phylogenetic characterization of cryptic species of the ...€¦ · phylogenetic characterization...
Post on 08-Apr-2018
226 Views
Preview:
TRANSCRIPT
J. Bio. & Env. Sci. 2014
317 | Efimova et al.
RESEARCH PAPER OPEN ACCESS
Phylogenetic characterization of cryptic species of the marine
dinoflagellate, Ostreopsis sp. Shmidt, 1902, from Russian
coastal waters, the Sea of Japan
Kseniya V. Efimova*, Tatiana Yu. Orlova, Vladimir A. Brykov
A.V. Zhirmunsky Institute of Marine Biology of the Far Eastern Branch of the Russian Academy of
Sciences, Palchevskogo St. 17, Vladivostok, 690041, Russia
Article published on October 21, 2014
Key words: Ostreopsis, rDNA, toxic dinoflagellates, harmful algal bloom, Sea of Japan.
Abstract
Ostreopsis Schmidt, 1902 is a genus of benthic and epiphytic dinoflagellates known to produce palytoxin (PTX)
and its analogues. In 2006, high concentrations (10,970 cells g-1dry weight) of Ostreopsis spp. were found in
waters of Peter the Great Bay, Sea of Japan, near Vladivostok (43˚04ʹ N, 131˚57ʹ E). Since then, high numbers of
Ostreopsis spp. have been observed each year associated with the epiphytic assemblages of the bay. The current
investigation focuses on molecular-genetic analysis and phylogenetic reconstruction of Ostreopsis sp. from
Russian waters based on ribosomal DNA genes (LSU rDNA (D1/D2) and ITS1-5.8S-ITS2 region, SSU rDNA).
Single cells from environmental samples and monoclonal cultures were used to isolate DNA, which was compared
to sequences of Ostreopsis species from the northwestern Pacific, Indo-Pacific, Malaysia, and
Atlantic/Mediterranean regions. Phylogenetic analysis, based on rDNA sequence, revealed three distinctly
different Ostreopsis ribotypes: one similar to a toxic Korean strain, the second analogous to a Japanese strain
from Okinawa (Ostreopsis sp.2), and the third similar to an extremely toxic Japanese strain (Ostreopsis sp.1). The
present study has revealed high genetic homogeneity of SSU rDNA within the Russian strain that allowed us to
reliably estimate distinctions among populations from different regions and homogeneity within population.
*Corresponding Author: Kseniya V. Efimova Xengen88@gmail.com
Journal of Biodiversity and Environmental Sciences (JBES) ISSN: 2220-6663 (Print) 2222-3045 (Online)
Vol. 5, No. 4, p. 317-332, 2014
http://www.innspub.net
J. Bio. & Env. Sci. 2014
318 | Efimova et al.
Introduction
Ostreopsis Schmidt (1902) is a genus of benthic and
epiphytic marine dinoflagellates known to produce
palytoxin (PTX) and its analogues (ovatoxin-
a/b/c/d/e/f, mascarenotoxin-a/c, ostreocin-D),
ostreotoxin-1 and ostreotoxin-3, and ostreol A.
Palytoxin is a very strong non-proteinaceous toxin,
second in toxicity only to botulinum toxin (Yasumoto,
1998; Onuma et al., 1999; Taniyama et al., 2003;
Lenoir et al., 2004; Riobó et al., 2006; Ito and
Yasumoto 2009; Deeds and Schwartz, 2010; Hwang
et al., 2013). This toxin can be bioaccumulated in
organisms at higher levels of the marine food chain
which when ingested, cause human fatalities
(Taniyama et al., 2003; Ciminiello et al., 2006).
Another mechanism of PTX exposure includes
breathing the aerosol from blooms of O. cf. ovata. In
Genova, Italy, in 2005 and 2006, this organism
caused respiratory problems in more than 150 people
who had to be hospitalized (Brescianini et al., 2006;
Durando et al., 2007). Recently, it has been reported
that PTX-like poisoning is rapidly increasing in
Japanese coastal areas (Taniyama et al., 2003, 2008;
Sato et al., 2011).
The genus Ostreopsis is one of the most unique of
Dinophyceae due to plasticity in its morphology,
ecology, and genetics. The taxonomy of genus
Ostreopsis is in dire need of revision (Parsons et al.,
2012). Like some other dinoflagellate genera,
Ostreopsis are roughly divided into the species
complexes O. cf. ovata and O. cf. siamensis, and the
species O. labens and O. lenticularis, based on
ribotyping. However, species of this genus are
considered to be cryptic. Plasticity in the morphology
of many dinoflagellate species, including Ostreopsis,
has made accurate identification difficult, but reliable
molecular markers will allow the establishment of
genotype classification that will facilitate and improve
species identifications. Presently, use of
morphological characteristics of Ostreopsis alone
enables taxonomic characterization only to the genus
level. However, phylogenetic analyses using rDNA
molecular markers could resolve taxonomy to the
species or strain level.
Nuclear ribosomal RNA genes are widely used for
inferring protist phylogeny (Moreira et al., 2007;
Fiore-Donno et al., 2010; Pillet et al., 2011) and for
species identification (Bass et al., 2009; Pawlowski
and Lecroq, 2010). Also, toxicity of dinoflagellates has
been associated with specific ribotypes (Penna et al.,
2005b; Sato et al., 2011). However, Sato et al., (2011)
have reported hypervariability of rDNA genes of the
genus Ostreopsis. The ITS regions are used to provide
clear species demarcations of dinoflagellates: a
genetic distance of p ≥ 0.04 can be used to delimit
species (Litaker et al., 2007; Stern et al., 2012). ITS-
region sequencing is commonly used to analyze
closely related and geographically different species
(Schlötterer, 1998; Coyer et al., 2001; LaJeunesse,
2001; Saito et al., 2002; Shao et al., 2004; Litaker et
al., 2007). However, ITS barcoding is not always
successful, as has been shown with many other
organisms, including dinoflagellates (Dyhrman et al.,
2010; Galluzzi et al., 2010).
In 2006, Ostreopsis spp. were found in high
concentrations (10,970 cells g-1dry weight) in waters
of Peter the Great Bay, Sea of Japan, near Vladivostok
(Selina and Orlova, 2010). This was the first
occurrence of the genus Ostreopsis in Russian marine
waters, which are characterized by extremely cold
temperatures during the winter season. Since then,
Ostreopsis have been documented each year,
associated with epiphytic assemblages in the Peter the
Great Bay. Preliminary studies have shown the
presence of two morphotypes, O. cf. ovata and O. cf.
siamensis, the morphology (Selina and Orlova, 2010)
and ultrastructure (Kreshenovskaya and Orlova, in
press) that have been examined and characterized.
Despite the absence of reported poisoning cases
caused by Ostreopsis blooms in the Russian Far East,
they are a potential threat to human health along the
southeastern coast of Russia, an important cultural
and economic zone with dependence on fisheries.
J. Bio. & Env. Sci. 2014
319 | Efimova et al.
In this study, we performed phylogenetic analyses of
several Ostreopsis spp. strains isolated from Russian
marine waters based on LSU (large subunit) and ITS-
5.8S rDNA. Sequences from new ribotypes from the
Sea of Japan were identified and compared with those
from worldwide isolates. Thus, this study adds
information about new ribotypes of Ostreopsis from
Russian Far Eastern waters.
Materials and methods
Sample collection
Isolates were collected in September – October 2010
or 2012 from the macroalga Neorhodomela larix at
43˚04ʹ N, 131˚57ʹ E in Sobol bight, Ussuriiskiy Bay of
Peter the Great bay, Sea of Japan. Twenty eight
Ostreopsis cells were isolated and cultured in K
medium (Keller et al., 1987) on a 12:12 h light:dark
cycle at 20ºС and ~3500 lx.
Cells collected in 2012 were isolated from seawater by
microscopy using micropipetting and used directly for
DNA extraction. Ostreopsis species used for analysis
of the ITS-region and LSU rDNA are shown in Tables
1 and 2, respectively.
DNA extraction, PCR, and DNA sequencing
Genomic DNA was extracted from frozen pellets of
monoclonal cultures using the CTAB method (Doyle
and Doyle, 1990) with modifications, using powdered
glass instead 0.2% 2-mercaptoethanol. Cells, CTAB,
and powdered glass were triturated with a glass stick.
Furthermore, a rapid, single-cell DNA extraction
method (Ki et al., 2005) was used.
Species-specific PCR were carried out using the
primers Ovata F/Ostreopsis R, Siamensis F/
Ostreopsis R (Penna et al., 2005a) to target the ITS
regions for O. cf. ovata and O. cf. siamensis. Attempts
to amplify samples with species-specific primers were
not successful. Both ITS regions, including the 5.8S
rDNA (ITS-region), were amplified using the primer
pair ITSA and ITSB (Adachi et al., 1996). The PCR
reactions were carried out in a total volume of 12 µl,
containing 0.25 µM of each primer, 200 µM of each
deoxynucleotide triphosphate (dNTP), 1.25 mM
buffer with MgCl2, 5U of Taq polymerase (Fermentas,
USA), sterile deionized water and 0.1 to 2 µl of
template DNA from clonal biomass and single cells,
respectively. The amplification profile of the ITS-
region consisted of an initial denaturation step at
94°C for 3 min, followed by 35 cycles of 30 s at 94°C,
1 min at 54°C, and 90 s at 72°C, with 5 min at 72°C for
the final extension.
Table 1. Samples used for LSU rDNA analysis,
collected from Ussuriiskiy Bay (Peter the Great Bay,
the Sea of Japan, Russia). All samples are Ostreopsis
sp. ORUS (Russian population).
Accession No. Sample ID Collection date KC848711 A1 Sep2010 KC848712 A2 Sep2010 KC848713 A3 Sep2010 KC848714 A4 Sep2010 KC848715 B1 Oct 2012 KC848716 B2 Oct 2012 KC848719 E1 Sep2010 KC848720 E2 Sep2010 KC848721 F1 Oct2010 KC848722 F2 Oct2010 KC848723 F3 Oct2010 KC848724 F4 Oct2010 KC848725 F5 Oct2010 KC848726 H1 Oct2010 KC848727 H2 Oct2010 KC848728 J2 Oct2010 KC848729 J1 Oct2010 KC84873 O1 Oct2010
KC848736 O2 Oct2010 KC848737 P1 Oct2010 KC848738 P2 Oct2010 KC848717 C Oct2012 KC848718 D Oct2012 KC848730 M Oct2010 KC848731 M1 Oct2010 KC848732 M2 Oct2010 KC848733 M3 Oct2010 KC848734 M4 Oct2010
The amplification profile of the LSU rDNA D1/D2
with D2C-DIR and 28S-zoox D1/D2 F- 28S-zoox
D1/D2 R consisted of an initial denaturation step at
94°C for 3 min, followed by 30-35 cycles of 30 s at
94°C, 1 min at 56°C, and 105 s at 72°C, with 5 min at
72°C for the final extension. Amplification of SSU
(small subunit) rDNA was made from three
overlapping fragments using the primer pairs 1F-5R,
3F-18Sbi and 18a2.0-9R, respectively. The cycling
profiles were as follows: 94°C for 3 min, followed by
J. Bio. & Env. Sci. 2014
320 | Efimova et al.
30 cycles of 30 s at 94°C, 90 s at 52°C, and 105 s at
72°C, with 5 min at 72°C for the final extension.
Primers are shown Table 3. The PCR products of LSU
rDNA and ITS-region were cloned into the pTZ57R/T
cloning vector (InsTAcloneTM PCR Cloning Kit,
Fermentas, USA).
Table 2. Samples used for the ITS-region analysis,
collected from Ussuriiskiy Bay (Peter the Great Bay,
the Sea of Japan, Russia). All samples are Ostreopsis
sp. ORUS (Russian population).
Accession No. Sample ID Collection date
KC991348 M2 Oct2010
KC991346 M Oct2012
KC991347 M1 Oct2010
KC991334 A4 Oct2010
KC991331 A1 Oct2010
KC991336 H1 Oct2012
KC991337 H2 Oct2012
KC991333 A3 Oct2010
KC991352 O2 Oct2012
KC991351 O1 Oct2012
KC991335 F Oct2012
KC991332 A2 Oct2010
KC991340 K Oct2012
KC991342 K2 Oct2012
KC991341 K1 Oct2012
KC991345 L3 Oct2010
KC991350 N2 Oct2010
KC991344 L2 Oct2010
KC991349 N1 Oct2010
KC991343 L1 Oct2010
KC991338 H3 Oct2010
KC991339 H4 Oct2010
All clones were sequenced using the universal
sequencing primers M13 with an ABI PRISM 3130 or
3500 Genetic Analyzers (Applied Biosystems, USA)
using the BigDye® Terminator v3.1 Cycle Sequencing
Kit (Applied Biosystems, USA). Sequences were
analyzed using DNA Baser Sequence Assembler v3.x
(2012 - trial), Unipro UGENE: 1.12 (Okonechnikov et
al., 2012). Molecular characterization of the
Ostreopsis genotype was performed via
BLAST/blastn suite (http://blast.ncbi.nlm.nih.gov).
The sequences were deposited in GenBank under the
accession numbers: KC848711-KC848738,
KF359996-KF360004 and KC991331-KC991352.
Alignments of all sequences were carried out
according to the following algorithms: Clustal W,
Clustal V, MUSCLE, MAFFT, Kalign. An optimal
alignment algorithm was found for each of ribosomal
regions. Thus, the ITS-region sequences were aligned
using the multiple sequence alignment program
MAFFT (http://www.biophys.kyoto-u.ac.jp/~katoh/
programs /align/mafft/); SSU sequences, with the
Clustal W program (Thompson et al., 1994); and LSU
D1/D2 with MUSCLE program (http://www.drive5.
com/muscle). The uncorrected genetic distances (p)
were estimated using MEGA 5.05 (Tamura et al.,
2011). The p-distances for ITS-region were compared
with the previously published values for genus and
species levels (Litaker et al., 2007).
Table 3. List of primers used for sequencing.
Primer Sequence (5′-3′) Direction Target region Reference
ITS A CCAAGCTTCTAGATCGTAACAAGGTHTCCGTAGGT
forward ITS1-5.8S-ITS2 Adachi et al., 1994
ITS B CCTGCAGTCGACAKATGCTTAARTTCAGCRG
reverse ITS1-5.8S-ITS2 Adachi et al., 1994
DIR ACCCGCTGAATTTAAGCATA forward LSU rDNA D1/D2 Scholin et al., 1994 D2C GTGTTATTTTGATTTCCTTG reverse LSU rDNA D1/D2 Scholin et al., 1994 28S zoox- D1/D2F
CCTCAGTAATGGCGAATGAACA forward LSU rDNA D1/D2 Loi 1998
28S zoox- D1/D2R
CCTTGGTCCGTGTTTCAAGA reverse LSU rDNA D1/D2 Loi 1998
1F TACCTGGTTGATCCTGCCAGTAG forward SSU rDNA Giribet and Ribera 2000
5R CTTGGCAAATGCTTTCGC reverse SSU rDNA Giribet et al., 1996 3F GTTCGATTCCGGAGAGGG forward SSU rDNA Giribet et al., 1996 18Sbi GAGTCTCGTTCGTTATCGGA reverse SSU rDNA Giribet et al., 1999 18a2.0 ATGGTTGCAAAGCTGAAAC forward SSU rDNA Giribet et al., 1996 9R GATCCTTCCGCAGGTTCACCTAC reverse SSU rDNA Giribet et al., 1996
J. Bio. & Env. Sci. 2014
321 | Efimova et al.
Phylogenetic analyses
All sequences were analyzed together with available
sequences from GenBank using the maximum-
likelihood (ML) method, neighbor-joining (NJ)
(Saitou and Nei, 1987) in MEGA5.05 and Bayesian
(BI) method in MrBayes (v. 3.1.2) (Ronquist and
Huelsenbeck, 2003) for phylogenetic inference.
Models of base substitutions were determined in
Modeltest 3.7 (Posada and Crandall, 1998). According
to the Akaike Information Criterion, the best-fit
model for all rDNA regions was T92+G (Tamura 3-
parameter with discrete Gamma distribution). MCMC
(Markov chain Monte Carlo) searches were run with
four chains for a million generations and sampled
every 100 generations to yield a posterior probability
distribution of 10,000 trees. Coolia monotis VGO783
was used as the outgroup. Bootstrap value analysis
was conducted using the fast stepwise addition option
in PAUP 4.0 b10 (Swofford, 2002) to evaluate the
robust nature of the groupings.
Results and discussion
Comparative analysis of the molecular data
The population of our Ostreopsis spp. was designated
as ORUS. The Ostreopsis genotype was determined
based on the previously described and named species,
clades, or ribotypes (Penna et al., 2005a, 2010; Sato
et al., 2011; Kang et al., 2013).
In total, 73 sequences of LSU rDNA from clonal
cultures and environmental cells, 22 sequences of
ITS1-5.8S rDNA-ITS2 (ITS-region) from clonal
cultures and 7 complete sequences of SSU rDNA were
successfully obtained.
The examined sequences of LSU D1/D2 rDNA were
obtained with two different pairs of primers. In both
cases, the sequences appeared to be polymorphic, but
our dataset based on primers developed by Loi (1998)
was most successful. The sequences of these primers
were more homogeneous and without deletions.
Sato et al. (2011) have noted the heterogeneity of the
LSU rDNA and ITS-region of Ostreopsis species from
different areas along the Japanese Islands.
Interestingly, the most recent report on Ostreopsis
from Jeju Island, South Korea (Kang et al., 2013)
affords no information about their intra-population
or within-strain variability. Yet, the Korean ribotype
is the closest to the Russian ribotypes based on
percent identity. The present study confirmed high
intrapopulation polymorphism of the ITS-region and
LSU rDNA of the Russian population. Therefore,
ORUS together with Korean and some Japanese
strains are firmly separated from the
Atlantic/Mediterranean, Malaysian, Oceanic, Indo-
Pacific and some of northwestern Pacific populations;
this is seen in Fig. 1-2.
Phylogenetic analyses
Bayesian, ML, and NJ analyses produced trees with
similar topologies for LSU datasets. LSU rDNA tree
demonstrates clearly divided clades with well
supported nodes (Fig. 1) The clade B further
differentiates into two subclades: Korean/Russian
(B1) and Ostreopsis sp.2 (Japan)/ORUS (Russian)
(B2). Our data show the existence of at least 2
different versions of the LSU rDNA sequences
(ribotypes) of the Ostreopsis strain from Russian
coastal waters.
Our analyses of the ITS-region performed were
analogous to those performed by Japanese
researchers (Sato et al., 2011). The topologies of all
phylogenetic trees were the same and resolved with
fairly high nodal supports. The ML phylogram with
ML and NJ bootstrap values and Bayesian posterior
probability are presented in Fig. 2. The clade of
Russian Ostreopsis was well clustered from other
species, as was the case for the subclade of O. cf.
ovata (Greece, Portugal, Indonesia, Malaysia, and
Cook Island), the clade C of O. siamensis and the
clades D/E of O. labens with Ostreopsis sp. The clade
A topologies of the Atlantic/Mediterranean/Indo-
Pacific O. ovata species-complex were not always the
same and resolved. This is evident in the BI
phylogram based on the ITS-region, which was
unresolved.
J. Bio. & Env. Sci. 2014
322 | Efimova et al.
Fig. 1. Phylogeny of Ostreopsis based on LSU D1/D2 rDNA sequences aligned with MUSCLE, obtained from
T92+G model using ML, NJ, and BI reconstructions. The outgroup is Coolia monotis VGO783. Bootstrap values
and Bayesian posterior probability are shown from left to right, ML/NJ/BI.
J. Bio. & Env. Sci. 2014
323 | Efimova et al.
Fig. 2. Phylogeny of Ostreopsis based on ITS-region sequences were aligned with MAFFT, obtained from T92+G
model using ML, NJ, and BI reconstructions. The outgroup is Coolia monotis VGO783. Bootstrap values and
Bayesian posterior probability are shown from left to right, ML/NJ/BI.
Further, we mainly analyzed clade B that includes
Russian, Japanese Ostreopsis sp.1/ sp.2, and S.
Korean Ostreopsis. The tree demonstrates that all of
the Russian Ostreopsis ribotypes belong to the
common clade (B) and are well separated from clade
(A) of O. ovata species-complex of Atlantic/
Mediterranean/South Pacific and some coasts of
Japan. The diversity within the Russian population of
Ostreopsis with two subclades indicates that they,
together with Korean and Japanese strains, are the
detached OTU (operational taxonomic unit). First, a
highly supported subclade B2 with three Russian
clones (KC991346.1, KC991347.1, KC991348.1) and
Japanese OdoOst6 (Ostreopsis sp.2, Sato et al., 2011)
branched off at the base clade B1 that contains ORUS,
Korean and Japanese (Ostreopsis sp.1, Sato et al.,
2011) strains. In contrast to the phylogram based on
LSU gene, four Japanese clones (Ostreopsis sp.1, Sato
et al., 2011) fell into the clade A.
High intra-specific diversity has been found in the
known species complexes of Alexandrium tamarense
J. Bio. & Env. Sci. 2014
324 | Efimova et al.
(Lebour) Balech (Scholin et al., 1995; John et al.,
2005; Lily et al., 2007), and Symbiodinium clades
(Coffroth and Santos, 2005), Oxyrrhis marina
Dujardin (Al-Kandari et al., 2011), Karenia
mikimotoi (Miyake & Kominami ex Oda) Hansen &
Moestrup (Lowe et al., 2010), Cryptoperidiniopsis
brodyi Steidinger, Landsberg, Mason, P.L.,
Vogelbein, Tester & Litaker (Park et al., 2007),
Luciella masanensis P.L.Mason, Jeong, Litaker,
Reece & Steidinger (Mason et al., 2007), and
Scrippsiella trochoidea (Stein) Balech ex Loeblich III
(Montresor et al., 2003). In turn, the genus
Ostreopsis itself is extremely diverse. It should be
noted that the 5.8S rDNA is considered conservative
within the genus; therefore, obviously, this
conservation is traced within individual
subpopulations. However, the identity between some
samples of the same species-complex from different
populations is difficult to explain. For example, some
representatives of the ORUS are related to the Korean
strain; the other part of ORUS is more close to the
different Japanese strains. Nevertheless, both of them
belong to the common Northwest Pacific population.
Conversely, Sato et al. (2011) unexpectedly found that
some Japanese sequences were similar to those of
members of the Atlantic/Mediterranean O. ovata
species-complex. Compared to the Ostreopsis sp.1
and Ostreopsis sp.2 clades that fell into the common
clade of O. ovata species-complex, the Russian strain
clustering into the two subclades (B1 and B2)
corresponds to the common clade.
Taking into account the existence of pseudogenes, we
can assume that some of the fragments can be a
paralogues. As paralogous genes are in excess, they do
not suffer from the strong pressure of selection and
can change significantly compared to the baseline
over time (Bannikova et al., 2004). The ITS and LSU
diversity can be explained by the multi-copy nature of
these genes. The allelic variation in the rDNA genes
both between populations and within a single isolate
has been shown in many organisms: microalgae,
foraminifera (Pillet et al., 2012), microsporidia, fungi,
insects, and animals (Debrunner-Vossbrinck et al.,
1996; Li et al., 2012; Schoch et al., 2012). However, in
all cases, the obtained variants of rDNA sequences
belonged to the same clade.
It is known that the average number of 28S rDNA
copies per cell of O. cf. ovata and Ostreopsis sp.1 in
environmental samples tends to be more than that in
cultured samples, namely 36,000+8,000
/24,000+5,000 and 88,000+22,000/58,000 +12,000,
respectively (Hariganeya et al., 2013). This more
likely explains the high variability Russian samples
which were collected from only one site and, in
addition, samples were collected from the same
seaweed in 2010. Several known ribotypes belonging
to different subclades were identified among our
Ostreopsis spp. On the whole, considering the
phylogeny of the genus, most of the species/strains,
including individual sequences, are heterogeneous.
However, we cannot be sure and verify which of them
is a true gene and which is a paralog. Hence, no one
sequence can be excluded from our analysis.
This intra-specific variation was previously associated
with phylogeography, but it is evident now that this
absolutely not the case. ORUS samples of the same
clonal culture are in different clades and have a
greater genetic distance. The copy number of several
separate genes varies among sub-clones of a single
strain. Today, genetic variability within clonal
cultures is estimated by three genetic processes,
namely spontaneous mutations, recombination
within even completely asexual cultures, and genetic
drift (Lakeman et al., 2009).
Note that complete SSU rDNA sequences within the
Russian population were identical to each other,
while analogous studies of different organisms
(Rooney, 2004; Xu et al., 2009; Mentewab et al.,
2011; Pillet et al., 2012) demonstrated
hypervariability in this marker. However, in our study
the use of the SSU marker showed that all of ORUS
samples are one species/strain, clearly differentiated
from other known Ostreopsis species/strains. Since
only two SSU rDNA sequences of Ostreopsis are
J. Bio. & Env. Sci. 2014
325 | Efimova et al.
published in GenBank, the phylogenetic
reconstructions are not presented here. The
geographical distribution of the Ostreopsis ribotypes
recorded from the Sea of Japan is presented in Fig. 3.
Fig. 3. Geographical distribution of Ostreopsis
ribotypes in the Sea of Japan. ▲ = clade B1,
Ostreopsis sp.1; ♦ = clade B1, O.cf. ovata from Jeju;
★ = clade B2, Ostreopsis sp.2.
Genetic distances
Genetic diversity was estimated using the uncorrected
p distances value between and within formed clades
for LSU rDNA and ITS-region sequences, and
between SSU rDNA sequences. The estimates of ITS-
region were compared with the p-values of
dinoflagellates (Litaker et al., 2007) in order to
elucidate the degree of relationships within the
Russian population and among other representatives
of the genus.
Genetic divergence was 1.9% (0.19) between the
ORUS and Korean strain (HE793379.1) and 5.9%
(0.59) between the ORUS and Malaysian strain
(AF244939.1). Estimates of evolutionary divergence
between SSU rDNA sequences are shown in Table 4.
A large range of genetic variation between sequences
was observed in both ITS-regions and LSU rDNA. The
p values among the inferred groups of Ostreopsis
were species level divergences according to Litaker et
al., (2007). Today, there are no approved scales to
estimate taxonomic levels within “genus” belonging to
the Dinophyta. Genetic variation in LSU rDNA
between subclades B1/B2 was 0.139, which is outside
of the range of species-level differences. The p-value
between clades A and B was 0.13. Genetic distance
within clade B of ITS-region was 0.058+0.012;
subsequently, p-values were estimated for B1 and B2
separately. Genetic distance between subclades B1/B2
was 0.158 and between clades A/B1 and A/B2 p were
0.107/0.160, respectively, which indicates species-
level distinctions. All p-values among and within
clades are shown in Tables 5-8.
Table 4. Estimates of evolutionary divergence between SSU rDNA sequences.
No GenBank Sequence 1 2 3 4 5 6 7 8 9 10 11 12
1 KF360004.1 Ostreopsis sp. ORUS J2 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009
2 KF360003.1 Ostreopsis sp. ORUS J1 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009
3 KF360002.1 Ostreopsis sp. ORUS O2 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009
4 KF360001.1 Ostreopsis sp. ORUS O1 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009
5 KF360000.1 Ostreopsis sp. ORUS K2 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.000 0.003 0.006 0.009
6 KF359999.1 Ostreopsis sp. ORUS H2 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.000 0.003 0.006 0.009
7 KF359998.1 Ostreopsis sp. ORUS H1 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.000 0.003 0.006 0.009
8 KF359997.1 Ostreopsis sp. ORUS A2 0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.000 0.003 0.006 0.009
9 KF359996.1 Ostreopsis sp. ORUS A1 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
0.003 0.006 0.009
10 HE793379.2 Ostreopsis cf. ovata 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.019
0.005 0.009
11 AF244939.1 Ostreopsis cf. ovata 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.052
0.009
12 JF521619.1 Alexandrium andersoni 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.171 0.173
J. Bio. & Env. Sci. 2014
326 | Efimova et al.
Alexandrium andersoni was used only as an outgroup
for estimation of evolutionary divergence between
related genera.
Values below the diagonal are genetic distances;
values under the diagonal are standard errors.
Table 5. Matrix of genetic distances based on ITS-region among clades of Ostreopsis.
No Clade 1 2 3 4 5 6 7 1 Clade A 0.027 0.033 0.053 0.109 0.064 0.181 2 Clade B1 0.107 0.034 0.066 0.107 0.071 0.184 3 Clade B2 0.160 0.158 0.065 0.170 0.078 0.173 4 Clade C 0.255 0.303 0.338 0.112 0.073 0.201 5 Clade D 0.533 0.580 0.694 0.582 0.094 0.287 6 Clade E 0.395 0.449 0.490 0.455 0.615 0.274 7 Coolia monotis 0.785 0.803 0.807 0.859 1.086 1.098
Values below the diagonal are genetic distances; values under the diagonal are standard errors.
Table 6. Genetic distances based on ITS-region
sequences within clades of Ostreopsis.
Clade p S.E. Clade A 0.007 0.002 Clade B1 0.025 0.008 Clade B2 0.047 0.013 Clade C 0 0 Clade D 0.334 0.057 Clade E 0.438 0.073 Coolia monotis n/c n/c
n/c – no common sites (single sequence within clade)
S.E.-Standard Error
However, genomic interspecies variation may differ
broadly (Caron et al., 2009) depending on
evolutionary rates within each lineage of eukaryotes,
and there is no universally correct level of similarity
(Majaneva, 2013). Consequently, there is no strictly
defined range of p-distance values for genus and
species levels of dinoflagellates. However, the ITS
marker revealed a greater genetic distance between
different species, compared to strains belonging to
the same putative species. Nevertheless, these p-
values do not enable us to conclude anything
definitely.
Conclusions
The results indicated that the genotype of ORUS is
closer to the genotype O. cf. ovata than O. cf.
siamensis. Moreover, significantly distinct cultures
and single isolates from the Sea of Japan formed a
common clade. On the other hand, the present study
confirmed the high divergence of our Sea of Japan
population from the Atlantic, Malaysian, Indo-Pacific,
and Australian (Oceania) populations.
Phylogenetic analysis of LSU rDNA data revealed two
distinctly different Ostreopsis ORUS genotypes: one
similar to the toxic Korean strain that produces
ostreol-A and the other analogous to a Japanese
strain from Okinawa (Ostreopsis sp.2). Phylogenetic
analysis based on ITS sequencing indicated one more
genotype from the Russian Far East similar to an
extremely toxic Japanese strain (Ostreopsis sp.1) that
produce palytoxin-like compounds. Thus, Ostreopsis
spp. from Russian waters have ribotypes that have
been shown to be toxic in other regions. These
ribotypes are either randomly amplified copies of a
gene from different regions or different variants of
hybrid genotypes. We suggest that further molecular-
genetic studies of the Ostreopsis genus using new
markers are needed to elucidate the phylogenetic
relationships and status of all members of the genus.
The SSU rDNA sequences from all ORUS samples
were highly conserved. The present study has
revealed high genetic homogeneity of SSU rDNA of
Russian strains and low polymorphism among other
known Ostreopsis.
Since attempts to obtain a reliable marker for the
genus have been unsuccessful thus far, it may be that
the SSU rDNA gene is the only effective molecular
marker to effectively characterize phylogenetic
relationships within the genus Ostreopsis. The use of
J. Bio. & Env. Sci. 2014
327 | Efimova et al.
SSU rDNA allowed us to reliably estimate the
distinctions among populations from different
regions and homogeneity within populations.
Heterogeneous sequences of a single gene (LSU
D1/D2 or ITS-region) from different samples of the
Russian strain may suggest that despite high
polymorphism, the Ostreopsis isolates are one
phylogenetic unit, which is confirmed by their
homogeneous SSU rDNA.
Acknowledgments
The authors are grateful to Kukhlevsky A.D. (A.V.
Zhirmunsky Institute of Marine Biology of the Far
Eastern Branch of the Russian Academy of Sciences,
Russia), Trainer V.L., and Adams N.G. (Northwest
Fisheries Science Center, National Marine Fisheries
Service, National Oceanic and Atmospheric
Administration, USA) for constructive
recommendations, advice in the work and proof
reading the article. Financing of the research was
partially supported by the Russian Foundation for
Basic Research (project 10-04-01438-a) and CRDF-
12-010 RUB1-7063-VL-12 “Changes in toxic
dinoflagellate communities in the Far Eastern seas of
Russia in response to climate change” 2012-2013) and
grant of the Far Eastern Branch of the Russian
Academy of Sciences (FEB1) and by the FEB RAS
Complex Target Program Biological Safety of Far East
Seas of Russian Federation, and the APN Foundation
Grant ARCP2006-FP14-Adrianov.
References
Adachi M, Sako Y, Ishida Y. 1994 Restriction
fragment length polymorphism of ribosomal DNA
internal transcribed spacer and 5.8S regions in
Japanese Alexandrium species (Dinophyceae).
Journal of Phycology 30, 857–865. doi:
10.1111/j.0022-3646.1994.00857.x
Adachi M, Sako Y, Ishida Y. 1996. Analysis of
Alexandrium (Dinophyceae) species using sequences
of the 5.8S ribosomal DNA and internal transcribed
spacer regions. Journal of Phycology 32, 424–432.
doi: 10.1111/j.0022-3646.1996.00424.x
Al-Kandari M, Highfield A, Hall M, Hayes P,
Schroeder D. 2011. Molecular tools separate
harmful algal bloom species, Karenia mikimotoi,
from different geographical regions into distinct sub-
groups. Harmful Algae 10, 636–643. doi:
10.1016/j.hal.2011.04.017
Bannikova AA. 2004. Molecular markers and
modern phylogenetics of Mammals. Zhurnal
Obshchei Biologii 65 (4), 278–305 (in Russian)
Bass D, Howe AT, Mylnikov AP, Vickerman K,
Chao EE, Edwards Smallbone J, Snell J,
Cabral C Jr, Cavalier-Smith T. 2009. Phylogeny
and Classification of Cercomonadida (Protozoa,
Cercozoa): Cercomonas, Eocercomonas, Paracerco-
monas, and Cavernomonas gen. nov. Protist 160,
483–521. doi:10.1016/j.protis.2009.01.004
Brescianini C, Grillo C, Melchiorre N,
Bertolotto R, Ferrari A, Vivaldi B, Icardi G,
Gramaccioni L, Funari E, Scardala S. 2006.
Ostreopsis ovata algal blooms affecting human health
in Genova, Italy, 2005 and 2006. Euro surveillance
Weekly 11, p 3040. Available online:
http://www.eurosurveillance.org
Caron DA, Countway PD, Savai P, Gast RJ,
Schnetzer A, Moorthi SD, Dennett MR, Moran
DM, Jones AC. 2009. Defining DNA-based
operational taxonomic units for microbial-eukaryote
ecology. Applied and Environmental Microbiology
75, 5797–5808.
Ciminiello P, Dell'Aversano C, Fattorusso E,
Forino M, Magno GS, Tartaglione L, Grillo C,
Melchiorre N. 2006. The Genoa 2005 outbreak.
Determination of putative palytoxin in Mediterranean
Ostreopsis ovata by a new liquid chromatography
tandem mass spectrometry method. Analytical
Chemistry 78, 6153–6159. doi: 10.1021/ac060250j
J. Bio. & Env. Sci. 2014
328 | Efimova et al.
Coffroth MA, Santos SR. 2005. Genetic diversity
of symbiotic dinoflagellates in the genus
Symbiodinium. Protist 156, 19–34.
doi:10.1016/j.protis.2005.02.004
Coyer JA, Smith GJ, Andersen RA. 2001.
Evolution of Macrocystis spp. (Phaeophyceae) as
determined by ITS1 and ITS2 sequences. Journal of
Phycology 37, 574–585. doi: 10.1046/j.1529-
8817.2001.037001574.x
Debrunner-Vossbrinck BA, Vossbrinck CR,
Vodkin MH, Novak RJ. 1996. Restriction analysis
of the ribosomal DNA internal transcribed spacer
region of Culex restuans and mosquitoes in the Culex
pipiens complex. Journal of the American Mosquito
Control Association 12, 477–482.
Deeds JR, Schwartz MD. 2010. Human risk
associated with palytoxin exposure. Toxicon 56, 150–
162. doi: 10.1016/j.toxicon.2009.05.035
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA
from fresh tissue. Focus 12, 13–15.
Durando P, Ansaldi F, Oreste P, Moscatelli P,
Marensi L, Grillo C, Gasparini R, Icardi G.
2007. Ostreopsis ovata and human health:
epidemiological and clinical features of respiratory
syndrome outbreaks from a two-year syndromic
surveillance, 2005–2006, in north-west Italy. Euro
surveillance Weekly 12 (6).
Dyhrman ST, Haley ST, Borchert JA, Lona B,
Kollars N, Erdner DL. 2010. Parallel Analyses of
Alexandrium catenella Cell Concentrations and
Shellfish Toxicity in the Puget Sound. American
Society for Microbiology 76(14), 4647–4654.
Fiore-Donno AM, Kamono A, Chao E, Fukui
M, Cavalier-Smith T. 2010. Invalidation of
Hyperamoeba by transferring its species to other
genera of Myxogastria. Journal of Eukaryotic
Microbiology 57, 189–196. doi: 10.1111/j.1550-
7408.2009.00466.x
Galluzzi L, Bertozzini E, Penna A, Perini F,
Garcés E, Magnani M. 2009. Analysis of rRNA
gene content in the Mediterranean dinoflagellate
Alexandrium catenella and Alexandrium taylori:
implications for the quantitative real-time PCR-based
monitoring methods. Journal of Applied Phycology
22, 1–9.
Giribet G, Carranza S, Baguñà J, Riutort M,
Ribera C. 1996. First molecular evidence for the
existence of a Tardigrada + Arthropoda clade.
Molecular Biology and Evolution 13, 76–84.
Giribet G, Rambla M, Carranza S, Baguñà J,
Riutort M, Ribera C. 1999. Phylogeny of the
arachnid order Opiliones (Arthropoda) inferred from
a combined approach of complete 18S and partial 28S
ribosomal DNA sequences and morphology.
Molecular Phylogenetics and Evolution 11, 296–307.
Giribet G, Ribera C. 2000. A review of arthropod
phylogeny: New data based on ribosomal DNA
sequences and direct character optimization.
Cladistics 16, 204–231.
Hariganeya N, Tanimoto Y, Yamaguchi H,
Nishimura T, Tawong W, Sakanari H,
Yoshimatsu T, Sato S, Preston CM, Adachi M.
2013. Quantitative PCR method for enumeration of
cells of cryptic species of the toxic marine
dinoflagellate Ostreopsis spp. in Coastal Waters of
Japan. PLoS ONE 8(3), e57627. doi:
10.1371/journal.pone.0057627
Hwang BS, Yoon EY, Kim HS, Yih WH, Park
JY, Jeong HJ, Rho JR. 2013. Ostreol A: a new
cytotoxic compound isolated from the epiphytic
dinoflagellate Ostreopsis cf. ovata from the coastal
waters of Jeju Island, Korea. Bioorganic & Medicinal
Chemistry Letters 23, 3023–3027. doi:
10.1016/j.bmcl.2013.03.020
J. Bio. & Env. Sci. 2014
329 | Efimova et al.
Ito E, Yasumoto T. 2009. Toxicological studies on
palytoxin and ostreocin-D administered to mice by
three different routes. Toxicon 54, 244–251. doi:
10.1016/j.toxicon.2009.04.009
John U, Medlin LK, Groben R. 2005.
Development of specific rRNA probes to distinguish
between geographic clades of the Alexandrium
tamarense species complex. Journal of Plankton
Research 27, 199–204. doi: 10.1093/plankt/fbh160
Keller MD, Selvin RC, Claus W, Guillard RRL.
1987. Media for the culture of oceanic
ultraphytoplankton. Journal of Phycology 23, 633–638.
Kang NS, Jeong HJ, Lee SY, Lim AS, Lee MJ,
Kim HS, Yih WH. 2013. Morphology and molecular
characterization of the epiphytic benthic dinoflagellate
Ostreopsis cf. ovata in the temperate waters off Jeju
Island, Korea. Harmful Algae 27, 98–112.
Ki J-S, Jang GY, Han M-S. 2005 Integrated
method for Single-cell DNA extraction, PCR
amplification, and sequencing of ribosomal DNA
from harmful dinoflagellates Cochlodinium
polykrikoides and Alexandrium catenella. Marine
Biotechnology 6, 587 – 593.
Kreshchenovskaya MA, Orlova TYu. 2014.
Ultrastructural study of dinoflagellate Ostreopsis cf.
ovata, Fukuyo, 1981 (Dinophyceae) Sea of Japan.
Russian Journal of Marine Biology 4(40), 286 – 292.
LaJeunesse TC. 2001. Investigating the
biodiversity, ecology, and phylogeny of endosymbiotic
dinoflagellates in the genus Symbiodinium using the
ITS region: in search of a „„species‟‟ level marker.
Journal of Phycology 37, 866–880. doi:
10.1046/j.1529-8817.2001.01031.x
Lakeman MB, von Dassow P, Cattolico RN.
2009. The strain concept in phytoplankton ecology.
Harmful Algae 8, 746–758. doi:
10.1016/j.hal.2008.11.011
Lenoir S, Ten-Hage L, Quod JP, Bernard C,
Hennion MC. 2004. First evidence of palytoxin
analogues from an Ostreopsis mascarenensis
(Dinophyceae) benthic bloom in southwestern Indian
Ocean. Journal of Phycology 40, 1042–1051.
Li JL, Chen WF, Wu J, Peng WJ, An JD,
Schmid-Hempel P, Schmid-Hempel R. 2012.
Diversity of Nosema associated with bumblebees
(Bombus spp.) from China. International Journal for
Parasitology 42, 49–61. doi:
10.1016/j.ijpara.2011.10.005
Lilly EL, Halanych KM, Anderson DM. 2007.
Species boundaries and global biogeography of the
Alexandrium tamarense complex (Dinophyceae).
Journal of Phycology 43, 1329–1338. doi:
10.1111/j.1529-8817.2007.00420.x
Litaker RW, Vanderseam W, Reece KS,
Stokesn A, Yonish BA, Kibler SR, Black MND,
Steidinger KA, Lutzoni FM, Tester PA. 2007.
Recognizing dinoflagellate species using, ITS rDNA
sequences. Journal of Phycology 43, 344–355. doi:
10.1111/j.1529-8817.2007.00320.x
Loi T. 1998. Molecular diversity of the predominant
clade C zooxanthellae from scleractinian corals of the
Great Barrier Reef. Honour‟s thesis, Department of
Microbiology, Univ. of Sydney, Sydney, Australia.
Lowe CD, Montagnes DJS, Martin LE, Watts
PC. 2010. Patterns of genetic diversity in the marine
heterotrophic flagellate Oxyrrhis marina (Alveolata:
Dinophyceae). Protist 161, 212–221. doi:
10.1016/j.protis.2009.11.003
Majaneva M. 2013. Linking taxonomy and
environmental 18S-rRNA-gene sequencing of Baltic
Sea protists Walter and Andree de Andree de
Nottbeck Foundation Scietific Reports, 40 p
Martins CA, Kulis D, Franca S, Anderson DM.
2004. The loss of PSP toxin production in a formerly
J. Bio. & Env. Sci. 2014
330 | Efimova et al.
toxic Alexandrium lusitanicum clone. Toxicon 43,
195–205. doi: 10.1016/j.toxicon.2003.11.023
Mason PL, Litaker RW, Jeong HJ, Ha JH,
Reece KS, Stokes N-A, Park J-Y, Steidinger K-
A, Vandersea M-W, Kibler S, Tester P-A,
Vogelbein WK. 2007. Description of a new genus of
Pfiesteria-like dinoflagellate, Luciella gen. nov.
(dinophyceae), including two new species: Luciella
masanensis sp. nov. and Luciella atlantis sp. nov.
Journal of Phycology 43, 799–810. doi:
10.1111/j.1529-8817.2007.00370.x
Mentewab AB, Jacobsen MJ, Flowers RA. 2011.
Incomplete homogenization of 18S ribosomal DNA
coding regions in Arabidopsis thaliana. BMC
Research Notes 4(93), 1–7.
Montresor M, Sgrosso S, Procaccini G,
Kooistra WCHF. 2003. Intraspecific diversity in
Scrippsiella trochoidea (Dinophyceae): Evidence for
cryptic species. Phycologia 42, 56–70.
Moreira D, Von der Heyden S, Bass D, Lopez-
Garcia P, Chao E, Cavalier-Smith T. 2007.
Global eukaryote phylogeny: Combined small- and
large-subunit ribosomal DNA trees support
monophyly of Rhizaria, Retaria and Excavata.
Molecular Phylogenetics and Evolution 44, 255–266.
Okonechnikov K, Golosova O, Fursov M. 2012.
Unipro UGENE: a unified bioinformatics toolkit.
Bioinformatics 28, 1166–1167.
Onuma Y, Satake M, Ukena T, Roux J,
Chanteau S, Rasolofonirina N, Ratsimaloto M,
Naoki H, Yasumoto T. 1999. Identification of
putative palytoxin as the cause of clupeotoxism.
Toxicon 37, 55–65. doi: 10.1016/S0041-
0101(98)00133-0
Park TG, De Salas MF, Bolch CJ, Hallegraeff
GM. 2007. Development of a real-time PCR probe for
quantification of the heterotrophic dinoflagellate
Cryptoperidiniopsis brodyi (Dinophyceae) in
environmental samples. Applied and Environmental
Microbiology 73, 2552–2560. doi:
10.1128/AEM.02389-06
Parsons ML, Aligizaki K, Dechraoui MY, Fraga
S, Morton S, Penna A, Rhodes L. 2012.
Gambierdiscus and Ostreopsis: reassessment of the
state of knowledge of their taxonomy, geography,
ecophysiology, and toxicology. Harmful Algae 14,
107–129. doi: 10.1016/j.hal.2011.10.017
Pawlowski J, Lecroq B. 2010. Short rDNA
Barcodes for Species Identification in Foraminifera.
Journal of Eukaryotic Microbiology 57, 197–205. doi:
10.1111/j.1550-7408.2009.00468.x
Penna A, Vila M, Fraga S, Giacobbe MG,
Andreoni F, Riobo P, Vernesi C. 2005a.
Characterization of Ostreopsis and Coolia
(Dinophyceae) isolates in the western Mediterranean
Sea based on morphology, toxicity and internal
transcribed spacer 5.8S rDNA sequences. Journal of
Phycology 41, 212–225. doi: 10.1111/j.1529-
8817.2005.04011.x
Penna A, Garcés E, Vila M, Giacobbe MG,
Fraga S, Luglié A, Bravo I, Bertozzini E,
Vernesi C. 2005b. Alexandrium catenella
(Dinophyceae), a toxic ribotype expanding in the NW
Mediterranean Sea. Marine Biology 148: 13–23. doi:
10.1007/s00227-005-0067-5
Penna A, Bertozzini E, Battocchi C, Galluzzi L,
Giacobbe MG, Vila M, Garces E, Luglie A,
Magnani M. 2007. Monitoring of HAB species in the
Mediterranean Sea through molecular methods.
Journal of Plankton Research 29, 19–38. doi:
10.1093/plankt/fbl053
Penna A, Fraga S, Battocchi C, Casabianca S,
Riobo P, Giacobbe MG, Vernesi C. 2010. A
phylogeography study of the toxic benthic
dinoflagellate genus Ostreopsis Schmidt. Journal of
J. Bio. & Env. Sci. 2014
331 | Efimova et al.
Biogeography 37: 830–841. doi: 10.1111/j.1365-
2699.2009.02265.x
Penna A, Fraga S, Nattocchi C, Casabianca S,
Perini F, Capellacci S, Casabianca A, Riobo P,
Giacobbe MG, Totti C, Accoroni S, Vila M,
René A, Scardi M, Aligizaki K, Nguyen-Ngoc L,
Vernesi C. 2012. Genetic diversity of the genus
Ostreopsis Schmidt: phylogeographical
considerations and molecular methodology
applications for field detection in the Mediterranean
Sea. Cryptogamie Algologie 33(2),153–163.
Pillet L, De Vargas C, Pawlowski J. 2011.
Molecular identification of sequestered Diatom
chloroplasts and kleptoplastidy in Foraminifera.
Protist 162, 394–404.
Pillet L, Fontaine D, Pawlowski J. 2012. Intra-
genomic ribosomal RNA polymorphism and
morphological variation in Elphidium macellum
suggests inter-specific hybridization in Foraminifera.
PLoS ONE 7(2), e32373. doi:
10.1371/journal.pone.0032373
Posada D, Crandall KA. 1998 Modeltest testing
the model of DNA substitution. Bioinformatics 14(9),
817-818.
Pin LC, Teen LP, Ahmad A, Usup G. 2001.
Genetic diversity of Ostreopsis ovata (Dinophyceae)
from Malaysia. Marine Biotechnology 3, 246–255.
Rhodes LL, Towers N, Briggs L, Munday R,
Adamson J. 2002. Uptake of palytoxin-like
compounds by feeding shellfish with Ostreopsis
siamensis (Dinophyceae). New Zealand Journal of
Marine and Freshwater Research 36, 631–636. doi:
10.1080/00288330.2002.9517118
Riobó P, Paz B, Franco JM. 2006. Analysis of
palytoxin-like in Ostreopsis cultures by liquid
chromatography with precolumn derivitization and
fluorescence detection. Analytica Chimica Acta 566,
217–223. doi: 10.1016/j.aca.2006.03.013
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3:
Bayesian phylogenetic inference under mixed models.
Bioinformatics 19, 1572–1574.
Rooney AP. 2004. Mechanisms underlying the
evolution and maintenance of functionally
heterogeneous 18S rRNA genes in Apicomplexans.
Molecular Biology and Evolution 21, 1704–1711. doi:
10.1093/molbev/msh178
Saito K, Drgon T, Robledo JAF, Krupatkina
DN, Vasta GR. 2002. Characterization of the rRNA
locus of Pfiesteria piscicida and development of
standard and quantitative PCR-based detection
assays targeted to the non-transcribed spacer.
Applied and Environmental Microbiology 68, 5394–
5407. doi: 10.1128/AEM.68.11.5394-5407.2002
Saitou N, Nei M. 1987. The neighbor-joining
method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution
4, 406–425.
Sato S, Nishimura T, Uehara K, Sakanari H,
Tawong W, Hariganeya N, Smith K, Rhodes L,
Yasumoto T, Taira Y, Suda S, Yamaguchi H,
Adachi M. 2011. Phylogeography of Ostreopsis along
West Pacific coast, with special reference to a novel
clade from Japan. PLoS ONE 6, e27983. doi:
10.1371/journal.pone.0027983
Schlötterer C. 1998. Ribosomal DNA probes and
primers. In Karp A, Isaac PG, Ingram DS (eds).
Molecular tools for screening biodiversity. Chapman
and Hall, London.
Schmidt J. 1902. Flora of Koh Chang. Contribution
to the knowledge of the vegetation in the Gulf of
Siam. Part IV. Peridiniales. J Botanique 23, 212–218.
J. Bio. & Env. Sci. 2014
332 | Efimova et al.
Schoch CL, Seifert KA, Huhndorf S, Robert V,
Spouge JL, Levesque CA, Chen W. 2012. Nuclear
ribosomal internal transcribed spacer (ITS) region as
a universal DNA barcode marker for Fungi. PNAS
(Proceedings of the National Academy of Sciences)
USA 109(16), 6241–6246.
Scholin CA, Hallegraeff G, Anderson DM. 1995.
Molecular evolution of the Alexandrium tamarense
„species complex‟ (Dinophyceae): dispersal in the
North American and West Pacific regions. Phycologia
34, 472–485.
Scholin CA, Herzog M, Sogin M, Anderson
DM. 1994. Identification of group and strain-specific
genetic markers for globally distributed Alexandrium
(Dinophyceae). II. Sequence analysis of a fragment of
the LSU rRNA gene. Journal of Phycology 30, 999–
1011. doi: 10.1111/j.0022-3646.1994.00999.x
Selina MA, Orlova TYu. 2010 First occurrence of
the genus Ostreopsis (Dinophyceae) in the Sea of
Japan. Botanica Marina 53, 243–249. doi:
10.1515/bot.2010.033
Shao P, Chen Y, Zhou H, Yuan J, Qu LH, Zhao
D, Lin YS. 2004. Genetic variability in
Gymnodiniaceae ITS regions: implications for species
identification and phylogenetic analysis. Marine
Biology 144, 215–224. doi: 10.1007/s00227-003-
1157-x
Stern RF, Andersen RA, Jameson I, Küpper
FC, Coffroth M-A, Vaulot D, Le Gall F, Véron
B, Brand JJ, Skelton H, Kasai F, Lilly EL,
Keeling PJ. 2012. Evaluating the Ribosomal
Internal Transcribed Spacer (ITS) as a Candidate
Dinoflagellate Barcode Marker. PLoS ONE 7(8),
e42780. doi: 10.1371/journal.pone.0042780
Swofford DL. 2002. PAUP*. Phylogenetic Analysis
Using Parsimony (*and other Methods) Version 4.0
b10, Sunderland, Massachusetts: Sinauer Associates
Tamura K, Peterson D, Peterson N, Stecher G,
Nei M, Kumar S. 2011. MEGA5. Molecular
Evolutionary Genetics Analysis Using Maximum
Likelihood, Evolutionary Distance, and Maximum,
Parsimony Methods. Molecular Biology and
Evolution 28(10), 2731–2739.
Taniyama S. 2008. The occurrence of palytoxin-like
poisoning and ciguatera in parts of the main land of
Japan. Nippon Suisan Gakkaishi 74, 917–918 (In
Japanese).
Taniyama S, Arakawa O, Terada M, Nishio S,
Takatani T, Mahmud Y, Noguchi T. 2003.
Ostreopsis sp., a possible origin of palytoxin (PTX) in
parrotfish Scarus ovifrons. Toxicon 42, 29–33.
Thompson JD, Higgins DG, Gibson TJ. 1994.
Clustal W: improving the sensitivity of progressive
multiple sequence alignment through sequence
weighting, position specific gap penalties and weight
matrix choice. Nucleic Acids Research 22, 4673–
4680.
Xu J, Zhang Q, Xu X, Wang Z, Qi J. 2009.
Intragenomic variability and pseudogenes of
ribosomal DNA in Stone flounder Kareius
bicoloratus. Molecular Phylogenetics and Evolution
52, 157–166. doi: 10.1016/j.ympev.2009.03.031
Yasumoto T, Satake M. 1998. New toxins and their
toxicological evaluation. In: Reguera B et al., (eds)
Harmful Algae. Xunta de Galicia and
Intergovernmental Oceanographic Commission of
UNESCO, 461–464.
top related