidase IV inhibitor for the treatment of type 2 diabetes. J Med Chem
48:5025-5037
8. Ussher JR, Drucker DJ 2012 Cardiovascular biology of the incretin system. Endocr
Rev 33:187-215
9. Elrick H, Stimmler L, Hlad CJ, Jr., Arai Y 1964 Plasma insulin response to oral
and intravenous glucose administration. J Clin Endocrinol Metab 24:1076-1082
10. McIntyre N, Holdsworth CD, Turner DS 1964 New interpretation of oral glucose
tolerance. Lancet 2:20-21
70
11. Loew ER, Gray JS, Ivy AC 1940 Is a duodenal hormone involved in carbohydrate
metabolism? American Journal of Physiology -- Legacy Content 129:659-663
12. Brown JC, Pederson RA, Jorpes E, Mutt V 1969 Preparation of highly active
enterogastrone. Can J Physiol Pharmacol 47:113-114
13. Brown JC, Mutt V, Pederson RA 1970 Further purification of a polypeptide
demonstrating enterogastrone activity. J Physiol 209:57-64
14. Brown JC, Dryburgh JR 1971 A gastric inhibitory polypeptide. II. The complete
amino acid sequence. Can J Biochem 49:867-872
15. Polak JM, Bloom SR, Kuzio M, Brown JC, Pearse AG 1973 Cellular localization
of gastric inhibitory polypeptide in the duodenum and jejunum. Gut 14:284-288
16. Simmons TC, Taylor IL, Maxwell V, Brown JC, Grossman MI 1981 Failure of
gastric inhibitory polypeptide to inhibit pentagastrin-stimulated acid secretion in
vagotomized human subjects. Dig Dis Sci 26:902-904
17. Sarson DL 1978 Gastric inhibitory polypeptide (GIP). J Clin Pathol Suppl (Assoc
Clin Pathol ) 8:31-37
18. Dupre J, Ross SA, Watson D, Brown JC 1973 Stimulation of insulin secretion by
gastric inhibitory polypeptide in man. J Clin Endocrinol Metab 37:826-828
19. Andersen DK, Elahi D, Brown JC, Tobin JD, Andres R 1978 Oral glucose
augmentation of insulin secretion. Interactions of gastric inhibitory polypeptide with
ambient glucose and insulin levels. J Clin Invest 62:152-161
20. Vilsboll T, Krarup T, Sonne J, Madsbad S, Volund A, Juul AG, Holst JJ 2003
Incretin secretion in relation to meal size and body weight in healthy subjects and
people with type 1 and type 2 diabetes mellitus. J Clin Endocrinol Metab 88:2706-
2713
21. Xie D, Cheng H, Hamrick M, Zhong Q, Ding KH, Correa D, Williams S, Mulloy
A, Bollag W, Bollag RJ, Runner RR, McPherson JC, Insogna K, Isales CM 2005
Glucose-dependent insulinotropic polypeptide receptor knockout mice have altered
bone turnover. Bone 37:759-769
22. Nyberg J, Anderson MF, Meister B, Alborn AM, Strom AK, Brederlau A,
Illerskog AC, Nilsson O, Kieffer TJ, Hietala MA, Ricksten A, Eriksson PS 2005
Glucose-dependent insulinotropic polypeptide is expressed in adult hippocampus and
induces progenitor cell proliferation. J Neurosci 25:1816-1825
23. Bollag RJ, Zhong Q, Ding KH, Phillips P, Zhong L, Qin F, Cranford J, Mulloy
AL, Cameron R, Isales CM 2001 Glucose-dependent insulinotropic peptide is an
integrative hormone with osteotropic effects. Mol Cell Endocrinol 177:35-41
71
24. Hauner H, Glatting G, Kaminska D, Pfeiffer EF 1988 Effects of gastric inhibitory
polypeptide on glucose and lipid metabolism of isolated rat adipocytes. Ann Nutr
Metab 32:282-288
25. Baggio LL, Drucker DJ 2007 Biology of incretins: GLP-1 and GIP.
Gastroenterology 132:2131-2157
26. Lauritsen B, Holst JJ, Moody AJ 1981 Depression of insulin release by anti-GIP
serum after oral glucose in rats. Scand J Gastroenterol 16:417-420
27. Ebert R, Unger H, Creutzfeldt W 1983 Preservation of incretin activity after
removal of gastric inhibitory polypeptide (GIP) from rat gut extracts by
immunoadsorption. Diabetologia 24:449-454
28. Lauritsen KB, Moody AJ, Christensen KC, Lindkaer JS 1980 Gastric inhibitory
polypeptide (GIP) and insulin release after small-bowel resection in man. Scand J
Gastroenterol 15:833-840
29. Hansotia T, Baggio LL, Delmeire D, Hinke SA, Yamada Y, Tsukiyama K, Seino
Y, Holst JJ, Schuit F, Drucker DJ 2004 Double incretin receptor knockout
(DIRKO) mice reveal an essential role for the enteroinsular axis in transducing the
glucoregulatory actions of DPP-IV inhibitors. Diabetes 53:1326-1335
30. Unger RH, Ketterer H, Eisentraut AM 1966 Distribution of immunoassayable
glucagon in gastrointestinal tissues. Metabolism 15:865-867
31. Orci L, Pictet R, Forssmann WG, Renold AE, Rouiller C 1968 Structural evidence
for glucagon producing cells in the intestinal mucosa of the rat. Diabetologia 4:56-67
32. Ravazzola M, Siperstein A, Moody AJ, Sundby F, Jacobsen H, Orci L 1979
Glicentin immunoreactive cells: their relationship to glucagon-producing cells.
Endocrinology 105:499-508
33. Hirota M, Shimizu I, Ohboshi C, Nishino T, Shima K 1987 A large molecular
form of glucagon-like peptide-1 (GLP-1) immunoreactivity is co-released with
glucagon from pancreas by arginine in normal subjects. Clin Chim Acta 167:293-302
34. Larsen PJ, Tang-Christensen M, Holst JJ, Orskov C 1997 Distribution of
glucagon-like peptide-1 and other preproglucagon-derived peptides in the rat
hypothalamus and brainstem. Neuroscience 77:257-270
35. Tager HS, Markese J 1976 Immunoreactive "glucagons" in pancreatic islets.
Metabolism 25:1343-1346
36. Tager H, Hohenboken M, Markese J, Dinerstein RJ 1980 Identification and
localization of glucagon-related peptides in rat brain. Proc Natl Acad Sci U S A
77:6229-6233
72
37. Tager HS, Markese J 1979 Intestinal and pancreatic glucagon-like peptides.
Evidence for identity of higher molecular weight forms. J Biol Chem 254:2229-2233
38. Lund PK, Goodman RH, Dee PC, Habener JF 1982 Pancreatic preproglucagon
cDNA contains two glucagon-related coding sequences arranged in tandem. Proc Natl
Acad Sci U S A 79:345-349
39. Lund PK, Goodman RH, Montminy MR, Dee PC, Habener JF 1983 Anglerfish
islet pre-proglucagon II. Nucleotide and corresponding amino acid sequence of the
cDNA. J Biol Chem 258:3280-3284
40. Bell GI, Sanchez-Pescador R, Laybourn PJ, Najarian RC 1983 Exon duplication
and divergence in the human preproglucagon gene. Nature 304:368-371
41. Ohara-Imaizumi M, Nishiwaki C, Kikuta T, Kumakura K, Nakamichi Y,
Nagamatsu S 2004 Site of docking and fusion of insulin secretory granules in live
MIN6 beta cells analyzed by TAT-conjugated anti-syntaxin 1 antibody and total
internal reflection fluorescence microscopy. J Biol Chem 279:8403-8408
42. Mojsov S, Weir GC, Habener JF 1987 Insulinotropin: glucagon-like peptide I (7-
37) co-encoded in the glucagon gene is a potent stimulator of insulin release in the
perfused rat pancreas. J Clin Invest 79:616-619
43. Drucker DJ, Philippe J, Mojsov S, Chick WL, Habener JF 1987 Glucagon-like
peptide I stimulates insulin gene expression and increases cyclic AMP levels in a rat
islet cell line. Proc Natl Acad Sci U S A 84:3434-3438
44. Ghiglione M, Uttenthal LO, George SK, Bloom SR 1984 How glucagon-like is
glucagon-like peptide-1? Diabetologia 27:599-600
45. Kreymann B, Williams G, Ghatei MA, Bloom SR 1987 Glucagon-like peptide-1 7-
36: a physiological incretin in man. Lancet 2:1300-1304
46. Burrin DG, Stoll B, Guan X, Cui L, Chang X, Hadsell D 2007 GLP-2 rapidly
activates divergent intracellular signaling pathways involved in intestinal cell survival
and proliferation in neonatal piglets. Am J Physiol Endocrinol Metab 292:E281-E291
47. Drucker DJ, Erlich P, Asa SL, Brubaker PL 1996 Induction of intestinal epithelial
proliferation by glucagon-like peptide 2. Proc Natl Acad Sci U S A 93:7911-7916
48. Kirkegaard P, Moody AJ, Holst JJ, Loud FB, Olsen PS, Christiansen J 1982
Glicentin inhibits gastric acid secretion in the rat. Nature 297:156-157
49. Sasaki M, Fitzgerald AJ, Mandir N, Sasaki K, Wright NA, Goodlad RA 2001
Glicentin, an active enteroglucagon, has a significant trophic role on the small
intestine but not on the colon in the rat. Aliment Pharmacol Ther 15:1681-1686
73
50. Pellissier S, Sasaki K, Le-Nguyen D, Bataille D, Jarrousse C 2004 Oxyntomodulin
and glicentin are potent inhibitors of the fed motility pattern in small intestine.
Neurogastroenterol Motil 16:455-463
51. Jarrousse C, Niel H, Audousset-Puech MP, Martinez J, Bataille D 1986
Oxyntomodulin and its C-terminal octapeptide inhibit liquid meal-stimulated acid
secretion. Peptides 7 Suppl 1:253-256
52. Eissele R, Goke R, Willemer S, Harthus HP, Vermeer H, Arnold R, Goke B 1992
Glucagon-like peptide-1 cells in the gastrointestinal tract and pancreas of rat, pig and
man. Eur J Clin Invest 22:283-291
53. Dhanvantari S, Seidah NG, Brubaker PL 1996 Role of prohormone convertases in
the tissue-specific processing of proglucagon. Mol Endocrinol 10:342-355
54. Schroeder WT, Lopez LC, Harper ME, Saunders GF 1984 Localization of the
human glucagon gene (GCG) to chromosome segment 2q36----37. Cytogenet Cell
Genet 38:76-79
55. Novak U, Wilks A, Buell G, McEwen S 1987 Identical mRNA for preproglucagon
in pancreas and gut. Eur J Biochem 164:553-558
56. Mojsov S, Heinrich G, Wilson IB, Ravazzola M, Orci L, Habener JF 1986
Preproglucagon gene expression in pancreas and intestine diversifies at the level of
post-translational processing. J Biol Chem 261:11880-11889
57. Tucker JD, Dhanvantari S, Brubaker PL 1996 Proglucagon processing in islet and
intestinal cell lines. Regul Pept 62:29-35
58. Marcinkiewicz M, Ramla D, Seidah NG, Chretien M 1994 Developmental
expression of the prohormone convertases PC1 and PC2 in mouse pancreatic islets.
Endocrinology 135:1651-1660
59. Rouille Y, Westermark G, Martin SK, Steiner DF 1994 Proglucagon is processed
to glucagon by prohormone convertase PC2 in alpha TC1-6 cells. Proc Natl Acad Sci
U S A 91:3242-3246
60. Dhanvantari S, Brubaker PL 1998 Proglucagon processing in an islet cell line:
effects of PC1 overexpression and PC2 depletion. Endocrinology 139:1630-1637
61. Damholt AB, Buchan AM, Holst JJ, Kofod H 1999 Proglucagon processing profile
in canine L cells expressing endogenous prohormone convertase 1/3 and prohormone
convertase 2. Endocrinology 140:4800-4808
62. Drucker DJ, Mojsov S, Habener JF 1986 Cell-specific post-translational processing
of preproglucagon expressed from a metallothionein-glucagon fusion gene. J Biol
Chem 261:9637-9643
74
63. Huang THJ, Brubaker PL 1995 Synthesis and secretion of glucagon-like peptide-1
by fetal rat intestinal cells in culture. Endocrine 3:499-503
64. Orskov C, Wettergren A, Holst JJ 1993 Biological effects and metabolic rates of
glucagonlike peptide-1 7-36 amide and glucagonlike peptide-1 7-37 in healthy
subjects are indistinguishable. Diabetes 42:658-661
65. Rask E, Olsson T, Soderberg S, Johnson O, Seckl J, Holst JJ, Ahren B 2001
Impaired incretin response after a mixed meal is associated with insulin resistance in
nondiabetic men. Diabetes Care 24:1640-1645
66. Rocca AS, Brubaker PL 1999 Role of the vagus nerve in mediating proximal
nutrient-induced glucagon-like peptide-1 secretion. Endocrinology 140:1687-1694
67. Brubaker PL, Anini Y 2003 Direct and indirect mechanisms regulating secretion of
glucagon-like peptide-1 and glucagon-like peptide-2. Can J Physiol Pharmacol
81:1005-1012
68. Anini Y, Hansotia T, Brubaker PL 2002 Muscarinic receptors control postprandial
release of glucagon-like peptide-1: in vivo and in vitro studies in rats. Endocrinology
143:2420-2426
69. Anini Y, Brubaker PL 2003 Muscarinic receptors control glucagon-like peptide 1
secretion by human endocrine L cells. Endocrinology 144:3244-3250
70. Parker HE, Reimann F, Gribble FM 2010 Molecular mechanisms underlying
nutrient-stimulated incretin secretion. Expert Rev Mol Med 12:e1
71. Roberge JN, Brubaker PL 1991 Secretion of proglucagon-derived peptides in
response to intestinal luminal nutrients. Endocrinology 128:3169-3174
72. Elliott RM, Morgan LM, Tredger JA, Deacon S, Wright J, Marks V 1993
Glucagon-like peptide-1 (7-36)amide and glucose-dependent insulinotropic
polypeptide secretion in response to nutrient ingestion in man: acute post-prandial
and 24-h secretion patterns. J Endocrinol 138:159-166
73. Reimann F, Habib AM, Tolhurst G, Parker HE, Rogers GJ, Gribble FM 2008
Glucose sensing in L cells: a primary cell study. Cell Metab 8:532-539
74. Herrmann C, Goke R, Richter G, Fehmann HC, Arnold R, Goke B 1995
Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma
levels in response to nutrients. Digestion 56:117-126
75. Shima K, Suda T, Nishimoto K, Yoshimoto S 1990 Relationship between
molecular structures of sugars and their ability to stimulate the release of glucagon-
like peptide-1 from canine ileal loops. Acta Endocrinol (Copenh) 123:464-470
75
76. Parker HE, Adriaenssens A, Rogers G, Richards P, Koepsell H, Reimann F,
Gribble FM 2012 Predominant role of active versus facilitative glucose transport for
glucagon-like peptide-1 secretion. Diabetologia 55:2445-2455
77. Iakoubov R, Izzo A, Yeung A, Whiteside CI, Brubaker PL 2007 Protein kinase
Czeta is required for oleic acid-induced secretion of glucagon-like peptide-1 by
intestinal endocrine L cells. Endocrinology 148:1089-1098
78. Iakoubov R, Ahmed A, Lauffer LM, Bazinet RP, Brubaker PL 2011 Essential
role for protein kinase Czeta in oleic acid-induced glucagon-like peptide-1 secretion
in vivo in the rat. Endocrinology 152:1244-1252
79. Poreba MA, Dong CX, Li SK, Stahl A, Miner JH, Brubaker PL 2012 Role of
fatty acid transport protein 4 in oleic acid-induced glucagon-like peptide-1 secretion
from murine intestinal L cells. Am J Physiol Endocrinol Metab 303:E899-E907
80. Lauffer LM, Iakoubov R, Brubaker PL 2009 GPR119 is essential for
oleoylethanolamide-induced glucagon-like peptide-1 secretion from the intestinal
enteroendocrine L-cell. Diabetes 58:1058-1066
81. Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto
Y, Miyazaki S, Tsujimoto G 2005 Free fatty acids regulate gut incretin glucagon-
like peptide-1 secretion through GPR120. Nat Med 11:90-94
82. Edfalk S, Steneberg P, Edlund H 2008 Gpr40 is expressed in enteroendocrine cells
and mediates free fatty acid stimulation of incretin secretion. Diabetes 57:2280-2287
83. Tolhurst G, Heffron H, Lam YS, Parker HE, Habib AM, Diakogiannaki E,
Cameron J, Grosse J, Reimann F, Gribble FM 2012 Short-chain fatty acids
stimulate glucagon-like peptide-1 secretion via the G-protein-coupled receptor
FFAR2. Diabetes 61:364-371
84. Damholt AB, Buchan AM, Kofod H 1998 Glucagon-like-peptide-1 secretion from
canine L-cells is increased by glucose-dependent-insulinotropic peptide but
unaffected by glucose. Endocrinology 139:2085-2091
85. Roberge JN, Brubaker PL 1993 Regulation of intestinal proglucagon-derived
peptide secretion by glucose-dependent insulinotropic peptide in a novel
enteroendocrine loop. Endocrinology 133:233-240
86. Lim GE, Xu M, Sun J, Jin T, Brubaker PL 2009 The rho guanosine 5'-
triphosphatase, cell division cycle 42, is required for insulin-induced actin remodeling
and glucagon-like peptide-1 secretion in the intestinal endocrine L cell.
Endocrinology 150:5249-5261
87. Lim GE, Huang GJ, Flora N, LeRoith D, Rhodes CJ, Brubaker PL 2009 Insulin
regulates glucagon-like peptide-1 secretion from the enteroendocrine L cell.
Endocrinology 150:580-591
76
88. Kahn SE, Hull RL, Utzschneider KM 2006 Mechanisms linking obesity to insulin
resistance and type 2 diabetes. Nature 444:840-846
89. Tornehave D, Kristensen P, Romer J, Knudsen LB, Heller RS 2008 Expression of
the GLP-1 receptor in mouse, rat, and human pancreas. J Histochem Cytochem
56:841-851
90. Wei Y, Mojsov S 1995 Tissue-specific expression of the human receptor for
glucagon-like peptide-I: brain, heart and pancreatic forms have the same deduced
amino acid sequences. FEBS Lett 358:219-224
91. Campos RV, Lee YC, Drucker DJ 1994 Divergent tissue-specific and
developmental expression of receptors for glucagon and glucagon-like peptide-1 in
the mouse. Endocrinology 134:2156-2164
92. Montrose-Rafizadeh C, Avdonin P, Garant MJ, Rodgers BD, Kole S, Yang H,
Levine MA, Schwindinger W, Bernier M 1999 Pancreatic glucagon-like peptide-1
receptor couples to multiple G proteins and activates mitogen-activated protein kinase
pathways in Chinese hamster ovary cells. Endocrinology 140:1132-1140
93. Wheeler MB, Lu M, Dillon JS, Leng XH, Chen C, Boyd AE, III 1993 Functional
expression of the rat glucagon-like peptide-I receptor, evidence for coupling to both
adenylyl cyclase and phospholipase-C. Endocrinology 133:57-62
94. Hoosein NM, Gurd RS 1984 Human glucagon-like peptides 1 and 2 activate rat
brain adenylate cyclase. FEBS Lett 178:83-86
95. Hallbrink M, Holmqvist T, Olsson M, Ostenson CG, Efendic S, Langel U 2001
Different domains in the third intracellular loop of the GLP-1 receptor are responsible
for Galpha(s) and Galpha(i)/Galpha(o) activation. Biochim Biophys Acta 1546:79-86
96. Takhar S, Gyomorey S, Su RC, Mathi SK, Li X, Wheeler MB 1996 The third
cytoplasmic domain of the GLP-1[7-36 amide] receptor is required for coupling to the
adenylyl cyclase system. Endocrinology 137:2175-2178
97. Light PE, Manning Fox JE, Riedel MJ, Wheeler MB 2002 Glucagon-like peptide-
1 inhibits pancreatic ATP-sensitive potassium channels via a protein kinase A- and
ADP-dependent mechanism. Mol Endocrinol 16:2135-2144
98. Gromada J, Bokvist K, Ding WG, Holst JJ, Nielsen JH, Rorsman P 1998
Glucagon-like peptide 1 (7-36) amide stimulates exocytosis in human pancreatic beta-
cells by both proximal and distal regulatory steps in stimulus-secretion coupling.
Diabetes 47:57-65
99. Shima K, Hirota M, Ohboshi C 1988 Effect of glucagon-like peptide-1 on insulin
secretion. Regul Pept 22:245-252
77
100. Alarcon C, Wicksteed B, Rhodes CJ 2006 Exendin 4 controls insulin production in
rat islet beta cells predominantly by potentiation of glucose-stimulated proinsulin
biosynthesis at the translational level. Diabetologia 49:2920-2929
101. Skoglund G, Hussain MA, Holz GG 2000 Glucagon-like peptide 1 stimulates
insulin gene promoter activity by protein kinase A-independent activation of the rat
insulin I gene cAMP response element. Diabetes 49:1156-1164
102. Edvell A, Lindstrom P 1999 Initiation of increased pancreatic islet growth in young
normoglycemic mice (Umea +/?). Endocrinology 140:778-783
103. Wong VS, Brubaker PL 2006 From cradle to grave: pancreatic beta-cell mass and
glucagon-like peptide-1. Minerva Endocrinol 31:107-124
104. Li Y, Hansotia T, Yusta B, Ris F, Halban PA, Drucker DJ 2003 Glucagon-like
peptide-1 receptor signaling modulates beta cell apoptosis. J Biol Chem 278:471-478
105. Xu G, Stoffers DA, Habener JF, Bonner-Weir S 1999 Exendin-4 stimulates both
beta-cell replication and neogenesis, resulting in increased beta-cell mass and
improved glucose tolerance in diabetic rats. Diabetes 48:2270-2276
106. Yusta B, Baggio LL, Estall JL, Koehler JA, Holland DP, Li H, Pipeleers D, Ling
Z, Drucker DJ 2006 GLP-1 receptor activation improves beta cell function and
survival following induction of endoplasmic reticulum stress. Cell Metab 4:391-406
107. Suzuki S, Kawai K, Ohashi S, Mukai H, Yamashita K 1989 Comparison of the
effects of various C-terminal and N-terminal fragment peptides of glucagon-like
peptide-1 on insulin and glucagon release from the isolated perfused rat pancreas.
Endocrinology 125:3109-3114
108. Komatsu R, Matsuyama T, Namba M, Watanabe N, Itoh H, Kono N, Tarui S
1989 Glucagonostatic and insulinotropic action of glucagonlike peptide I-(7-36)-
amide. Diabetes 38:902-905
109. Kawai K, Suzuki S, Ohashi S, Mukai H, Ohmori H, Murayama Y, Yamashita K
1989 Comparison of the effects of glucagon-like peptide-1-(1-37) and -(7-37) and
glucagon on islet hormone release from isolated perfused canine and rat pancreases.
Endocrinology 124:1768-1773
110. Layer P, Holst JJ, Grandt D, Goebell H 1995 Ileal release of glucagon-like
peptide-1 (GLP-1). Association with inhibition of gastric acid secretion in humans.
Dig Dis Sci 40:1074-1082
111. Spiller RC, Trotman IF, Adrian TE, Bloom SR, Misiewicz JJ, Silk DB 1988
Further characterisation of the 'ileal brake' reflex in man--effect of ileal infusion of
partial digests of fat, protein, and starch on jejunal motility and release of neurotensin,
enteroglucagon, and peptide YY. Gut 29:1042-1051
78
112. Chu S, Schubert ML 2012 Gastric secretion. Curr Opin Gastroenterol 28:587-593
113. Miller LJ, Malagelada JR, Taylor WF, Go VL 1981 Intestinal control of human
postprandial gastric function: the role of components of jejunoileal chyme in
regulating gastric secretion and gastric emptying. Gastroenterology 80:763-769
114. Spiller RC, Trotman IF, Higgins BE, Ghatei MA, Grimble GK, Lee YC, Bloom
SR, Misiewicz JJ, Silk DB 1984 The ileal brake--inhibition of jejunal motility after
ileal fat perfusion in man. Gut 25:365-374
115. Schirra J, Goke B 2005 The physiological role of GLP-1 in human: incretin, ileal
brake or more? Regul Pept 128:109-115
116. Talsania T, Anini Y, Siu S, Drucker DJ, Brubaker PL 2005 Peripheral exendin-4
and peptide YY(3-36) synergistically reduce food intake through different
mechanisms in mice. Endocrinology 146:3748-3756
117. Chokshi NP, Grossman E, Messerli FH 2013 Blood pressure and diabetes: vicious
twins. Heart 99:577-585
118. Kim M, Platt MJ, Shibasaki T, Quaggin SE, Backx PH, Seino S, Simpson JA,
Drucker DJ 2013 GLP-1 receptor activation and Epac2 link atrial natriuretic peptide
secretion to control of blood pressure. Nat Med 19:567-575
119. Sivertsen J, Rosenmeier J, Holst JJ, Vilsboll T 2012 The effect of glucagon-like
peptide 1 on cardiovascular risk. Nat Rev Cardiol 9:209-222
120. Mentlein R, Gallwitz B, Schmidt WE 1993 Dipeptidyl-peptidase IV hydrolyses
gastric inhibitory polypeptide, glucagon-like peptide-1(7-36)amide, peptide histidine
methionine and is responsible for their degradation in human serum. Eur J Biochem
214:829-835
121. Meier JJ, Nauck MA, Kranz D, Holst JJ, Deacon CF, Gaeckler D, Schmidt WE,
Gallwitz B 2004 Secretion, degradation, and elimination of glucagon-like peptide 1
and gastric inhibitory polypeptide in patients with chronic renal insufficiency and
healthy control subjects. Diabetes 53:654-662
122. Deacon CF, Nauck MA, Toft-Nielsen M, Pridal L, Willms B, Holst JJ 1995 Both
subcutaneously and intravenously administered glucagon-like peptide I are rapidly
degraded from the NH2-terminus in type II diabetic patients and in healthy subjects.
Diabetes 44:1126-1131
123. Kieffer TJ, McIntosh CH, Pederson RA 1995 Degradation of glucose-dependent
insulinotropic polypeptide and truncated glucagon-like peptide 1 in vitro and in vivo
by dipeptidyl peptidase IV. Endocrinology 136:3585-3596
124. Hansen L, Deacon CF, Orskov C, Holst JJ 1999 Glucagon-like peptide-1-(7-
36)amide is transformed to glucagon-like peptide-1-(9-36)amide by dipeptidyl
79
peptidase IV in the capillaries supplying the L cells of the porcine intestine.
Endocrinology 140:5356-5363
125. Buffa R, Polak JM, Pearse AG, Solcia E, Grimelius L, Capella C 1975
Identification of the intestinal cell storing gastric inhibitory peptide. Histochemistry
43:249-255
126. Holst JJ 2007 The physiology of glucagon-like peptide 1. Physiol Rev 87:1409-1439
127. Ruiz-Grande C, Alarcon C, Alcantara A, Castilla C, Lopez Novoa JM,
Villanueva-Penacarrillo ML, Valverde I 1993 Renal catabolism of truncated
glucagon-like peptide 1. Horm Metab Res 25:612-616
128. Rosenstock J, Sankoh S, List JF 2008 Glucose-lowering activity of the dipeptidyl
peptidase-4 inhibitor saxagliptin in drug-naive patients with type 2 diabetes. Diabetes
Obes Metab 10:376-386
129. Brubaker PL 1988 Control of glucagon-like immunoreactive peptide secretion from
fetal rat intestinal cultures. Endocrinology 123:220-226
130. Brubaker PL, Vranic M 1987 Fetal rat intestinal cells in monolayer culture: a new
in vitro system to study the glucagon-like immunoreactive peptides. Endocrinology
120:1976-1985
131. Lovshin J, Yusta B, Iliopoulos I, Migirdicyan A, Dableh L, Brubaker PL,
Drucker DJ 2000 Ontogeny of the glucagon-like peptide-2 receptor axis in the
developing rat intestine. Endocrinology 141:4194-4201
132. Mulherin AJ, Oh AH, Kim H, Grieco A, Lauffer LM, Brubaker PL 2011
Mechanisms underlying metformin-induced secretion of glucagon-like peptide-1
from the intestinal L cell. Endocrinology 152:4610-4619
133. Habib AM, Richards P, Rogers GJ, Reimann F, Gribble FM 2013 Co-localisation
and secretion of glucagon-like peptide 1 and peptide YY from primary cultured
human L cells. Diabetologia 56:1413-1416
134. Rogers GJ, Tolhurst G, Ramzan A, Habib AM, Parker HE, Gribble FM,
Reimann F 2011 Electrical activity-triggered glucagon-like peptide-1 secretion from
primary murine L-cells. J Physiol 589:1081-1093
135. Lee YC, Asa SL, Drucker DJ 1992 Glucagon gene 5'-flanking sequences direct
expression of simian virus 40 large T antigen to the intestine, producing carcinoma of
the large bowel in transgenic mice. J Biol Chem 267:10705-10708
136. Ehrlich P, Tucker D, Asa SL, Brubaker PL, Drucker DJ 1994 Inhibition of
pancreatic proglucagon gene expression in mice bearing subcutaneous endocrine
tumors. Am J Physiol 267:E662-E671
80
137. Drucker DJ, Jin T, Asa SL, Young TA, Brubaker PL 1994 Activation of
proglucagon gene transcription by protein kinase-A in a novel mouse enteroendocrine
cell line. Mol Endocrinol 8:1646-1655
138. Brubaker PL, Schloos J, Drucker DJ 1998 Regulation of glucagon-like peptide-1
synthesis and secretion in the GLUTag enteroendocrine cell line. Endocrinology
139:4108-4114
139. Anini Y, Brubaker PL 2003 Role of leptin in the regulation of glucagon-like
peptide-1 secretion. Diabetes 52:252-259
140. Tolhurst G, Zheng Y, Parker HE, Habib AM, Reimann F, Gribble FM 2011
Glutamine triggers and potentiates glucagon-like peptide-1 secretion by raising
cytosolic Ca2+ and cAMP. Endocrinology 152:405-413
141. Egerod KL, Engelstoft MS, Grunddal KV, Nohr MK, Secher A, Sakata I,
Pedersen J, Windelov JA, Fuchtbauer EM, Olsen J, Sundler F, Christensen JP,
Wierup N, Olsen JV, Holst JJ, Zigman JM, Poulsen SS, Schwartz TW 2012 A
major lineage of enteroendocrine cells coexpress CCK, secretin, GIP, GLP-1, PYY,
and neurotensin but not somatostatin. Endocrinology 153:5782-5795
142. Habib AM, Richards P, Cairns LS, Rogers GJ, Bannon CA, Parker HE, Morley
TC, Yeo GS, Reimann F, Gribble FM 2012 Overlap of endocrine hormone
expression in the mouse intestine revealed by transcriptional profiling and flow
cytometry. Endocrinology 153:3054-3065
143. Grant SG, Seidman I, Hanahan D, Bautch VL 1991 Early invasiveness
characterizes metastatic carcinoid tumors in transgenic mice. Cancer Res 51:4917-
4923
144. Rindi G, Grant SG, Yiangou Y, Ghatei MA, Bloom SR, Bautch VL, Solcia E,
Polak JM 1990 Development of neuroendocrine tumors in the gastrointestinal tract
of transgenic mice. Heterogeneity of hormone expression. Am J Pathol 136:1349-
1363
145. Efrat S, Linde S, Kofod H, Spector D, Delannoy M, Grant S, Hanahan D,
Baekkeskov S 1988 Beta-cell lines derived from transgenic mice expressing a hybrid
insulin gene-oncogene. Proc Natl Acad Sci U S A 85:9037-9041
146. Park JG, Oie HK, Sugarbaker PH, Henslee JG, Chen TR, Johnson BE, Gazdar
A 1987 Characteristics of cell lines established from human colorectal carcinoma.
Cancer Res 47:6710-6718
147. De Bruine AP, Dinjens WN, van der Linden EP, Pijls MM, Moerkerk PT,
Bosman FT 1993 Extracellular matrix components induce endocrine differentiation
in vitro in NCI-H716 cells. Am J Pathol 142:773-782
81
148. Cao X, Flock G, Choi C, Irwin DM, Drucker DJ 2003 Aberrant regulation of
human intestinal proglucagon gene expression in the NCI-H716 cell line.
Endocrinology 144:2025-2033
149. Reimer RA, Darimont C, Gremlich S, Nicolas-Metral V, Ruegg UT, Mace K
2001 A human cellular model for studying the regulation of glucagon-like peptide-1
secretion. Endocrinology 142:4522-4528
150. Ferro-Novick S, Jahn R 1994 Vesicle fusion from yeast to man. Nature 370:191-193
151. Malhotra V, Orci L, Glick BS, Block MR, Rothman JE 1988 Role of an N-
ethylmaleimide-sensitive transport component in promoting fusion of transport
vesicles with cisternae of the Golgi stack. Cell 54:221-227
152. Block MR, Glick BS, Wilcox CA, Wieland FT, Rothman JE 1988 Purification of
an N-ethylmaleimide-sensitive protein catalyzing vesicular transport. Proc Natl Acad
Sci U S A 85:7852-7856
153. Beckers CJ, Block MR, Glick BS, Rothman JE, Balch WE 1989 Vesicular
transport between the endoplasmic reticulum and the Golgi stack requires the NEM-
sensitive fusion protein. Nature 339:397-398
154. Whiteheart SW, Brunner M, Wilson DW, Wiedmann M, Rothman JE 1992
Soluble N-ethylmaleimide-sensitive fusion attachment proteins (SNAPs) bind to a
multi-SNAP receptor complex in Golgi membranes. J Biol Chem 267:12239-12243
155. Sugita S 2008 Mechanisms of exocytosis. Acta Physiol (Oxf) 192:185-193
156. Weber T, Zemelman BV, McNew JA, Westermann B, Gmachl M, Parlati F,
Sollner TH, Rothman JE 1998 SNAREpins: minimal machinery for membrane
fusion. Cell 92:759-772
157. Sudhof TC, Rizo J 2011 Synaptic vesicle exocytosis. Cold Spring Harb Perspect
Biol 3:
158. Jahn R, Scheller RH 2006 SNAREs--engines for membrane fusion. Nat Rev Mol
Cell Biol 7:631-643
159. Chapman ER, An S, Barton N, Jahn R 1994 SNAP-25, a t-SNARE which binds to
both syntaxin and synaptobrevin via domains that may form coiled coils. J Biol Chem
269:27427-27432
160. Trimble WS, Cowan DM, Scheller RH 1988 VAMP-1: a synaptic vesicle-
associated integral membrane protein. Proc Natl Acad Sci U S A 85:4538-4542
161. Elferink LA, Trimble WS, Scheller RH 1989 Two vesicle-associated membrane
protein genes are differentially expressed in the rat central nervous system. J Biol
Chem 264:11061-11064
82
162. Sudhof TC, Baumert M, Perin MS, Jahn R 1989 A synaptic vesicle membrane
protein is conserved from mammals to Drosophila. Neuron 2:1475-1481
163. Ferlito M, Fulton WB, Zauher MA, Marban E, Steenbergen C, Lowenstein CJ
2010 VAMP-1, VAMP-2, and syntaxin-4 regulate ANP release from cardiac
myocytes. J Mol Cell Cardiol 49:791-800
164. Regazzi R, Wollheim CB, Lang J, Theler JM, Rossetto O, Montecucco C, Sadoul
K, Weller U, Palmer M, Thorens B 1995 VAMP-2 and cellubrevin are expressed in
pancreatic beta-cells and are essential for Ca(2+)-but not for GTP gamma S-induced
insulin secretion. EMBO J 14:2723-2730
165. Zhu D, Zhang Y, Lam PP, Dolai S, Liu Y, Cai EP, Choi D, Schroer SA, Kang Y,
Allister EM, Qin T, Wheeler MB, Wang CC, Hong WJ, Woo M, Gaisano HY 2012 Dual role of VAMP8 in regulating insulin exocytosis and islet beta cell growth.
Cell Metab 16:238-249
166. Chat S, Layani S, Mahaut C, Henry C, Chanat E, Truchet S 2011
Characterisation of the potential SNARE proteins relevant to milk product release by
mouse mammary epithelial cells. Eur J Cell Biol 90:401-413
167. Galli T, Zahraoui A, Vaidyanathan VV, Raposo G, Tian JM, Karin M, Niemann
H, Louvard D 1998 A novel tetanus neurotoxin-insensitive vesicle-associated
membrane protein in SNARE complexes of the apical plasma membrane of epithelial
cells. Mol Biol Cell 9:1437-1448
168. Bennett MK, Calakos N, Scheller RH 1992 Syntaxin: a synaptic protein implicated
in docking of synaptic vesicles at presynaptic active zones. Science 257:255-259
169. Wang Y, Tang BL 2006 SNAREs in neurons--beyond synaptic vesicle exocytosis
(Review). Mol Membr Biol 23:377-384
170. Linial M 1997 SNARE proteins--why so many, why so few? J Neurochem 69:1781-
1792
171. Oyler GA, Higgins GA, Hart RA, Battenberg E, Billingsley M, Bloom FE,
Wilson MC 1989 The identification of a novel synaptosomal-associated protein,
SNAP-25, differentially expressed by neuronal subpopulations. J Cell Biol 109:3039-
3052
172. Vogel K, Roche PA 1999 SNAP-23 and SNAP-25 are palmitoylated in vivo.
Biochem Biophys Res Commun 258:407-410
173. Gonzalo S, Linder ME 1998 SNAP-25 palmitoylation and plasma membrane
targeting require a functional secretory pathway. Mol Biol Cell 9:585-597
174. Hess DT, Slater TM, Wilson MC, Skene JH 1992 The 25 kDa synaptosomal-
associated protein SNAP-25 is the major methionine-rich polypeptide in rapid axonal
83
transport and a major substrate for palmitoylation in adult CNS. J Neurosci 12:4634-
4641
175. Schiavo G, Santucci A, Dasgupta BR, Mehta PP, Jontes J, Benfenati F, Wilson
MC, Montecucco C 1993 Botulinum neurotoxins serotypes A and E cleave SNAP-
25 at distinct COOH-terminal peptide bonds. FEBS Lett 335:99-103
176. Sadoul K, Berger A, Niemann H, Weller U, Roche PA, Klip A, Trimble WS,
Regazzi R, Catsicas S, Halban PA 1997 SNAP-23 is not cleaved by botulinum
neurotoxin E and can replace SNAP-25 in the process of insulin secretion. J Biol
Chem 272:33023-33027
177. Su Q, Mochida S, Tian JH, Mehta R, Sheng ZH 2001 SNAP-29: a general SNARE
protein that inhibits SNARE disassembly and is implicated in synaptic transmission.
Proc Natl Acad Sci U S A 98:14038-14043
178. Hohenstein AC, Roche PA 2001 SNAP-29 is a promiscuous syntaxin-binding
SNARE. Biochem Biophys Res Commun 285:167-171
179. Tsuboi T 2009 Molecular mechanism of attachment process of dense-core vesicles to
the plasma membrane in neuroendocrine cells. Neurosci Res 63:83-88
180. Verhage M, Sorensen JB 2008 Vesicle docking in regulated exocytosis. Traffic
9:1414-1424
181. De Wit H 2010 Molecular mechanism of secretory vesicle docking. Biochem Soc
Trans 38:192-198
182. De Wit H 2010 Morphological docking of secretory vesicles. Histochem Cell Biol
134:103-113
183. Ma C, Li W, Xu Y, Rizo J 2011 Munc13 mediates the transition from the closed
syntaxin-Munc18 complex to the SNARE complex. Nat Struct Mol Biol 18:542-549
184. Sheu L, Pasyk EA, Ji J, Huang X, Gao X, Varoqueaux F, Brose N, Gaisano HY
2003 Regulation of insulin exocytosis by Munc13-1. J Biol Chem 278:27556-27563
185. Jahn R, Fasshauer D 2012 Molecular machines governing exocytosis of synaptic
vesicles. Nature 490:201-207
186. Xiao W, Poirier MA, Bennett MK, Shin YK 2001 The neuronal t-SNARE complex
is a parallel four-helix bundle. Nat Struct Biol 8:308-311
187. Poirier MA, Xiao W, Macosko JC, Chan C, Shin YK, Bennett MK 1998 The
synaptic SNARE complex is a parallel four-stranded helical bundle. Nat Struct Biol
5:765-769
84
188. Binz T, Sikorra S, Mahrhold S 2010 Clostridial neurotoxins: mechanism of SNARE
cleavage and outlook on potential substrate specificity reengineering. Toxins (Basel)
2:665-682
189. Montecucco C, Schiavo G 1994 Mechanism of action of tetanus and botulinum
neurotoxins. Mol Microbiol 13:1-8
190. Hayashi T, McMahon H, Yamasaki S, Binz T, Hata Y, Sudhof TC, Niemann H
1994 Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on
assembly. EMBO J 13:5051-5061
191. Schiavo G, Benfenati F, Poulain B, Rossetto O, Polverino de LP, Dasgupta BR,
Montecucco C 1992 Tetanus and botulinum-B neurotoxins block neurotransmitter
release by proteolytic cleavage of synaptobrevin. Nature 359:832-835
192. Schiavo G, Rossetto O, Catsicas S, Polverino de LP, Dasgupta BR, Benfenati F,
Montecucco C 1993 Identification of the nerve terminal targets of botulinum
neurotoxin serotypes A, D, and E. J Biol Chem 268:23784-23787
193. Ting PT, Freiman A 2004 The story of Clostridium botulinum: from food poisoning
to Botox. Clin Med 4:258-261
194. Maksymowych AB, Reinhard M, Malizio CJ, Goodnough MC, Johnson EA,
Simpson LL 1999 Pure botulinum neurotoxin is absorbed from the stomach and
small intestine and produces peripheral neuromuscular blockade. Infect Immun
67:4708-4712
195. Simpson L 2013 The life history of a botulinum toxin molecule. Toxicon 68:40-59
196. Simpson LL 1979 Studies on the mechanism of action of botulinum toxin. Adv
Cytopharmacol 3:27-34
197. Blasi J, Chapman ER, Link E, Binz T, Yamasaki S, De Camilli P, Sudhof TC,
Niemann H, Jahn R 1993 Botulinum neurotoxin A selectively cleaves the synaptic
protein SNAP-25. Nature 365:160-163
198. Blasi J, Chapman ER, Yamasaki S, Binz T, Niemann H, Jahn R 1993 Botulinum
neurotoxin C1 blocks neurotransmitter release by means of cleaving HPC-1/syntaxin.
EMBO J 12:4821-4828
199. Schiavo G, Shone CC, Rossetto O, Alexander FC, Montecucco C 1993 Botulinum
neurotoxin serotype F is a zinc endopeptidase specific for VAMP/synaptobrevin. J
Biol Chem 268:11516-11519
200. Yamasaki S, Baumeister A, Binz T, Blasi J, Link E, Cornille F, Roques B, Fykse
EM, Sudhof TC, Jahn R, . 1994 Cleavage of members of the synaptobrevin/VAMP
family by types D and F botulinal neurotoxins and tetanus toxin. J Biol Chem
269:12764-12772
85
201. Yamasaki S, Binz T, Hayashi T, Szabo E, Yamasaki N, Eklund M, Jahn R,
Niemann H 1994 Botulinum neurotoxin type G proteolyses the Ala81-Ala82 bond of
rat synaptobrevin 2. Biochem Biophys Res Commun 200:829-835
202. Andersson SA, Pedersen MG, Vikman J, Eliasson L 2011 Glucose-dependent
docking and SNARE protein-mediated exocytosis in mouse pancreatic alpha-cell.
Pflugers Arch 462:443-454
203. Xia F, Leung YM, Gaisano G, Gao X, Chen Y, Fox JE, Bhattacharjee A,
Wheeler MB, Gaisano HY, Tsushima RG 2007 Targeting of voltage-gated K+ and
Ca2+ channels and soluble N-ethylmaleimide-sensitive factor attachment protein
receptor proteins to cholesterol-rich lipid rafts in pancreatic alpha-cells: effects on
glucagon stimulus-secretion coupling. Endocrinology 148:2157-2167
204. Gutierrez LM, Quintanar JL, Viniegra S, Salinas E, Moya F, Reig JA 1995 Anti-
syntaxin antibodies inhibit calcium-dependent catecholamine secretion from
permeabilized chromaffin cells. Biochem Biophys Res Commun 206:1-7
205. Huang X, Wheeler MB, Kang YH, Sheu L, Lukacs GL, Trimble WS, Gaisano
HY 1998 Truncated SNAP-25 (1-197), like botulinum neurotoxin A, can inhibit
insulin secretion from HIT-T15 insulinoma cells. Mol Endocrinol 12:1060-1070
206. Huang X, Kang YH, Pasyk EA, Sheu L, Wheeler MB, Trimble WS, Salapatek A,
Gaisano HY 2001 Ca(2+) influx and cAMP elevation overcame botulinum toxin A
but not tetanus toxin inhibition of insulin exocytosis. Am J Physiol Cell Physiol
281:C740-C750
207. Gaisano HY, Sheu L, Foskett JK, Trimble WS 1994 Tetanus toxin light chain
cleaves a vesicle-associated membrane protein (VAMP) isoform 2 in rat pancreatic
zymogen granules and inhibits enzyme secretion. J Biol Chem 269:17062-17066
208. Nagamatsu S, Fujiwara T, Nakamichi Y, Watanabe T, Katahira H, Sawa H,
Akagawa K 1996 Expression and functional role of syntaxin 1/HPC-1 in pancreatic
beta cells. Syntaxin 1A, but not 1B, plays a negative role in regulatory insulin release
pathway. J Biol Chem 271:1160-1165
209. Land J, Zhang H, Vaidyanathan VV, Sadoul K, Niemann H, Wollheim CB 1997
Transient expression of botulinum neurotoxin C1 light chain differentially inhibits
calcium and glucose induced insulin secretion in clonal beta-cells. FEBS Lett 419:13-
17
210. Ohara-Imaizumi M, Fujiwara T, Nakamichi Y, Okamura T, Akimoto Y, Kawai
J, Matsushima S, Kawakami H, Watanabe T, Akagawa K, Nagamatsu S 2007
Imaging analysis reveals mechanistic differences between first- and second-phase
insulin exocytosis. J Cell Biol 177:695-705
211. Spurlin BA, Thurmond DC 2006 Syntaxin 4 facilitates biphasic glucose-stimulated
insulin secretion from pancreatic beta-cells. Mol Endocrinol 20:183-193
86
212. Burr IM, Kanazawa Y, Marliss EB, Lambert AE 1971 Biphasic insulin release
from perifused cultured fetal rat pancreas. Effects of glucose, pyruvate, and
theophylline. Diabetes 20:592-597
213. Turner RC, Schneeloch B, Nabarro JD 1971 Biphasic insulin secretory response to
intravenous xylitol and glucose in normal, diabetic and obese subjects. J Clin
Endocrinol Metab 33:301-307
214. Wang Z, Thurmond DC 2009 Mechanisms of biphasic insulin-granule exocytosis -
roles of the cytoskeleton, small GTPases and SNARE proteins. J Cell Sci 122:893-
903
215. Jewell JL, Luo W, Oh E, Wang Z, Thurmond DC 2008 Filamentous actin
regulates insulin exocytosis through direct interaction with Syntaxin 4. J Biol Chem
283:10716-10726
216. Nevins AK, Thurmond DC 2003 Glucose regulates the cortical actin network
through modulation of Cdc42 cycling to stimulate insulin secretion. Am J Physiol
Cell Physiol 285:C698-C710
217. Nemoz-Gaillard E, Bosshard A, Regazzi R, Bernard C, Cuber JC, Takahashi M,
Catsicas S, Chayvialle JA, Abello J 1998 Expression of SNARE proteins in
enteroendocrine cell lines and functional role of tetanus toxin-sensitive proteins in
cholecystokinin release. FEBS Lett 425:66-70
218. Gustavsson N, Wang Y, Kang Y, Seah T, Chua S, Radda GK, Han W 2011
Synaptotagmin-7 as a positive regulator of glucose-induced glucagon-like peptide-1
secretion in mice. Diabetologia 54:1824-1830
219. Gustavsson N, Han W 2009 Calcium-sensing beyond neurotransmitters: functions of
synaptotagmins in neuroendocrine and endocrine secretion. Biosci Rep 29:245-259
220. Gustavsson N, Lao Y, Maximov A, Chuang JC, Kostromina E, Repa JJ, Li C,
Radda GK, Sudhof TC, Han W 2008 Impaired insulin secretion and glucose
intolerance in synaptotagmin-7 null mutant mice. Proc Natl Acad Sci U S A
105:3992-3997
221. Simons K, Ikonen E 1997 Functional rafts in cell membranes. Nature 387:569-572
222. Zidovetzki R, Levitan I 2007 Use of cyclodextrins to manipulate plasma membrane
cholesterol content: evidence, misconceptions and control strategies. Biochim
Biophys Acta 1768:1311-1324
223. Chamberlain LH 2004 Detergents as tools for the purification and classification of
lipid rafts. FEBS Lett 559:1-5
87
224. Chamberlain LH, Gould GW 2002 The vesicle- and target-SNARE proteins that
mediate Glut4 vesicle fusion are localized in detergent-insoluble lipid rafts present on
distinct intracellular membranes. J Biol Chem 277:49750-49754
225. Vikman J, Jimenez-Feltstrom J, Nyman P, Thelin J, Eliasson L 2009 Insulin
secretion is highly sensitive to desorption of plasma membrane cholesterol. FASEB J
23:58-67
226. Fernow I, Icking A, Tikkanen R 2007 Reggie-1 and reggie-2 localize in non-
caveolar rafts in epithelial cells: cellular localization is not dependent on the
expression of caveolin proteins. Eur J Cell Biol 86:345-352
227. Lang T 2007 SNARE proteins and 'membrane rafts'. J Physiol 585:693-698
228. Falkowski MA, Thomas DD, Messenger SW, Martin TF, Groblewski GE 2011
Expression, localization, and functional role for synaptotagmins in pancreatic acinar
cells. Am J Physiol Gastrointest Liver Physiol 301:G306-G316
229. Solomon S, Masilamani M, Rajendran L, Bastmeyer M, Stuermer CA, Illges H
2002 The lipid raft microdomain-associated protein reggie-1/flotillin-2 is expressed in
human B cells and localized at the plasma membrane and centrosome in PBMCs.
Immunobiology 205:108-119
230. Khandelwal P, Ruiz WG, Apodaca G 2010 Compensatory endocytosis in bladder
umbrella cells occurs through an integrin-regulated and RhoA- and dynamin-
dependent pathway. EMBO J 29:1961-1975
231. Mehrabian M, Allayee H, Wong J, Shi W, Wang XP, Shaposhnik Z, Funk CD,
Lusis AJ 2002 Identification of 5-lipoxygenase as a major gene contributing to
atherosclerosis susceptibility in mice. Circ Res 91:120-126
232. Davies JP, Scott C, Oishi K, Liapis A, Ioannou YA 2005 Inactivation of NPC1L1
causes multiple lipid transport defects and protects against diet-induced
hypercholesterolemia. J Biol Chem 280:12710-12720
233. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta AK,
Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda N, Salen
G, Patel SB 2004 A mouse model of sitosterolemia: absence of Abcg8/sterolin-2
results in failure to secrete biliary cholesterol. BMC Med 2:5
234. Randhawa VK, Bilan PJ, Khayat ZA, Daneman N, Liu Z, Ramlal T, Volchuk A,
Peng XR, Coppola T, Regazzi R, Trimble WS, Klip A 2000 VAMP2, but not
VAMP3/cellubrevin, mediates insulin-dependent incorporation of GLUT4 into the
plasma membrane of L6 myoblasts. Mol Biol Cell 11:2403-2417
235. Wheeler MB, Sheu L, Ghai M, Bouquillon A, Grondin G, Weller U, Beaudoin
AR, Bennett MK, Trimble WS, Gaisano HY 1996 Characterization of SNARE
88
protein expression in beta cell lines and pancreatic islets. Endocrinology 137:1340-
1348
236. Braun JE, Fritz BA, Wong SM, Lowe AW 1994 Identification of a vesicle-
associated membrane protein (VAMP)-like membrane protein in zymogen granules
of the rat exocrine pancreas. J Biol Chem 269:5328-5335
237. Souza JC, Vanzela EC, Ribeiro RA, Rezende LF, De Oliveira CA, Carneiro EM,
Oliveira HC, Boschero AC 2013 Cholesterol reduction ameliorates glucose-induced
calcium handling and insulin secretion in islets from low-density lipoprotein receptor
knockout mice. Biochim Biophys Acta 1831:769-775
238. Oya M, Kitaguchi T, Pais R, Reimann F, Gribble F, Tsuboi T 2013 The G
protein-coupled receptor family C group 6 subtype A (GPRC6A) receptor is involved
in amino acid-induced glucagon-like peptide-1 secretion from GLUTag cells. J Biol
Chem 288:4513-4521
239. Taraska JW, Perrais D, Ohara-Imaizumi M, Nagamatsu S, Almers W 2003
Secretory granules are recaptured largely intact after stimulated exocytosis in cultured
endocrine cells. Proc Natl Acad Sci U S A 100:2070-2075
240. Braiman L, Alt A, Kuroki T, Ohba M, Bak A, Tennenbaum T, Sampson SR
2001 Activation of protein kinase C zeta induces serine phosphorylation of VAMP2
in the GLUT4 compartment and increases glucose transport in skeletal muscle. Mol
Cell Biol 21:7852-7861
241. Uehara S, Jung SK, Morimoto R, Arioka S, Miyaji T, Juge N, Hiasa M, Shimizu
K, Ishimura A, Otsuka M, Yamamoto A, Maechler P, Moriyama Y 2006
Vesicular storage and secretion of L-glutamate from glucagon-like peptide 1-
secreting clonal intestinal L cells. J Neurochem 96:550-560
242. Kasai H, Takahashi N, Tokumaru H 2012 Distinct initial SNARE configurations
underlying the diversity of exocytosis. Physiol Rev 92:1915-1964
243. Sudhof TC, Rothman JE 2009 Membrane fusion: grappling with SNARE and SM
proteins. Science 323:474-477
244. Salaun C, Gould GW, Chamberlain LH 2005 Lipid raft association of SNARE
proteins regulates exocytosis in PC12 cells. J Biol Chem 280:19449-19453
245. Chamberlain LH, Burgoyne RD, Gould GW 2001 SNARE proteins are highly
enriched in lipid rafts in PC12 cells: implications for the spatial control of exocytosis.
Proc Natl Acad Sci U S A 98:5619-5624
246. Lee AK, Yeung-Yam-Wah V, Tse FW, Tse A 2011 Cholesterol elevation impairs
glucose-stimulated Ca(2+) signaling in mouse pancreatic beta-cells. Endocrinology
152:3351-3361
89
247. Tsuchiya M, Hosaka M, Moriguchi T, Zhang S, Suda M, Yokota-Hashimoto H,
Shinozuka K, Takeuchi T 2010 Cholesterol biosynthesis pathway intermediates and
inhibitors regulate glucose-stimulated insulin secretion and secretory granule
formation in pancreatic beta-cells. Endocrinology 151:4705-4716
248. Schoch S, Deak F, Konigstorfer A, Mozhayeva M, Sara Y, Sudhof TC, Kavalali
ET 2001 SNARE function analyzed in synaptobrevin/VAMP knockout mice. Science
294:1117-1122
249. Zhu D, Hansen JB, Dolai S, Xie L, Kang YH, Lin X, Osborne L, Rubin DC,
Gaisano HY, Syntaxin 2 Acts as Inhibitory SNARE for Newcomer Insulin Granule
Exocytosis. (Abstract)
250. Torrejon-Escribano B, Escoriza J, Montanya E, Blasi J 2011 Glucose-dependent
changes in SNARE protein levels in pancreatic beta-cells. Endocrinology 152:1290-
1299
251. Vilsboll T, Krarup T, Deacon CF, Madsbad S, Holst JJ 2001 Reduced
postprandial concentrations of intact biologically active glucagon-like peptide 1 in
type 2 diabetic patients. Diabetes 50:609-613
top related