mutation and polymorfism genetics and genomics for ed students 20.02.2015

MUTATION AND POLYMORFISM

Genetics and genomics for ED students 20.02.2015.

Genetic variability

- is increased by – mutation

– sexual reproduction

meiosis (generation of gametes)

- homologous recombination (crossing over) - independent assortment of homologous chromosomes

fertilisation

- significance

DNA

DNA variants, alleles(any coding or non-coding sequence)

Mutation causing any

change)

Genetic (DNA) polymorphism

Significance of mutation (for all species)

Without mutation, evolution would not be possible. This is because mutations provide the "raw material" upon which the mechanisms of natural selection can act.

• normal or wild variant (allele) is the most frequent in a population

• polymorphism (or polymorphic) is the variant (allele) if its frequency is › 1 % in the population (formerly:having no effect on phenotype)

• mutation (or mutant) is the variant (allele) if itsfrequency is ‹ 1 % in the population

(formerly: disease causing, it has a negative connotation)

Regarding the variants….

Long way from mutation to polymorphism

Appearance of new variant by mutation Survival of rare allele

Increase in allele frequency after population expand

New allele is fixed in population as novel polymorphism

Classification of mutation types

• by the cause

• by the site

• by the function

• by the fitness

• by the size

By the cause mutations may be

• Spontaneous

• Induced

Spontaneous mutation

- Spontaneous chemical reactions in bases• Tautomerization• Depurination • Deamination

- Errors in DNA related processes• Replication• Recombination• Repair

E.g. Tautomers of adenine

T - A

Imino groupAmino group

(Purine-Purine)

results

Frequent rare

Depurination (hydrolysis)

Deamination

Repaired Not repaired

DNA methylation(regulation of DNA functions, see epigenetics)

Mutation hot spot

Induced mutation

Some environmental agent = mutagen– physical - radiation

• Heat• UV• Ionizing

– chemicals • Natural toxins• Synthetic substances

– Laboratory substances– Pollutants– Chemoterapeutics

Natural substances

Psoralen

Aflatoxin Aspergillus sp.

Laboratory chemicals: acridine orange, ethidium bromide, propidium jodide

A senescent endothelial cell stained with the fluorescent dye acridine orange to visualise the lysosomes.

Fluorescent dyes

BrdU - thymine analogue

Acrylamide Polyacrylamide

Pollutants

E.g. benzpyrene Metabolized to epoxides in liver polyaromatic hydrocarbons (PAH)

DNA adduct

Mutation

Biological warfare agent

Mustard gase

Iranian victim (end of 20th century)

I. World war victim (beginning of 20th century)

Correction of DNA errors

• DNA polymerase with proofreading ability

• Repair mechanisms nuclear but not mitochondrial DNA

DNA repair mechanisms

• Direct repair the change is reversed

no template is needed

mainly in prokaryotes

• Excision repair template is needed

in eukaryotes

Repair of single strand damage(complementer strand is used as template)

Xeroderma pigmentosum is caused by the defective nucleotide excision repair enzymes

Repair of double strand breaks (DSB)

may result loss of nucleotides = deleterious

Sister chromatid (after S phase) or like in meiosis, homologous chromosome is used as template = safety

Multicellular cell cycle

GoG2

G1

S

M-phase

Restriction point

G2

M

- Growth factors- anchorange

mitosis cytokinesis

Interphase

Checkpoints:Restriction pointG2M (spindle)

Function and activity of checkpoint machinery

G1 G2 M

DNA damage free kinetochors not complete DNA replication sensor protein kinases

transducer

effector s t o p of c e l l c y c l e

repair

Ataxia telangiectasia (ATM=sensor)

Its mutation causes rare, neurodegenerative, inherited disease (AR), that affects many parts of the body and causes severe disability, characterized by radiosensitivityand different tumors.

Role of BRCA (transducer) proteins in DNA repair

BRCA mutations are found in breast and ovarian tumors.

p53

Site of mutations - in the organism

• Somatic - in somatic cells

localized- inherited within cells of an organism

(mosaicism: tumors,

antibody diversity, etc.)

higher in dividing cells

• Generative - in primordial

germ line inherited from one

generation to the next one

And nondisjunction of sex chromosomes

B.R. Korf: Human Genetics and Genomics,2006

Site of mutations - in a gene may be

1/ Promoter mutations decreased transcription2/ Exon mutations amino acid change or truncated protein (stop) see later3/ Intron mutations errors in splicing4/ Polyadenylation site mutations decreased mRNA stability 5 5 UTR disturbed ribosome binding

1 2

3 4

UTR UTR

Mutations of other regulatory sequences (enhancers, silencers) also may influence transcription.

Splicing mutations

B.R. Korf: Human Genetics and Genomics,2006

Splicing mutations

B.R. Korf: Human Genetics and Genomics,2006

Different mutations of a gene may lead to different malfunctions of the protein(=CFTR)

Most frequent

Function and mutationsBack mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.

Lethal mutations are mutations that lead to the death of the organisms which carry the mutations.

Gain-of-function mutations - change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes.

Loss-of-function mutations - gene product having less or no function. Phenotypes associated with such mutations are most often recessive.

Exception is when the reduced dosage of a normal

gene product is not enough for a normal phenotye

(this is called haploinsufficiency).

Dominant negative mutations - the altered gene

product acts antagonistically to the wild-type allele.

These mutations are characterised by a dominant

phenotype. In humans, dominant negative mutations

have been implicated in cancer (e.g. mutations in

genes p53, ATM).

Fitness and mutations

- Most are neutral – during evolution later may be harmful or beneficial

- Some are beneficial – - harmful one mutates back to wild - getting beneficial function – diversity of antibody - CCR532 – HIV resistency - sickle cell anemia – malaria resistency

- Some are harmful – causing diseases (all monogenic inherited diseases)

Size of mutations

• Large Genome mutation = change of chromosome number

• Medium Chromosome mutations = change of chromosome structure

• Small gene mutations = ranging from a change of single nucleotide to a whole gene (not visible) Affecting the lenght of DNA Deletion (single base or shorter-longer sequences)

Insertion (single base or shorter-longer sequences- repetitive more insertion than deletion

No effect on the length of DNA

nucleotide substitution

Cytogenetics

38

Repetitive insertions

– Tandem repeats• Satellite DNA

– pericentromeric heterochromatin

• Minisatellite (VNTR)– 10-60 bp– Telomere

• Microsatellite (STR=short tandem repeats)– 2- some bp– good markers of kinship– Repeat number expansion diseases

– Interspersed repeats: • SINEs (Short Interspersed Elements), • LINEs (Long …) e. g. L1

Microsatellite (STR = short tandem repeats)

• 1-4 bp• Trinucleotide (triplet) repeats are very frequent

– only few of them cause disease

(huntingtin)(Huntingtin)

Trinucleotide repeats may be either in coding(C) or noncoding (NC) region

NC

C

NC

C

C codingNC noncoding

Polyglutamine Polyalanine disorders disorders

• CAG repeats

• Neurodegenerative disorders • Different proteins

• Gain of function mutations

• Variable length

• Expansion

• Replicational slippage

Replication slippage

MATLEKLMKAFESLKSFQQQQQQQQQQQQQQQQQQQQQQQPPPP

PPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPK

KELSATKKDRVNHCLTICENIVAQSVRNSPEFQKLLGIAHELFLLCSDD...

Huntingtin

• 350 kD protein • ubiquitously expressed • function unknown • correlation between repeat size and age of onset and the severity of disease (Huntington chorea)

Huntington

healthy

Polyglutamine Polyalanine disorders disorders

• CAG repeats

• Neurodegenerative disorders • Different proteins

• Gain of function mutations

• Variable length

• Expansion

• Replicational slippage

• GCX repeats

•Developmental abnormalities

• Transcription factors

• Loss of function mutations

• Constant length

• Stable

• Uneven crossing over

Uneven crossing over

Unevensister chromatid exchange

Disorder Gene

• Holoprosencephaly ZIC2

Polyalanine disorder

Deletion or insertion of a single nucleotide (InDel)

It is a frameshift mutation if number of nucleotide is not a multiple of three,and in-frame if number of nucleotide is a multiple of three

DNA

mRNA

protein

Mutant protein

Medium InDel mutations

• Deletion– Pl. Hypodontia

(Deletion of Pax 9)

• Insertion– (retro)transposons

• Eg. L1 hemophilia A

L1 is a LINE: Long Interspersed Elements

51

L1 insertion and recombination in Hemophilia A

Hemophilia A inversion mutation due to recombination between L1 repetitive sequences within (gray arow) an outside (red arrow) the F8 gene

VIII. Blood clotingfactor gene (F8)

Single nucleotide substitution

Nucleotide substitutions in coding region

Transition

Transversion

Pyr ↔ PyrPu ↔ Pu

Pyr ↔ Pu

Synonymous not synonymousNo change in amino acid change of amino acid or no amino acid

More frequent in human

Missense mutation – sickle cell anemia

Frequences of disease causing mutations

Polymorphism

• Polymorphism appears at different levels:

– Phenotype polymorphism– Protein polymorphism (Immunoglobulins, ABO blood groups)– Genetic (DNA) polymorphism

Rate of genetic polymorphism

– Identity between individuals = 99,5%

– Difference between individuals = 0,5%

• It is variation of DNA sequence that is common in the general population (>1%)

• Most are neutral, but some confer susceptibility or resistance to disease

• In human genome there are many, that is why can be used for personal identification

• Detection technics are available

DNA Polymorphism

Genetic polymorphism

• chromosomal (minor variants)• tandem repeats

Satellite DNApericentromeric heterochromatin

Minisatellite (VNTR)Telomere

Microsatellite (STR=short tandem repeats)

• Single nucleotide polymorphism (SNP)

Chromosomal polymorphism

1, 9,16 chromosomes centromeresY chromosome long arm

ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT SNP SNP

Nucleotide substitution=SNP(single nucleotide polymorphism)

Disease resistant population Disease susceptible population

Genotype all individuals for thousands of SNPs

ATGATTATAG ATGTTTATAG

Resistant people all have an ‘A’ at position 4 in geneX, while susceptible people have a ‘T’

geneX

PPARG = Peroxiszóma Proliferátor Aktivátor Receptor γ, APOE = Apolipoprotein E; F5 = Faktor V; CTLA4 = Cytotoxikus T-lymphocyta Antigén 4; GSTM1 =Glutathione S-transferase Mu 1; INS = inzulin;KCNJ11 = ATP szenzitív K+csatornát kódoló gén; HF1/CFH = Komplement faktor H;COL1A1 = Kollagén 1 típus A1; CARD15 = Caspase Recruitment Domain 15;

Some disease associated SNPs

Association ≠ correlation

CNVR = copy number variations

1 kb - 5 megabAbout 1500 CNV12% of genome2900 gene

is based on mutations and polymorphisms