phylogeny of the eudicots : a nearly complete familial...
Post on 27-Jun-2020
6 Views
Preview:
TRANSCRIPT
KEW BULLETIN 55: 257 - 309 (2000)
Phylogeny of the eudicots: a nearly complete familialanalysis based on rbcL gene sequences
V. SAVOLAINENI.2, M. F. FAyl, D. c. ALBACHI.\ A. BACKLUND4, M. VAN DER BANK1,\
K. M. CAMERON1i, S. A. ]e)H;-.;so:--.;7, M. D. LLWOI, j.c. PINTAUDI.R, M. POWELL',
M. C. SHEAHAN 1, D. E. SOLTlS~I, P. S. SOLTIS'I, P. WESTONI(), W. M. WHITTEN 11,
K.J. WCRDACK I2 & M. W. CHASEl
Summary, A phylogenetic analysis of 589 plastid rbcl. gene sequences representing nearly all eudicotfamilies (a total of 308 families; seven photosynthetic and four parasitic families are missing) wasperformed, and bootstrap re-sampling was used to assess support for clades. Based on these data, theordinal classification of eudicots is revised following the previous classification of angiosperms by theAngiosperm Phylogeny Group (APG) , Putative additional orders are discussed (e.g. Dilleniales,Escalloniales, VitaiRs) , and several additional families are assigned to orders for future updates of the APGclassification. The use of rbcl. alone in such a large matrix was found to be practical in discovering andproviding bootstrap support for most orders, Combination of these data with other matrices for the restof the angiosperms should provide the framework for a complete phylogeny to be used in macroevolutionary studies,
!:--':TRODL'CTlON
The angiosperms are the first division of organisms to have been re-classified largelyon the basis of molecular data analysed phylogenetically (APG 1998). Several largescale molecular phylogenies have been produced for the angiosperms, based onboth plastid rbcL (Chase et al. 1993, 1999, in press) and atpB (Savolainen et al. inpress) genes, and on 18S rDNA from the nuclear genome (Soltis et al. 1997a; Soltis& Soltis 1998a). At higher taxonomic levels, these genes have also been combinedin pairs (Bayer et al. 1999, Savolainen et al. in press, Nickrent & Soltis 1995, Soltis etal. 1997a) or the three altogether (Chase et al. 2000, Hoot et al. 1999, Soltis et al.1999a, Soltis et al. in press). Combined analyses of these genes have always led to
Accepted for publication Mm 2()()(),
I Molecular Systematics Secuon.jodrell Laboratorv, Royal Botanic Gardens, Kew, Richmond TW9 3DS, L',K.2 Author to whom correspondence should he addressed:1 Botanischcs lnstiuu del' l 'nivcrsita! BOIlIl. BOIlIl :)~~ 115. Oc-rmanv4 Department of Pharmacy. Div, Ph.u'macognosv. L'ppsal» l"lliH'lsity. Uppsala 7r,~)2f). Sweden ..~I Rand Afrikaans L'nivcrsitv. Auckland Park 2006, South Africa.
6 The New York Botanical Garden. Broux, :\'e\\ York 1045H, L'.S,.\,
7 San Francisco SLate L'uivcrsnv, San Francisco, California 94132, USA,H IRD, Botaniquc & Ecologie ,~ppliqll{>(" 9HH4H ~\'oUIll('a, New Caledonia.
9 Department of Botany. \\'ashingtoll SLate L'uivcrsitv, Pullman. Washington YYlt)4-4~3H, C.S.A.10 Royal Botanic Gardens, Svducv ~IJIJIJ, Australia.
11 Florida Museum of ~alural History, L'niversitv of Florida, Florida 32611-7HOO, U.S.A.12 University of North Carolina. Chapel Hill. Xorth Camlilla ~7599-:\~HIJ, L',S,A,
257
258 KEW BULLETIN VOL. 55(2)
better resolution and higher bootstrap or jackknife percentages (Chase & Cox 1998,Savolainen et al. in press, Soltis et at. 1998, Soltis et al. 1999a, Soltis et al. in press).Recently, several studies focused on the palaeodicots (basal angiosperms with mostlyuniaperturate pollen) have used even more genes, with up to five being combinedto identify Amborella as the sister to all other angiosperms (Qiu et al. 1999). Despitethe fact that these studies presented a comprehensive sampling of the angiosperms,few studies have included all families. Chase et al. (2000) sampled all but onemonocot family (Hydatellaeeae) and Hoot & Crane (1995), Hoot et al. (1999) andQiu et al. (1993, 1998, 1999) included all lower dicot and palaeodicot families intheir respective analyses. The APG classification (1998) lists 65 families not assignedto order. Unpublished results have also shown some families to be polyphyletic, andsome of the synonymies presented in APG (1998) could be reconsidered. Withimproving use of herbarium specimens in DNA studies (Savolainen et at. 1995, Fayet al. 1998a) and because a DNA bank now holds over 10,000 extracts at RoyalBotanic Gardens, Kew, it became both feasible and desirable to obtain moleculardata for all angiosperm families. In this paper, we provide a nearly completephylogeny of eudicot families, the bulk of the flowering plants (viz. angiospermswith triaperturate pollen, principally caryophyllids, rosids and asterids), based on ananalysis of plastid rbeL gene sequences. The rbeL gene has proved useful at resolvinginterfamilial relationships (see review in Soltis & Soltis 1998b, Chase & Albert1998); it is by far the most widely used gene in plant phylogenetics with over 4600entries already available in the EMBL/GenBank/DDBJ databases (e.g.http://www.ebi.ac.uk) . We present here a phylogenetic analysis of 589 eudicotsrepresenting 308 families (including 104 new rbeLsequences). Seven photosyntheticfamilies are still missing since we could not obtain any usable material, and severalof the parasitic plant families were not included since rbeL is either absent or onlypresent as a pseudogene (Nickrent et al. 1998, see Table 1).
TABLE 1. Families of uncertain position according to APG (1998) for which DNAdata are highly desirable, with indication of number of genera and species, as
well as parasites (P, see text).
Family (No. genera/spp.)
Dipentodontaeeae (111)Hoplestigmataceae (1/2)Medusandraceae (1/1)Metteniusaeeae (1/3)Pottingeriaeeae (1/1)Rhynehoealyeaceae (111)Tepuianthaeeae (l 15)
Balanophoraeeae (17/120IP)Cynomoriaeeae (1/2/P)Cytinaceae (1/7IP)Mitrastemonaeeae (1/2/P)
Distribution
Northeast India, Southern China, BurmaWest equatorial AfricaWest tropical AfricaNorthwest and South AmericaAssam, northern ThailandNatal and Transkei, Southern AfricaGuyana, Venezuela
PantropicalMediterraneanMediterranean, Africa, MadagascarSoutheast Asia, Japan, Central America
EUDICOT PHYLOGENY BASED O:\' RBCL SEQllENCES
MATERIALS AND METHODS
259
Taxa, voucher information for new sequences and accession numbers of all DNAsequences are listed in Appendix 1. Total DNA from fresh, silica gel-dried orherbarium specimens was extracted using the 2X CTAB method of Doyle & Doyle(1987) and subsequently purified through caesium chloride gradient. Some sampleswere further purified with silica columns (QIAquicFM, Qiagen, according tomanufacturer's protocol); this removes a degree of Taq inhibition, presumably fromphenolic compounds not removed by gradient purification. For recently producedsequences, the rbeL exon was amplified by PCR (usually 28 - 30 cycles, 1 mindenaturation at 95°C, 30 sec annealing at 50°C, 1 min extension at 72°C, 7 min finalextension) using primers IF (5'-ATGTCACCACAAACAGAAAC-3') and 1460R (5'TCCTTTTAGTAAAAGATTGGGCCGAG-3'; Olmstead et al. 1992, Fay et al. 1998a).Amplification products were then purified using QIAquick™ columns. Cyclesequencing (26 cycles, 10 sec denaturation at 96°C, 5 sec annealing at 50°C, 4 minextension at 60°C) with dye terminators was performed in 5 pi volumes on thecleaned PCR products and then purified by simple ethanol precipitation. The resuspended samples were run on a PE Applied Biosystems Inc. 377 automated DNAsequencer following the manufacturer's protocols (PE Applied Biosystems Inc.).Both strands were sequenced using the amplification primers and additionalinternal primers 636F (5'-GCGTTGGAGAGATCGTTTCT -3') and 724R (5'TCGCATGTACCTGCAGTAGC -3'); these sequencing primers provided 80 - 90%overlapping and complementary pairs of sequences.
Not all DNAs were obtained according to the above protocol since we usedsequences from various origins. The above protocol was also slightly modified whenusing herbarium specimens. For instance, bovine serum albumin (0.40% w/v) wasadded to the PCR mix because it is useful for recalcitrant DNA samples (Savolainenet al. 1995), and long DNA precipitation (>two weeks) was performed usingisopropanol instead of ethanol prior to caesium gradients (Fay et al. 1998a). DoublePCR was performed, starting with an amplification using 20 cycles from which 1 piafter QIAquick purification was used in a second PCR amplification with 20 cyclesusing the same primers. Primer combinations IF-724R or 636F-1460R were used toamplify rbeL in smaller fragments (Fay et at. 1998a), but PCR cycles were otherwiseidentical to those described above.
Sequences were aligned manually (1428 base pairs matrix) without indels (allraw data and matrices are available from VS and MWC; see also Appendix fordetails). Phylogenetic analysis was performed using PAUP*4.0b2a (Swofford1998). Most-parsimonious trees were obtained from 1000 replicates of randomtaxon addition using equal weights and tree-bisection-reconnection (TBR) branchswapping, with only five trees held at each step (NCHUCK = 5). The variablepositions in rbeL alone are insufficient to provide evidence for all branchingpatterns in such a complex phylogenetic tree. We also know that extensiveswapping will indeed find shorter trees than the ones shown here, but these treeswould be equally poor estimates of the true phylogeny (Chase & Cox 1998, Chaseet al. in press). Therefore, our aim here was to provide a tree in which we canidentify well-supported groups as estimated using the bootstrap (bootstrap
260 KEW BULLETIN VOL. 55 (2)
support, BS; Felsenstein 1985). One thousand bootstrap replicates wereperformed using the SPR swapping algorithm (which is faster than TBR) withsimple addition of taxa and only 10 trees held at each step. The tree was rootedwith Ranunculales, which are sister to all other eudicots according to numerousstudies (Chase et al. 1993, Savolainen et al. in press, Soltis et al. 1998, in press,Soltis et al. 1999a, Hoot et al. 1999).
RESULTS AND Drsct.ssrox
The results of the phylogenetic analysis are presented in Figs 1- 10 (one tree of17401 steps, consistency index 0.12, retention index 0.58, ACCTRAN optimisation).Branch length (numbers above branches) and bootstrap support (numbers belowbranches) are also indicated. Phylogenetic relationships based solely on rbcL willmisplace many taxa due to sampling error (i.e. too few variable positions), andgroups without internal support greater than c. 75% are unreliable (they are subjectto change with addition of either more taxa or more data). Identification of wellsupported families, orders and supra-ordinal clades is the only reasonable task thatcan be achieved with the data at hand. Knowing which clades are consistent in allshortest trees is of little utility, so we illustrate only one tree with bootstrappercentages. Congruence with other data is of course more important than internalsupport as a mean of reliability, and this is mentioned in the text. For the remainingfamilies unassigned to orders or for which aberrant placements are due to samplingerror (Chase et al. in press), we need more data. Most results presented here are inagreement with previous large-scale phylogenetic analyses of angiosperms (Chase etal. 1993, Hoot et at. 1999, Qiu et al. 1999, Savolainen et at. in press, Soltis et al. 1997a,1997b, 1998, in press, Soltis et al. 1999a, as well as the APG 1998 classification). Inthe following discussion we have cited these papers only when our results deviatedfrom those studies, but we have provided additional and specific references formany smaller clades.
Early-Diverging TaxaThe early-diverging eudicot taxa (Fig. 1), or 'lower' eudicots, consist of the orders
Ranunculales and Proteales, plus Sabiaceae, Didymelaceae/Buxaceae (BS 90%) andTrochodendraceae (including Tetracentraceae, BS 100%). Ranunculales consist of sevenfamilies (Berberidaceae, Circaeasteraceae (including Kingdoniaceae) , Eupteleaceae,Lardizabalaceae (including Sargentodoxaceae), Menispermaceae, Papaveraceae (includingFumariaceae and Pteridophyllaceae), Ranunculaceae; BS 59% excluding Papaveraceae)whereas Proteales consist only of Platanaceae/Proteaceae (BS 69%) and Nelumbonaceae(APG 1998). The sister position of Sabiaceae to Nelumbonaceae in Fig. 1 could be due
FIl;s I - 10. One most parsimonious tree resulting from the exploratory phvlogenetic analysis of rbd, for 5R9taxa (see Material and Methods. length 1740] steps. consistency index 0.12. retention index 0.58. ACCTRA:-':optimisation). Number of steps are indicated above the hranches. and hootstrap values over 50% are indicatedbelow the branches. Note that any node that dot's not receive BS of at least 7!iCjf" is unreliable (see text). Becauseof its size, the tree has been broken into ten parts: eudicots (I). Carxophvllales (2). rosids (3). A!a!jJ;!!;hia!fs (4).eurosids I pro 1)(11"11' (I)). eurosid II (6). SajJillda!fs (7). asterids (8). euasterids II (9), euasterids 1(10).
EUDICOT PHYLOGENY BASED O~ RBCL SEQUE~CES 261
CaryophyllalesTetraceraPachynemaHibbertia DilleniaeeaeDilleniaSchumacheriaAmplocissusParthenocissusVitis a VitaeeaeVitis vAmpelopsisLeearosidsasteridsGaiadendron Loranthaeeae
lMisodendron MisodendraeeaeSchoepfla SantalaeeaeOpilia OpiliaeeaeSantalum
SantalalesOsyris Santalaeeae54
ViseumPhoradendronHeisteria Olaeaeeae~hanopetalum unnamed family
etracarpaea TetracarpaeaceaeHa/oragis I HaloragaeeaeMyriophyllum
IS Penthorum PenthoraeeaeCrassula
I71 Dudleya
SedumCrassulaeeae
KalanehoePaeonia h
ISaxifragalesPaeonia s Paeoniaceae61 Paeonia t
Choristylis I IteaeeaeIteaPterostemon PterostemonaeeaeAstllbe
IHeuchera SaxifragaeeaeSaxifraga
Il Ribes Grossulariaceae
11Cercidiphyllum CercidiphyllaceaeAltingia Altingiaeeae
100 Liquidambar52 Corylopsis
TrichocfadusHamamelis
HamamelidaeeaeDisanthus23 Exbuck/andia
8Daphniphyllum DaphniphyllaeeaeGunnera Gunneraceae
62 Myrothamnus MyrothamnaeeaeGunnerales
---.JBuxus
BuxaceaePaehysandra
11Didyme/es DidymelaeeaeTetracentronTrochodendron Troehodendraeeae
83Isopogon
lLambertia ProteaeeaeProteaPlatanus Platanaceae ProtealesMeliosmaSabia SabiaeeaeNelumbo NelumbonaeeaeCoptis
RanuneulaeeaeGlaucidiumMenispermum MenispermaceaeNandina BerberidaeeaeSargentodoxa
LardizabalaeeaeDecaisneaCircaeaster
CircaeasteraceaeKingdoniaEuptelea Eupteleaeeae RanuneulalesPteridophyllum IPapaveraeeae JArgemone
FIG.l Dicentra
262 KEW BULLETIN VOL. 55(2)
to sampling error since Soltis et al. (in press) showed Sabiaceae to be unresolved withProteales based on the combination of atpB, rbcL and 18S rDNA. The paraphyly ofPapaoeraceae in Fig. 1 is also probably due to sampling error. Affinities depicted hereare mostly in agreement with previous publications from Hoot & Crane (1995),Hoot et al. (1995a, b, 1999) and Qiu et al. (1998).
Core EudicotsThe core eudicots according to APG (1998) consist of 23 orders, most of which
(excluding Caryophyllales, Santalales, Saxifragales) have been included in twoinformal higher categories: rosids (including eurosids I and 11, see Figs 3 - 7) andasterids (including euasterids I and 11, see Figs 8 - 10). Rosids here include theorder Geraniales unplaced in APG (1998), plus eurosids I (Cucurbitales, Fabales,Fagales, Malpighiales, Oxalidales, Rosales) and eurosids 11 (Brassicales, Malvales,Myrtales, Sapindales). Asterids included three orders unplaced in APG (1998),Ericales, Cornalesand Garryales, plus euasterids I (Gentianales, Lamiales, Solanaless andeuasterids 11 (Apiales, Aquifoliales, Asterales, Dipsacalesi, In addition, APG included incore eudicots 35 families not assigned to order: Adoxaceae, Aextoxicaceae, Aphloiaceae,Berberidopsidaceae, Boraginaceae, Bruniaceae, Carlemanniaceae, Celastraceae,Columelliaceae, Crossosomataceae, Desfontainiaceae, Dilleniaceae, Eremosynaceae,Escalloniaceae, Gunneraceae, Huaceae, lcacinaceae, Ixerbaceae, Krameriaceae,Myrothamnaceae, Parnassiaceae, Picramniaceae, Plocospermataceae, Podostemaceae,Polsosmaceae, Sphenostemonaceae, Stachyuraceae, Stackhousiaceae, Staphyleaceae,Tapisciaceae, Tribelaceae, Tristichaceae, Vahliaceae, Vitaceae and Zygophyllaceae. In thisanalysis, eudicots (BS 61 %) consist of all orders described above plus severaladditional orders and families. For descriptive purposes, we discuss below eachorder sensu APG (1998) and Soltis et al. (in press) in succession and their currentfamilial composition. The previously unplaced families are discussed in each sectionwith recommendations for their classification. Detailed familial descriptions can befound at http://biodiversity.bio.uno.edu/delta/angio/index.htm (Watson &Dallwitz 1992 and onwards), whereas discussions regarding morphologicalsynapomorphies for most orders can be found in Nandi et al. (1998), Savolainen etal. (in press) and Soltis et at. (in press).
SantalalesSantalales (Fig. 1, BS 54%) consist of six families, mostly parasitic: Loranthaceae,
Misodendraceae, Olacaceae, Opiliaceae, Santalaceae and Viscaceae. This delimitation ofthe order is roughly in agreement with APG (1998), Nickrent & Starr (1994) andNickrent et al. (1994, 1998), but Viscaceae is here included in Santalaceae based onrbcL and 18S rDNA combined. According to the same studies and as also observedhere, Schoepfia is not a member of Olacaceae but is instead sister to Misodendraceae.
SaxifragalesSaxifragales (Fig. 1) consist of 13 families that correspond to their
circumscriptions in APG (1998): Altingiaceae, Cercidiphyllaceae, Crassulaceae,Daphniphyllaceae, Grossulariaceae, Haloragaceae, Hamamelidaceae, Iteaceae, Paeoniaceae,Penthoraceae, Pterostemonaceae, Saxifragaceae and Tetracarpaeaceae (Aphanopetalum is
EUDICOT PH\LOGE~YB.-\SED 0" RBCL SEQUENCES 263
kept here as a member of an un-named family). The order does not receive BS>50% in this analysis, but some subgroups received strong support (e.g.Tetracarpoeaceae/ Haloragaceae/ Penthoraceae BS 96%, Pterostemonaceae/lteaceae BS96%). Choristylis should be considered a member of Iteaceae. This delimitation is inagreement with Fishbein et al. (submitted), Soltis et at. (1990, 1993, 1996, 1997b),Morgan & Soltis (1993),Johnson & Soltis (1994, 1995) and Soltis & Soltis (1997).
10Phytolacca
Delosperma PhytolaccaceaeErcilla
18 BougainvilleaNyctaginaceae
Mirabilis21
Petiveria Petiveriaceae42
Trianthema Aizoaceae38
MolluginaceaeMollugo40
Halophytum Halophytaceae
Basella Basellaceae
15 Pereskia Cactaceae
93 58 Portulaca Portulacaceae
Alluaudia Didiereaceae10
19 Stegnospermum Stegnospermataceae41
Amaranthus100
SpinaciaAmaranthaceae
1911
Phau/othamnus Achatocarpaceae94
Dianthus Caryophyllaceae15
Asteropeia Asteropeiaceae33
38Physena Physenaceae
Rheum
PolygonumPolygonaceae
28 34
98 Limonium CaryophyllalesIS Plumbago Plumbaginaceae
Aegialitis26
Simmondsia Simmondsiaceae12
Ancistroc/adus Ancistrodadaceae
Triphyophyllum Dioncophyllaceae
27 Drosophyllum Drosophyllaceae
92 Frankenia Frankeniaceae
Tamarix Tamaricaceae70
Drosera Droseraceae25
32Nepenthes Nepenthaceae
Rhabdodendron Rhabdodendraceae
FIG.2
264 KEW BULLETIN VOL. 55(2)
CaryophyllalesCaryophyllaZes (Fig. 2, BS 92 %) include here 27 families for which several inter
familial relationships receive support: Achatocarpaceae, Aizoaceae, Amaranthaceae,Ancistrocladaceae, Asteropeiaceae, Basellaceae, Cactaceae, Caryophyllaceae, Didiereaceae,Dioncophyllaceae, Droseraceae, Drosophyllaceae, Frankeniaceae, Halophytaceae,Molluginaceae, Nepenthaceae, Nyctaginaceae, Petioeriaceae, Physenaceae, Phytolaccaceae,Plumbaginaceae, Polygonaceae, Portulacaceae, Rhabdodendraceae, Simmondsiaceae,Stegnospermataceae, Tamaricaceae. An expanded concept of Caryophyllales is inagreement with previous studies by Albert et al. (1992), Rettig et at. (1992), Downieet at. (1997), Fay et at. (1997a, b), Morton et at. (1997a), Lled6 et al. (1998) andClement & Mabry (in press), but none of these investigations sampled all families(see also caryophyllid families in Kubitzki et at. 1993). Many families ofCaryophyllales are highly specialized (halophytes, carnivores, succulents etc.) andpeculiar in various aspects. Several members have anomalous secondary growth orfloral development (e.g. pseudodiplosternony, Ronse Decraene et al. 1998) and donot have the typical tricolpate pollen of the eudicots (Nandi et al. 1998, Savolainenet al. in press). Compared to APG (1998), our results indicate that Halophytaceaeand Petiveriaceae should be added to the order Caryophyllales. We could not obtainmaterial of Sarcobataceae, which APG included in this order (see also Downie et al.1997). Halophytaceae consist of one succulent species from Patagonia, which hasbeen included in Amaranthaceae [=Chenopodiaceae] by several authors (includingAPG 1998; see also Bittrich 1993) based on floral morphology, succulent leaves andexine structure of the pollen grains. In this analysis, Halophytaceae falls withBasellaceae/Cactaceae/Didieraceae/Portulacaceae (BS 58%), but not with Amaranthaceae;thus its present separate familial status should be maintained, pending furtherdata. Petiuetiaceae consist of one species from tropical and subtropical America (butsometimes also include more species from genera other than Petiveria); they havealso been included in Phytolaccaceae. Our results indicate that they merit familialstatus since Petiveria is sister to Nyctaginaceae/ Phytolaccaceae rather than beingincluded in Phytolaccaceae, but additional data are necessary because BS is <50% forthis result.
OxalidalesOxalidales (Fig. 3, BS 88%) consist of six families: Brunelliaceae, Cephalotaceae,
Connaraceae, Cunoniaceae (including Eucryphiaceae and Davidsoniaceae) , Elaeocarpaceaeand Oxalidaceae. Tremandraceae (three genera and 45 species from Australia:Platytheca, Tetratheca, Tremandra) are embedded within Elaeocarpaceae (BS 65%).Brunelliaceae, a monogeneric family from tropical America, are also a member ofOxalidales. They were included in Cunoniaceae in APC (1998), but their positionhere sister to Elaeocarpaceae/ Cunoniaceae/Cephalotaceae may justify continued familialstatus (Fig. 3).
BerberidopsidalesBerberidopsidales consist of two small families from Chile and Australia:
Berberidopsidaceae and Aextoxicaceae. This assemblage (Fig. 3, BS 57%) couldrepresent relics of an ancient flora as noted previously (Savolainen et al. in press).
EUDICOT PH\1~OGENYBASED 0:\ RBCL SEQUENCES 265
10 --,22
Malpighialeseurosidsl)0 Hua IHuaceae
10015
Afrastyrax19
Brunel/ia Brunelliaceae
7 Aceratium16
92 Elaeocarpus82 18
Platytheca ElaeocarpaceaeJ2
92 65 Crinodendron12
Val/ea10
Sloanea21
Bauera Oxalidales12 Ceratopetalum88 Davidsonia Cunoniaceae
Eucryphia
"Cephalotus CephalotaceaeAverrhoa IOxalidaceae10 47Oxalis
86 15ConnaraceaeConnarus
10lepidobotrys36 ILepidobotryaceae
100 RuptiliocarponBrexia
Celastrus
EuonymusPleurostylia CelastralesHippocratea
18 Reissentia
88 Plagiopteronlophopetolum CelastraceaeSo/ocio
13Conotio
79 Denhamia
Psommomoyo
StockhouSlo18
71 Tripteroeoccus99 14
" Siphonodon 0
88 Siphonodon c20
24 lepuropetolon IParnassiaceae14
Parnassio
Fagales
RosalesZygophyllales
CucurbitalesFabales
eurosid 1113
30 Alvorodoo Alvaradoaceae100
18Picromnio Picramniaceae
PyrenoconthoChlomydoehoriaSareastigma Icacinaceaelodes
" 10leaeina
39
21AphlOia Aphloiaceae
14 ~ AextDxicon Aextoxicaceae Berberidopsidales57 16 Berberidopsis Berberidopsidaceae -.J
FIG.3
266 KEW BULLETIN VOL. 55(2)
Their placement relative to other orders remains unclear, even with a combinedanalysis of atpB/rbcL and 18S rDNA (Soltis et at. 1999a, Soltis et at. in press). Thisorder was not defined in APG (1998).
CelastralesCelastrales (Fig. 3, BS 88%) consist of three families: Lepidobotryaceae, Parnassiaceae
(including Lepuropetalaceaey and Celastraceae (including Brexiaceae, Hippocrateaceae,Stackhousiaceae and Plagiopteraceae; see Baas et al. (1979), for details of Plagiopteron).The delimitation of this order has been variable with most of its previous members(viz. sensu Cronquist 1981) now being assigned to other orders (Savolainen et al. ]994,1997). The order as recircumscribed here is reduced to its core family Celastraceae plustwo rather peculiar small families: Parnassiaceae (Lepuropetalon/Parnassia; BS 100%)include the smallest terrestrial angiosperm (Lepuropetalon, see Chase et al. 1993),whereas Lepidobotryaceae show a geographical disjunction between Central America(Ruptiliocarpon) and tropical Africa (Lepidobotrys). It is also noteworthy thatPsammamoya is sister to Stackhousia/ Tripterococcus (BS 72%). These two latter generawere members of the Stackhousiaceae, but their inclusion in Celastraceae withPsammamoya as sister compares well with their geographical distribution (Australia)and their habit (xerophytic perennial rhizomes with reduced leaves andphotosynthetic succulent stems). Celastrales were not recognised by APG (1998) withtheir families being unplaced under eurosids I; high BS (88%) justifies theresurrection of the order.
MalpighialesMalpighiales are a large order including 36 families: Balanopaceae, Bonnetiaceae,
Caryocaraceae, Chrysobalanaceae, Clusiaceae, Ctenolophonaceae, Dichapetalaceae,Elatinaceae, Erythroxylaceae, Euphorbiaceae, Euphroniaceae, Goupiaceae, Hugoniaceae,Humiriaceae, Hypericaceae, Irvingiaceae, Ixonanthaceae, Kiggelariaceae (includingAchariaceae) , Lacistemaceae, Linaceae (including Hugoniaceae), Lophopyxidaceae,Malesherbiaceae, Malpighiaceae, Ochnaceae sensu lato (including Medusagynaceae andQuiinaceae) , Pandaceae, Passifloraceae, Peridiscaceae, Phyllanthaceae, Podostemaceae(including Tristichaceae), Pseudanthaceae, Putranjivaceae , Rliizophoraceae, Salicaceae(including Flacourtiaceae pro parte and Scyphostegiaceae), Trigoniaceae, Turneraceae andViolaceae. The entire group of families received BS < 50%, but several sub-groupsreceived high BS (see Fig. 4). This ordinal delimitation comprises all families sensuAPG (1998), apart from Achariaceae, which are embedded within Kiggelariaceae (93%BS for Acharia sister to Guthriea; 100% for Acharia/Guthriea sister to Kiggelaria/Gynocardia/ Trichadenia). In addition we have embedded Medusagynaceae andQuiinaceae in Ochnaceae; the entire clade receive 97% BS whereas there is no clearpattern for the separation of the three families. It is also in agreement with severalstudies in which the entire order received bootstrap or jackknife support(Savolainen et al. in press, Soltis et al. 1999a, Soltis et al. in press, Litt & Chase 1999).Kiggelariaceae sensu stricto (viz. one single species from tropical and South Africa,Kiggelaria africana) was included in Flacourtiaceae in APG (1998) whereas our resultsindicate that Kiggeleriaceae sensu lato merit familial status (BS 100% excludingErythrospermum). Apart from Achariaceae, Kiggelariaceae include Gynocardia odorata
EUDICOT pml.oGE~YBA.5ED O~ RBeL SEQUEKCES 267
Mal ighiales
Salicaceae
Kiggelariaeeae
Euphorbiaceae
IHumiriaceae
CtenolophonaceaeLaeistemaceae
IViolaeeae
Goupiaceae
IPassifloraeeae
TurneraceaeMalesherbiaceaeLophopyxidaeeaePandaceae
IPodostemaceae
HypericaceaeBonnetiaceae
IClusiaceae
Caryocaraceae
lochnaceae
Ixonanthaceae
IPseudanthaceae
Hugoniaceae
ILinaceaePhyllanthaceae
Elatinaceae
IMalpighiaceae
Peridiscaceae
IChrysobalanaceae
Euphroniaceae
IDichapetalaceaeTrigoniaceaeBalanopaceae
IPutranjivaceaeIrvingiaceae
IErythroxylaceae
IRhizophoraeeae
IS
VantaneaHumiriaPopulusSolixPoliothyrsusFloeaurtioBonaraScyphostegioBembieio
'---=----..,.,.... gg;t~~i~AdenlaPossi~oroPoropsiaTurneraMafesherbioLophopyxisMlcrodesmisTristiehaMarothrum
L__~--:_ Hypericum
BonnetioColophyJlumMesuoClusioGoreinia
'----'~-.,..,...-- CoryoeorLuxemburgioMedusogyneOchnaOui;no
r-----=~-- ClehthoeosmusStoehystemonHyoenaneheAndrostoehysHugonioUnumReinwordtioPhyJlonthusBergioElotineBornebyoByrsonimoDiceJlo
'----'''----.,.,.- WhittonioHirtelloChrysobolonusAtuna
'--"'--.,..,... EuphroniaTopuroDichopetolumTrigonia
'----'"---..,-- BalonopsKigge/orioGynoeordioTrichodenioAehoriaGuthrieaErythrospermumunknown sp.CtenolophonLac/stemaHymenontheroVioloLeonioGoupioEuphorbiaOmolonthusBernordioDysopsisKoilodepos
'-~".-'-'----- Ostodes'---""'"=------- Mierandro
Endospermum'------:.::...------,.- Neoseorteehino
DrypetesPutronjivofrvingio
,.----""'-------r", NeaoropetolumErythroxylumCarollioKonde/ioRhizophoro
'---"~--- Cossipoureo
12
82
10
FIG. 4
268 KEW BULLETIN VOL. 55(2)
from Assam and Burma and Trichadenia (two species from Sri Lanka and Malaysia).Ochnaceae sensu stricto do not appear monophyletic in this study, with Medusagynefalling between Luxemburgia and Ochna. Other studies resolved a monophyleticOchnaceae (e.g. Fay et al. 1997b). However, relationships within the cladeMedusagyne/ Ochnaceae/ Quiinaceae (BS 97%) remain unclear and lack BS >50%.
Compared to APG (1998), our results also indicate that five additional familiesare members of Malpighiales: Bonnetiaceae, Ctenolophonaceae, Lophopyxidaceae,Peridiscaceae and Podostemaceae (including Tristichaceae). Bonnetiaceae (excludingPloiarium from Southeast Asia which is related to Thymelaeaceae; see Malvales below)include 30 species from tropical America and were included in Theales by Dahlgren(1980) and Cronquist (1981). Ctenolophonaceaecomprise three species from tropicalAfrica and western Malaysia; their pollen type already indicated a close relationshipwith Malpighiaceae (Saad 1962). LOphopyxidaceae were originally included inCelastrales by Cronquist (1981); they include a single species from Malaysia and thewestern Pacific, Lophopyxis maingayi. Peridiscaceae comprise Peridiscus and Whittoniafrom South America; they were of uncertain position in APG (1998), but our resultsindicate that they are sister to Malpighiaceae. Phyllanthaceae were included inEuphorbiaceae at a subfamily level, but those results and others indicate thatPhyllanthoideae warrant familial status; the same applies to Oldfieldioideae, elevatedhere to family Pseudanthaceae. Podostemaceae, a pantropical aquatic family comprisingc. 200 species, appear to be members of Malpighiales. Based on molecular data, Leset al. (1997) included Podostemaceae in Saxifragales but this study did not include anyMalpighiales. Tristichaceae (two pantropical species) should be included inPodostemaceae (BS 100%, see Soltis et al. 1999b), whereas they were unassigned toorder in rosids by APG (1998).
Nitrogen-fixing ordersSeveral families of the closely related orders Cucurbitales, Fabales, Fagales and Rosales
(Fig. 5) form associations with nitrogen-fixing bacteria, suggesting a single origin forthe predisposition for this key physiological process (Soltis et al. 1995). Cucurbitales(BS 65%) consist here of seven families: Anisophyllaeaceae, Begoniaceae, Coriariaceae,Corynocarpaceae, Cucurbitaceae, Datiscaceae and Tetramelaceae. Fabales (BS 82 %) consistof four families: Fabaceae, Polygalaceae (including Xanthophyllaceae) , Quillajaceae andSurianaceae. Fagales (BS 85%) consist of eight families: Betulaceae, Casuarinaceae,Fagaceae, Juglandaceae, Myricaceae, Nothofagaceae, Rhoipteleaceae and Ticodendraceae. Inthis study, Casuarinaceae are embedded in Betulaceae, but with greater sampling thetwo families are separated (Sytsma et al. unpubl.). Rosales (BS 51 %) consist of 11families: Barbeyaceae, Cannabaceae, Cecropiaceae, Celtidaceae, Dirachmaceae, Elaeagnaceae,Moraceae, Rhamnaceae, Rosaceae, Ulmaceae and Urticaceae. All the above sets ofrelationships are in agreement with APG (1998). However, contrary to what seems tobe indicated for Rhamnaceae, this family includes both Rhamnus and Zizyphus. Thesetwo genera do not form a monophyletic group based on rbcL, and Elaeagnaceaeappear embedded within Rhamnaceae. However, this is a well-known problem that hasbeen addressed by Thulin et al. (1998) and Richardson et al. (in press), and additionof data from other sources resolved the monophyly of Rhamnaceae.
EUDICOT PH\LOGENY BASED O~ RBCL SEQUENCES 269
11A/biziaParkiaChamaecristaGymnocladusMedicago FabaceaePisum
89 XanthacercisBauhiniaCercis Fabales
13 Cadellia
ISurianaceae82 Guilfoylia
Sty/obasiumSuriana
56Comesperma
IPolygalaceaeSecuridacaPolyga/aXanthophyllumQuillaja QuillajaceaeRhoiptelea RhoipteleaceaeCarya IJuglandaceaeJuglansMyrica MyricaceaeBetula Betulaceae
FagalesCasuarina Casuarinaceae
9Cory/us Betulaceae
61 Ticodendron TicodendraceaeChryso/epsis
IFagaceaeQuercus
85 TrigonobaFagusNothofagus NothofagaceaeAmpe/ocera IUlmaceaeU/musBaehmeria UrticaceaeCecropia CecropiaceaeCeltis CeltidaceaeHumulus ICannabaceaeCannabisFicus MoraceaeTrema UlmaceaeRhamnus Rhamnaceae RosalesEleagnus EleagnaceaeZizyphus Rhamnaceae
624
Barbeya Barbeyaceae43
51 55 Dirachma Dirachmaceae15
16 35Dryas IRosaceae98 8 Rosa
1971 Spiraea
BalanitesSi5ynditeTribulus Zy ophyllales
FagoniaZygophyllaceaeZygophyllum
GuaiacumPorlieriaViscainoQKrameria KrameriaceaeBegonia BegoniaceaeCombretocarpus AnisophyllaeaceaeDotisca DatiscaceaeCucurbito ICucurbitaceae CucurbitalesNeoa/somitra
JCoriaria Coriariaceae65 Corynocarpus Corynocarpaceae
" Oetomeles ITetramelaceae98 Tetrame/esFIC.5
270 KEW BULLETIN VOL. 55 (2)
ZygophyllalesZygophyllales (Fig. 5, BS 82%) include two families: Zygophyllaceae and Krameriaceae.
They are included in eurosids I as previously reported by Soltis et at. (1999a) andSoltis et al. (in press) based on atpB, rbcLand 18S rDNA. This order was not used byAPG (1998) with their families being included under rosids (see also Sheahan &Chase 1996 & in press, for a detailed analysis based on molecular data andanatomy/morphology). Their exclusion from all of the rosid orders indicates thatrecognition of Zygophyllales is appropriate.
GeranialesGeraniales (Fig. 6) consist of three families: Geraniaceae (including Hypseocharitaceae),
Melianthaceae (including Francoaceae and Greyiaceae) and Vivianaceae (includingLedocarpaceae) , thus reducing by half the number of families in this order compared toAPG (1998, see also Price & Palmer 1993). Melianthaceae, including Francoaceae andGreyiaceae, share pinnately veined leaves, gamosepaly, tendency to tetramery,anatropous ovules, outer integument contributing to the micropyle, embryo-sacdevelopment of Polygonum-type, basal to axile placentation and a small embryo withcopious endosperm. In addition, Greyiaceae and Melianthaceae have calcium oxalatecrystals in wood parenchyma, multilacunar nodes and similar wood anatomy;Cronquist (1981) also reports that the pollen of Greyia is very similar to that of Bersama.
BrassicalesBrassicales (Fig. 6, BS 88%) consist of 14 families: Akaniaceae, Bataceae, Brassicaceae,
Caricaceae, Gyrostemonaceae, Koeberliniaceae, Limnanthaceae, Moringaceae,Pentadiplandraceae, Resedaceae, Salvadoraceae, Setchellanthaceae, Tovariaceae andTropaeolaceae. As previously reported (Gadek et al. 1992, Rodman et al. 1993, 1998),this order includes all families producing mustard oils (glucosinolates) exceptDrypetes (Putranjivaceae) , which is a member of Malpighiales. Brassicales ascircumscribed here are congruent with APG (1998) except for the exclusion ofEmblingiaceae. Placement of Emblingiaceae (a monotypic family from WesternAustralia) within Brassicales was probably due to misidentified material. The originalsequence is potentially from a member of Gyrostemonaceae, which are common in thesame localities after fires and have a similar habit to Emblingia (the voucher for thismaterial cannot be found; C. Quinn, UNSW, pers. cornm.). We have used here anindependent, properly vouchered and verified collection of Emblingia, andEmblingiaceae are embedded in Gentianaceae (BS 100%), correlating well with theirfused sepals and petals. Tapiscia (one species from China) is sister to Brassicales (BS<50%) but is not included in this order with additional genes in all shortest trees( Tapisciaceae fall as sister to the whole eurosids 11 in Soltis et al. in press, but theywere without assignment to order in APG 1998).
MalvalesMalvales (Fig. 6) consist of 11 families: Bixaceae, Cistaceae, Cochlospermaceae,
Diegodendraceae, Dipterocarpaceae, Malvaceae (including Bombacaceae, Tiliaceae andSterculiaceae), Muntingiaceae, Neuradaceae, Sarcolaenaceae, Sphaerosepalaceae andThymelaeaceae. Despite receiving BS<50%, Malvales as circumscribed are in
EUDICOT PH\1.0GE:-.JY BASED O\' RBCL SEQUE:-.JCES
11
18
95
FIG.6
ICochlospermaceae
ISphaerosepalaceae
BixaceaeDiegodendraceae
Thymelaeaceae
IMalvaceae
DipterocarpaceaeSarcolaenaceae
IDipterocarpaceae
ICistaceae
IMuntingiaceae
INeu radaceae
TovariaceaePentadiplandraceaeGyrostemonaceaeResedaceae
IBrassicaceae
KoeberliniaceaeBataceaeSalvadoraceaeLimnanthaceaeSetchellanthaceaeMoringaceaeCaricaceaeAkaniaceaeTropaeolaceaeTapisciaceae
ILythraceae
IOnagraceae
Lythraceae
ICombretaceae
OliniaceaeAlzateaceaePenaeaceaeCrypteroniaceaeIMelastomataceae
MyrtaceaePsiloxylonaceaeHeteropyxidaceaeVochysiaceaeIxerbaceaeStrasburgeriaceaeGeissolomataceaeCrossosomataceaeStachyuraceae
IStaphyJeaceae
IMelianthaceae
IVivianaceae
IGeraniaceae
271
Malvales
eurosid 11
Brassicales
J
lM rtales
272 KlW BULLETIN VOL. 55 (2)
agreement with APG (1998) and studies from Alverson et al. (1998), Bayer et al.(1998, 1999), Fay et al. (1997a) and Dayanandan et al. (1999). Ploiarium (the onlyOld World Bonnetiaceae, ranging from Southeast Asia to Papua New Guinea) IS amember of Thymelaeaceae.
MyrtalesMyrtales (Fig. 6, BS 95%) here consist of 13 families: Alzateaceae, Combretaceae,
Crypteroniaceae, Heteropyxidaceae, Lythraceae (including Punicaceae and Trapaceae) ,Memecylaceae, Melastomataceae, Myrtaceae, Oliniaceae, Onagraceae, Penaeaceae,Psiloxylaceae and llochysiaceae. Myrtales as circumscribed here agree with APG (1998)except that we have not been able to get material of Rhynchocalycaceae (Table 1).Rhynrhocalycareae are a monospecific family from Natal and Transkei (southernAfrica); they have also been considered to be related to Myrtales by Dahlgren (1980)and Cronquist (1981). With greater sampling, Conti et al. (1996) showed Punicaceaeand Trapaceae to be embedded within Lythraceae.
CrossosomatalesCrossosomatales include three families (Fig. 6): Crossosomataceae, Stachyuraceae and
Stapbsleaceae (excluding Tapisciaceae; see Brassicalesi. Crossomataceae are microphyllousxerophytic shrubs from North America; Stachyuraceae include five species fromHimalaya to Japan whereas Staphyleaceae comprise c. 60 species from southwesternEurope, eastern Asia and the Americas. Crossosomatales were not recognised by APG(1998) with their families being unplaced under rosids; high BS (98%) justify therecognition of Takhtajan's order. In addition, Aphloiaceae received BS<50% for theirplacement, but they are sister to Icacinaceae in Fig. 3 (see below for comments onwhat we view as an aberrant placement). However, based on combined atpB, rbcLand 18S rDNA (Soltis et al. 1999a; Soltis et al. in press) Aphloia is sister to Ixerbawith73% jackknife support, and Ixerba/ Aphloia are then sister to Crossosomatales (56%jackknife support); with rbcL alone (this paper) Ixerba is sister to Strasburgeria (BS99%), and these two are sister to Geissoloma (BS 58%). Thus, if these relationshipsare confirmed (especially using additional data for Geissoloma and Strasburgeria),then Crossosomatales could be expanded to include Geissolomataceae (one species inSouth Africa), Ixerbaceae (one species in New Zealand), Strasburgeriaceae (one speciesin New Caledonia) and perhaps ,4phloiaceae (one species in East Africa, Madagascarand the Mascarenes).
SapindalesSapindales (Fig. 7, BS 74%) consist of ten families: Anacardiaceae, Biebersteiniaceae,
Burseraceae, Kirkiaceae, Meliaceae, Nitrariaceae, Peganaceae, Rutaceae, Sapindaceae(including Aceraceae and Hippocastanaceae) and Simaroubaceae. This definition ofSapindales is in agreement with APG (1998) and previous studies based onmolecular data (Bakker et al. 1998, Gadek et al. 1996). Beiselia is sister to and distantfrom the rest of Burseraceae and has distinct features, for example in pollen structure(Clarkson et al. in prep.). Lissocarpa falls within Rutaceae (BS 72%); because the rbcLsequence was obtained from degraded herbarium DNA, this rather peculiarplacement needs confirmation. However the sequence was unique and should be
EUDICOT PHYLOGEI\Y BASED 0;,\ RBCL SEQllE;\ICES 273
Beiselia
Commiphora Burseraceae
Bursera7
82 Buchanania
Amphipterigium AnacardiaceaeSchinus
Spondias4
Malacocarpus
Peganum Peganaceae
Tetradic/is
Nitraria Nitrariaceae31
Ailanthus Simaroubaceae13
2Vavaea
Heckeldora
Guarea
Walsura Meliaceae
Ekebergia
6Azadirachta
1086 Khaya
66
Copuronianthus Sapindales8
60 Cedrela15 Dietyoloma94 Spathelia
4Ptaeroxylon
50Bottegoa
Cneorum
Harrisonia RutaceaeFlindersia
6 Chloroxylon64 Lissocarpa
PoncirusRuta
25Serjania
Diatenopteryx
Talisia
23Paranephelium
4 Koelreuteria7460 14
Diplopelti~
4 13Ungnadio
13Sapindaceae
16Dipteronia
96 10 Acer90 Aesculus
Bil/ia26
27Xanthoceros
26 Kirkia Kirkiaceae JFIG. 7
Biebersteinia Biebersteiniaceae
274 KEW BULLETIN VOL. 55(2)
considered seriously. Tetradiclis falls into Peganaceae whereas it was previouslyincluded in Zygaphyllaceae (Sheahan & Chase 1996).
CornalesCornales (Fig. 8) consist of six families: Cornaceae, Grubbiaceae, Hydrangeaceae,
Hydrostachydaceae, Loasaceae and Nyssaceae. In Soltis et al. (in press), this orderreceived 98% jackknife support (apart from Grubbiaceae which were not included),but rbcL alone does not provide BS >50% except for Hydrangeaceae/Loasaceae (62%,Fig. 8). Loasaceae appear paraphyletic (Fig. 8), but this could be due to samplingerror (see Hempel et al. 1995).
EricalesEricales (Fig. 8, BS 73%) consist of 24 families: Actinidiaceae, Balsaminaceae,
Clethraceae, Cyrillaceae, Diapensiaceae, Ebenaceae, Ericaceae, Fouquieriaceae, Lecythidaceae(including Scytopetalaceae) , Marcgraviaceae, Myrsinaceae, Pellicieraceae, Polemoniaceae,Primulaceae, Roridulaceae, Sapotaceae, Sarraceniaceae, Sladeniaceae, Styracaceae (includingHalesiaceae), Symplocaceae, Ternstroemiaceae, Tetrameristaceae, Theaceae and Theophrastaceae.This corresponds to Ericales sensu APG (1998) and is in agreement with previousmolecular studies from Anderberg et al. (1998), Johnson & Soltis (1995), Johnson etal. (1996,1999), Kron (1996, 1997), Kron & Chase (1993) and Morton et al. (1997b),except that Sladeniaceae are added here. Sladeniaceae are a monospecific family fromBurma, Yunnan and Thailand that were classified under 'families of uncertainposition' in APG (1998). Their position in Ericales compares well with previous viewsfrom Dahlgren (1980) and Cronquist (1981) that placed Sladeniaceae inTheales/ Theaceae; they could be considered as part of Ternstroemiaceae. We were onlyable to amplify half a sequence for rbcL so this position needs confirmation.Halesiaceaewere recognized by APG (1998) as distinct, but because Halesiafalls here assister to Styrax, a broader circumscription of Styraceae is more appropriate.
GarryalesGarryales (Fig. 9) consist of four families: Aucubaceae, Eucommiaceae, Garryaceae and
Oncothecaceae. This order received BS<50% (only Aucuba/Garrya received 98 % BS).Aucubaceae (Aucuba) consist of three species from Himalaya to Japan. Garryaceae(Garrya) contain 18 - 20 species from southeastern USA, Central America and theWest Indies. Eucommiaceae contain only one species from China, and Oncothecaceae(Oncotheca) contain only two species from New Caledonia. The assemblageGarrya/Aucuba/Eucommia is in agreement with APG (1998). The inclusion ofOncothecaceae in Garrvales needs confirmation because with three genes (Soltis et al.in press) Oncotheca falls with other asterids (jackknife support <50%).
ApialesApiales (Fig. 9, BS 76%) consist of seven families: Apiaceae, Araliaceae, Aralidiaceae,
Griseliniaceae, Melanaphyllaceae, Pittosporaceae and Torricelliaceae (see also Plunkett et al.1997a, b). It is noteworthy that this order contains mostly polypetalous flowerswhereas the vast majority of euasterids are characterized by gamopetaly; however,Erbar & Leins (1996) showed that members of Apiales exhibit early sympetaly.
EUDICOT PHYLOt;E;\;Y BASED 0:" RBCL SEQUE:"CES 275
euasterids
Symplocos Symplocaceae
Sladenia
ITernstroemiaceaeTernstroemia
EuryaHalesia IStyracaceaeStyrax
Diapensia DiapensiaceaeCobaea IPolemoniaceaePhloxDiospyros Ebenaceae
13Maesa Myrsinaceae
Anagallis Primulaceae
Ardisia Myrsinaceae
Clavija Theophrastaceae17
Manilkara Sapotaceae18
Clethra Clethraceae
Camellia ITheaceae7Schima
20Cyrilla Cyrillaceae
4Roridula Roridulaceae
EricaEricalesEricaceae
Rhododendron
4 Sarracenia Sarraceniaceae
54 Aetinidia
ClematoclethraActinidiaceae
4Asteranthos
16 OubanguiaLecythidaceae10
10073
Couroupita
Eschweilera13
Idria Fouquieraceae30
Impatiens Balsaminaceae22 10
Marcgravia100 Marcgraviaceae
Norantea
Pelliciera Pellicieraceae
Tetramerista Tetrameristaceae16
Grubbia Grubbiaceae
Comus Cornaceae
Hydrostachys Hydrostachyaceae
18 Nyssa Nyssaceae
Eucnide Loasaceae CornalesHydrangea
JPhiladelphusHydrangeaceae
Schismocarpus LoasaceaeFIt;. 8
276 KEW BULLETIN VOL. 55(2)
euasterid I17
23 Cyphia36
'7 17 Lobelia Campanulaceae48
62 Campanula67
11 Stylidium Styldiaeeae
Donatio Donatiaceae46
Helianthus Asteraeeae
Boapis Calyceraceae Asterales
Sccevoro Goodeniaceae
Menyanthes Menyanthaceae
20 Argophyllum5 100 12
Corokia Argophyllaceae
57 13PheJline Phellinaeeae
18Crispi/oba
11 Alseuosmia Alseuosrniaceae
Wittsteinla21
Pentaphragma Pentaphragmataeeae
" Carpodetus
11Abrophyllum Carpodetaceae
80Cuttsia
Roussea Rousseaceae21
T ribelaceaeTribe/es57
Eremosyne Eremosynaceaeeuasterid 1118
Esca/lonia Escalloniaeeae14
Aralidium Aralidiaeeae
6. Melanaphylla Melanophyllaceae l58 13Taricellia Torieelliaeeae
21Pittosparum Pittosporaceae
T18Hedera Araliaceae56
7611
Griselinia Griseliniaeeae16
Apium Apiaceae
Marina Morinaceae
lDiervilla Diervillaceae
Abelia Linnaeaceae
Va/eriana Valerianaeeae
20Dipsacus Dipsaeaeeae Dipsacales
12Sympharicarpas CaprifoliaeeaeParacryphia Paracryphiaceae
Sphenostemon Sphenostemonaeeae
Palyosma Polyosmaceae
12 Des(onlainia Desfontainiaceae
~SambueusAdoxaeeae83 Viburnum
4lJ Brunio100 Berze/ia
Bruniaeeae
" Helwingiaceae lHe/wingia
Phyllonoma Phyllonomaeeae
/lexAquifoliales
77Aquifoliaeeae JNemopanthus
Aucuba Aucubaceae lGorrya Garryaceae
Eucommia Eucommiaceae JryaleS
Oncotheea Oncothecaceae
FI(;. 9
EUDICOT PHYLOGE:-':Y BASED 0:-': RBCL SEQUt\CES 277
AquifolialesAquifoliales (Fig. 9, BS 77%) consist of three families: Aquifoliaceae, Helwingiaceae
and Phyllonomaceae. Aquifoliaceae have over 300 species and one genus (flex,including Nemopanthus; Powell et al. 2000) mainly from South America andSoutheast Asia, Helunngiaceae (Helwingia) have five species from eastern Himalaya toJapan and Taiwan, whereas Phyllonomaceae (Phyllonoma) have four species fromMexico to northwestern Bolivia. This alliance is rather peculiar with the two lastfamilies having epiphyllous inflorescences as previously noted by Chase et al. (1993).Reduction to a single family might be appropriate.
AsteralesAsterales (Fig. 9, BS 75%) consist of 13 families for which several inter-familial
relationships receive support: Alseuosmiaceae, Argophyllaceae, Asteraceae, Calyceraceae,Campanulaceae (including Lobeliaceae) , Carpodetaceae, Donatiaceae, Goodeniaceae,Menyanthaceae, Pentaphragmataceae, Phellinaceae, Rousseaceae and Stylidiaceae. Thiscircumscription is in agreement with APG (1998).
DipsacalesDipsacales (Fig. 9) consist of eleven families: Adoxaceae, Caprifoliaceae, Desfontainiaceae,
Diervillaceae, Dipsacaceae, Linnaeaceae, Morinaceae, Paracryphiaceae, Polyosmaceae,Sphenostemonaceae and Valerianaceae. Core Dipsacales include only Caprifoliaceae,Diervillaceae, Dipsacaceae, Linnaeaceae, Morinaceae and Valerianaceae; they received 93%BS. Adoxaceaeshould be included in Dipsacales despite the fact that rbcL alone doesnot provide support for this placement. A combined analysis of atpB, rbcL and 18SrDNA provided 86% jackknife support for this circumscription (Soltis et at. 1999a,Soltis et at. in press, see also Donoghue et al. 1992, Backlund & Bremer 1997).Finally, Polyosmaceae (60 species from Himalaya to tropical Australia) are sister toDesfontainiaceae (one species in the Andes) whereas Gustafsson et al. (1996) andBacklund & Bremer (1997) found Desfontainia to be sister of Columellia withBS>50%. Columellia is here sister to Gentianales/ Solanales/ Lamiales but with noBS>50% (Fig. 10). Sphenostemonaceae (seven species from eastern Malaysia,Queensland and New Caledonia) are sister to Paracryphiaceae (one species in NewCaledonia) but with no BS>50%. For details on Dipsacales see also Backlund (1996)and Backlund et al. (in press).
GentianalesGentianales (Fig. 10, BS 75%) consist of five families: Apocynaceae, Gelsemiaceae,
Gentianaceae, Loganiaceaeand Rubiaceae, in agreement with APG (1998), Civeyrel etat. (1998) and Manen et at. (1994). Emblingiaceae are included in Gentianaceae,contrary to the APG placement (1998, viz. Brassicales due to a misidentification, seeabove). Dialypetalanthaceae, consisting of one species in eastern Brazil, should beincluded in Rubiaceae (Fay et al. in press).
LamialesLamiales (Fig. 10) consist of 23 families (BS 56%, BS 67 % excluding
Plocospermum): Acanthaceae, Antirrhinaceae (including Plantaginaceae) , Auicenniaceae,
278 KEW BULLETIN VOL. 55(2)
20NicotionoSchwenckia lSchizanthus SolanaceaeDuckeadendranMetternichia Solanalesp.p.GoerzioConvolvulus ConvolvulaceaeKaliphora
IMontiniaceaeMontiniaHydraphyllum
IBoraginaceaeBaraga
" 23Te!rachandra ITetrachondraceaePolypremumCalceolaria Calceolariaceae
Catalpa Bignoniaceae
Sch/egelia Schlegeliaceae
"Myoporum IScrophulariaceae
"Budd/eJaPhryma PhrymaceaeEuthystachys Stilbaceae LamialesProboscidea MartyniaceaeCyc/ocheilon CyclocheilaceaePedicularis Orobanchaceae
59 Byblis ByblidaceaePaulawnia Paulowniaceae
HVerbena Verbenaceae
37LamiaceaeLavandula
MimulusStreptocorpus GesneriaceaeAvicennia Avicenniaceae
Thunbergia Acanthaceae67
Sesamum PedaliaceaePlantago
IAntirrhinaceaeVeronicaAntirrhinum
I' Scrophularia Scrophulariaceae38
Utricularia Lentibulariaceae
" Car/emannia Carlemanniaceae
" 6437
Jasminum Oleaceae38
41Placaspermum Plocospermataceae
22 Sphenoc/ea Sphenocleaceae ...,i2 84 62 Hydra/eo Hydroleaceae ~Ianales p.p.
2'
"Vah/ia Vahliaceae
" Mostuea IGelsemiaceae71i'
Ge/semiumNeubergia
ILogantaceaeStrychnosSpigeliaGeniostomaEmblingiaGemianellaGentionaAnthoc/eista Gentianaceae
Gentianales12 Fagraeo
j71 33
£Xacum12
20Apocynum IApocynaceae
8' Skytanthus23
Dialypeto/anthus
IRubiaceaeGardenia
12 GaliumCinchona
22Calumellia Columelliaceae
1532 Gomphondra
IlcacinaceaeJIrvingbaileya
2716 Pentaphylax Pentaphylaceae
22 J18
Cardiopteris ICardiopteridaceae11
FIG. 10 Gonocaryum
EUDlCOT PH'rl.0GE:'\'Y BASED O~ RBCL SEQl'E:'\'CES 279
Bignoniaceae, Byblidaceae, Calceolariaceae, Carlemanniaceae, Cyclocheilaceae, Gesneriaceae,Lamiaceae, Lentibulariaceae, Martyniaceae, Oleaceae, Orobanchaceae, Paulowniaceae,Pedaliaceae, Phrymaceae, Plocospermataceae, Schlegeliaceae, Scrophulariaceae (includingBuddlejaceae and MyopoTaceae) , Stilbaceae, Tetrachondraceae and Verbenaceae. Comparedto APC (1998), we have added here Antirrhinaceae, Calceolariaceae, Carlemanniaceae,Martyniaceae, Plocospermataceae and Tetrachondraceae; we have also includedBuddlejaceae and Myoporaceae in Scrophulariaceae according to Olmstead et al. (1992,1999, submitted, Oxelman et al. 1999), as well as Plantaginaceae in Antirrhinaceaeaccording to Reveal et al. (1999). Antirrhinaceae (BS 61 %) have been resurrectedbecause Scrophulariaceae have been shown to be polyphyletic (Olmstead & Reeves1995, Olmstead et al. 1999, pers. comm.). Calceolariaceae (slipper flowers) are new anddistinct from Scrophulariaceae sensu stricto and include Calceolaria (250 species fromSouth America), Jovellana (six species from New Zealand and Chile) and Porodittia(=Stemotria) from Peru (Olmstead et al. 1999, pers. comm.). Carlemanniaceae consist offive species and two genera (Carlemannia and Silvianthus) from Southeast Asia toSumatra; they were included in Caprifoliaceae/Dipsacales by Cronquist (1981), buttheir connivent anthers compare well with their placement in Lamiales (BS 64% forCarlemannia sister to Jasminum). Martyniaceae comprise 13 species and four genera(Proboscidea included here) from tropical and subtropical America; they wereincluded in Pedaliaceae in APC (1998) but our results as well as those of Olmstead etat. (1999, pers. comm.) indicate that their familial status should be maintained.
Plocospermaiaceae are a monogeneric family comprising three species from CentralAmerica; they were included in Loganiaceae by Cronquist (1981) and not assigned toorder in APC (1998). Tetrachondraceae are a new family with two species and onegenus (Tetrachondra) from Patagonia and New Zealand and Polypremum procumbensfrom tropical America (Oxelman et al. 1999, Olmstead et al. pers. comm.). Severalother genera of the Lamiales sensu Olmstead et al. (pers. comm.) should receivefamilial status when additional information is available (e.g., Mimulus possibly to beassigned to family Mimulaceae). Vahliaceae could also be included in Lamiales(Olmstead et al. pers. comm.) despite the fact that they are sister toSphenocleaceae/ Hydroleaceae in this study (Fig. 10). Vahliaceae contain five species inthe genus Vahlia (=Bistella) from tropical and South Africa (Cape) to northwesternIndia. Vahlia was included in Saxifragaceae (Saxifragales, Dahlgren 1980 or Rosales,Cronquist 1981) because of their free sepals/petals and were unassigned to order inAPC (1998); the presence of iridoids and tenuinucellate ovules compare well withtheir placement within the asterids and Lamiales.
Although not likely to be popular with specialists, a more practical solution forfamily circumscription in Lamiales would be to recognise Scrophulariaceae sensu lato,including all these families except Carlemanniaceae, Oleaceae and Plocospermataceae.These families are morphologically and chemically coherent, and the low levels ofsequence divergence are similar to many other large families. We find the emergingnarrow family limits based on subtle morphological differences difficult to justify.
SolanalesAccording to APC (1998), Solanales (Fig. 10) consist of five families:
Convolvulaceae, Hydroleaceae, Montiniaceae (including Kaliphora) , Solanaceae (including
280 KEW BULLETIN VOL. 55(2)
Duckeodendraceae and Goetziaceae) and Sphenocleaceae. In this study, however, thesefamilies do not form a monophyletic group making Solanales paraphyletic toLamiales (Fig. 10). This is probably due to sampling error (rbcL by itself does notprovide enough information). Based on a combined atpB/ rbcL/18S rDNA analysis,Solanales received 96% jackknife support (Soltis et al. 1999a, Soltis et al. in press).
Families to be assigned to ordersBoraginaceae (including Hydraphyllaceae) remain unassigned to order in euasterid I
(within Lamiales/ Gentianales/ Solanales, BS 62%), but based on ndhF they could beincluded in Solanales (Olmstead et al. 1999). Even using a combined analysis of atpB,rbcL and 18S rDNA (Soltis et al. 1999a, Soltis et al. in press) support for the inclusionof Boraginaceae within any order was lacking.
Bruniaceae include Berzeliaceae (BS 100%); this South African clade remainsunassigned to order within euasterid II (APG 1998, Soltis et al. 1999a, Soltis et al.in press). lcacinaceae are at least diphyletic (Savolainen et al. in press, Soltis et al.1999a, Soltis et al. in press). The true lcacinaceae are represented here byChlamydocharia, lcacina, lodes, Pyrenacantha and Sarcostigma (see below), butGonocaryum, Irvingbaileya and Gomphandra (formerly in lcacinaceae) fall outside thisfamily (see Fig. 10). These latter three genera are close to Pentaphylax (one speciesfrom from southern China to Malay Peninsula) and Cardiopteris (three speciesfrom southeastern Asia and Australia). Therefore, Cardiopteridaceae could beexpanded to include Pentaphylaceae and some genera previously referred tolcacinaceae (at least Gonocaryum, Irvingbaileya and Gomphandra); however, moredata are needed to confirm this view. Icacinaceae sensu stricto (Fig. 3) form a wellsupported clade (BS 98%), but their position within core eudicots is not yet clear.Contrary to what is shown in Fig. 3, lcacinaceae are undoubtedly better placedamong asterids because of their tenuinucellate ovules and gamopetalous flowers,but rbcL alone does not provide support for such a relationship. lcacinaceae sensustricto are members of Garryales (jackknife support 55%) based on a combinedanalysis of rbcL/ atpB/18S rDNA (Soltis et al. 1999a, Soltis et al. in press), whereasIrvingbaileya/ Gonocaryum were included in Aquifoliales in the same study (jackknifesupport 96%).
Columelliaceae (Fig. 10) received support <50%, and they remain unassigned toorder within euasterids (APG 1998). Based on pairwise absolute distancecalculations, Columellia is equally close to Gonoraryum (Cardiopteridaceae sensu lato)and Melanophylla (Apial<,s), but distance alone can be misleading.
Dilleniaceae and Vitaceae (including Leea) are together sister to Caryophyllales (Fig.1). Based on the combined atpB/rbcL/18S rDNA analyses (Soltis et al. 1999a, Soltiset al. in press), Dilleniaceae are also sister to Caryophyllales (jackknife support 60%)whereas Vitaceae are sister to rosids (jackknife support 70%). Both families could beelevated to the ordinal level in updates of the APG classification if additionalmolecular data provide support for these placements; familial circumscriptions arewell supported with rbcL alone (BS 100% in both cases).
Eremosynaceae, Escalloniaceae and Tribelaceae form a clade within euasterids II (Fig.9), but with BS<50% provided by rbcL alone. However, Escallonia/Eremosyne received90% jackknife support based on the combined analysis of atpB/ rbcL/ 18S rDNA
EUDICOT PHYLOGDJY BASED 0:\ RBCL SEQUENCES 281
(Soltis et al. 1999a, Soltis et al. in press, see also Hibsch:Jetter et al. 1997). Thereforewe could perhaps define the order Escalloniales and include the three familiesmentioned above. Escalloniaceae are from South America and Australasia with 150species; Eremosynaceae and Tribelaceae are both monotypic and occur in southwesternAustralia and South America, respectively. Alternatively and more reasonably, thetwo last families could be included in an expanded family Escalloniaceae.
Gunneraceae (50 species, tropical and southern temperate) are sister (BS 62%) toMyrothamnaceae (two species from southern tropical Africa and Madagascar), aspreviously reported based on the combined atpB/rbcL/18S rDNA analysis (jackknifesupport 75%; Soltis et al. 1999a, Soltis et al. in press). However, the placement ofGunneraceae/Myrothamnaceae relative to asterids/rosids remains unclear and requiresadditional data; we would however suggest including both families in Gunnerales infurther updates of the APG classification (see Soltis et al. 1999a).
Huaceae remain unassigned to order within eurosids I. The use of rbcL aloneprovided BS<50% for the placement of Huaceae, but in combination with atpB/18SrDNA, sister status to Celastrales was supported (jackknife support 62%; Soltis et al. inpress). Picramniaceaeare sister to Aluadoraceae (BS 100%, alternatively Alvadomcouldbe included in the former), but they remain unassigned to order within rosids. Theycomprise 50 species from central and tropical America. Based on a combinedatpB/ rbcL analysis, Picramniaceae were sister to Krameriaceae/ Zygophyllaceae amongeurosids I, but with BS<50% (Savolainen et al. in press). Additional molecular dataare required for a well-supported placement of these families.
CO:\,CI.USIONS
As exemplified at the last International Botanical Congress (St. Louis, USA,1999), recent progress in plant systematics has been the basis of many discoveries(e.g. Gura 1999, Mathews & Donoghue 1999, Qiu et al. 1999, Soltis et al. 1999a).Most botanists now wish to know the phylogeny of the model taxa they are studying,and this is now as true for physiologists and geneticists as for evolutionary biologists.Understanding the evolutionary history for the traits being investigated can provideimportant insights into this operation. Classifying all angiosperm families based onphylogenetic analyses as initiated by APG (1998) is thus highly desirable because itprovides the framework for more thorough and varied analyses to take place atlower taxonomic levels (Soltis et al. 1999a).
In this analysis, we have sampled nearly all eudicot families. More importantly,the large number of phylogenetic studies published in the last five years has guidedour sampling strategy, making this study the most encyclopaedic of any publishedthus far. Soltis et al. (in press) observed that what APG called families and ordersbased on molecular data were uniformly characterised by relatively long branchesassociated with bootstrap support. Despite the fact that rbcL alone does not providesupport for several of the interordinal relationships, it is noteworthy that theinformation in a single gene can identify as monophyletic nearly all families andorders with BS >50%. It is also noteworthy that none of the more important cladesidentified in the rbcL study by Chase et al. in 1993 has been seriously questioned.Since then, the addition of taxa has refined the definition of many orders whereas
282 KEW BULLETIN VOL. 55(2)
the placement of more problematic taxa (e.g. Vitaceae or Zygophyllaceae) remainsuncertain and we await further data. Therefore, this analysis permits two mainconclusions to be drawn.
First, it is a straightforward task to reclassify angiosperms based on moleculardata. Because the rate of evolution and the spectrum of evolutionary constraintsacting on the plastid genome make it an ideal tool to be used by plant systematists,the phylogenetic signal is clear and easily detected when the sampling is thoroughenough (Hillis 1998, Kallersjo et al. 1998, Soltis et al. 1998). The main difficulty hasbeen in obtaining material from geographically restricted and rare key taxa, and afew families have yet to be sampled and investigated (Table 1). Obtaining DNAsequences from herbarium samples is not yet a routine task; we tried for all of theremaining unsampled families, but although we obtained DNA in each case we havebeen unable to amplify rbcl: from these degraded samples.
Second, the use of time-consuming exhaustive tree-search methods in the hopeof finding a reasonably short tree is not necessary; faster and simple tree-buildingmethods perform equally well in recovering accurate estimates of the truephylogeny in simulations (Nei et al. 1998, Chase et al. in press). Thus when largedata sets are used to build a family/order tree for the angiosperms, only wellsupported groups are of interest (no matter how many taxa are included), andthese are found easily with simple and fast methods. Obtaining an optimal tree withsingle genes and hundreds of taxa is not only impossible, it is also unnecessary;shorter trees are not only underestimates of the true phylogeny (Chase & Cox 1998,Chase et al. in press), but they also do not uniformly contain more accurate cladesthan trees produced with faster methods (Chase et al. in press). As stated, mostangiosperm families and orders received BS even using one single gene like rbcL (c.60% of the branches received BS>50%), and all analyses performed here requiredless than one week (using a Power Macintosh G3, 300 Mhz, 256 MB RAM).However, some families and clades of several families still remained unassigned toorder. In these cases, we simply need to add more data, as demonstrated incombined analyses of three genes (atpB, rbcL, 18S rDNA) that have clearly increasedsupport for all clades (Soltis et al. 1998, Soltis et al. 1999a, Soltis et al. in press). Formore problematic branching patterns such as the earliest angiosperms, five geneswere required to provide a clear pattern for these ancient lineages (Qiu et al. 1999),and these findings have been corroborated by several independent lines of evidence(e.g. gene duplication; Mathews & Donoghue 1999). Here for the eudicots as well,we need to add more genes, especially faster-evolving ones to provide support forrecent or rapid cladogenesis.
Soon, large data sets for all angiosperms families will be available, the analysis ofwhich will provide clear pattern and support for all clades above the generic level.In the meantime, our data could be combined with other data sets for angiosperms,e.g. those for basal angiosperms in Qiu et al. (1999), monocots in Chase et al.(2000), parasites in Nickrent et al. (1998) or data sets for general patterns in Chaseet al. (1993), Savolainen et al. (in press), Soltis et al. (l997a, b, in press) and Soltis etal. (l999a). These could be used to produce a complete super-tree for the familiesof angiosperms (see Sanderson et al. 1998), as has already been produced for allextant species of primates and carnivores (Purvis et al. 1995, Bininda-Emonds et al.
EUDICOT PH\1,OGE:-JY BASED 0:\ RBCL SEQl'I'::-JCES 283
1999). However, prior to such achievements, rbcL alone has proved to be useful indepicting interfamilial relationships in eudicots. The APG study (1998) was thebeginning of a new way to classify flowering plants, and we hope this analysis will aidin this process and that it will also become a starting point for addressing questionsof patterns and processes of angiosperm evolution (e.g. Barraclough et al. 1996,1998, Savolainen & Goudet 1998, Pagel 1999).
ACK:-\OWLEDGEMENTS
We are very grateful to all persons and institutes who provided plant samples andto Jim Clarkson who runs the DNA databank at RBG Kew. Two anonymousreviewers provided useful comments. This work was partially supported by the SwissNSF (31-52378.97).
REFEREi'\CES
Albert, V. A, Williams, S. E. & Chase, M. W. (1992). Carnivorous plants: phylogenyand structural evolution. Science 257: 1491 - 1495.
Alverson, W. S., Karol, KG., Baum, D. A., Chase, M. W., Swensen, S. M., McCourt,R. & Sytsma, K]. (1998). Circumscription of the Malvales and relationships toother Rosidae evidence from rbcL sequence data. Amer.]. Bot. 85: 876 - 887.
Anderberg, A A., Stahl, B. & Kallersjo, M. (1998). Phylogenetic relationships in thePrimulales inferred from rbcL sequence data. PI. Syst. Evol. 211: 93 - 102.
APG (1998). An ordinal classification for the families of flowering plants. Ann.Missouri Bot. Gard. 85: 531 - 553.
Baas, P., Geesink, R., van Heel, W. A & Muller, H.]. (1979). The affinities ofPlagiopteron suaveolensGriff. (Plagiopteraceae). Grana 18: 69 - 89.
Backlund, A (1996). Phylogeny of the Dipsacales. Doctoral Thesis. Acta UniversityUppsala 243.
-- & Bremer, B. (1997). Phylogeny of the Asteridaes.str. based on rbcL sequences,with particular reference to the Dipsacales. PI. Syst. Evol. 207: 225 - 254.
-- & Bremer, K (1998). To be or not to be - Principles of classification andmonotypic plant families. Taxon 47: 391 - 400.
--, Oxelman, B. & Bremer, B. (in press). Phylogenetic relationships withinGentianales based on ndhF and rbcl: sequences, with particular references to theLoganiaceae. Amer.]. Bot.
Bakker, F. T., Vassiliades, D. D., Morton, C. M. & Savolainen, V. (1998). Phylogeneticrelationships of Biebersteinia Stephan (Geraniaceae) inferred from rbcL and atpBsequence comparison. Bot.]. Linn. Soc. 127: 149 - 158.
Barraclough, T. G., Harvey, P. H. & Nee, S. (1996). Rate of rbcL gene sequenceevolution and species diversification in flowering plants (angiosperms). Proc.Roy. Soc. B 263: 589 - 591.
--, Vogler, A. & Harvey, P. (1998). Revealing the factors that promote speciation.Phil. Trans. Roy. Soc. B 353: 241 - 249.
Bayer, C., Chase, M. W. & Fay, M. F. (1998). Muntingiaceae, a new family ofdicotyledons with malvalean affinities. Taxon 47: 37 - 42.
284 KEW BULLETIN VOt. 55(2)
--, Fay, M. F., de Bruijn, A. Y, Savolainen, v., Morton, C. M., Kubitzki, K &Chase, M. W. (1999). Support for an expanded family concept of Malvaceaewithin a re circumscribed order Malvales: a combined analysis of plastid atpB andrbcL sequences. Bot. J. Linn. Soc. 129: 267 - 303.
Bininda-Emonds, O. R. P., Gittleman, J. L. & Purvis, A. (1999). Building large treesby combining phylogenetic information: a complete phylogeny of the extantCarnivora (Mammalia). BioI. Rev. 74: 143 - 175.
Bittrich, V. (1993). Halophytaceae In: K. Kubitzki,J. G. Rohwer & V. Bittrich (eds.),The families and genera of vascular plants. Flowering plants, dicotyledons.Magnoliid, hamamelid and caryophyllid families, pp. 320 - 321. Springer Verlag,Berlin.
Bousquet, J., Strauss, S. H., Doerksen, A. D. & Price, R. A. (1992). Extensivevariation in evolutionary rate of rbcL gene sequences among seed plants. Proc.Natl. Acad. Sci. USA 89: 7844 - 7848.
Bremer, B. & Thulin, M. (1998). Collapse of Isertieae, re-establishment ofMussaendeae, and a new genus of Sabiceeae (Rubiaceae); phylogenetic relationshipsbased on rbcl: data. PI. Syst. Evol. 211: 71 - 92.
Bremer, K, Olmstead, R. G., Struwe, L. & Sweere, J. A. (1994). rbcL sequencessupport exclusion of Retzia, Desfontainia and Nicodemia from the Gentianales. PI.Syst. Evol. 190: 213 - 230.
--, Andreasen, K & Olsson, D. (1995). Subfamilial and tribal relationships in theRubiaceae based on rbcLsequence data. Ann. Missouri Bot. Gard. 82: 383 - 397.
-- & Gustafsson, M. H. (1997). East Gondwanan ancestry of the sunfloweralliance offamilies. Proc. Nat!. Acad. Sci. USA: 9188 - 9190.
Chase, M. W. & 42 others (1993). Phylogenetics of seed plants: an analysis ofnucleotide sequences from the plastid gene rbcL. Ann. Missouri Bot. Gard. 80:528 - 580.
-- & Albert, V. A. (1998). A perspective on the contribution of plastid rbcL DNAsequences to angiosperm phylogenetics In: D. E. Soltis, P. S. Soltis & J. J. Doyle(eds.), Molecular Systematics of plants 11: DNA sequencing, pp 488 - 507. KluwerAcademic, Dordrecht.
-- & Cox, A. V. (1998). Gene sequences, collaboration, and analysis oflarge datasets. Austral. Syst. Bot. 11: 215 - 229.
--, Morton, C. M. & Kallunki,J. A. (1999). Phylogenetic relationships of Rutaceae:a cladistic analysis of the subfamilies using evidence from rbcL and atpB sequencevariation. Amer.J. Bot. 86: 1191 -1199.
--, Savolainen, v., Takahashi, K, Fay, M. F., Soltis, D. E., Soltis, P. S. (in press).Simple tree search methods work better for complex phylogenies. Abstract.Amer.]. Bot. Suppl. 87.
--, Soltis, D. E., Soltis, P. S., Rudall, P. J., Fay, M. F., Hahn, W. H., Sullivan, S.,Joseph, J., Molvray, M., Kores, P. J., Givnish, T. J., Sytsma, K. J. & Pires, J. C.(2000). Higher-level systematics of the monocotyledons: an assessment of currentknowledge and a new classification. In: K L. Wilson & D. A. Morrison (eds),Monocots: Systematics and Evolution, pp. 3 - 16. CSIRO Press, Sydney.
Chen, Z. D., Wang, X. Q., Sun, H. Y & Han, Y (1998). Systematic position of theRhoipteleaceae: evidence from rbcLsequences. Acta Phytotax. Sin., Addit. 36: 1 - 5.
EUDICOT PHYLOGDJY BASED 0:\ RBCL SEQUENCES 285
Civeyrel, L., Le Thomas, A., Ferguson, K & Chase, M. W. (1998). Criticalreexamination of palynological characters used to delimit Asclepiadaceae incomparison to the molecular phylogeny obtained from plastid matK sequences.Molec. Phylogenet. Evol. 9: 517 - 527.
Clarkson,]., Chase, M. W. & Harley, M. M. (in prep.). Phylogenetic relationships inthe Burseraceae based on plastid rys16 intron.
Clement,]. S. & Mabry, T.]. (in press). rbcL sequence data and pigment evolution inthe Caryophyllales: non-monophyly of the betalain-producing plants. Amer.]. Bot.
Conti, E., Fischbach, A. & Sytsma, K]. (1993). Tribal relationships in Onagraceae:implications from rbcL sequence data. Ann. Missouri Bot. Gard. 80: 672 - 685.
--, Litt, A. & Sytsma, K.]. (1996). Circumscription of Myrtales and theirrelationships to other rosids: evidence from rbcl: sequence data. Amer.]. Bot. 83:221- 233.
Cosner, M. E., Jansen, R. K. & Lammers, T. G. (1994). Phylogenetic relationships inthe Campanulales based on rbcL sequences. PI. Syst. Evol. 190: 79 - 95.
Cronquist, A. (1981). An integrated system of classification of flowering plants.Columbia University Press, New York.
Dahlgren, R. M. T. (1980). A revised system of classification of the angiosperms. Bot.]. Linn. Soc. 80: 91 - 124.
Dayanandan, S., Ashton, P. S. & Primack, R. B. (1999). Phylogeny of the tropicaltree family Dipteroairpaceaebased on nucleotide sequences of the chloroplast rbcLgene. Amer.]. Bot. 86: 1182 - 1190.
Donoghue, M. j., Olmstead, R. G., Smith,]. F. & Palme,]. D. (1992). Phylogeneticrelationships of Dipsacales based on rbcL sequences. Ann. Missouri Bot. Gard. 79:333 - 345.
Downie, S. R., Katz-Downie, D. S. & Cho, K-]. (1997). Relationships in theCaryophyllales as suggested by phylogenetic analyses of partial chloroplast DNAORF2280 homolog sequences. Amer. j. Bot. 84: 253 - 273.
Doyle, J. ]. & Doyle, J. L. (1987). A rapid DNA isolation procedure for smallquantities of fresh leaf tissue. Phytochem. Bull. Bot. Soc. Amer. 19: 11 - 15.
--, --, Ballenger, ]. A., Dickson, E. E., Kajita, T. & Ohashi, H. (1997). Aphylogeny of the chloroplast gene rbcL in the Leguminosae: taxonomiccorrelations and insights into the evolution of nodulation. Amer. J. Bot. 84: 541 554.
Endress, M. E., Sennblad, B., Nilsson, S., Civeyrel, L., Chase, M. W., Huysmans, S.,Grafstroem, E. & Bremer, B. (1996). A phylogenetic analysis of Apocynaceae s. str.and some related taxa in Gentianales. A multidisciplinary approach. Opera Bot.Belg. 7: 59 - 102.
Erbar, C. & Leins, P. (1996). Distribution of the character state "early sympetaly"and "late sympetaly" within the "sympetalae tetracyclicae" and presumably alliedgroups. Bot. Acta 109: 427 - 440.
Fay, M. F., Cameron, K. M., Prance, G. T., Lledo, M. D. & Chase, M. W. (1997a).Familial relationships of Rhabdodendron (Rhabdodendraceae): plastid rbcL sequencesindicate a caryophyllid placement. Kew Bull. 52: 923 - 932.
--, Swensen, S. M. & Chase, M. W. (1997b). Taxonomic affinities of Medusagyneoppositifolia (Medusagynaceae). Kew Bull. 52: 111-120.
286 KEW BULLETIN VOt. 55 (2)
--, Bayer, C., Alverson, W., de Bruijn, A. Y, Swensen, S. M. & Chase, M. W.(1998a). Plastid rbcLsequences indicate a close affinity between Diegodendron andBixa. Taxon 47: 43 - 50.
--, Olmstead, R. G., Richardon, J. E., Santiago, E., Prance, G. T. & Chase, M. W.(1998b). Molecular data support the inclusion of Duckeodendron celastroides inSolanceae. Kew Bull. 53: 203 - 212.
--, Bremer, B., Prance, G. T., van der Bank, M., Bridson, D. & Chase, M. W. (inpress). Plastid rbcL sequence data show Dialypetalanthus to be a member ofRubiaceae. Kew Bull.
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39: 783 - 791.
Fernando, E. S., Gadek, P. A, Crayn, D. M. & Quinn, C. J. (1993). Rosid affinities ofSurianaceae: molecular evidence. Molee. Phylogenet. Evol. 2: 344 - 350.
Fishbein, M., Hibsch-:Jetter, G, Soltis, D. E. & Hufford, L. (submitted). Phylogenyof Saxifragales (Angiosperms, Eudicots): analysis of a rapid, ancient radiation.Syst. BioI.
Gadek, P. A., Quinn, C. j., Rodman, J. E., Karol, K. G., Conti, E., Price, R. A. &Fernando, E. S. (1992). Affinities of the Australian endemic Akaniaceae: newevidence from rbcL sequences. Austral. Syst. Bot. 5: 717 - 734.
--, Fernando, E. S., Quirm, C. j., Hoot, S. B., Terrazas, T., Sheahan, M. C. &Chase, M. W. (1996). Sapindales: molecular delimitation and infraordinal groups.Amer. J. Bot. 83: 802 - 811.
Giannasi, D. E., Zurawski, G. R., Learn, G. H. & Clegg, M. T. (1992). Evolutionaryrelationships of the Caryophyllidae based on comaparative rbcL sequences. Syst.Bot. 17: 1-15.
Gunter, L. E., Kochert, G. & Giannasi, D. E. (1994). Phylogenetic relationships ofthe Juglandaceae. PI. Syst. Evol. 192: 11 - 29.
Gura, T. (1999). International Botanical Congress Meeting: new ways to gleanmedicines from plants. Science 285: 1347 - 1349.
Gustafsson, M. H. G., Backlund, A & Bremer, B. (1996). Phylogeny of the Asteralessensu lato based on rbcl. sequences with particular reference to the Goodeniaceae.PI. Syst. Evol. 199: 217 - 242.
Hempel, A L., Reeves, P. A, Olmstead, R. G. &Jansen, R. K. (1995). Implications ofrbcLsequence data for higher order relationships of Loasaceae and the anomalousaquatic plant Hydrostachys (Hydrostachyaceae). PI. Syst. Evol. 194: 25 - 37.
Hibsch-jetter, C., Soltis, D. E. & MacFarlane, T. D. (1997). Phylogenetic analysis ofEremosyne peainata (Saxifragaceae s. 1.) based on rbcL sequence data. PI. Syst. Evol.204: 225 - 232.
Hillis, D. M. (1998). Taxonomic sampling, phylogenetic accuracy, and investigatorbias. Syst. BioI. 47: 3 - 8.
Hoot, S. B., Culham, A & Crane, P. R. (1995a). The utility of atpB gene sequencesin resolving phylogenetic relationships: comparison with rbcL and 18S ribosomalDNA sequences in the Lardizabalaceae. Ann. Missouri Bot. Gard. 82: 194 - 208.
--, -- &-- (1995b). Phylogenetic relationships of the Lardizabalaceae andSargentodoxaceae: chloroplast and nuclear DNA sequence evidence. PI. Syst. Evol.9: 195 -199.
EUDICOT PHYLOGE:\Y BASED 0:\ RBCL SEQUE\iCES 287
-- & Crane, P. R. (1995). Inter-familial relationships in the Ranunculidae based onmolecular systematics. PI. Syst. Evol. 9: 119 - 13l.
--, Kadereit, J. W., Blattner, F. R., Jork, K B., Schwarzbach, A. E. & Crane, P. R.(1997). Data congruency and phylogeny of the Papaveraeeae s. l. based on fourdata sets: atpB, rbeL and 18S nuclear ribosomal DNA sequences. Syst. Bot. 22:575 - 590.
--, Megallon-Puebla, S. & Crane, P. R. (1999). Phylogeny of basal eudicots basedon three molecular data sets: atpB and rbeL sequences, trnK restriction sites andmorphological characters. Ann. Missouri Bot. Gard. 86: 119 - 131.
Johnson, L. A., Schultz, J. L., Soltis, D. E. & Soltis, P. S. (1996). Monophyly andgeneric relationships of Polemoniaceae based on matK sequences. Amer, J. Bot. 83:1207 - 1224.
-- & Soltis, D. E. (1994). matK DNA sequences and phylogenetic reconstructionin SaxiJragaeeae s.s. Syst. Bot. 19: 143 - 156.
-- & Soltis, D. E. (1995). Phylogenetic inference in Saxifragaeeae sensu stricto andCilia (Polernoniaeeae) using matK sequences. Ann. Missouri Bot. Gard. 82: 149 - 75.
--, -- & Soltis, P. S. (1999). Phylogenetic relationships of Polemoniaceaeinferred from 18S ribosomal DNA sequences. PI. Syst. Evol. 214: 65 - 89.
Kallersjo, M., Farris, J. S., Chase, M. w. Brerner, B., Fay, M. F., Humphries, C. J.,Petersen, G., Seberg, O. & Bremer, K (1998). Simultaneous parsimonyjackknife analysis of 2538 rbcl: DNA sequences reveals support for major cladesof green plants, land plants, seed plants and flowering plants. PI. Syst. Evol. 213:259 - 287.
Kass, E. & Wink, M. (1995). Molecular phylogeny of the Papilionoideae (FamilyLeguminosae): rbeL sequences versus chemical taxonomy. Bot. Acta 108: 149 - 162.
Kaufmann, M. & Wink, M. (1994). Molecular systematics of the Nepetoideae (familyLabiatae): Phylogenetic implications from rbeL gene sequences. Biosci. Rep. 49:635 -645.
Kim, K..]., Jansen, R. K., Wallace, R. S., Michaels, H.]. & Palme R.]. D. (1992).Phylogenetic implications of rbeL sequence variation in the Asteraeeae. Ann.Missouri Bot. Gard. 79: 428 - 445.
Koontz,]. A. & Soltis, D. E. (1999). DNA sequence data reveal polyphyly ofBrexioideae (Brexiaeeae; SaxiJragaeeae sensu lato). PI. Syst. Evol. 219: 199 -208.
Kron, K (1996). Phylogenetic relationships of Empetraceae, Epaeridaeeae, andErieaeeae: evidence from nuclear ribosomal 18S sequence data. Ann. Bot. 77:293 - 303.
-- (1997). Phylogenetic relationships of Rhododendroideae (Erieaeeae). Arner.]. Bot.84: 973 - 980.
-- & Chase, M. W. (1993). Systematics of the Ericaeeae, Empetraeeae, Epacridaceaeand related taxa based upon rbeL sequence data. Ann. Missouri Bot. Card. 80: 735-74l.
Kubitzki, K, Rohwer,]. G. & Bittrich, V. (1993). The families and genera of vascularplants. Flowering plants, dicotyledons. Magnoliid, hamamelid and caryophyllidfamilies. Springer Verlag, Berlin.
Les, D. H., Garvin, D. K & Wimpee, C. F. (1991). Molecular evolutionary history ofancient aquatic angiosperms. Proc. Natl. Acad. Sci. USA: 10119 - 10123.
288 KEW BULLETIN VOL. 55(2)
--, Philbrick, C. T. & Novelo, R. A. (1997). The phylogenetic position of riverweeds(Podostemaceae): insights from rbcLsequence data. Aquatic Bot. 57: 5 - 27.
Lin, D. M., Liu, Z. Q. & King, S. D. (1986). Nicotiana chloroplast genome: X.Correlation between the DNA sequences and the isoelectric focusing pattern ofthe LS ofrubisco. PI. Molec. BioI. 6: 81 - 87.
Litt, A. & Chase, M. W. (1999). The systematic position of Euphronia, with commentson the position of Balanops: an analysis based on rbcLsequence data. Syst. Bot. 23:401 - 409.
Lledo, M. D., Crespo, M. B., Cameron, K. M., Fay, M. F. & Chase, M. W. (1998).Systematics of Plumbaginaceae based upon cladistic analysis of rbcL sequence data.Syst. Bot. 23: 21 - 29.
Manen, ].-F., Natali, A. & Ehrendorfer, F. (1994). Phylogeny of Rubiaceae-Rubieaeinferred from the sequence of a cpDNA intergene region. PI. Syst. Evol. 190:195 - 211.
-- & -- (1995). Comparison of the evolution of ribulose-l,5-bisphosphatecarboxylase (rbcL) and atpB-rbcL noncoding spacer sequences in a recent plantgroup, the tribe Rubieae (Rubiaceae).J. Molec. Evol. 41: 920 - 927.
Martin, P. C. & Dowd,]. M. (1993). Using sequences ofrbcL to study phylogeny andbiogeography of Nothofagus species. Austral. Syst. Bot. 6: 441 - 447.
Mathews, S. & Donoghue, M.J. (1999). The root of angiosperm phylogeny inferredfrom duplicate phytochrome genes. Science 286: 947 - 950.
Michaels, R]., Scott, K. M., Olmstead, R. C., Szaro, T.,jansen, R. K. & Palmer, ]. D.(1993). Interfamilial relationships of the Asteraceae: insights from rbcL sequencevariation. Ann. Missouri Bot. Card. 80: 742 - 751.
Morgan, D. R. & Soltis, D. E. (1993). Phylogenetic relationships among Saxifragaceaesensu lato based on rbcl: sequence data. Ann. Missouri Bot. Card. 80: 631 - 660.
--, -- & Robertson, K R. (1994). Systematic and Evolutionary Implications ofrbcLSequence Variation in Rosaceae. Amer.]. Bot. 81: 890 - 903.
Morton, C. M., Chase, M. W. & Karol, K. C. (1997a). Phylogenetic relationships oftwo anomalous dicot genera, Physena and Asteropeia: evidence from rbcL plastidDNA sequences. Bot. Rev. 63: 231 - 239.
--, --, Kron, K. A. & Swensen, S. M. (1997b). A molecular evaluation of themonophyly of the order Ebenales based upon rbcL sequence data. Syst. Bot. 21:577 - 586.
--, Mori, S. A., Prance, C. T., Karol, K. C. & Chase, M. W. (1997c). Phylogeneticrelationships of Lecythidaceae: A cladistic analysis using rbcL sequence andmorphological data. Amer. J. Bot. 84: 530 - 540.
Nandi, O. I., Chase, M. W. & Endress, P. K (1998). A combined cladistic analysis ofangiosperms using rbcl: and non-molecular data sets. Ann. Missouri Bot. Card. 85:137 - 212.
Nei, M., Kumar, S. & Takahashi, K (1998). The optimization principle in phylogeneticanalysis tends to give incorrect topologies when the number of nucleotides or aminoacids used is small. Proc. Nat!. Acad. Sci. USA 95: 12390 - 12397.
Nickrent, D. L., Schuette, K & Starr, E. (1994). A molecular phylogeny ofArceuthobium (Viscaceae) based on nuclear ribosomal DNA internal transcribedspacer sequences. Amer. J. Bot. 81: 1149 - 60.
EUDICOT PHH,OGENY BASED ox RBCL SEQLEKCES 289
--, Duff, R. ]., Colwell, A. E., Wolfe, A. D., Young, N. D., Steiner, K E. &dePamphilis, C. W. (1998). Molecular phylogenetics and evolutionary studies ofparasitic plants In: D. E. Soltis, P. S. Soltis &J.J. Doyle (eds.), Molecular Systematicsof plants II: DNA sequencing, pp. 211 - 241. Kluwer Academic, Dordrecht.
-- & Soltis, D. E. (1995). A comparison of angiosperm phylogenies based uponcomplete 18S rDNA and rbeLsequences. Ann. Missouri Bot. Gard. 82: 208 - 234,
-- & Starr, E. M. (1994). High rates of nucleotide substitution in nuclear smallsubunit (18S) rDNA from holoparasitic flowering plants.J. Molec. Evol. 39: 62 -70.
Olmstead, R G., Michaels, H. J., Scott, K M. & Palmer, J. D. (1992). Monophyly ofthe Asteridae and identification of their major lineages inferred from DNAsequences of rbeL. Ann. Missouri Bot. Gard. 79: 249 - 65.
--, Bremer, B., Scott, K M. & Palmer, J. D. (1993). A parsimony analysis of theAsteridae sensu latobased on rbeL sequences. Ann. Missouri Bot. Gard. 80: 700 - 722.
-- & Reeves, P. A. (1995). Evidence for the polyphyly of the Scrophulariaeeae basedon chloroplast rbeLand ndhF sequences. Ann. Missouri Bot. Gard. 82: 176 - 93.
--, Sweere,]. A., Spangler, R. E., Bohs, L. & Palmer,]. D. (1999). Phylogeny andprovisional classification of the Solanaceae based on chloroplast DNA In: M. Nee& D. Symon (eds.), Solanaceae IV, Advances in biology and utilization, RoyalBotanic Gardens, Kew.
--, Kim, Kj., jansen, R. K & Wagstaff, S. J. (submitted). The phylogeny of theAsteridaesensu lato based on chloroplast ndhF gene sequences. Syst. Bot.
Oxelman, B., Backlund, M. & Bremer, B. (1999). Relationships of the Buddlejaceaeinvestigated using parsimony jackknife and branch support analysis of ndhF andrbeLsequence data. Syst. Bot. 24(2): 164-182.
Pagel, M. (1999). Inferring historical patterns of biological evolution. Nature 401:877 - 884.
Plunkett, G. M., Soltis, D. E. & Soltis, P. S. (1997a). Evolutionary patterns inApiaeeae: inferences based on matK sequence data. Syst. Bot. 21: 477 - 495.
--, -- & -- (1997b). Clarification of the relationship between Apiaeeae andAraliaeeaebased on matK and rbeL sequence data. Amer. J. Bot. 84: 565 - 580.
Powell, M., Savolainen, v., Cuenoud, P., Manen, J.-F. & Andrews, S. (2000). Themountain holly (Nemopanthus mucronatus) revisited with molecular data. Kew Bull.55: 341 - 347.
Price, R A. & Palmer, J. D. (1993). Phylogenetic relationships of the Geraniaceae andGeraniales from rbeLsequence comparison. Ann. Missouri Bot. Card. 80: 661 - 671.
Purvis, A., Nee, S. & Harvey, P. H. (1995). Macroevolutionary inferences fromprimate phylogeny. Proc. Roy. Soc. B 260: 329 - 333.
Qiu, Y-L., Chase, M. W, Les, D. H. & Parks, C. R (1993). Molecular phylogeneticsof the Magnoliidae: cladistic analyses of nucleotide sequences of the plastid generbeL. Ann. Missouri Bot. Gard. 80: 587 - 606.
--, Chase, M. W, Hoot, S. B., Conti, E., Crane, P. R, Sytsma, K. J. & Parks, C. R(1998). Phylogenetics of the Hamamelidae and their allies: parsimony analysis ofnucleotide sequences of the plastid gene rbeL. Int. J. PI. Sci. 159: 891 - 905.
--, Lee, J., Bernasconi-Quadroni, F., Soltis, D. E., Soltis, P. S., Zanis, M., Chen, Z.,Savolainen, V. & Chase, M. W. (1999). The earliest angiosperms: evidence frommitochondrial, plastid and nuclear genomes. Nature 402: 404 - 407.
290 KEW BULLETIN VOL. 55 (2)
Rettig, J. H., Wilson, H. D. & Manhart, J. M. (1992). Phylogeny of the Caryophyllales- gene sequence data. Taxon 41: 201 - 209.
Reveal,]. L.,judd, W. S. & Olmstead, R. G. (1999). Proposal to conserve the nameAntirrhinaceae against Plantaginaceae (Magnoliophyta). Taxon 48: 182.
Richardson,J., Fay, M. F., Cronk, Q. C., Bowman, D. & Chase, M. W. (in press). Amolecular analysis of Rhamnaceae using rbcL and trnL-F plastid DNA sequences.Amer. .J. Bot.
Rodman,j. K, Price, R A., Karol, K, Conti, E., Sytsma, Kj. & Palmer,J. D. (1993).Nucleotide sequences of the rbcL gene indicate monophyly of mustard oil plants.Ann. Missouri Bot. Gard. 80: 686 - 699.
--, Karol, K G., Price, R. A., Conti, E. & Sytsma, K J. (1994). Nucleotidesequences of rbcL confirm the capparalean affinity of the Australian endemicGyrostemonaceae. Austral. Syst. Bot. 7: 57 - 69.
--, --, -- & Sytsma, K J. (1996). Molecules, morphology and Dahlgren'sexpanded order Capparales. Syst. Bot. 21: 289 - 307.
--, Soltis, P. S., Soltis, D. K, Sytsma, K J. & Karol, K G. (1998). Parallel evolutionof glucosinolate biosynthesis inferred from congruent nuclear and plastid genephylogenies. Amer.J. Bot. 87: 997 -1006.
Ronse Decraene, P. L., Smets, E. F. & Vanvinckenroye, P. (1998). Pseudodiplostemony, and its implication for the evolution of the androecium in theCaryophyllaceae. j. PI. Res. Ill: 25 - 43.
Saad, S. I. (1962). Pollen morphology of Ctenolophon. Bot. Not. 115: 49 - 57.Sanderson, M. J., Purvis, A. & Henze, C. (1998). Phylogenetic supertrees:
assembling the trees of life. Trends Ecol. Evol. 13: 105 - 109.Savolainen, v., Manen, J. F., Douzery, E. & Spichiger, R. (1994). Molecular
phylogeny of families related to Celastrales based on rbcl: 5' flanking sequences.Molec. Phylogenet. Evol. 3: 27 - 37.
--, Cuenoud, P., Spichiger, R, Martinez, M. D. P., Crevecoeur, M. & Manen, J.-F.(1995). The use of herbarium specimens in DNA phylogenetics: evaluation andimprovement. PI. Syst. Evol. 197: 87 - 98.
--, Spichiger, R. & Manen, J.-F. (1997). Polyphyletism of Celastrales deduced froma noncoding chloroplast DNA region. Molec. Phylogenet. EvoI. 7: 145 - 157.
-- & Goudet, J. (1998). Rate of gene sequence evolution and species diversificationin flowering plants: a re-evalutation. Proc. Roy. Soc. B 265: 603 - 607.
--, Chase, M. W., Morton, C. M., Hoot, S. B., SoItis, D. K, Bayer, c., Fay, M. F.,de Bruijn, A., SuIIivan, S. & Qiu, Y.-L. (in press). Phylogenetics of floweringplants based upon a combined analysis of plastid atpB and rbcLgene sequences.Syst, BioI.
Sennblad, B. & Bremer, B. (1996). The familial and subfamilial relationships ofApocynaceae and Asclepiadaceae evaluated with rbcL data. PI. Syst. Evol. 202: 153 - 175.
Sheahan, M. C. & Chase, M. W. (1996). A phylogenetic analysis of Zygophyllaceae RBr. based on morphological, anatomical, and rbcL DNA sequence data. Bot. j.Linn. Soc. 122: 279 - 300.
-- & -- (in press). Phylogenetic relationships within Zygophyllaceae based onDNA sequences of three plastid regions, with special emphasis on Zygophylloideae.Syst. Bot.
EUDICOT PHYLOGENY BASED ON RBCL SEQCE1\iCES 291
Soltis, D. E., Soltis, P. S., Clegg, M. T. & Durbin, M. (1990). rbcL sequence divergenceand phylogenetic relationships in Saxifragaceae sensu lata. Proc. Natl, Acad. Sci.USA 87: 4640 - 4644.
--, Morgan, D. R., Grable, A., Soltis, P. S. & Kuzoff, R. (1993). Molecularsystematics of Saxifragaceae sensu stricto. Amer.J. Bot. 80: 1056 -108I.
--, Soltis, P. S., Morgan, D. R., Swensen, S. M., Mullin, B. C., Dowd, J. M. &Martin, P. G. (1995). Chloroplast gene sequence data suggest a single origin ofthe predisposition for symbiotic nitrogen fixation in angiosperms. Proc. Natl.Acad. Sci. USA 92: 2647 - 265I.
--, Kuzoff, R. K, Conti, E., Gornall, R. & Ferguson, K (1996). matK and rbcl:gene sequence data indicate that Saxifraga (Saxifragaceae) is polyphyletic. Amer. J.Bot. 83: 371 - 382.
-- & Soltis, P. S. (1997). Phylogenetic relationships in the Saxifragaceae sensu lato: acomparison of topologies based on 18S rDNA and rbcLsequences. Amer. J. Bot.84: 504 - 22.
--, Soltis, P. S., Nickrent, D. L.,Johnson, L. A., Hahn, WJ., Hoot, S. B., Sweere,J.A., Kuzoff, R. K, Kron, K A. & Chase, M. W (1997a). Angiosperm phylogenyinferred from 18S ribosomal DNA sequences. Ann. Missouri Bot. Gard. 84: 1 49.
--, Hibsch:Jetter, C., Soltis, P. S., Chase, M. W & Farris,J. S. (1997b) Molecularphylogenetic relationships among angiosperms: an overview based on rbcL and18S rDNA sequences In: K Iwatsuki & P. H. Raven (eds.), Evolution anddiversification of land plants, pp. 157 - 178. Springer, Tokyo.
--, Soltis, P. S., Mort, M. E., Chase, M. W., Savolainen, v., Hoot, S. B. & Morton,C. M. (1998). Inferring complex phylogenies using parsimony: an empiricalapproach using three large DNA data sets for angiosperms. Syst. BioI. 47: 32 - 42.
-- & Soltis, P. S. (1998b) Choosing an approach and an appropriate gene forphylogenetic analysis In: D. E. Soltis, P. S. Soltis & J. J. Doyle (eds.), MolecularSystematics of plants 11: DNA sequencing, pp. 1 - 42. Kluwer Academic,Dordrecht.
--, Mort, M. E., Soltis, P. S., Hibsch:Jetter, C., Zimmer, E. A. & Morgan, D.(1999b). Phylogenetic relationships of the enigmatic angiosperm familyPodostemaceae inferred from 18S rDNA and rbcL sequence data. Molec.Phylogenet. Evol. 261 - 272.
--, Soltis, P. S., Chase, M. W, Mort, M. E., Albach, D. C., Zanis, M., Savolainen, V.,Hahn, W. H., Hoot, S. B., Fay, M. F., Axtell, M., Swensen, S. M., Nixon, K C. &Farris, J. S. (in press). Angiosperm phylogeny inferred from a combined data setof 18S rDNA, rbcL, and atpB sequences. Bot. J. Linn. Soc.
Soltis, P. S. & Soltis, D. E. (1998a) Molecular evolution of 18S rDNA in angiosperms:implications for character weighting in phylogenetic analysis In: D. E. Soltis, P. S.Soltis & J. J. Doyle, (eds.), Molecular Systematics of plants 11: DNA sequencing,pp. 188 - 210. Kluwer Academic, Dordrecht,
--, Soltis, D. E. & Chase, M. W. (1999a). Angiosperm phylogeny inferred frommultiple genes as a tool for comparative biology. Nature 402: 402 - 404.
Swensen, S. M. (1996). The evolution of actinorhizal symbioses: evidence formultiple origins of the symbiotic association. Amer. J. Bot. 83: 1503 - 1512.
292 KEW BULLETIN VOL. 55 (2)
Swofford, D. L. (1998). PAUP*: Phylogenetic analysis using parsimony (* and othermethods), Version 4.0. Sinauer Associates, Sunderland, Masachusetts.
Thulin, M., Bremer, B., Richardson, J., Niklasson, J., Fay, M. F. & Chase, M. W.(1998). Family relationships of the enigmatic rosid genera Barbeya and Dirachmafrom the Horn of Africa region. PI. Syst. Evol. 213: 103 - 119.
Ueda, K., Kosuge, K. & Tobe, H. (1997). A molecular phylogeny of Celtidaceae andUlmaceae (Urticales) based on rbcL nucleotide sequences. J. PI. Res. 110: 171 - 178.
Wolfe, A. D. & dePamphilis, C. W. (1998). The effect of relaxed functionalconstraints on the photosynthetic gene rbcL in photosynthetic andnonphotosynthetic parasitic plants. Molec. BioI. Evol. 15: 1243 - 1258.
Xiang, Q.-Y., Soltis, D. E., Morgan, D. R. & Soltis, P. E. (1993). Phylogeneticrelationships of Cornus L. sensu lato and putative relatives inferred from rbcLsequence data. Ann. Missouri Bot. Gard. 80: 723 - 734.
-- & Soltis, D. E. (1998). rbcL sequence data define a cornaceous clade and clarifyrelationships of Cornus L. sensu lata. In: D. E. Boufford & H. Ohba (eds.), SinoJapanese florista: its characteristics and diversification, pp. 125 - 137. Universityof Tokyo Press, Tokyo.
Zurawski, G., Perrot, B., Bottomley, W. & Whitfield, P. R. (1981). The structure ofthe gene for the large subunit of ribulose 1,5 bisphosphate carboxylase fromspinach chloroplast DNA. Nucl. Acids Res. 9: 3251 - 3270.
--, Whitfield, P. R. & Bottomley, W. (1986). Sequence of the gene for the largesubunit of ribulose-1,5-bisphosphate-carboxylase from pea chloroplasts. Nucl.Acids Res. 14: 3975.
ApPENDIX 1. t'"C0
Family Species Accession number Citation (voucher) n0...,"ti
Acanthaceae Thunbergia coccinea Wall. Ll2956 Chase et al. 1993 :r:.....Achariaceae Acharia tragodes Thunb. AF206728 Soltis et al. in press r'
0A rhatocarpaceae Phaulothamnus spinescens A. Gray M97887 Manhart & Rettig unpubl. C")
rr.A ctinidiaceae Actinidia chinensis Planeh. L01882 A1bert et al. 1992 ZActiniduiceae Clemaioclethra lasioclada Maxim. Z80172 Morton et al. 1997b -<
I:l:lAdoxacrae Sambucus nigra L. Ll4066 Donoghue et al. 1992 ;..
(f)
Adoxaceae Viburnum acerifolia L. L01959 Olmstead et al. 1992 rr.0
Aextoxicaceae Aextoxicon punctatum Ruiz & Pav. X83986 Savolainen et at. 1997 0Aizoturae Delosperma echinatum (Larn.) Sehwantes AJ235778 Savolainen et al. in press :;;:
Aizaaceae Trianthema portulacustrum L. M62572 Rettig rt al. unpubl.;;>:J
Aktmiaceae Akania bulunllii (R. Hogg) Mabb. Ll2568 Gadek et al. 1992 ~
Alseuomiaceae Crispiloba disperma (S. Moore) Steenis X87382 Custafsson et al. 1996 (f)
rr.Alseuomiaceae Wittsteinia uaccinincea F. Muell. X87399 Gustafsson et al. 1996 toAlseuosmiareae Alseuosmia macrophylla A. Cunn. X87377
r:Soltis et al. in press rr.
Altingiaceae Altingia excelsa Noronha AJ131769 Chase et al. 1993 ~~Altingiaceae Liquidambar[ormosana Hanee M58394 Chase et al. 1993 (f)
Alzateaceae Alzatea uertiallata Ruiz & Pav. U26316 Conti et al. 1996A maranthaceae A maranthus tricolor L. X53980 Rettig et al. 1992Amaranthareae Spinacia olerarea L. J01443 Zurawski et al. 1981Anacardiaceae Amphipterygium adstringens (Sehltdl.) Sehiede AJ402921 this paper (Manzanero 1150 NY)
ex StandI.Anacardiaceae Buchanania latifolia Roxb. U39275 Gadek et al. 1996Anacardiaceae Schinus molle L. U39270 Gadek et al. 1996A nacardiaceae Spondias cytherea Tussae U39274 Gadek et al. 1996Anastrocladaceae Ancistrocladus korupensis D. W. Thomas & Gereau AF206733 Soltis et al. in pressAnisophyllaeaceae Combretocarpus rotundatus Danser AF006763 Setoguehi et al. unpubl.Anrtirrhinareae Plantago lanceolata Hook. L36454 Olmstead & Reeves 1995Aphlouurae Aphloia theiformis (Vahl) Benn. AF206735 Soltis et al. in pressApiacea« Apium gravfolRns L. 1,01885 A1bert et al. 1992Apiaceae Melanophylla alnijolia Baker U50254 Plunkett et al. 1997bApuCYlw((ae Apocynum cannabinum L. X91761 Sennblad & Bremer 1996Aporynaceae Skytanthus acutus Meyen AJ403003 this paper (Endress s.n. Z) Nl
<.0(,JO
Family Species Accession number Citation (voucher) N)<.0....
Aquifoliaceae Ilex crenata Thunb. L01928 Albert et al. 1992Aquifoliaceae Nemopanthus mucronatus (L.) Trel. X69747 Savolainen et al. 1994
Araliaceae H rdrra helix L. L01924 Xiang et at. 1993Aralidiaceae Aralidium pinnatifidum (jungh. & de Vriese) Miq. U58627 Xiang & Soltis 1998Argophyllaceae Argophyllum sp. X87379 Gustafsson et al. 1996
A Igophyllacrar Corokia cotoneaster Raoul Ll1221 Xiang et al. 1993Asterarear Helianthus annuus L. Ll3929 Kim et al. 1992
Asteropeiaceae Asteropeia micrasterHallier f. Z80150 Morton et al. 1997bAucubaceae Aucuba japonica Thunb. L11210 Xiang et al. 1993
Avicenniacrflf Auicennia germinans (Humb., Bonp!. & Kunth) U28868 Wagstaff & Olmstead unpubl.Moldenke
Baianopaceae Balanops viellardii Baill. AF089760 Lilt & Chase 1999Balsaminaceae Impatiens capensis Meerb. Z83142 Chase et al. 1993
Barbeyaceae Barbeya oleiodes Schwein. U60314 Qiu et al. 1998
Basellaceae Basella alba L. M62564 Rettig et al. 1992
Bataceae Batis maritima L. M88341 Chase et al. 1993
Begoniaceae Begonia metallica ¥ sanguinea L01888 Chase et al. 1993
Berberidaceae Nandina domestica Thunb. L37920 Hoot et al. 1995
Berberidopsidaceae Berbendopsis corallina Hook. AJ235773 Savolainen et al. in pressBetulaceae Betula nigra L. L01889 Albert et al. 1992
Betulaceae Corylus cornuta Marshall X56619 Bousquet et al. 1992
Biebersteiniaceae Biebersteinia orphanidis Boiss. AF035920 Bakker et at. 1998
Bignoniaceae Caialpa bignonioides Waiter Ll1679 Olmstead et at. 1992
Bixaceae Bixa orellana L. Yl5139 Fay et at. 1998a ~Bonnetiaceae Bonnetia roraimae Oliv. AJ402930 this paper (Weitzman et al. 402 US) :::;:
I;:iBoraginaceae Borago officinalis L. Ll1680 Olmstead et al. 1992 §Boraginaceae Hydrophyllum virginianum L. L01927 Olmstead et al. 1992Brassicaceae Brassica oleracea L. M88342 Rodman et al. 1993
M>-l
Brassicaceae Cleome hassleriana Chodat M95755 Chase et al. 1993 ZBrunelliaceae Brunellia sp. AJ402932 this paper (Lewis 3366 K) <
0Bruniaceae Berzelia lanuginosa Brongn. Ll4391 Olmstead et at. 1993 rBru.niaceae Brunia aliJiflora E. Phillips Yl0674 Backlund & Bremer 1998 U't
U'tBuddlejaceae Buddleja sp. AJOO1757 Oxelman et al. unpubl. ,.......
N)Buddlejaceae Polypremum procumbens L. AJ01l989 Oxelman et al. 1999 ---
Burseraceae
Burseraceae
BurseraceaeBuxaceaeBuxaceaeByblidaceaeCactaceaeCalsceraceae
Campanulacear
CampanulaceaeCampnnulaceae
CannabaceaeCannabaceae
CaprifoliaceaeCardioptrridareae
Cardioptrruiaceue
Cardiopteridaceae
( .ardipteridureae
Cariaiceae
Carlemanniaceae
CarpodetaceaeCarpodetaceaeCarpodetaceaeCarsocaraceaeCaryophyllaceaeCasuarinaceae
CecropiaceaeCelastraceae
CelastraceaeCelastraceaeCelastraceaeCelastraceaeCelastrareaeCelastraceae
Celastraceae
Celastraceae
Ceiastrareae
Beiselia mexirana FormanBursera inaguensis BrittonCommiphora abessinicn Engl.BUXUJ semperuirens L.Pachysandra procumbens Michx.Byblis liniflora Salisb.Pereskia aculeata Mill.Boopis anthemoides]uss.Campanula ramulosa Wall.Cyphia elata Harv.Lobelia erinus L.Cannabis satioa L.Humulus lupulus 1..Symphoricarpos albus (1..) S. F. BlakeGomphandra javanica ValetonGonocaryum litorale Sleumerlrvingbailrya sp.Cardioptens quinqueloba Hassk.Carica papaya L.Carlrmannia griffithiiAbrophyllum ornans Hook. f.Carpodetus serratus]. R Forst. & G. Forst.Cuttsia uirbunea F. Muell.Caryocar glabrum Pers.Dianthus caryophyllus L.Casuarina litotea L.Cecropiapalmata Willd.Brexia madaeascariensis ThouarsCanotia holoranthe Torr.CelaJtTUJ orbiculatus Humb. & Bonpl.Denhamia celasuoides (F. Muell.) ]essupEuonymus alatus SieboldHippocratea richardiana Cambess.Lophopetalum sessilifolium Ridl.Plagiopteron suaueolens Griff.Pleurostslia wightii PierrePsammomoya choretroides Diels & Loes,
A]402925L01890U39276AF093717AF093718L01891M97888Ll3860Ll3861Ll8796LOl931A]402933AF061992Lll682AJ402954A]235779AF156733A]402936M95671A]402937X87375\'08461\'08462Z75671M77699L01893AF06 1196Lll176A]402934A]235775A]402941Ll3184X69740AJ402969A,J235787A]402989AJ402994
this paper (Chase 639 K)Albert et al. 1992Gadek et al. 1996Hoot et al. 1999Chase et al. 1993Albert et al. 1992
Rettig et al. 1992Olmstead et al. 1992Olmstead et al. 1992Cosner et al. 1994
Albert et al. 1992this paper (ChaJe 2992 K)Qiu et al. 1998
Olmstead et al. 1992this paper (Chnse 1293 K)Savolainen et al. in pressSoltis et al. in pressthis paper (Van Bensekom 3836 K)Rodman et al. 1993
this paper (Grierson & Long 3027 K)
Gustafsson et al. 1996Bremer & Gustafsson 1997Bremer & Gustafsson 1997Fay et al. 1997bGiannasi et al. 1992
Albert et al. 1992Qiu et at. 1998
Soltis et al. 1990this paper (Ramsden & Hodgson 6336 NY)Savolainen et al. in pressthis paper (ChaJe 2050 K)Chase et al. 1993
Savolainen et al. in pressthis paper (Chase 1214 K)Savolainen et at. in pressthis paper (Chase 2093 K)this paper i Chose 2160 K)
t""CS2,...o-I":l::r:;::;oC'Ct'1Z-<0;;..er.I'T1Cl
o7.:>::l0;,...r:er.t'1
(0Ct""Z,...t"er.
~<.DU1
Family Species Accession number Citation (voucher) Nl<.0O"l
Celastraceae Reissentia sp. AJ402996 this paper (Chase 2471 K)Celastraceae Salacia undulata Cambess. AJ402998 this paper (Chase 2096 K)Celastraceae Siphonodon australis Benth. AJ403002/AJ403033 this paper (Savolainen saul G)Celastrarear Siphonodon celasirineus Griff. AF206821 Soltis et al. in pressCelastraceae Stackhousia minima Hook. f. AJ235795 Savolainen et al. in pressCelastraceae Tripterococcus brurumis Endl. AJ403012 this paper (Cha..e 2193 K)Celtidnceae Celtis yunnanl'1lsi, C. K. Schneid. Ll2638 Chase et al. 1993
Ceratophsliaceae Ceratophvllum demersum L. M77030 Les et at. 1991
Cercidiphyllaceae Cercidiphsllum japonicum Siebold & Zucc. Ll1673 Olmstead rt al. 1992
Chry.lObalanaeeae Aluna racemose Rafin. AF089758 Litt & Chase 1999Chrysobalanaceae Chrysobalanus icaco L. Lll178 Morgan & Soltis 1993Chrvsobalanaceae Hirtella bicormis Mart. & Zucc. AF089756 Litt & Chase 1999Circaeasteraceae Circaester agreslis Maxim. AF092116 Hoot & Crane 1995Circaeasteraceae Kingdonia uniflora Balf. f. & W.W. Srn. AF093719 Hoot & Crane 1995Cistaceae Cistus reuolii H. J. Coste & Soulie AF035902 Savolainen et al. in pressCistaceae Helianthemum grandiflorum DC. Yl5141 Fay et al. 1998aClethraceae Clethra alnifolia L. Ll2609 Kron & Chase 1993Clusiaceae Calophyllum sp. Z75672 Fay et al. 1997bClusiaceae Clu..ia gundlachi Stahl Z75673 Fay et al. 1997bClusiacene Garcinia hessii (Britton) Alain AJ402952 this paper (Axelrod 4537 UPR)Clusiaceae Hypericum empetrifolin WilId. AF206779 Soltis et al. in pressClusiaceae Mesua sp. AF206794 Soltis et al. in pressCochlospermaceae Amoreuxia wrighlii A. Gray Yl5142 Fay et at. 1998aCochlospermaceae Cochlospermum intermedium Mildbr. Yl5143 Fay et al. 1998a gjColumelliaceae Columellia oblonga Ruiz & Pay. Yl0675 Backlund & Bremer 1997 ::::Combretaceae Quisqualis indica L. L01948 Albert et al. 1992 t>:l
c:Combretaceae Terminalia calappa L. U26338 Chase et al. 1993 r-
r-Connaraceae Connarus conchocarpus F. Muell. L29493 Fernando et at. 1993 t"1...,Conuoluulaceae Convolvulus tricolor L. Ll1683 01mstead et al. 1992 ZConariaceae Conaria myrlifolia L. LOIR97 Albert er al. 1992 <
0Cornaceae Cornu... officinalis Sieb. et Zucc. Ll1216 Xiang et al. 1993 rCornaceae Griselinia lucida G. Forst, Ll1225 Xiang et at. 1993 (.]l
Comaceae Nvssa ogeche Marshall Ll1228 Xiang et al. 1993(.]l~
Cornnreae Toricellia tilifolia DC. N/A Xiang & Soltis 1998Nl'-"
Corynocarpaceae
Crassu lareaeCrassulaceae
Crassulaceae
Crassulaceae
Crossosomatacene
Crypteronuueae
Ctenolophonaceae
CucurbitaceaeCucurbitaceae
Cunoniaceae
Cunoniareae
Cunoniareae
Cydocheilarme
Cyrillnceae
Duphniphvltaceae
Dtuiscareae
DntiscaceaeDatiscaceae
Desfoniainiaceae
Diapensuurae
Dichapetalaceae
Dichapetalaceae
Didieraceae
Didyrneleaceae
Diegodendraceae
Diervillaceae
Dilleniaceae
Dilleniaceae
Dilleniaceae
Dilleniaceae
Di lleniaceae
Dioncophsllaceae
Dipsacaceae
Dipterocarpareae
DipterocorpnceaeDiptrrorarpareae
Corynocarpus laevigalusJ. R Forst. & G. Forst.Crassula marnierana H. Huber & H. ]acobsenDudleya viscida MoranKalanchoe daigremonliana Rayrn-Hamet & H. PerrierSedum rubrotinctum R T. ClausenCrossosoma californicum Nutt.Crypleronia paniculata B1umeCtenolophon englerianus Mildbr.Cucurbita pepo L.Neoalsomitra sarrophylla (WaiL) Hutch.Bauera rubioides AndrewsDavidsonia puriens F. MuelLEucrsphia lucida DruceCydocheilon somaliense Oliv.
Cyrilla racemiflora L.Daphniphyllum sp.Datiscn cannabina L.Octomeles sumatrane Teijsm. & Binn. ex Hassk.Tetrameles nudiflora R Br.Desfontainia spinosa Ruiz & Pay.Diapensia lapponica L.Dichapelalum crassifolium ChodatTapura amazonica Poepp, & EndLAlluaudia procera DrakeDidyrneles perrieriLeandriDiegodendron humbertu CapuronDiervilla sessifolia BuckleyDillenia indica L.Hibbertia volubilis AndrewsPachynema juncea Benth.Schu macheria sp.Tetracera asiatica HooglandTriphyophyllum peltatum (Hutch. & Dalziel) Airy ShawDipsacus satiuus (L.) Honck.Monotes sp.Pakaraimaea dipterocarpacea Maguire & P. S. AshtonShorea toorthingtonii P. S. Ashton
X69731L01899Ll1l82Ll1l89L01956Ll1l79AF215545A]402940L21938U59823Llll74AF206759L01918U28871L01900L01901L21939L21942L21943Z29670Ll2612X69733AF089763M62563AF094541Yl5138Z29672L01903AF093721A]402980/A]403030AF095734A]235796Z97637Ll3824N/AN/AN/A
Savolainen et al. 1997Albert et al. 1992Morgan & Soltis 1993Morgan & Soltis 1993Albert et al. 1992Morgan & Soltis 1993Clausing & Renner, unpubLthis paper tDourse 1572 K)Chase et al. 1993Swensen 1996Morgan & Soltis 1993Soltis et al. in pressAlbert et al. 1992Wagstafl & Olmstead unpuhl.Albert et al. 1992Albert et al. 1992Chase et al. 1993Swenson unpubLChase et al. 1993Bremer et al. 1994Kron & Chase 1993Savolainen et al. in pressLilt & Chase 1999Re ttig et al. 1992Hoot et al. 1999Fay et al. 1998aBremer et al. 1994Albert et al. 1992Hoot et al. 1999this paper (Carlquist 15460 NY)Savolainen et al. in pressSavolainen et al. in pressL1ed6 et al. 1998Olmstead et al. 1992Dayanandan et al. 1999Dayanandan et al. 1999Dayanandan et al. 1999
t"'lCon~'""::r:~oC'JtT'%-eO::l;..VJtT'Cl
oZ;:tlO::l
PVJtT'(0c:tT'
~~VJ
N:l<.0<r
Family
Dirachmaceae
Donatiaceae
Droseraceae
DrosophyllaceaeEbenaceae
ElaeagnaceaeElaeocarpaceae
ElaeocarpaceaeElaeocarpaceaeElaeocarpnceaeElaeocarpoceae
Elaeocarpaceae
Elatinaceae
Elatinaceae
Emblingiaceae
EremosynnceaeEncaceae
Ericaeeae
Erythroxylaeeae
Erythroxylaeeae
Esralloniaceae
EscalloniaceaeEucommiaceae
EuphorbiaceaeEuphorbiaceaeEuphorbiaceaeEuphorbiaceae
EuphorbiaceaeEuphorbiaceaeEuphorbuiceaeEuphorbiaceaeEuphorbiaceaeEupteleaceaeFabaceae
Species
Dirachma socotrana Schweinf. ex Ball'.Donatiafascicularis i. R. Forst. & G. Forst.Drosera spathulata Labill.Drosophsllum lusitunicum (L.) LinkDiospyros virginiana L.Elaeagnus angustifolia L.Acrratium ferruginrum C. T. WhiteCrinodendron hookerianurn GayElaeocarpus sp.Platstheca uerticellata Bail!.Sloanea latifolia Schurn.Vallea stipularis L.Bergia ammanioides Heyne ex Roth.Elaline hydropiper L.Emblingia calceoliflora F. MueH.Eremosme pectinala Endl.Erica australis L.Rhododendron hippophaeoides BaIt'. f. & W. W. Srn.Erythroxylum confusum BrittonNectaropetalum zuluense (Schonland) CorbishleyEscallonia coquimbensisJ. Rerny ex GayPolyosma eunninghamii Benn.Eucommia ulmoides Oliv.Bemardia incana C. V. MortonDvsopsis giechomoides Mull. Arg.Endospermum moluccanurn Becc.Euphorbia polychroma A. Kern.Koilodepas batamense Hassk.Micrandra minor Benth.Neoscortechinia kingii Pax & K. Hoffm.Omalanthus populneus KuntzeOstodes paniculata BlurneEuptelea polyandra Siebold et Zucc.Albizia sp.
Accession number
AJ225789X87385L13168L01907L12613V17038L28947AF206754AF206765L01944AF022131AJ403015/AJ403035AJ402927AJ402948AJ402949L47969L12617LOl949L13183AJ402976Ll1183AJ402992L01917AJ402928AJ402946AJ402950L13183AJ402965AJ402974AJ402977AJ402978AJ402979Ll2645Z70149
Citation (voucher)
Thulin et al. 1998Gustafsson et al. 1996
Chase et al. 1993
Al bert et al. 1992
Kron & Chase 1993Soltis et al. 1995
Martin & Dowd unpubl.Soltis et al. in pressSoltis et at. in pressChase et at. 1993
Alverson et at. 1998this paper (Lewis 2657 K)this paper (Drummond 7782 K)this paper (Liden s.n. GB)this paper (Chase 2161 K)Hibsch:Jetter et at. 1997
Kron & Chase 1993Albert et at. 1992
Chase et al. 1993
this paper (Chase 1128 K)Morgan & Soltis 1993Xiang & Soltis 1998Albert et al. 1992
this paper (MeGill & Sunde1l5459 K)this paper (Wallen & Moore3815 NY)this paper (Chase 1258 K)Chase et al. 1993
this paper (Chase 1263 K)this paper (Rimarhi 8731 NY)this paper (Chase 1265 K)this paper (Chase 1266 K)this paper (Chase 1267 K)Chase et at. 1993
Kiss unpubl,
NI~00
~~COc:f=~..,Z<or(,)l(,)l
""'NI'-'
Fabaceae
Fobaceae
FabaceaeFabaceaeFabaceae
Fabaceae
FabaceaeFabaceaeFagaceaeFagacear
FagaceaeFagareae
FouquieriareaeFrankeniturar
Garryaceae
Geissoloma taceae
Gelsrmiareae
Gentumacrae
Centianaceae
Crntiannceae
Gentian aceaeCentianaceae
Geraniaceae
GeraniaceaeCeraniaceaeGeraruaceaeGeraninceaeGesneriaceaeGoodeniaceaeCoupiaceaeGrossulariareaeGrubbiareaeGu nnerareal'GyrostemonaceaeHalophstarrae
Haloragacear
Bauhinia candicans Benth.Cercis eanadensis L.
Chamoecrista [asciculata Greenel'Ymnodadus dioica C. KochMedicago satioa L.
Parkia roxburghii G. DonPisum satioum L.Xanthoterris zambesiaca (Baker) Dumaz-le-GrandChrysolepis semperuirens (KeIlogg) Hjelmq.Fagus syluaticus L.
Quercus rubramenta Trel.Trigonobalanus oertiallata FormanIdria colu mnaria Ke lloggFrankenia puluerulenta 1..Garrva elliptira DouglasGeissoloma marginata (L.) A.Juss.Gelsemiu.m srmperoiuens (L.) Pers.Anthodeista grandiflora GilgExacum affine Balf. f. ex RegelFagraea sp.Centiana procera HolmGentianella rapunculoules (Willd. ex Schult.)
J. S. PringleGeranium cinereum Cav.Hypseoeharis sp.Monsonia emarginata (L.) L' Her.Pelargonium cotvledonis L' Her.Wendtia gracilis MeyenStreptocarpus holstii Engl.Scaeoola aemula R. Br.Goupia glabra Aubl.Ribes aureum PurshGrubbia tomentosa (Thunb.) HarmsGunnera manicata LindenGyrostemon sp.Halophytum ameghinoi Speg.Haloragis serra Brongn.
Z7016lU74188U74187U74193Z70173Z70152X03853U74189AF06199SLl3340AF132888
AJ235812Z80210Z97638L01919AJ4029S3/AJ403022Ll4397Ll4389Ll1684Ll4396Ll4398Yl1862
Ll4695Ll4699Ll4701L01919Ll4708Ll4409Ll3932AJ235780Ll1204Z83141Lll186L22439AJ402958/Af403024U26325
Kiss unpubl.Doyle et al. 1997Doyle et al. 1997Doyle et al. 1997Kiss & Wink 1995Kiss unpubl.Zurawski et al. 1986Doyle PI al. 1997Chase et al. 1993Marlin & Dowd 1993Soltis et al. in pressChase et al. 1993Morton et at. 1997cFay et al. 1997aMorgan & Soltis 1993this paper (Savolainen gmal C)
Olmstead et at. 199301mstead et al. 1993Olmstead et al. 1992Olmstead et al. 1993Olmstead et al. 1993Brerner & Thulin 1998
Price & Palmer 1993Price & Palrner 1993Price & Palmer 1993Alber t et at. 1992Price & Palmer 1993Olmstead et al. 1993Michaels et al. 1993Savolainen et at. in pressMorgan & Soltis 1993Morton et al. 1997bMorgan & Soltis 1993Rodman et at. 1994this paper (Chase 1753 K)Conti et al. 1996
IT'c:::t;;l
CSo...,.."::c:r:oC)IT'Z~
o::J;l.-
'"tr'Cl
o7.
GlClr-
'"tT'ltoc:::tT'lZCltT'l
'"
~'-D'-D
Family Species Accession number Citation (voucher) (J:)00
Haloragarear Myriaphyllum exalbescens Fernald Ll1l95 Morgan & Soltis 1993Hamamelidaceae Corylopsis paueiflora Siebold & Zucc. AF094548 Hoot et at. 1999
Homamelidaceae Disanthus ceradifolia Maxim. AF094549 Hoot et al. 1999
Hamamelidaeeae Exbucklandia populnea (R. Br. ex Griff.) R. W. Br. AF060708 Qiu et al. 1998
H amameliducear Hamamelis mollis Oliv. LOl922 Albert et al. 1992
Hamamelidaceae Trichocladus erinitis Pers. AF060711 Qiu et al. 199RHelioingiareae Helunngic japonica (Thunb.) F. Dietr. Ll1226 Xiang et al. 1993
Huaceae Afrostyrax sp. AJ235771 Savolainen et al. in pressHuacene Hua gabonii Pierre ex De Wild. AJ402960 this paper (Wieringa 3177 WAG)Humiriareae Humiria balsaminifera Aubl. L01926 Albert et at. 1992
Humiriaceae Vantanea guimumsis Aubl. Z75679 Fay 1'1 al. 1997bHydrangeareae Hydrangea macrophslla Torr, Ll1l87 Morgan & Soltis 1993Hydrangeaeeae Philadelphus lewisii Pursh Lll198 Morgan & Soltis 1993Hsdroleaceae Hydrolea ouata Nutt. Ll4293 Olmstead et al. 1993
Hydrostaehyaeeae Hydrostaehys muitifida A. Juss. Ul7879 Hempei et al. 1995
Icacin aceae Chlamydoeharya thomsoniana Baill. AJ402939 this paper (Chatdain s.n. G, IIRSDA forest coll.7.97)
Icaeinaceae Icacina mannii Oliv. AF206780 Soltis et at. in presslcacinaceue lodes liberica Stapf AJ402962/AJ403025 this paper (Chatelain s.n. G, lIRSDA forest coil.
7.97)Icaanaceae Pyrenacantha maluaefolia Engl. AJ402995 this paper i Chase 6R3 K)lcacinaceae Sarcostigma kleinii Wight & Arn. AJ402999 this paper (Chase 1296 K)Iroingiaceae Iruingia malayana Oliv. AFI23278 Soltis et al. in pressltraceae Choristslis rhamnoides Harv. AJ238132 this paper (Bremer3763 UPS) ~Iteaceae Itea uirginita L. Lll188 Soltis et al. 1990 ~
Ixerbaceae Ixerba brexioides A. Cunn. AF084475 Koontz & Soltis 1999 D:lC
Ixonanthaceae Ochthocosmus sp. Z75680 Fay et al. 1997b r-r-
[uglandaceae Carya glabra (Mill.) Sweet Ll2637 Chase et al. 1993 ITl...,Juglandaceae Juglans nigra L. U00437 Gunter et al. 1994 ZKigellariaceae Kiggelaria africana L. AF206786 Soltis et al. in press <
0Kiggelariaceae Guthriea capensis Bolus AJ402956 this paper (Abbott 6071 BOL) rKiggeleriaeme Ervthrospermum phylolaccoides Gardner AJ402951 this paper i Chase 1277 K) <:.T<
Kiggeleriaceae Flacourtia jangomas Steud. AF206768 Soltis et al. in press <:.T<~
Kiggelenaceae Gynocardia udorata R. Br, AJ402957 this paper (Chase 1276 K) Nl-
Kiggeleriaeeae
Kiggeleriaeeae
KoeberliniaceaeKrameriaceaeLacistemataceaeLamiaceaeLardiutbalareae
Lardiutbalaceae
Lecythidaceae
LecythidaceaeLecythidaceae
LecythidaceaeLentibulariareae
LepidobotryaceaeLetndobotrvareae
l.imnanthareae
l.inaceoe
Linaceae
Linaceae
Linnaeaceae
LissocarpaceaeLoasaceaeLoasaceae
Loganiaceae
Loganiaceae
Loganiareae
Loganiaceae
Loganiaceae
Lophopyxidaceae
Loranthaceae
Lythrareae
Lythraceae
LythraceaeMalesherlnaceaeMalpighiaeeae
Malpighiaceae
MalpighiamU'
Trichadenia zeylanica ThwaitesUnknown speciesKoeberlinia spinsoa Zucc.Krameria lanceolata Torr.Lacistema aggregatum RushyLauandula angustifolia BuhaniDecaisnea [argesii Franch.Sargentodoxa cuneata Rehder & E. H. WilsonAstrranthos brasiliensis Desf.Couroupita guianensis Auhl.Esrhioeilera odora MiersOubanguia alata Baker f.Utrirulana biflora Roxb.Lepidabatrys stnudtii Engl.Ruptiliocarpon caracolito Hammel & N. ZamoraLimnanthes douglnuii R. Br,Hugonia jJlatysepala Welw. ex Oliv.Unum perenne Guss.Reinuiardtia indica Dumort.Abelia sp.Lissocarpn benthamii Bail!.Eucnide lobata A. GraySchismocarpus matudai Steyerm.Geniostoma rupestreJ. R. Forst. & G. Forst,Mostuea brunonis Didr,Neuburgia corynocarpa (A. Gray) Leenh.Spigelia marilandica L.Strychnos nux-vomica L.Lophopyxis maingayi Hook. f.Gaiadendron punrtatum G. DonLythrum hsssopifolia L.Punica protopunica Balf.Trapn natans L.Maleshrrbia lineanfolia Poir,Barnebya dispar (Griseh.) W. R. Anderson & B. GatesBvrsonima rrnssifolia Hurnb., Bonpl. & Kunth.Durlla nurifrca Chodat
AJ403011AF206783Ll4600Yl5032AF206787Z374071.37907AF093731Z8019RZR0181Ztl01R2ZR0201L13190AJ402966AJ402997Ll4700Z7567RZ75681Ll318RAF206727AJ402968U17R74Ul7878Z6882RLl4404AJ001755Ll4410Ll 44 10AJ402970/AJ4030261.26072Ll0218Ll0223Ll0226Z756R3AJ402924/AJ4030201.01892AJ235802
this paper (Chase 1289 K)Soltis et al. in pressRodrnan et al. 1993Chase et al. 1993Sol tis et al. in pressKaufmann & Wink 1994Hoot et al. 1995Hoot et al. 1999Morton et al. 1997hMorton et al. 1997hMorton et al. 1997hMorton et al. 1997hAlbert et al. 1992this paper (Louis lOR37 K)this paper (Pennington & Zamora 631 K)Rodman et al. 1993Fay et al. 1997hFay et al. 1997bChase et al. 1993Soltis et al. in pressthis paper (Maguire et al. 29964 NY)Hempel et al. 1995Hempel et al. 1995Endress et al. 1996Olrnstead et al. 1993Oxelman unpub!.01mstead et al. 1993Olmstead et al. 1993this paper (Adelbai P10203 US)Nickrent & Soltis 1995Conti et al. 1993Conti et al. 1993Conti et al. 1993Fay et al. 1997bthis paper (Lruni 1473 MICH)Albert et al. 1992Chase et al. 1993
I"T'c:s::o~-e:r:r;oI;")I"T'Z--:tl:l;>[J)
I"T'Cl
oZ;;0tl:lnr[J)
I"T'tor:I"T'
~~[J)
""o......
Family Species Accession number Citation (voucher) <.>:>0Nl
Maloaceae Fremontodendron mexicanum Davidson AF022124 Alverson et at. 1998Malvaceae G05sypium robinsoni F. Muell. Ll3186 Chase et at. 1993Malvaceae Quararibea gomeziana W. S. Alverson AF022121 Alverson et al. 1998Malvaceae Sterculia tragacantha Lindl. AF022126 Bayer et at. 1999Marcgraviaceae Marcgravia rectiflora Triana & Planch. Z83148 Morton et at. 1997bMarcgraviaceae Norantea guianemis Aubl. Z80200 Morton et al. 1997bMartyniaceae Proboscidea louisianica Thell. L01946 Albert et at. 1992Melastomataceae Osbeckia stellata Wall. U26330 Comi et at. 1996Meliaceae Azadirachta indica A. Juss. AJ4029 I 7 this paper (Chase 1307 K)Meliaceae Capuronianthus mahafalensis Leroy AJ402935 this paper tFosberg52439 K)Meliaceae Cedrela odorata Cham. & Schhdl. AJ402938 this paper (Chase 2112 K)Meliaceae Ekebergia eapensis Sparrm. AJ402947 this paper (Chase 5807 K)Meliaceae Guarea glabra Vahl U39085 Gadek et al. 1996Meliaceae Heckeldora staudtii (Harms) Staner AJ402959 this paper (Chase 3311 K)Meliaceae Khaya anthotheca DC. AJ402964 this paper (Chase 2859 K)Meliaceae Vavaeae amicorum Benth. AJ403016/AJ403036 this paper (Katik et at. 74722 K)Meliacpae Walmra tubulata Hiern AJ403017 this paper (Chase 1314 K)Melianthaceae Bersama lucens Szyszyl. AJ235774 Savolainen et at. in pressMelianthaceae Francoa sonchifolia Cav. Ll1l84 Soltis et at. 1990Melianthaceae Greyia radlkoferi Szyszyl. Ll1l85 Morgan & Soltis 1993Melianthaceae Melianthus major L. AJ402972/AJ403027 Gadek et al. 1996Memecyclaceae Mouriri cyphocarpa StandI. U26327 Conti et at. 1996Menispermaceae Menispermum canadensis L. AF093726 Hoot et at. 1999Menyanthaceae Menyanthes trifoliata L. Ll4006 Olmstead et at. 1993 ~Misodendraceae Misodendron brachystachyum DC. L26074 Nickrent & Soltis 1995 :::E
t:l:IMolluginaceae Mollugo oertiallata L. M62566 Rettig et al. 1992 CMontiniaceae Kaliphora madagascariensis Hook. f. AJ402963 Xiang & Soltis 1998 C
trlMontiniaceae Montinia caryophsllacea Thunb. Ll1l94 Morgan & Soltis 1993 ..,Moraeeae Ficus trigonata L. AF206767 Chase et at. 1993 ZMorinaceae Morina coulteriana Royle Yl0706 Backlund & Brerner 1998 <
0Moringaeeae Moringa oleifera Lam. Ll1359 Rodman et al. 1993 rMuntingiaceae Dicraspidia donnell-smithii StandI. Yl5145 Fay et al. 1998a u-<
u-<Muntingiaceae Muntingia calabura L. Yl5146 Fay et al. 1998a ----..
NlMyoporaceae Myoporum mauritanum DC. L36403 Olrnstead & Reeves 1995 ~
MyricaceaeMyrothamnaceaeM~rsinaceae
Mvrsinaceae
M~rtaceae
MyrtaceaeNelumbonaceaeNepenthaceae
Neuradaceae
NeuradaceaeNothojagaceae
NyctaginaceaeNyctaginaceaeOchnaceaeOchnaceae
DchruueaeOchnacearOlacaceaeOlacaceae
Oleaceae
OliniaceaeOnagraceae
OnagraceaeoncothecaceaeOpiliaceae
OxalidaceaeOxalidaceae
PaeoniaceaePaeoniaceaePaeoniaceae
PandaceaePapaueraceaePapaveraceae
PapaveraceaeParacryphiaceaeParnassiacear
Parnnssiaceae
M~rica cerifera L.Mvrothamnus flabellifoiius Welw.Ardisia crenata Sirns.Maesa myrsinoides Lev,Heteropyxis natalensis Harv.Metrosideros neruulosa C. Moore & F. Muell.Nelumbo lutea Pers.Nepenthes alata B1ancoGrielum humijusum Thunb.Neurada procumbens L.Nothojagus dombeyi (Mirb.) Oerst.Bougainvillea glalJra ChoisyMirabilis jalapa L.Luxemburgia ciliosa (Mart.) Tiegh.Medusagyne oppositifolia BakerOchna serratula Walp.Quiina pteridophylla (Radlk.) PiresHeisteria parvijolia Srn.Schoepfia schreberiJ. F. Grnel.Jasminum suavissimum Lindl.Olinia cymosa Thunb.Clarkia xantiana A. GrayEpilobium angustijolium L.Oncotheca balansae Baill.Opilia amentacea Roxb.Averrhoa carambola L.Oxalis dilleniiJacq.Paeonia humilis WiIld.Paeonia sujfruticosa AndrewsPaeonia tenuifolia L.Microdesmis puberula Hook. f.Argemone mexicana L.Dicentra spectabilis (L.) Lern.Pteridophyllum racemosum Siebold & Zucc.Paracryphia alticola (Schltr.) SteenisLepuropetalon spathulatum (Muhl.) ElliottPatnassia fimbriate Banks
L01934AF060707Ll2599Z80203U26326AJ402973/AJ403028M77032L01935
AJ402955/AJ403023U06814Ll3350M88340M62565Z75685Z75670Z75273Z75689AJ131771Ll1205L01929U26329Ll0896Ll0217
AJ131950AJ131773Ll4692L01938
AJ402981/AJ403031AJ402982Ll3687AJ402975/AJ403029U86621L08761U86631
AJ402983Ll1l92L01939
Albert et al. 1992Qiu et at. 1998Kron & Chase 1993Morton et al. 1997cSoltis et al. in pressConti et at. 1996
Les et al. 1991Albert et al. 1992this paper (Chase 5711 K)Morgan et at. 1993Qiu et al. 1998
Rettig et al. 1992Rettig et at. 1992Fay et al. 1997bFay et at. 1997bChase et at. 1993
Fay et al. 1997bthis paper (Savolainen hpa C)
Chase et al. 1993
Albert et at. 1992Conti et at. 1996
Olrnstead et al. 1992
Conti et al. 1993Savolainen et at. in pressSavolainen et al. in pressPrice & Palrner 1993Albert et al. 1992
this paper (Chase 504 K)this paper (Chase 486 K)Chase et al. 1993
this paper (Chase 5986 K)Hoot et al. 1997
Chase et al. 1993Hoot et al. 1997
this paper (Chase 9604 K)Morgan & Soltis 1993Soltis et al. 1990
t"1CClno....,"'0:r:....r-'oClt"1Z-<0;;...[J1
t"1Cl
oZ:;<:l0;nr[J1
t'"s:ct"1Znt'"[J1
(.>0o(.>0
Family
Passifloraceae
PassifloraceaePassifloraceaePauloumiareaePedaliacenr
PeganaceaePeganaceaePeganarrae
PegaruurnrPelliceriareaePenaeaceae
PentadiplandmceaePentaphragmatareae
PentaphslacareaePenthoraceaePendiscaceae
Petiueriaceae
Phellinaceae
Phrsmacen«
PhsllanthaceaePhyllonomaeeae
Physenaceae
Phstolaccaceae
Phstolaccaceae
PhstolaccaceaePieram niaceaePicramniaceaePittosporaeeae
Platanaeeae
PlocospermataceaePlumbaginaeeae
PlumbaginaceaePlumbaginaceaePodostemaceae
Species
Adenia digztata Engl.Paropsia madagascariensis (Baill.) H. PerrierPassiflora quadrangalis L.Paulownia tomentosa (Thunb.) Steud.Sesamum indicum L.Malacocarpus crithmifolrus Fisch. & C. A. Mey.Nitrruia retusa Asch.Peganum harmala L.Tetradic/is tenella (Ehrenb.) Lirv,Prllirieria rhizophora Planch. & TrianaPenaea mucronata L.Pentadiplandra brazxeann Baill.Pentaphragma ellipticum PoulsenPentaphylax eurioides Gardner & Champ.Penthorum sedoides L.Whit/on ia guianensis Sandwi thPetiueria alliaceaeL.Phelline comosaLabill.Phryma leptosuuhya L.Phyllanthus liebmannianus Mull. Arg.Phsllonoma laticuspis Eng!.Phssena sp.Errilla uolubilis A. Juss.Phstolacca ameritana L.Stegnosperma halimifolium Benth.Alvaradoa amorphoides Liebm.Picramnia polyantha Planch.Piuosporum japonirum Hort. ex C. PreslPlatanus occidentalis L.Plocosperma buxifolium Benth.Aegialitis annulata R. Br.Limon iu m dendroidrs Svent.Plumbago aurirulata BlumeMarathrum oxyrarpum Tul.
Accession number
Z75687AF206802L01940L36447L14408U39280U39278U38279AJ40:~009
AF206804U26331U38533Ll8794AJ402986Ll1197AJ403018AJ402987X69748L28881Z75676Ll1201Yl3116AJ235800M62567M62570AF123277AF127025Ll1202L01943Z68829AJ402918Z97644M77701AJ402971
Citation (voucher)
Fay et al. 1997bSoltis et al. in pressAlbert et al. 1992Olmstead & Reeves 1995Olmstead et al. 1993
Gadek et al. 1996Gadek et al. 1996
Gadek et al. 1996this paper (F A. Barkle» 7848 K)Morton et al. 1997bConti et al. 1996Rodman et al. 1996
Cosner et al. 1994this paper (Hu 11401 K)Morgan & Soltis 1993this paper (Whit/on 84 NY)
this paper (Whit/en 1743 FI AS)Savolainen et al. in pressWagstaff & Olmstead unpubl.Fay et al. 1997bMorgan & Soltis 1993Morton et al.1997aSavolainen et al. in pressRe ttig et al. 1992
Rettig et al. 1992Fernando et al. 1993
Fernando et al. 1993
Morgan & Soltis 1993Albert et al. 1992
Endress et al. 1996this paper iLngrouille M1l96002, no voucher)Fay et al. 1997aGiannasi et al. 1992this paper (Amaral s.n. UEC)
~o~
f:i~::;;c::rf;;-IZ<:o~
u-<u-<
,.-...l"\:)~
PodostemaceaePolemoniaceae
Polemoniaceae
Polsgalaceae
PolygalaceaePolygalaceae
Polygalaceae
Polygonaceae
PolsgonaceaePortulacaceae
Primulaceae
Proteareae
Proteaceae
Proteareae
Pseudanthaceae
Pseudanthaceae
Pseudanthaceae
Psiloxylaceae
Pterostemonaceae
Putranjiuaceae
PutmnJivaceae
QuillaJaeene
Ranunculaceae
Ranunculaceae
ResedaceaeRhabdodendraceae
Rhamnaceae
Rhamnaceae
RhizophoraceaeRhizophoraceae
Rhizophoraceae
RhizophoraceaeRhoipteleareaeRoridulareaeRosaceae
Rosaceae
Rosaceae
Tristicha trifaria (Bory ex Willd.) Spreng.Cobaea scandens Cav.Phlox longifolia Nutt.Comesperma ericinum DC.Polygala cruciata L.Seruridaca diuersifolia (L.) S. F. BlakeXanthophyllum sp.Polygonum sachalinense F. SchmidtRheum x cultorum Thorsrud & ReisaeterPortulaca grandiflora Hook.Anagallis aruensis L.Isopogon latifolius R. Br.Lambertia inrrmis R. Br.Protea repens AndrewsAndrostachys johnsonii PrainHyaenanche globosa Lamb.Suuhsstemon axillare A. S. GeorgePsiloxylon mauritianum. Baill.Ptrrostemon rotundifolium RamirezDrypetes macrostigma J.J. Srn.Putranjiua roxburghii (Wall.) Hurus.QuillaJa saponaria Poir.Coptis tnfolia Salisb.Glaucidium palmatum Siebold & Zucc.Reseda alba L.Rhabdodendron amazonicum HuberRhamnus cathartica L.Zizyphus glabrata Heyne ex. RothCarallia brachiate Merr.Cassipourea rotundifolia AlstonKandelia carulel DruceRhizophora mangle L.Rhoiptelea chiliantho Diels & Hand.-Mazz.Roridula gorgonias Planch.Dryas drummondi RichardsonRosa woodsii Lindl.Spirra uanhouttei Zabel
U68089Z83143AF156732L29492L01945L01955AJ235799AJ235789M77702M62568M88343U79179L11l90U79182AJ402922AJ40296IAJ403006U26333L11203AJ402945M95757U06822AF093730AF093723M95756Z97649L13189U60313AF006757AF006762AF006755U26335AF0l76871.01950U59818U06824L11206
Les et al. 1997Morton et at. 1997bAlbach unpubl,Fernando et al. 1993Albert et at. 1992Olmstead et al. 1992Savolainen et at. in pressL1ed6 et at. 1998Chase et al. 1993Rettig et al. 1992Chase et at. 1993Plunkett et al. unpubl.Morgan & Soltis 1993Plunkett et at. unpubl,this paper (Chase 1904 K)this paper (Chase 1445 K)
this paper (Chase 2165 K)
Conti et at. 1996Morgan & Soltis 1993this paper (Chase 1259 K)
Rodman et al. 1993Morgan et al. 1994Hoot et al. 1999Hoot & Crane 1995Rodman et at. 1993Fay et al. 1997aChase et al. 1993Thulin et al. 1998Soltis et at. in pressSetoguchi et al. unpubl.Setoguchi et at. unpubl.Conti et at. 1996Chen et al. 1998Albert et al. 1992Swensen 1996Morgan et al. 1994Morgan & Soltis 1993
t"'"lCClno-l
'"::r:r::oC"lt"'"lZ-<~Ult"'"lCl
oZ;<l0:>
PUlt"'"lf:)r.t"'"lZ()t"'"lUl
e"oo~
Family
RousseaceaeRubiaeeae
Rubiaceae
Rubiaceae
RubuueaeRubiaceae
Rutaceae
Rutareae
RutaceaeRutaceae
RutaceaeRutaceaeRutaeeae
Rutaeeae
Rutaceae
SabiaceaeSabiaceaeSalicaceaeSalieaeeae
Salicaceae
SalicaceaeSalicaceae
Salicaceae
Salieaeeae
Salieaeeae
Saluadoraceae
Santalaceae
Santalaceae
Santalaceae
Sapindaceae
Sapindaceae
Sapindacear
Sapindaeeae
Sapindaceae
Species
Roussea simplex Sm.Cephalanthus occidentalis L.Cinchona pubescens VahlDialypetalanthus fusceseellS Kuhlm.Galium album GarsaultGardenia thunbergia L.Bottegoa insignis Chiov.Chloroxylon stoietenia DC.Cneorum puluerulentum Vent.Dietyoluma uandellianum A. Juss.Flindersia australis R. Br.Poncirus trifoliata Raf.Ptaeroxylon obliquum Radlk.Ruta graveolens L.Spathelia excelsa (K. Krause) R. S. Cowan & BrizickyMeliosma simplicifolia Walp.Sabia sioinhoei Hernsl. ex F. B. Forbes & Hernsl.Banara guianensis Aub!.Bembicia sp.Casearia sylvestris Sw.Dovyalis rhamnoides Burch, ex Harv, & Sond.Poliothyrsis sinensis Oliv.Populus euphratira OlivierSalix teticulata L.Scyphostegia borneensis StapfSalvadora persira L.Osyris lanceolate Hochst. & Steud.Santalum album L.Viscu1Tl album. L.Acer saccharum L.Aeseulus pavia Castig!.Billia hippoeastanum Peyr,Diatenopteryx sorlnlofia Radlk.Diplopeltis huegelii End!.
Accession number
AJ235792X83629X83630AJ251366X81090X83637AJ402931AF066802AF066828AF066823U38861AJ235806AF123276U39281AF066798AF19587Ll2662AJ402923AJ402926/AJ403021AF206746Z75677AJ402991AJ402993AJ235793AJ403000X69755Ll1l96L26077L26078L01881U39277AJ402929AJ402943AJ402944
Citation (voucher)
Savolainen et al. in pressBremer et al. 1995Brerner et al. 1995Fay et al. in pressManen & Natali 1995Brerner et al. 1995this paper (Chiovi et at. 4824 K)Chase et al. 1999Gadek et al. 1996Chase et al. 1993Gadek et al. 1996Chase et al. 1993Gadek et al. 1996Gadek et al. 1996Chase et al. 1993Qiu et al. 1998Chase et al. 1993this paper (Pennington & Zamora 593 K)this paper (Civeyrel 1374 K)Soltis et af. in pressFay et al. 1997bthis paper (Wurdack s.n. K)this paper (M. D. Lled6 & M. B. Crespo 368 ABH)Savolainen et al. in pressthis paper (Davis s.n. BR)Savolainen et al. 1994Morgan & Soltis 1993Nickrent & Soltis 1995Nickrent & Soltis 1995Chase et al. 1993Gadek et al. 1996this paper (Pennington & Zamora 604 K)this paper (Tressens et al. 3504 K)this paper (Chase 2192 K)
C.>OoOl
~::EO:lCr'r'~....,z<oru-<u-<-N:I-
Sapindaceae
Sapindaceae
Sapindaceae
Sapindaceae
Sapindaceae
Sapindacene
SopindaceaeSapotaceae
Sarcolaenaeaceae
Sarraceniaceae
Saxifragaceae
Saxifragaceae
Saxifragaceae
Schlegrliaceae
Srropliulariareae
Scrophulariaceae
Scrophulariaceae
Scrophulariaceae
Scrophulariaceae
Scrophulariacrae
Setchellanthacear
Simaroubaceae
Simaroubaceae
Simaroubaceae
Simmondsiaceae
Sladeniaceae
Solanaceae
Solanaceae
Solanaceae
Solanaceae
Solanaceae
Solanaceae
Spaerosepalacear
Sphaerosepalaceae
Sphenocleaceae
Sphenostrmonarrae
Stachyurarear
Dipteronia sinensis Oliv.Koelreuteria paniculata Laxrn.Paranephelium macrophyllum KingSerjania communis Cambess.Talisia nervosa Radlk.Ungnadia speciosa End!.Xanthoceras sorbifolia BungeManilkara zapota RoyenSarcolaena sp.Sarracenia flava L.Astilbe taouetii Koidz.Heuchrra micrantha DouglasSaxifraga integrifolia Hook.Schlegelia paroiflora (Oerst.) Monach.Antirrhinum majus L.Calceolaria sp.Mimulus aurnntiarus RenjifoPediculans foliosa GunnerusScrophularia sp.Veronica catenata PennellSetchellanthus caeruleus BrandegeeAilanthus altissirna L.Harnsonia perforata (Blanco) Men.Kirkia unlmsii Eng!.Simmondsia chinensis C. K Schneid.Sladenia celastrifolia KurzDuckeodendron celastroides Kuhlm.Goetzia elegans WydlerMetternichia princeps Miers.Nicotiana tabacum L.Schizanthus pinnatus Ruiz. & Pav.Schwenckia lateriflora (Vahl) CarvalhoRhopalocarpus sp.Dialyceras paruifolium CapuronSphenoclea zeylanica Gaertn.Sphenostemon lobosporus (F. Muel!.) L. S. Sm.Stachyurus praecox Siebold & Zucc.
U39268U39283AJ402984/AJ403032AJ40300lAJ403008AJ403014AJ4030191.01932Yl51471.0l952Ll1l73Ll1l731.019531.36448Ll1688AF123669AF026835AF0268361.364491.36453U41455Ll2566U38863U38857AF093732AJ403004Yl4760AF035738AF022182Z00044U08619AF035739Yl5148AJ402942Ll8798AJ403005AJ235794
Gadek et al. 1996Gadek et at. 1996this paper (Chase 1356 K)this paper (Chase 2138 K)this paper (Pennington 628 K)this paper t Chase 2854 K)this paper (Chase 2866 K)
Albert et al. 1992Fay et al. 1998aAlbert et al. 1992Soltis et al. 1990Soltis et al. 1990Morgan & Soltis 199301mstead & Reeves 1995Olmstead et al. 1992Olmstead et al. unpuh!.Wolfe & dePamphilis 1998Wolfe & dePamphilis 1998Olmstead & Reeves 1995Olmstead & Reeves 1995Rodman et al. 1993Chase et al. 1993Gadek et al. 1996Gadek et al. 1996Fay et at. 1997athis paper (Borsch s.n. BONN)Fay et al. 1998bFay et al. 1998bFay et al. 1998bLin et al. 1986Fay et at. 1998bFay et al. 1998bFay et al. 1998athis paper (Srhatz s.n. MO)Cosner et al. 1994this paper (Jensen 280 QRS)Savolainen et al. in press
t'"Ct:ino....,-e::r:r::oot'"Z.-:O:l>(J;
t'"t:i
oZ:;>:lO:lor(J;
t'"
~t'"Z,..,~(J;
(..>0o-J
Family Species Accession number Citation (voucher) (,J!)
000
Staphyleaceae Staphslea trifoliata Marshall AJ238406 Gadek et al. 1996
Staphyleaceae Turpinia paniculata Vent. AJ403013/AJ403034 this paper (Axelrod 4236 UPR)Strasburgenareae Strasburgena robusta (Vieill. ex Pancher & Sebert) AJ403007 this paper (Bemardi 9444 K)
GuillauminStylidiareae Stslidium graminifolium Sw. ex Willd. L18790 Cosner et al. unpubl.Sryramceae Halesia carolina 1.. Z80190 Morton et al. 1997aSlyracaceae Styrax americana Lam. L12623 Kron & Chase 1993Surianaceae Cadellia pentastylis F. Muell. 1.29491 Fernando et al. 1993
Surianaceae Guilfoylia monostylis F. Muell. 1.29494 Fernando et al. 1993
Surianaceae Stylobasium spathulatum Desf. U06828 Soltis et al. 1993
Sutiunnceae Suriana maritima 1.. U07680 Fernando et al. 1993
Symplocareae Symplocus costata Cboisy Ll2624 Kron & Chase 1993Tamaricaceae Tamanx pentandra Hampe ex Bunge Z97650 Fay et al. 1997aTapisaaceae Tapiscia sinensis 0liv. AF206825 Soltis et at. in pressTernsttoemiaceae Eurya japonica Thunb. Z80207 Morton et al. 1997bTernstroemiaceae Ternstroemia stahlii Krug & Urb. Z80211 Morton et al. 1997bTetracarpaeaceae Tetracarpaea tasmanica Hook. f. Ll1207 Morgan & Soltis 1993Tetrachondraceae Tetrachondra hamiltonii Petrie U28885 Wagstaff & Olmstead unpubl.Tetrameristaceae Tetramensta sp. Z80199 Morton et al. 1997cTheaceae Camellia japonica L. Ll2602 Kron & Chase 1993Theaceae Srhima superba Gardner & Champ. Z80208 Morton et al. 1997bTheophrastaceae Clavija eggersiana Mez Ll260H Kron & Chase 1993Thsmalaeaceae Dirca palustris L. U26322 Conti et at. 1996
Thsmelaeaceae Aquilaria beccariana Tiegh. Yl5149 Fay et al. 1998a g;Thsmelaeaceae Gonsstylus macrophsllus (Miq.) Airy Shaw Yl5150 Fay et al. 1998a ~
Thsmelaeaceae Lethedon setosa (C. T. White) Kosterm. AJ402967 this paper (Heyland 7741 K)o;lc:
Thsmelaeaceae Phaleria chermsideana (F. M. Bailey) C. T. White J\J402988 this paper (Chase 1383 K) t"""t"""
Thvmelaeaceae Ploiarium sp. AJ402990 this paper (Carneron s.n. NCU) r<1....,Ticodendraceae Ticodendron incognitum]. Comez-Laur, & 1.. D. Comez AF061197 Qiu et al. 1998 ZTouariaceae Tovaria pendula Ruiz & Pay. M95758 Rodman et al. 1993 <:
0Tribelaceae Tribeles australis Phil. AJ403010 this paper (Gardner & Knees 3879 K) rTrigoniaceae Trigonia nivea Cambess, AF089761 Chase et al. 1993 (.Jl
Trochodendraceae Tetracentron sinensis Oliv. Ll2668 Chase et al. 1993(.Jl~
Trochodendraceae Trochodendron aralioides Siebold & Zucc. L01958 Albert et al. 1992N)........
•
Tropaeolaceae
Turneraceae
Ulmaceae
Ulmaceae
UlmaceaeUnnamed family
Urticaceae
Vahliaceae
Valerianareae
VerbmaceaeVerbenaCfae
Violaceae
Violaceae
Violaceae
Viscacear
Vitaceae
Vitaceae
Vitaceae
Vitaceae
VitaceaeVitaceae
Vivianiaceae
Vochysiaceae
Vochysiaceae
Zygophyllaceae
Zygophyllaceae
Zygophyllaceae
Zygophyllaceae
Zygophyllaceae
Zygophyllaceae
Zygophyllaceae
ZygophyllacPae
Tropaeolum tricolor Lindl.Turnera ulmifolia L.Ampelocera hottlei (Standl.) Standl.Trema micrantha BlumeUlmus parvifoliaJacq.Aphanopetalum resinosum Endl.Boehmeria nivea (L.) Gaudich.Vahlia capmsis Thunb.Valeriana officinalis L.Euthsstachs ahbreoiaia (E. Mey) A. DC.Verbena bonariensis 1"Hymenanthera alpina Oliv.Leonia glycycarpa Ruiz & Pay.Viola sororiaWilld.Phoradendron serotinum (Raf.) M. C. Johnsl.Ampelocissus thyrsifolia Planch.Ampelopsis rTU'galophylla Diels & GilgLeea guinernse G. DonParthenocissus quinquefolia Planch.Vitis aestiualis Michx.Vitis rotundifolia Michx.Viviania marifolia Cav.Euphronia guianensis (R. H. Schomb.) Hallier f.Qualea sp.Balanites maughamii SpragueFagonia indica Burm.Guaiacum sanctum L.Porlieria chilensis GaySisyndite spartea E. Mey. ex Sond. & Harv.Tribulus macropterus Boiss.Viscainoa geniculata (Kellogg) GreeneZygophyllum simplex L.
LI4706Z7569 1D86314U03844D86316
AF062005L1l208LI3934Z29671LI4412Z75692Z75693L11674LI1l99AJ402919AJ402920AJ235783AJ402985L0l960AF1l9174LI4707AF089762U02730Yl5016Yl5018AJ131l770Yl5024Yl5026Yl5028Yl5029Yl5031
Price & Palmer 1993Fay et al. 1997bUeda et al. 1997Chase et al. 1993Ueda et al. 1997this paper (Bradford 845 MO)Qiu et at. 1998Morgan & Soltis 1993Olmstead et at. 1992Bremer et al. 1994Olmstead et al. 1992Fay et al. 1997bFay et al. 1997bOlmstead et al. 1992Morgan & Soltis 1993this paper (Chase 1386 K)this paper (Chase 849 K)Savolainen et al. in pressthis paper (Chase 967 K)AJbert et al. 1992Wang & Lincoln, unpubl.Price & Palmer 1993Lilt & Chase 1999Olmstead et al. 1992Sheahan & Chase 1996Sheahan & Chase 1996Chase et al. 1993Sheahan & Chase 1996Sheahan & Chase 1996Sheahan & Chase 1996Sheahan & Chase 1996Sheahan & Chase 1996
t"'lCeno...,""::r:~oot"'lZ-<~Vlt"'looz
'"0::>
Per:t"'l
~t"'lZ,...,rriVl
(J:)o<.0
top related