pcr based detection of nosocomial infection causing mrsa ...pcr based detection of nosocomial...
Post on 11-Mar-2020
8 Views
Preview:
TRANSCRIPT
PCR based detection of nosocomial infection causing MRSA (Methicillin resistant Staphylococcus aureus)
Archana Panchapakesan Iyer Experimental Biochemistry Unit
King Fahad Medical Research Centre Jeddah, Saudi Arabia
e-mail: arch729@gmail.com
Taha Abdulah Kumosani Experimental Biochemistry Unit
King Fahad Medical Research Centre Jeddah, Saudi Arabia
e-mail: t.kumosani@yahoo.com
Abstract— Nosocomial infections are infections that develop as a result of a stay in hospital or are produced by microorganisms and viruses acquired during hospitalization. Nasal carriage of S. aureus is very common and may be due to hand to nose transmission. The objective of the present study was to screen individuals from various sectors as carriers of MRSA. The study group included hospital staff such as nurses, doctors and visitors. Nasal swabs were taken from the volunteers and cultured on media selective for Staphylococcus aureus. Pathogenecity was confirmed using PCR for the coagulase gene. Coagulase positive strains were subjected to PCR for the mec gene. A comparison was done with a student population to serve as a group non exposed to MRSA.
Keywords-MRSA, coagulase gene, mec gene, nosocomial infections, PCR based detection
I. INTRODUCTION Nosocomial infections are infections that develop as a
result of a stay in hospital or are produced by microorganisms and viruses acquired during hospitalization. They may be endogenous, arising from an infectious agent present within a patient's body, or exogenous, transmitted from another source within the hospital. In addition to patient-to-patient spread, others may be involved, including staff, students, visitors and voluntary workers[1]. Staphylococci and Enterococci are major causes of nosocomial infections. They cause superficial skin lesions such as boils, styes and more serious infections such as pneumonia, mastitis, phlebitis, meningitis and urinary tract infections; and deep-seated infections, such as osteomyelitis and endocarditis. Methicillin-resistant S. aureus (MRSA) is a strain of S. aureus which by definition is resistant to the semi- synthetic penicillins (i.e. methicillin, nafcillin, and oxacillin). As such, it is resistant to all other beta-lactam antibiotics (including other penicillins, cephalosporins and cephamycins). Additionally, MRSA is often resistant to other classes of antibiotics including aminoglycosides, macrolides and quinolones. Thus, MRSA is not only methicillin-resistant but also multiply-resistant as well[2]. MRSA colonization and infection in acute and non-acute care facilities have increased dramatically over the past two decades, evidenced by the increasing number of reported
outbreaks in the medical literature. Because of its resistance to antibiotics, management of MRSA infections requires more complicated, toxic and expensive treatment. It is important for the health care professional to understand the difference between colonization and infection. Colonization indicates the presence of the organism without symptoms of illness. S. aureus permanently colonizes the anterior nares of about 20% to 30% of the general population. Hospital workers are more likely to be colonized than persons in the general population, presumably because of increased exposure [3]. The resistance to antibiotics is due to a gene called mecA which is part of the staphylococcal cassette chromosome. It codes for a Pencicillin Binding Protein (PBP2a) that prevents the action of beta lactam antibiotics [4]. This study is hence focused on rapid detection of the MRSA using gene specific primers designed to detect the mecA gene. Recently, coagulase gene typing is being used as an important tool to characterize pathogenic Staphylococci. Its discriminatory power relies on the heterogeneity of the region containing the 81-bp tandem repeats at the 3' ends of the coagulase gene. PCR amplification of this particular region produces DNA fragments of different sizes which can then be further discriminated by AluI digestion [5]. In this study I have used coagulase gene PCR and RFLP to type the MRSA strains from various populations.
II. EXPERIMENTAL PROCEDURE Samples were taken from hospital workers such as nurses
and technicians.The sample group consisted of volunteers from various clinics and hospitals. A total of 50 samples was used for the study. All volunteers signed a consent form for ethical approval of the study. A control group of students not exposed to hospitals was also used for the study. Swabs were taken from both the anterior nares using sterile swabs moistened in saline. The swabs were used to spread on Media specific for Staphylococcus aureus (Fig 1). Cultures were then subjected through three rounds of purification and subculturing to get single colonies.
1
2011 2nd International Conference on Biotechnology and Food Science IPCBEE vol.7 (2011) © (2011) IACSIT Press, Singapore
Fig 1. Nasal sw
Colonies wX 100 at 95°Cand 10 ul of tPrimers specimethicillin gefor presence othe coagulaseshown in table Table 1. Pdetection of m
Gene
Mec A FP:5′ARP:5′A
Coagulase FP : 5RP :
PCR prodagarose gel. Mfor coagulaseproducts wererestriction enzwas used as M
wabs cultured on m
were boiled inC for 15 minsthe supernatanfic for the mecene. mecA poof the coagulae gene. Primee 1[5-8].
Primers and mecA and co
Primers used
AAAATCGATGGTAAAGTTCTGCAGTACC
5′ATAGAG ATGCTG5′GCTTCCGATTGTT
ducts were visuMec A positive gene. Thee subjected tozyme for 1 ho
MRSA positive
media specific for
n lysis buffer cs. The suspensnt was used ac A gene wereositive strains ase gene usingers used and
PCR condagulase gene
d co
AAGGTTGGC3' CGGATTTGC3’ 9
5
eGGTACAGG3′
TCGATGC3′ 9
5
e
ualized by eleve strains wer
e different sio restriction dour at 37°C. Ae control.
r Staphylococcus
containing 1%sion was centras template foe used to ampwere then sc
g primers specPCR conditio
ditions useds.
PCR onditions
No.of cycles
94°C – 30
secs
55°C – 30
secs
72°C –
1min
72°C –
5 min
final
extension
40
94°C – 1
min
55°C – 1
min
72°C –
1min 72°C – 5 min final
extension
40
ectrophoresis ure subjected tize coagulasedigestion usinATCC 700699
s aureus
% Triton rifuged
or PCR. lify the creened cific for ons are
d for
PCR product
size
533 bp
350 bp
430 bp
570 bp
630 bp
using 1% to PCR e gene ng AluI 9 strain
mdothcounpono
LaLawoLa
LaLaLaLa
coon35prdiamdi
III.PCR based
most of the heoctors were Mhe hospital viomparison wndergraduate opulation was on exposure to
Fig 2. Mec
ane 1 - 100 bpanes 2-12 –orkers ane 13 – mec A
Fig 3.
ane 1 - 100 bpane 2 - mec Aane 3 - PCR panes 4-11 – PC
Mec A posoagulase gene.n polymorphis50 bp, 430 broducts also gestion with
mongst the strfferent types.
RESULTSscreening for
ealth care woMRSA positivisitors also with the studstudents, it wfree from nas
o the pathogen
c A gene PCR pro
p DNA ladderPCR produ
A positive con
Mec A gene PCR
p DNA ladderA positive contproduct from hCR negative f
sitive strains w. Four differensms in the sizbp, 570 bp a
yielded diffthe enzyme
rains isolated
AND DISCUr carriers of Morkers such asve, but asympwere positivedent populatiwas observedsal carriage of n (Fig 2 and 3)
oducts from health
ucts from hea
ntrol ATCC 7
R from student po
trol ATCC 70health care wofrom student p
were subjectent strain typese of the coagu
and 630 bp (fferent restric
AluI (Fig 5from this stud
USSION MRSA showeds staff nursesptomatic. Some for MRSAon consisting
d that the stuf MRSA, indic).
h care workers
alth care
00699 strain
opulation.
0699 strain orker population
ed to PCR fos were found bulase gene su(Fig 4). The ction patterns5), indicating dy there were
d that s and me of . On g of udent cating
or the based ch as PCR
s on that
e four
2
Fig 4. Coagula
Lane 1: 100 bLane 2: NegaLane 3: coaguLane 4: coaguLane 5: coaguLane 6: coagu
Fig 5. Rest Lane 1 - 100 bLanes 2-7 –restriction pat
ase PCR product o
bp DNA laddeative control ulase product ulase product ulase product ulase product
triction analysis o
bp DNA ladd– coagulase Ptterns
of various sizes fr
er
of size 350 bpof size 430 bpof size 570 bpof size 630 bp
of coagulase PCR
er PCR products
from the MRSA is
p p p p
R products with A
s showing di
solates
AluI
ifferent
cadeouto mimdiinillabwogeexMhoMcatechoheprin
[1][2]
[3]
[4][5]
[6]
[7]
[8]
[9][10
MRSA coloare facilities hecades, evidenutbreaks in the antibiotics,
more complicamportant for thfference betw
ndicates the prlness. S. aureubout 20% to orkers are moeneral populaxposure. In mo
MRSA, but the our is develop
MRSA. This stuan be done usichnique can ospitals to avealth care profroper hand sanfections from
] Boyce, J M., I] Shrestha, B.,
(2009). ] Van Hal, S.J.
J.Clin.Microb] Jorgensen J H] Himabindu ,M
American J. In] Ercis,S., Sanc
26 : 21 (2008)] Ünal,S., Hosk
Skatrud, P.L.,] Graham, J.C.,
and Freeman,] J.Antimicrob.0] . Computation
Dec. 2007, pp
IV. COonization and ihave increasednced by the e medical litemanagement
ated, toxic, ahe health care
ween colonizatresence of the us permanently
30% of theore likely to bation, presumost cases culturesults take aing faster andudy shows thaing the PCR sbe used as a
void spread ofessionals on anitization mspreading.
REFE
Infect Control HoPokhrel, B and M
, Stark, D., Lockbiol, 10:1128 (200H., Infect Control M., Muthamilselvnfect.Dis, 5: 170 cak,B., Hascelik,). kins, J., Flokowit, J Clin Microbiol, Murphy, O.M., R, .Chemotheraphy,nal Intelligence
p. 57-64, doi:10.1
ONCLUSION infection in ac
d dramaticallyincreasing nurature. Becauof MRSA i
and expensivee professionaltion and infecorganism wit
y colonizes the general popbe colonized thmably becauure methods aat least 2 days[
d precise methat rapid identispecific for tha regular screof MRSA andthe importanc
methods to pr
ERENCES
osp Epidemiol, 1Mohapatra, T, Ne
kwood, B., Marrio07). Hosp Epidemiol,
van, S.D., Bishi, D(2009).
, G.,Indian Journ
tsch, J.E., Wu, Cl, 30:1685 (1992)Stewart, D., kear
45 : 111 (2000) in Scheduling (S109/SCIS.2007.3
cute and non-y over the pastumber of repse of its resistinfections reqe treatment. l to understanction. Colonizthout symptomhe anterior narpulation. Hoshan persons i
use of increare used to ide[3]. The need o
hods for identiification of M
he mecA geneeening prograd also to educe of frequentrevent the M
13:725 (1992). epal Med Coll J,1
ott, D and Harkn
, 1:14 (1991). D.K and Verma
nal of Med. Micr
C.Y., Preston and) rns, A.M., Gallow
SCIS 07), IEEE 357670.
acute t two orted tance
quires It is d the
zation ms of res of spital n the eased entify of the fying
MRSA . The
am in ucate t and
MRSA
11:123
ness, J,
a, R.S.,
robiol,
d D.A.,
way, A
Press,
3
top related